Molecular Endocrinology 13 (1): 24-37
Copyright © 1999 by The Endocrine Society
Somatostatin Activation of Mitogen-Activated Protein Kinase via Somatostatin Receptor 1 (SSTR1)
Tullio Florio,
Hong Yao,
Kendall D. Carey,
Tara J. Dillon and
Philip J. S. Stork
Vollum Institute (H.Y., K.D.C., T.D., P.J.S.S.) Oregon Health
Sciences University Portland, Oregon 97201
Institute of
Pharmacology (T.F.) School of Medicine University of Genoa
and Service of Pharmacology National Institute for Cancer
Research (IST), 16132 Genoa, Italy
 |
ABSTRACT
|
|---|
Hormones and growth factors regulate cell growth
via the mitogen-activated protein (MAP) kinase cascade. Here we examine
the actions of the hormone somatostatin on the MAP kinase cascade
through one of its two major receptor subtypes, the somatostatin
receptor 1 (SSTR1) stably expressed in CHO-K1 cells. Somatostatin
antagonizes the proliferative effects of fibroblast growth
factor in CHO-SSTR1 cells via the SSTR1 receptor. However, in
these cells, somatostatin robustly activates MAP kinase (also called
extracellular signal regulated kinase; ERK) and augments fibroblast
growth factor-stimulated ERK activity. We show that the activation of
ERK via SSTR1 is pertussis toxin sensitive and requires the small G
protein Ras, phosphatidylinositol 3-kinase, the serine/threonine kinase
Raf-1, and the protein tyrosine phosphatase SHP-2. The activation of
ERK by SSTR1 increased the expression of the cyclin-dependent protein
kinase inhibitor
p21cip1/WAF1. Previous studies have
suggested that somatostatin-stimulated protein tyrosine phosphatase
activity mediates the growth effects of somatostatin. Our data suggest
that SHP-2 stimulation by SSTR1 may mediate some of these effects
through the activation of the MAP kinase cascade and the expression of
p21cip1/WAF1.
 |
INTRODUCTION
|
|---|
Somatostatin is a circulating peptide hormone that displays a
range of biological actions including inhibition of hormone secretion,
modulation of neuronal transmission, and regulation of cell growth (1).
Somatostatin acts through a family of related G protein-coupled
receptors that are variably expressed in a wide variety of tissues and
tumors (2), including the central and peripheral nervous system, the
endocrine system, and the gut (3). Upon activation of these receptors,
somatostatin exerts well characterized growth- inhibitory effects in a
wide variety of epithelial (4, 5, 6, 7) and endocrine cells (8).
Somatostatin binds to and activates at least five distinct receptor
subtypes that are expressed in overlapping tissue distributions within
many tissues (9, 10). The molecular subtypes of the somatostatin
receptor are organized pharmacologically into at least two groups that
are distinguished both by their coupling to distinct effector pathways
and by their ability to bind to distinct cyclic somatostatin analogs
(11, 12, 13, 14). While somatostatin receptor (SSTR)1 and 4 are insensitive to
the cyclic somatostatin analogs, octreotide, lanreotide, and RC160,
these compounds are the best known ligands for SSTR2, 3, and 5 (3, 12, 15).
Somatostatin directly antagonizes the mitogenic action of epidermal
growth factor in pancreatic tumor cells (16) and antagonizes additional
tyrosine kinases in other cell types (17, 18). This antagonism of
tyrosine kinase-signaling pathways is thought to be a consequence of
the ability of somatostatin to stimulate a phosphotyrosine phosphatase
(PTP) activity in responsive cells (1, 7, 19, 20, 21, 22). Many of the studies
of the antiproliferative actions of somatostatin have been focused on
SSTR2, principally because most of the clinical experience with
somatostatin involves the somatostatin agonist octreotide (23), which
is a well known ligand for SSTR2, but not SSTR1 (15). SSTR1, like
SSTR2, is widely expressed in human tissues and tumors (23). Both SSTR1
and SSTR2 inhibit adenylyl cyclase when expressed in heterologous
CHO-K1 cells (24). In these cells, only SSTR1 couples to PTP activity
(25). However, somatostatin can couple to PTP activity in other cell
types via SSTR2 (19, 26, 27). Recently, it has been shown that hormones
as well as growth factors can regulate cell growth via their actions on
the mitogen-activated protein (MAP) kinase cascade (28, 29, 30). In this
study, we examine the ability of SSTR1 to activate intracellular
signaling pathways that converge on the MAP kinase cascade.
 |
RESULTS
|
|---|
Somatostatin Inhibits Proliferation Stimulated by Serum and Basic
Fibroblast Growth Factor (FGF) in CHO Cells Stably Expressing SSTR1
Basic FGF activates proliferation in Chinese Hamster Ovary cells
(CHO-K1). To examine somatostatins effects on FGF signaling in CHO
cells, we used CHO-K1 cells that stably express somatostatin receptor
SSTR1 (Bmax = 1664 fmol/mg) (1, 24). These cells have been
extensively characterized and used as model systems for the study of
somatostatin signaling via SSTR1 receptor (1, 24, 31). The cell line
used in this and prior studies (1, 24, 31) expresses comparable levels
of recombinant receptors and responds to the physiological somatostatin
agonist, somatostatin-14 (SS-14), via pertussis toxin (PTX)-sensitive
pathways to inhibit adenylyl cyclase with pharmacological features
identical to native receptors (1, 24, 31). Initial studies demonstrate
that SS-14 significantly reduced the rate of proliferation stimulated
by serum in this cell line (Fig. 1A
), as
evidenced by a delay in serum-stimulated growth initiation. This
cytostatic action of somatostatin is similar to that seen in other cell
types (7, 32).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 1. Effect of Somatostatin on MTT Activity in CHO-SSTR1
Cells
A, Time course of proliferation of CHO-SSTR1 cells maintained in serum,
incubated with SS-14 (1 µM) ( ) or without SS-14 ( )
for the indicated times, as measured by MTT assay. B, MTT activity of
FGF-stimulated CHO-SSTR1 cells in the presence or absence of varying
doses of SS-14 (0.1 µM 10 µM) as
indicated was measured 48 h after treatment with FGF (50 ng/ml) or
FCS (10%). Data are presented as percent of increase in absorbance at
570 nm over basal (unstimulated) cells at 48 h.
|
|
Somatostatin Activates MAP Kinase via SSTR1
Growth factors like FGF are thought to activate proliferative
pathways via activation of the MAP kinase cascade (33). SS-14 also
inhibited FGF-induced proliferation in these cell lines (Fig. 1B
). This
inhibition showed a dose dependence that was similar to SS-14s
antiproliferative actions in other cell types (7, 19, 20). Our studies
showed that the activation of cell growth by FGF in these cells was
inhibited by 73% (compared with stimulated levels) by the MAP kinase
kinase (MEK) inhibitor PD98059 (34) (data not shown), suggesting that
FGF-induced proliferation of CHO cells required activation of
extracellular signal-regulated kinase (ERK). These results raised the
possibility that somatostatins actions on FGF-stimulated
proliferation might be mediated via its actions on ERK as well. We
examined the actions of SS-14 on ERK phosphorylation as well as
activation. ERK phosphorylation at threonine-183 and tyrosine-185 are
widely used indices of ERK activation by the ERK kinase MEK. We
examined the phosphorylation of both ERK 1 (pERK1) and ERK2 (pERK2),
using antibodies recognizing phosphotyrosine-185 (pTyr-185) in both
pERK1 and pERK2. This antibody recognizes pERK2 with greater affinity
than pERK1, but is specific for the "phospho" form in both cases
(New England Biolabs, Beverly, MA). Initial experiments show that SS-14
increased the phosphorylation of both ERK1 and ERK2 in CHO-SSTR1 cells,
but not in wild-type CHO (CHO-K1) cells. Maximal phosphorylation of
both ERK1 and ERK2 was seen after 10 min of SS-14 incubation (Fig. 2A
).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2. Time Course of ERK1 Activation after Somatostatin
Treatment
A, Wild type CHO-K1 cells (upper panel) and CHO-SSTR1
cells (lower panel) were treated with SS-14 (1
µM) for the indicated times. Lysates were harvested and
phospho-ERK (pERK) was detected by Western blotting, using
pERK-specific antibodies. A representative Western blot is shown
(n = 3). The positions of pERK1 and pERK2 are indicated. B,
CHO-SSTR1 cells were treated with SS-14 (1 µM) for
several time periods as indicated, and the lysates were
immunoprecipitated using ERK1-specific antisera. Kinase assays were
performed as described, and phosphorylated MBP was separated by
SDS-PAGE. The results of a representative autoradiogram are shown with
the position of MBP indicated (upper panel).
Phosphorylated MBP was then quantitated by PhosphorImager analysis, and
the fold stimulation over basal levels is presented as an average of
three independent experiments (lower graph). SE is shown.
|
|
We next examined the actions of SS-14 on ERK1 activation using in
vitro kinase assays after immunoprecipitation of ERK1 from treated
cell lysates. SS-14 strongly activated ERK1 in CHO-SSTR1 cells,
reaching maximum levels within 1020 min (Fig. 2B
). This is in
contrast to results in SSTR2-expressing cells, obtained by our
laboratory and others, where somatostatin does not activate MAP kinase
(data not shown) (35, 36).
To confirm the pattern of activation of MAP kinase by somatostatin in
cells expressing endogenous receptors, we examined ERK activation in
the pituitary cell line, GH4C1. These
lacto-somatotrophic cells express predominantly SSTR1 receptors, but
also express SSTR2 receptors (1). Because SSTR1 represents the
predominant somatostatin receptor subtype, SS-14 action should be
mediated, in large part, via SSTR1 in these cells. After incubation of
these cells with SS-14, the time course of ERK activation was similar
to that seen in the CHO-SSTR1 cells (data not shown). In
GH4C1 cells, as in other cell types, the
somatostatin agonist octreotide selectively stimulates SSTR2 and the
related SSTR3 and SSTR5 receptors (32). After incubation of these cells
with octreotide, very little activation of ERK1 was detected (data not
shown). These results in GH4C1 cells are
consistent with those seen in CHO cells and suggest that SSTR1 is a
strong activator of ERK whether expressed endogenously or in stably
transfected cells.
SSTR1 Potentiates FGF Stimulation of ERK1
FGF can induce phosphorylation of ERK1 and ERK2 on Tyr-185 via
endogenous receptors on wild-type CHO cells (CHO-K1). This action is
faithfully reproduced in the CHO-SSTR1 cells (Fig. 3A
). As with SS-14, this phosphorylation
was maximal at 10 min. The activation of ERK1 by FGF in CHO-SSTR1 cells
was confirmed by immune complex kinase assay (Fig. 3B
). SS-14 augmented
FGFs activation of ERK1 in CHO-SSTR1 cells. This is in contrast to
results in SSTR2-expressing cells, where somatostatin inhibits growth
factor activation of MAP kinase (data not shown) (35, 36).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 3. Effect of Somatostatin Treatment on FGF-Stimulated
ERK1 Activity in CHO-SSTR1 Cells
A, Wild-type CHO-K1 cells (upper panel) and CHO-SSTR1
cells (lower panel) were treated with FGF (50 ng/ml) for
the indicated times. Lysates were harvested and pERK detected by
Western blotting, using pERK antibodies. A representative Western blot
is shown (n + 3). The positions of pERK1 and pERK2 are indicated. Cells
were treated with SS-14 (1 µM) and FGF for 10 min, and
lysates were immunoprecipitated using ERK1 antisera. Kinase assays were
performed as described, and phosphorylated MBP was separated by 12%
SDS-PAGE. B, The results of two representative autoradiograms and the
position of MBP are shown (upper panel). Phosphorylated
MBP was quantitated by PhosphorImager analysis, and the ERK1 activity
is reported as fold stimulation over basal levels and presented as an
average of four independent experiments (lower graph).
SE is shown.
|
|
SSTR1 and FGF Induce the Expression of
p21cip1/WAF1
It has been proposed that high levels of ERK acti-vation can
cause growth arrest via the induction of p21cip1/WAF1
(37, 38, 39). To examine this possibility, we examined
p21cip1/WAF1 protein levels by Western blot (Fig. 4A
). The basal level of
p21cip1/WAF1 expression was not increased by SS-14 or FGF
alone, but was increased when the hormone and growth factor were
applied together. This synergistic action was seen more clearly after
the immunofluorescent examination of p21cip1/WAF1 protein.
Strong nuclear staining of p21cip1/WAF1 protein was
detectable only with the combined treatment with SS-14 and FGF (Fig. 4B
). In lysates prepared from CHO-SSTR1 cells, the increase in the
levels of p21cip1/WAF1 protein seen after treatment with
SS-14 and FGF was reduced after treatment with the MEK inhibitor
PD98059 (34), suggesting that ERK activity was required for this action
(Fig. 4C
).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 4. p21cip1/WAF1 Protein Levels Are Induced
by the Combined Treatment of SS-14 and FGF
A, CHO-SSTR1 cells were untreated (control, C) or treated with
FGF (F) (50 ng/ml) and/or SS-14 (S) (1 µM) for 24
h as indicated. After treatment, cells were lysed, transferred to
immobilon paper, and probed with anti-p21cip1/WAF1
antisera (upper panel). Coomassie staining is shown in
lower panel to confirm equivalent loading of protein. A
representative Western blot is shown (n = 3). B, CHO-SSTR1 cells
were treated with FGF (50 ng/ml) and/or SS-14 (1 µM) for
24 h as indicated (1, untreated; 2, SS-14; 3, FGF; 4, SS-14 and
FGF). After treatment, cells were fixed and permeabilized with acetone
and labeled with anti-p21cip1/WAF1 antisera. Immune
complexes were detected using fluorescein isothiocyanate-coupled
anti-IgG antibodies. C, CHO-SSTR1 cells were treated with FGF (F)
and/or SS-14 (S) for 16 h, as in panel A, in the absence (-PD) or
presence of PD98059 (+PD), as indicated. After treatment, cells were
lysed, transferred to immobilon paper, and probed with
anti-p21cip1/WAF1 antisera. A representative Western blot
is shown.
|
|
SSTR1 Activation of ERK1 Requires Ras
To examine the requirement of specific proteins within the MAP
kinase cascade in SS-14s activation of ERK1, we transiently
transfected specific interfering mutants of upstream components of the
MAP kinase cascade, including Ras, Raf, and MEK (mitogen and
extracellular regulated kinase) into CHO-SSTR1 cells and examined their
effects on somatostatin signaling. MEK K79R and Raf-301 are
kinase-deficient mutants of MEK and Raf, respectively, that sequester
endogenous downstream substrates (40, 41, 42), and RasN17 interferes with
endogenous Ras function by binding to specific Ras exchange proteins
(43). The expression of all three interfering mutants blocked myc-ERK
activation by SS-14 (Fig. 5
, A and B),
suggesting that MEK, Raf, and Ras were required for SS-14 activation of
ERK.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5. Requirement of Ras, Raf, and MEK for Somatostatin
Activation of ERK in CHO-SSTR1 Cells
CHO-SSTR1 cells were transfected with cDNAs encoding RasN17, Raf-301,
or MEK K97R along with myc-ERK2, and cells were treated with (+) or
without (-) SS-14 as indicated. Cells were lysed and immune complex
kinase assays were performed on cell lysates after immunoprecipitation
with anti-myc antibodies, using MBP as a substrate, and phosphorylated
MBP was separated by 12% SDS-PAGE. A, A representative autoradiogram
showing phosphorylated MBP is presented. B, Phosphorylated MBP was
quantitated by PhosphorImager analysis and the fold stimulation over
basal levels is presented as an average of four independent
experiments.
|
|
SS-14 Activation of ERK1 Is Mediated by a PTX-Sensitive G Protein
and a c-src-Like Tyrosine Kinase
The mechanisms by which G protein-coupled receptors activate the
MAP kinase cascade are not fully understood. To evaluate the
involvement of specific G proteins in the SSTR1-mediated activation of
ERK, we pretreated CHO-SSTR1 cells with PTX. Like other known actions
of SSTR1, the activation of ERK by SSTR1 was PTX sensitive (Fig. 6A
). SS-14s activation of ERK1 was also completely
blocked by wortmannin, an inhibitor of phosphatidylinositol 3-kinase
(PI3 kinase) (Fig. 6
, B and C). This activation of ERK1 was also
completely blocked by LY294002, a second inhibitor of PI3 kinase that
utilizes an independent mechanism of inhibition (Fig. 6B
). SS-14s
activation of ERK1 was partially blocked by herbimycin A, an inhibitor
of cytoplasmic tyrosine kinases of the c-src family (Fig. 6C
). The action of these agents on FGF signaling was also examined.
Herbimycin A nearly completely inhibited FGFs activation of ERK1,
while wortmannin only partially reduced FGFs effect (Fig. 6C
),
suggesting that while PI3 kinase was not absolutely necessary for
FGFs activation of ERKs, it was necessary for that of
somatostatin.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6. Fig. 6. Requirement of a PTX-Sensitive G Protein, PI3
Kinase, and Tyrosine Kinase in Somatostatin Stimulation of ERK
A, Somatostatins activation of ERK1 in CHO-SSTR1 cells is
PTX-sensitive. Cells were left untreated (basal, B) or treated with
SS-14 (SS) with or without pretreatment with PTX (18 h, 200 ng/ml), as
indicated. The cells were lysed and immune complex kinase assays were
performed using MBP as a substrate after immunoprecipitation with
anti-myc antibodies. Phosphorylated MBP was separated by 12% SDS-PAGE.
The results of a representative autoradiogram are shown (upper
panel). Phosphorylated MBP was quantitated by PhosphorImager
analysis, and the average of the results derived from four independent
experiments are shown (lower panel). B, Somatostatins
activation of ERK1 in CHO-SSTR1 cells requires PI3 kinase. Cells were
left untreated (basal, B) or treated with SS-14 (SS) with or without
pretreatment with wortmannin (100 nM), or LY294002 (LY, 25
nM) as indicated. The cells were lysed and immune complex
kinase assays were performed using MBP as a substrate after
immunoprecipitation with anti-ERK1 antibodies. Phosphorylated MBP was
separated by 12% SDS-PAGE. The results of a representative
autoradiogram are shown. C, Inhibition of somatostatins and FGFs
stimulation of ERK1 activity by wortmannin and herbimycin A. Cells were
pretreated for 10 min with either wortmannin (1 µM),
herbimycin A (1 µM), or left untreated (basal, B) and 10
min later exposed to either SS-14 (SS) or FGF. Immune complex kinase
assays were performed using MBP as a substrate as described in panel A.
A representative autoradiogram is shown (upper panel).
The position of MBP is shown. Phosphorylated MBP was quantitated by
PhosphorImager analysis, and the fold stimulation of ERK1 activity over
basal levels is presented as an average of four independent experiments
(lower panel).
|
|
The involvement of specific G proteins in the SS-14 effects was further
demonstrated by the transfection of the carboxyl-terminal domain of the
ß-adrenergic receptor kinase (ßARKct) into CHO-SSTR1 cells. Because
ßARKct can specifically bind to ß
-subunits, it has been used to
demonstrate the involvement of the ß
-subunits in other G
protein-coupled pathways (44). The expression of ßARKct blocked
myc-ERK activation by SS-14, confirming the involvement of the G
protein ß
-subunits in the SSTR1 signaling to the MAP kinase
cascade (Fig. 7
, A and B). A role for
src-like kinases in somatostatin signaling was examined after
transfection of the cDNA encoding the c-src kinase (CSK).
CSK phosphorylates c-src at inhibitory sites and is the
major physiological inactivator of these kinases (45). The expression
of CSK blocked SS-14 activation of myc-ERK (Fig. 7
, A and B),
suggesting that a cytoplasmic kinase of the src family was required for
maximal activation of ERK by somatostatin.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 7. Involvement of the ß -Subunit of G Protein and
Src-Like Kinases in Somatostatins Stimulation of ERK Activity
CHO-SSTR1 cells were transfected with cDNAs encoding ßARKct or the
c-src kinase (CSK) along with myc-ERK2. The cells were
treated with SS-14 (1 µM) (+) or without SS-14 (-) as
indicated, and immune complex kinase assays were performed as described
in Fig. 5 . A, The results of a representative autoradiogram and the
position of MBP are shown. B, Phosphorylated MBP was quantitated by
PhosphorImager analysis, and the fold stimulation over basal levels is
presented as an average of four independent experiments.
|
|
SSTR1 Is Coupled to Raf-1 Activation
Ras-dependent activation of ERK requires members of the Raf family
of serine/threonine kinases (46, 47). Here, we examined the effects of
SS-14 on Raf-1 activity, the major Raf isoform expressed in CHO cells
(data not shown). SS-14 induced a significant activation of Raf-1 with
a time course that mirrored ERK activation (Fig. 8
, A and B). Moreover, herbimycin A
inhibited SS-14 activation of Raf-1 in these cells (Fig. 8C
),
suggesting that the activation of a tyrosine kinase was required to
stimulate Raf-1 as well as ERK. This is consistent with the results of
other laboratories that suggest that src-like kinases are required for
full activation of Raf-1 by Ras-dependent signals (47, 48).

View larger version (46K):
[in this window]
[in a new window]
|
Figure 8. Effect of Somatostatin Treatment of CHO-SSTR1 Cells
on Raf-1 Activity
Cells were treated with SS-14 (1 µM) for the indicated
times, lysed, and immunoprecipitated with anti Raf-1 antisera (A and C)
or myc antibodies (B). Raf-1 kinase assays were performed using MEK-1
as a substrate, and phosphorylated MEK-1 was separated by 10%
SDS-PAGE. A, Time course of somatostatin activation of Raf-1. A
representative autoradiogram and the position of MEK1 are shown (n
= 3). B, Somatostatin activation of myc-Raf-1. Cells were transfected
with cDNA encoding myc-Raf-1 (5 µM) as described and
treated with SS-14 or FGF, as indicated, and Raf-1 activities were
measured by in vitro kinase assay after
immunoprecipitation with myc antibodies. A representative autoradiogram
and the position of MEK1 are shown (n = 2). C, Inhibition of
somatostatin activation of Raf-1 by herbimycin A, assayed 10 min after
the addition of SS-14. Cont, Unstimulated cells; SS,
somatostatin-treated cells; H, herbimycin-pretreated cells; SS + H,
herbimycin-pretreated and somatostatin-treated cells. A representative
autoradiogram and the position of MEK1 are shown (n = 2). Fold
increases in Raf-1 kinase activity over control (unstimulated) levels
are provided at the top of the figure.
|
|
SSTR1 Stimulates the Activity of SH-PTP2 (SHP-2)
Somatostatins growth effects are associated with the stimulation
of a specific PTP activity (16, 22). Previous reports have suggested
that this PTP might be a member of a small family of PTPs that contain
src-homology (SH2) domains, including SHP-1 (SHPTP-1, syp, PTP1D) and
SHP-2 (SHPTP-2, syp, PTP1C). Src homology 2 (SH2) domains mediate
protein/protein interaction via their association with specific
phospho-tyrosine residues. SHP-1 is expressed primarily in
hematopoietic cells (49) but was not detected in CHO-SSTR1 or CHO-SSTR2
cells (Fig. 9A
). SHP-2 is widely
expressed in many cell types (49), including both CHO-SSTR1 and
CHO-SSTR2 cells (Fig. 9A
). To determine whether somatostatin can
stimulate SHP-2 activity in CHO-SSTR1 cells, we treated these cells
with SS-14 and measured PTP activity after immunoprecipitation with an
antisera directed against SHP-2, in an immune complex assay using
p-nitrophenylphosphate (pNPP) as a substrate.
pNPP has been previously reported to be a good substrate for
SHP-2 (50). The results demonstrate that SS-14 can rapidly stimulate
SHP-2 activity within 1 min, reaching a maximum at 10 min, and
returning to basal levels after longer treatments (Fig. 9B
).
SHP-2 Coprecipitates with c-src in Both SS-14-Treated
and Untreated Cells
The involvement of src family kinases and SHP-2 in somatostatin
signaling suggests the possibility that c-src or related
kinases and SHP-2 may both participate within the same signaling
complex. To test this hypothesis, we examined the interaction of
c-src with SHP-2 in CHO-SSTR1 cells by
coimmunoprecipitation. We transfected myc-tagged SHP-2 (myc-SHP-2) and
myc-SHP-2(CS) into CHO-SSTR1 cells and examined whether they could
associate with endogenous c-src. SHP-2(CS) encodes a
catalytically inactive protein where the essential cysteine has been
replaced by a serine. This mutant phosphatase binds tightly to
physiological substrates without dephosphorylating them, thereby
interfering with access of these substrates to endogenous wild-type
SHP-2. Endogenous c-src protein was immunoprecipitated using
c-src antibodies and assayed for the presence of SHP-2(CS)
within the immunoprecipitates by Western blot using myc antibodies
(Fig. 9C
). The results demonstrate that both SHP-2 and SHP-2(CS) can
bind c-src in these cells and raise the possibility that
c-src is a direct substrate of SHP-2 in these cells, as has
been suggested for SHP-1 (51, 52). The association of SHP-2 was not
modulated by SS-14 treatment (Fig. 9C
), suggesting that the two
proteins may be constitutively associated under basal conditions.
Maximal Activation of Raf-1 and ERK by SSTR1 Requires SHP-2
To determine whether the activation of SHP-2 was required for
SSTR1 signaling to ERK, we used the interfering mutant SHP-2(CS). The
interference with endogenous SHP-2 after the expression of SHP-2(CS) is
specific and does not interfere with the actions of the closely related
PTP, SHP-1 (53). The expression of SHP-2(CS) in CHO-SSTR1 cells blocked
SS-14s activation of both Raf-1 (Fig. 10A
) and myc-ERK (Fig. 10
, B and C),
suggesting that SHP-2 was necessary for maximal activation of the MAP
kinase cascade by somatostatin in these cells. In contrast,
overexpression of wild-type SHP-2 did not inhibit SS-14s activation
of Raf-1 (Fig. 10A
) or ERK (Fig. 10
, B and C). Similar results were
obtained after measurement of the transcriptional activity of Elk-1, a
direct target of ERK kinase activity (54). Using a
transcription-coupled luciferase assay that reflects MAP kinase
activity (55, 56), we showed a complete inhibition of SS-14-induced
Elk-1 activity after expression of SHP-2(CS) and a modest potentiation
of SS-14-induced Elk-1 activity after the expression of wild-type SHP-2
(Fig. 10D
). These studies strongly suggest that endogenous SHP-2 may
provide a positive signal from SSTR1 to the MAP kinase cascade.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 10. Somatostatin Activation of the MAP Kinase Cascade
Requires SHP-2
A, Inhibition of somatostatin-stimulated Raf-1 activity after
expression of SHP-2(CS). CHO-SSTR1 cells were transfected with cDNAs
encoding myc-Raf-1, along with vector DNA (control), wild-type SHP-2
(SHP-2 wt), or phosphatase-dead SHP-2 (SHP-2-CS), and treated with (+)
or without (-) SS-14, as indicated. Raf-1 kinase assays were performed
after immunoprecipitation with anti-myc antibodies. The position of the
substrate MEK-1 is shown (n = 3). Fold activation is indicated
above each lane, and the levels of myc-Raf-1 expressed
in each condition were determined by Western blot, using myc antibody
(lower panel). B, Inhibition of somatostatin-stimulated
myc-ERK activity after expression of SHP-2(CS). CHO-SSTR1 cells were
transfected with cDNAs encoding myc-ERK2 and SHP-2 wt or SHP-2(CS) and
treated with SS-14 (+) or left untreated (-) as indicated. In
vitro ERK assays were performed after immunoprecipitation with
myc antibodies, using MBP as a substrate. A representative
autoradiogram is shown, with the position of phosphorylated MBP
indicated. C, Quantitation of ERK kinase assays depicted in panel B
(above) after transfection of SHP-2. Data are represented as the
mean ± SE; n = 4. D, The effects of the
expression of SHP-2 wt or SHP-2(CS) on somatostatins
activation of Elk-1. Cells were transfected with 5 µg of cDNAs
encoding Elk-1/Gal 4 and 5XGal4-E1b/luciferase and either 5 µg of
pCDNA3 or SHP-2wt or SHP-2(CS) as indicated. Activation of Elk-1 was
measured by luciferase activity, as described (41 ), and reported as
fold over basal levels.
|
|
 |
DISCUSSION
|
|---|
In many cell types, the growth-promoting actions of extracellular
growth factors and hormones are thought to require the activation of
MAP kinase (28, 29, 30). However, in some cells, differentiation and the
accompanying growth inhibition are also associated with MAP kinase
activation (33, 57). For example, the expression of markers of
differentiation in pituitary somatotrophs (58) and in pituitary
gonadotrophs (56) requires activation of the MAP kinase cascade, as
does the neuronal differentiation of cultured adrenal medullary PC12
cells (33, 41). In this study, we examined the ability of somatostatin
to activate the MAP kinase cascade via SSTR1. We and others have used
stably transfected cell lines to study the biochemical action of the
somatostatin receptor subtype SSTR1 (1, 19). In any study utilizing
transfected cell lines, the possibility that clonal variations arising
during the selection process may influence the interpretation of the
results. In this study, we utilize a well characterized
SSTR1-expressing cell line (1, 24) that we have previously shown
express these receptors at physiological levels and functionally couple
to relevant somatostatin-signaling pathways (24). Previous studies have
demonstrated that somatostatin activation of a PTPase activity
accounts, in part, for its antiproliferative effects (1, 22, 25).
Because activation of PTPase activity by somatostatin has been
demonstrated in CHO-SSTR1 cells (1), we have used these cells to study
the regulation of proliferation and MAP kinase signaling in these
cells. In the absence of additional growth factor stimulation,
somatostatin activated ERK1 robustly and augmented FGFs activation of
ERK1. Thus, despite inhibiting FGF-induced cellular proliferation in
FGF-treated CHO-SSTR1 cells, SS-14 potentiates FGFs activation of
ERKs.
The induction of growth arrest in the face of
increased stimulation of MAP kinase appears to be an unlikely mechanism
for growth control. However, recent studies have demonstrated that
the induction of high levels of ERK activation leads to cell cycle
arrest via the induction of the cell cycle inhibitor,
p21cip1/WAF1 (37, 38, 39). p21cip1/WAF1 is a member
of a growing family of inhibitors of cyclin-dependent protein kinases
(37) and is associated with the growth arrest induced by sustained
activation of ERK in endocrine cells (59). It is possible that the
antiproliferative actions of SSTR1 are, in part, triggered by its
stimulation of ERK activity to levels higher than that achieved by FGF
alone. This is suggested by the synergistic actions of SS-14 and FGF on
p21cip1/WAF1 and the requirement of MEK for this
action (Fig. 4
); however, other mechanisms may also contribute
(60).
We show here that somatostatins actions on MAP kinase via SSTR1 were
PTX sensitive and required the activity of the ß
-subunits of the G
proteins, like other hormones that are known to be coupled to the
Gi and Go subfamily of receptors [including
2A adrenergic receptors (61) and M2 muscarinic receptors
(44)]. The role of ß
-subunits in SSTR1 signaling to MAP kinase
was demonstrated here by the ability of the ßARKct cDNA to block
SS-14s activation of MAP kinase in CHO-SSTR1 cells. ßARKct acts as
an interfering mutant of ß
signaling via the overexpression of the
plekstrin homology (PH) domain of ßARK that functions within the
full-length ßARK protein to permit the association of ßARK to
ß
, and has been widely used to demonstrate the requirement of
ß
in other signaling cascades (62, 63). ß
-subunits have
previously been implicated in other actions of somatostatin through
SSTR1, including the activation of GIRK potassium channels (64), and
the data presented here suggest that ß
is required for
somatostatins activation of MAP kinase, as well.
Somatostatins activation of ERK in CHO-SSTR1 cells was dependent on
the activation of MEK, the MAP kinase kinase kinase, Raf-1, and the
small G protein Ras. In addition, this action of somatostatin was
blocked by wortmannin and LY294002, suggesting the involvement of PI3
kinase. These results are similar to those identified for other
Gi-coupled receptors, including the stimulations of MAP
kinase via SSTR4 (65), serotonin1A (66), and the
lysophosphatidic acid receptor (67, 68, 69, 70). The activation of PI3
kinase by G protein ß
- subunits has also been reported (63). PI3
kinase may be required for activation of MAP kinase by multiple
hormones including somatostatin, as well as certain growth factors
(71).
We have previously reported somatostatin coupling to PTP activity in
CHO-SSTR1 cells (1). This stimulation of PTP activity in CHO-SSTR1
cells by somatostatin was G protein coupled and PTX sensitive, and
correlated with somatostatins growth effects (Fig. 1A
) (1). Studies
by other laboratories have suggested that the PTP stimulated by
somatostatin might be an intrinsic membrane protein capable of
associating with the somatostatin receptor/G protein complex (1, 25, 72, 73, 74, 75). Here we report that SS-14 stimulation of SSTR1 increases SHP-2
activity and interfering mutants of SHP-2 activity block SS-14
activation of the MAP kinase cascade. In other cells, SHP-2 has been
shown to be recruited to the plasma membranes upon somatostatin
stimulation (27). A related phosphatase, SHP-1, has been implicated in
somatostatin signaling (73, 75). However, SHP-1 is principally
expressed in hematopoeitic cells (76) and is not expressed in CHO-SSTR1
cells.
The time course of SHP-2 activation by somatostatin in CHO-SSTR1 cells
is consistent with data from recent studies using Ras-transformed
NIH3T3 after transient transfection of somatostatin receptors (26) and
CHO cells stably expressing somatostatin receptors (73). The studies
presented here differ from those of Reardon and co-workers (26) who
showed that SSTR2, 3, and 4, but not SSTR1 or SSTR5, could activate PTP
activity when transiently expressed in v-Ras-transformed NIH 3T3 cells.
In those cells, the activation of PTP was blocked by SHP-2(CS),
suggesting that SHP-2 was involved. Their inability to detect coupling
of SSTR1 to PTP activation in those studies may reflect the inability
of transiently expressed SSTR1 to couple efficiently to downstream
effectors. However, it may also point to differences in the mechanisms
by which distinct somatostatin receptors couple to SHP-2. The pathway
described here for SSTR1 differs from that identified for SSTR2 and
SSTR3 (26) in that SSTR1 in CHO-SSTR1 cells appears to couple to
cytoplasmic tyrosine kinases and utilizes Gß
rather
than G
i/o (77). It is possible that SSTR1 utilizes a
signaling pathway in whole cells that is distinct from the
membrane-delimited pathways identified by others in vitro
(26).
The MAP kinase kinase kinase, Raf-1, is recruited to the membrane after
Ras activation and represents the last membrane-delimited protein in
the growth factor/MAP kinase cascade. Its activation by Ras is greatly
potentiated by the actions of c-src (38, 48) and src-family
tyrosine kinases (47) via two tyrosine phosphorylation sites within the
Raf-1 protein at amino acids 340 and 341 (78). The induction of
PTP activity by somatostatin has been shown to dephosphorylate this
site in vitro, resulting in decreased Raf-1 activity
in vitro (74, 79). We show here that somatostatin can
activate both ERK and Raf-1 via SSTR1 in vivo and can
augment the activation of ERK by FGF. Both the activations of ERK and
Raf-1 by SS-14 can be blocked by the interfering mutant SHP-2(CS),
suggesting that, at least for SSTR1, SHP-2 may be required for maximal
activation of ERK. These studies suggest a role for SHP-2 in the
activation of components of the MAP kinase cascade including Raf-1 and
ERK.
This requirement of SHP-2 for somatostatins activation of Raf-1 and
ERK may be similar to the role of SHP-2 in signaling via many growth
factors, where the activation of ERK requires the phosphatase activity
of SHP-2 (80, 81, 82, 83, 84). These studies suggest that SHP-2 may function both
as adaptors, via their SH2 domains, and as enzymes that stimulate
signaling to ERKs. In PC12 cells, SHP-2 and not SHP-1 is required for
sustained ERK activation by FGF (53, 85). In these cells, prolonged ERK
activation is required for cessation of cell growth and neuronal
differentiation and is accompanied by an induction of
p21cip1/WAF1 (59). We show here that somatostatin also
requires SHP-2 for the activation of ERKs via SSTR1, and this
activation of ERKs by somatostatin is associated with cessation of cell
growth and the induction of p21cip1/WAF1 in growth
factor-treated cells.
We show that SHP-2 is required for full activation of Raf-1 by
somatostatin. One potential target of SHP-2 is c-src, a
cytoplasmic tyrosine kinase that is physically associated with SHP-2 in
CHO-SSTR1 cells and in other cell types (86). Dephosphorylation of
c-src at a single phosphotyrosine (tyrosine 529 in the
mouse) is required for full activity (87, 88) and, in lymphocytes, is
accomplished by the related phosphatase, SHP-1 (52, 89). The
involvement of c-src in the activation of ERKs by SS-14 in
CHO-SSTR1 cells is further supported by the ability of both herbimycin
A and CSK to block ERK activation via SSTR1 (Fig. 11
). However, we have not completely
ruled out the role of other herbimycin A- and CSK-sensitive kinases in
ERK activation, nor have we ruled out the possibility that SHP-2 may be
acting on additional proteins.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 11. Schematic Representation of the Proposed Signal
Transduction Pathway Used by Somatostatin to Stimulate the MAP Kinase
Cascade via SSTR1
The plasma membrane is depicted by parallel dotted
lines, with SSTR1 drawn as a heptahelical
transmembrane protein. At this time, neither can we propose a specific
mechanism by which PI3 kinase (PI3 K) cooperates with SHP-2, nor can we
rule out the possibility that c-src may be acting at
additional sites upstream of Raf-1.
|
|
In conclusion, we propose that the activation of SSTR1 is coupled
positively to the MAP kinase cascade. Somatostatins ability to
potentiate growth factor stimulation of the MAP kinase cascade via
SSTR1 may limit proliferative signals generated by growth factor
receptors by increasing the expression of proteins like
p21cip1/WAF1 that inhibit cell cycle progression in these
cells (37).
 |
MATERIALS AND METHODS
|
|---|
Materials
PTX and basic FGF were purchased from Sigma Chemical Co. (St.
Louis, MO). Octreotide was provided by Sandoz Pharmaceuticals (Basel,
Switzerland). Somatostatin-14 (SS-14) was purchase from American
Peptides (Sunnyvale, CA). Herbimycin A, wortmannin, and LY294002 were
purchased from CalBiochem (La Jolla, CA). Antisera directed toward
ERK1, ERK2, Raf-1, SHP-1, and myc antibody 9E10 were purchased from
Santa Cruz Biotechnology (Santa Cruz, CA). Antisera directed toward
p21cip1/WAF1 was purchased from Pharmingen (San Diego, CA)
and used at 1:1000. Antibodies directed to SHP-2 and c-src
were purchased from Upstate Biotechnology Inc. (Lake Placid, NY).
Antibodies directed to phospho-ERK (pThe-183,pTyr-185) were purchased
from New England Biolabs, Inc. (Beverly, MA.). Radioisotopes were from
NEN-DuPont (Boston, MA). All other reagents were from Sigma.
Cell Culture and Treatments
CHO-SSTR1 and GH4C1 cells were
maintained as previously described (1). Before immune complex,
luciferase, and immunofluorescence assays, the cells were deprived of
serum and maintained in DMEM for 16 h at 37 C in 5%
CO2 before treatment with SS-14 at 1 µM, for
10 min unless otherwise indicated. Basic FGF was used at 50 ng/ml. For
studies examining FGFs activation of ERKs, cells were lysed after 10
min of FGF treatment. Herbimycin A was used at 1 µM
concentration, wortmannin was used at 100 nM to 1
µM, and LY294002 was used at 25 nM. All
compounds were added 10 min before SS-14 or FGF.
Proliferation Assay
Cell number was determined through the assay of mitochondrial
function, using 3(4, 5-dimethythiazol-2-yl)-2,5diphenyl tetrazolium
bromide (MTT) as a substrate. MTT is reduced by mitochondrial
dehydrogenases to form an insoluble purple precipitate that can be
solublized with dimethylsulfoxide and absorbance at 570 nm
quantitated as an index of cell number.
Plasmids and Transfection
The plasmids encoding RasN17, MEK K97R, Raf301, myc-ERK2, and
Elk-1/Gal-4, 5xGal4-E1b/luciferase have been previously described (41).
The plasmids encoding myc-SH-PTP2 and myc-SH-PTP2(CS) were kindly
provided by Dr. J. Pessin (University of Iowa, Iowa City, IA).
The plasmid encoding CSK was provided by Dr. K. Rodland (Oregon Health
Sciences University). The plasmid encoding myc-Raf-1 was provided by
Dr. A. Shaw (Washington University, St. Louis, MO). All cell lines were
grown to 50% confluence before transfection. Transfections were
performed using lipofectamine per the manufacturers instructions
(GIBCO-BRL). In all experiments, total DNA transfected was kept
constant with addition of pcDNA3 vector (Invitrogen, San Diego, CA).
For luciferase assays, the plasmids 5xGal4-E1b/luciferase and Gal4-Elk1
were used in combination with other plasmids as indicated (41, 51, 52, 55). For all experiments, cells were allowed to recover for 2436 h
and serum starved for 612 h before treatment. The C-terminal fragment
of ßARKct was cloned by PCR from a rat brain cDNA library using
specific primers to the published ßARK sequence (sense oligo,
ATAGAATTCGCCGCCACCATGGGAATCAAGTTACTGGAC; antisense oligo,
ATATCTAGAGAATCAGAGGCCGTTGGCAC-TGCCACGCTG) and subcloned into pcDNA3.
To facilitate translation, the sense oligo included a ribosomal binding
cassette and a ATG start codon.
Luciferase Assay
Luciferase assays were carried out as described (41, 51, 52, 55). Cells were transfected with 5xGal4-E1b/luciferase and Gal4-Elk1 as
described and treated with somatostatin (SS-14) (1 µM) or
left untreated. After 6 h of treatment, cell lysates were prepared
and luciferase activity was assayed as described (55). Luciferase
activity was reported as fold increase above basal levels determined
from untreated serum-starved cells.
Phosphatase Assay
Cells were grown to 50% confluency, serum starved, and treated
with SS-14 (1 µM). At the indicated times, the cells were
washed twice in PBS and lysed in a buffer containing 50 mM
Tris (pH 7.4), 100 mM NaCl, 1 mM EDTA, 1%
NP40, 0.1 mM phenylmethylsulfonyl fluoride, 1
mM leupeptin, and 10 µg/ml aprotinin. Total proteins (100
µg) were immunoprecipitated in the same buffer using 3 µg of
anti-SHP-2 antibody for 4 h at 4 C. The immunoprecipitate was
resuspended in 15 µl of 50% protein G sepharose (Pharmacia,
Piscataway, NJ) in 10 mM Tris. The entire immunoprecipitate
was washed and resuspended in 100 µl containing 20 µl 5x
phosphatase buffer (25 mM EDTA, 250 mM HEPES,
pH 7.2, 50 mM dithiothreitol) in the presence of the
serine/threonine phosphatase inhibitor microcystin ML-R (20
nM) and ZnCl2 (10 µM), and the
reaction was initiated by the addition of p-Npp substrate
(10 mM, final concentration) at 30 C and incubated for 30
min. The PTPase reaction was terminated by the addition of 0.9 ml of
0.2 N NaOH, and the absorbance of the sample was measured
at 410 nm, as previously reported (22).
Immune Complex Kinase Assay
Cells were grown to 50% confluence, serum-starved for 16
h, and treated with the specific agents for defined time points as
indicated. Lysates were normalized for total protein, and ERK assays
were performed with agarose-conjugated antisera to ERK1 (or antibodies
to myc for cells transfected with myc-tagged ERK2) as indicated, using
myelin basic protein (MBP) and [32P]-
ATP as substrates
(22, 41). For Raf-1 assays, untreated and treated cells were lysed in
1% NP-40 buffer containing 10 mM Tris, pH 7.4, 5
mM EDTA, 50 mM NaCl, and 1 mM
phenylmethylsulfonyl fluoride. Immune complex kinase assays were
performed as described using recombinant wild-type MEK-1 (Santa Cruz)
and [32P]-
-ATP as substrates (90). The reaction
products of ERK and Raf-1 assays were resolved by 12% and 10%
SDS-PAGE, respectively, and were analyzed with a PhosphorImager
(Molecular Dynamics, Sunnyvale, CA).
Immunofluorescence
CHO-SSTR1 cells were plated on two-chambered slides and treated
with 1 µM SS-14 for the indicated times. Cells were fixed
in 4% paraformaldehyde and permeabilized with acetone at -20 C for 1
min. The cells were incubated with p21cip1/WAF1 antisera
(1:1000 dilution) in PBS-0.1% BSA and fluorescein
isothiocyanate-coupled antirabbit IgG and were visualized using
a Leitz DMRB microscope (Leica, Inc., Deerfield, IL).
 |
ACKNOWLEDGMENTS
|
|---|
We thank R. Goodman, C. Marshall, R. Maurer, J. Pessin, K.
Rodland, and A. Shaw for cDNAs, C. Ellig for technical assistance, and
Chris Fenner for secretarial assistance.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Philip J. S. Stork, The Vollum Institute, L-474, Oregon Health Sciences University, 3181 SW Sam Jackson Park Road, Portland, Oregon 97201-3098.
T. Florio was supported by a "Short-term mobility grant" by
Consiglio Nazionale delle Ricerche (Italy).
Received for publication January 8, 1998.
Revision received October 1, 1998.
Accepted for publication October 8, 1998.
 |
REFERENCES
|
|---|
-
Florio T, Rim C, Hershberger RE, Loda M, Stork PJS 1994 The somatostatin receptor SSTR1 is coupled to phosphotyrosine
phosphatase activity in CHO-K1 cells. Mol Endocrinol 8:12891297[Abstract]
-
Reubi JC, Maurer R, von Werder K, Torhorst J, Klijn JGM,
Lamberts SWJ 1987 Somatostatin receptors in human endocrine tumors.
Cancer Res 47:551558[Abstract/Free Full Text]
-
Bell GI, Reisine T 1993 Molecular biology of somatostatin
receptors. Trends Neurosci 16:3438[CrossRef][Medline]
-
Dy DY, Whitehead RH, Morris DL 1992 SMS 201.995 inhibits
in vitro and in vivo growth of human colon
cancer. Cancer Res 52:917923[Abstract/Free Full Text]
-
Prévost G, Foehrlé E, Thomas F, Pihan I, Veber N,
Starzec A, Israël L 1991 Growth of human breast cancer cell lines
is inhibited by the somatostatin analog BIM23014. Endocrinology 29:323329
-
Qin Y, Schally AV, Willems G 1991 Somatostatin analogues
RC-160 inhibits the growth of transplanted colon cancer in rats. Int J
Cancer 47:765770[Medline]
-
Florio T, Scorziello A, Fattore M, DAlto V, Salzano S,
Rossi G, Berlingieri MT, Fusco A, Schettini G 1996 Somatostatin
inhibits PC C13 thyroid cell differentiation through the modulation of
phosphotyrosine activity. J Biol Chem 271:61296136[Abstract/Free Full Text]
-
Taylor JE, Moreau J-P, Baptiste L, Moody TW 1990 Octapeptide
analogues of somatostatin inhibit the clonal growth and vasoactive
intestinal peptide-stimulated cyclic AMP formation in human small cell
lung cancer cells. Peptides 12:839843[CrossRef]
-
Kluxen FW, Bruns C, Lubbert H 1992 Expression cloning of a
rat brain somatostatin receptor cDNA. Proc Natl Acad Sci USA 89:46184622[Abstract/Free Full Text]
-
Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S 1992 Cloning and functional characterization of a family of human and mouse
somatostatin receptors expressed in brain, gastrointestinal tract, and
kidney. Proc Natl Acad Sci USA 89:251255[Abstract/Free Full Text]
-
Hoyer D, Bell GI, Berelowitz M, Epelbaum J, Feniuk W, Humphrey
PP, OCarroll AM, Patel YC, Schonbrunn A, Taylor JE 1995 Classification and nomenclature of somatostatin receptors. Trends
Pharmacol 16:8688[CrossRef][Medline]
-
Kaupman K 1993 Distribution and second messenger coupling of
four somatostatin receptor subtypes expressed in brain. FEBS Lett 331:5359[CrossRef][Medline]
-
Schonbrun D, Tashjian AB 1978 Characterization of functional
receptors for somatostatin in rat pituitary cells in culture. J
Biol Chem 253:64736483[Abstract/Free Full Text]
-
Chen L, Fitzpatrick VD, Vandlen RL, Tashjian AHJ 1997 Both
overlapping and distinct signaling pathways for somatostatin receptor
subtypes SSTR1 and SSTR2 in pituitary cells. J Biol Chem 272:1866618672[Abstract/Free Full Text]
-
Rens-Domiano S, Reisine T 1992 Biochemical and functional
properties of somatostatin receptors. J Neurochem 58:19871996[CrossRef][Medline]
-
Liebow C, Lee MT, Kamer AR, Schally AV 1991 Regulation of
luteinizing hormone-releasing hormone receptor binding by heterologous
and autologous receptor-stimulated tyrosine phosphorylation. Proc Natl
Acad Sci USA 88:22442248[Abstract/Free Full Text]
-
Grant MB, Wargovich TJ, Ellis EA, Caballero S, Mansour M,
Pepine CJ 1994 Localization of insulin-like growth factor I and
inhibition of coronary smooth muscle cell growth by somatostatin
analogues in human coronary smooth muscle cells. A potential treatment
for restenosis. Circulation 89:15111517[Abstract/Free Full Text]
-
Tsuzaki S, Moses AC 1990 Somatostatin inhibits
deoxyribonucleic acid synthesis induced by both thyrotropin and
insulin-like growth factor-I in FRTL5 cells. Endocrinology 126:31313138[Abstract]
-
Buscail L, Delesque N, Estéve J-P, Saint-Laurent N,
Prats H, Clerc P, Robberecht P, Bell GI, Liebow C, Schally AV, Vaysse
N, Susini C 1994 Stimulation of tyrosine phosphatase and inhibition of
cell proliferation by somatostatin analogues: mediation by human
somatostatin receptor subtypes SSTR1 and SSTR2. Proc Natl Acad Sci USA 91:23152319[Abstract/Free Full Text]
-
Hierowski MT, Liebow C, du Sapin K, Schally AV 1985 Stimulation by somatostatin of dephosphorylation of membrane proteins
in pancreatic cancer MIA PaCa-2 cells line. FEBS Lett 179:252256[CrossRef][Medline]
-
Lee MT, Liebow C, Kamer AR, Schally AV 1991 Effects of
epidermal growth factor and analogues of luteinizing hormone-releasing
hormone and somatostatin on phosphorylation and dephosphorylation of
tyrosine residues of specific protein substrates in various tumors.
Proc Natl Acad Sci USA 88:16561660[Abstract/Free Full Text]
-
Pan MG, Florio T, Stork PJS 1992 G protein activation of a
hormone-stimulated protein-tyrosine phosphatase in human tumor cells.
Science 256:12151217[Abstract/Free Full Text]
-
Lamberts SWJ, Krenning EP, Reubi JC 1991 The role of
somatostatin and its analogs in the diagnosis and treatment of tumors.
Endocr Rev 12:450482[Medline]
-
Hershberger RE, Newman BL, Florio T, Bunzow J, Civelli O, Li
X-J, Forte M, Stork PJS 1994 The somatostatin receptors SSTR1 and SSTR2
are coupled to inhibition of adenylyl cyclase in CHO cells via
pertussis toxin sensitive pathways. Endocrinology 134:12771285[Abstract]
-
Florio T, Scorziello A, Thellung S, Salzano S, Berlingieri MT,
Fusco A, Schettini G 1997 Oncogene transformation of PC C13 clonal
thyroid cell line that induces an autonomous pattern of proliferation
that correlates with loss of basal and stimulated phosphotyrosine
phosphatase activity. Endocrinology 138:37563763[Abstract/Free Full Text]
-
Reardon DR, Dent P, Wood SL, Kong T, Sturgill TW 1997 Activation in vitro of somatostatin receptor subtypes 2, 3,
or 4 stimulates protein tyrosine phosphatase activity in membranes from
ras-transformed NIH3T3 cells: coexpression with catalytically inactive
SHP-2 blocks responsiveness. Mol Endocrinol 11:10621069[Abstract/Free Full Text]
-
Srikant CB, Shen SH 1996 Octapeptide somatostatin analog SMS
201995 induces translocation of intracellular PTP1C to membranes in
MCF-7 human breast adenocarcinoma cells. Endocrinology 137:34613468[Abstract]
-
Dhanasekaran N, Heasley LE, Johnson GL 1995 G protein-coupled
receptor systems involved in cell growth and oncogenesis. Endocr Rev 16:259270[CrossRef][Medline]
-
Schlessinger J, Ullrich A 1992 Growth factor signaling by
receptor tyrosine kinases. Neuron 9:383391[CrossRef][Medline]
-
Ullrich A, Schlessinger J 1990 Signal transduction by
receptors with tyrosine kinase activity. Cell 60:203212
-
Gu YZ, Brown PJ, Loose-Mitchell DS, Stork PJS, Schonbrunn A 1995 Development and use of a receptor antibody to characterize the
interaction between somatostatin receptor subtype 1 and G proteins. Mol
Pharmacol 48:10041014[Abstract]
-
Cheung NW, Boyages SC 1995 Somatostatin-14 and its analog
octreotide exert a cytostatic effect on GH3 rat pituitary tumor cell
proliferation via a transient G0/G1 cell cycle block. Endocrinology 136:41744181[Abstract]
-
Cowley S, Paterson H, Kemp P, Marshall CJ 1994 Activation of
MAP kinase kinase is necessary and sufficient for PC12 differentiation
and for transformation of NIH3T3 cells. Cell 77:841852[CrossRef][Medline]
-
Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR 1995 A synthetic inhibitor of the mitogen-activated protein kinase
cascade. Proc Natl Acad Sci USA 92:76867689[Abstract/Free Full Text]
-
Cattaneo MG, Amoroso D, Gussoni G, Sanguini AM, Vicentini LM 1996 A somatostatin analogue inhibits MAP kinase activation and cell
proliferation in human neuroblastoma and in human small cell lung
carcinoma cell lines. FEBS Lett 397:164168[CrossRef][Medline]
-
Tentler JJ, Hadcock JR, Guetierrez-Hartmann A 1997 Somatostatin act by inhibiting the cyclic 3',5'-adenosine monophosphate
(cAMP)/protein kinase A pathway, cAMP response element-binding protein
(CREB) phosphorylation and CREB transcriptional potency. Mol Endocrinol 11:859866[Abstract/Free Full Text]
-
Xiong Y, Hannon GJ, Zhang H, Kobayashi R, Beach D 1993 p21 is
a universal inhibitor of cyclin kinases. Nature 366:701704[CrossRef][Medline]
-
Woods D, Parry D, Cherwinski H, Bosch E, Lees E, McMahon M 1997 Raf-induced proliferation or cell cycle arrest is determined by
the level of Raf activity with arrest mediated by p21Cip1. Mol Cell
Biol 17:55985611[Abstract]
-
Sewing A, Wiseman B, Lloyd AC, Land H 1997 High-intensity Raf
signal causes cell cycle arrest mediated by p21Cip1. Mol Cell Biol 17:55885597[Abstract]
-
Bruder JT, Heidecker G, Rapp UR 1992 Serum-, TPA-, and
Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1
kinase. Genes Dev 6:545556[Abstract/Free Full Text]
-
Vossler M, Yao H, York R, Rim C, Pan M-G, Stork PJS 1997 cAMP
activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent
pathway. Cell 89:7382[CrossRef][Medline]
-
Zheng C-F, Guan K-L 1993 Dephosphorylation and inactivation of
the mitogen-activated protein kinase by a mitogen-induced Thr/Tyr
protein phosphatase. J Biol Chem 268:1611616119[Abstract/Free Full Text]
-
Stacy DW, Feig LA, Gibbs JB 1991 Dominant inhibitory ras
mutants selectively inhibit the activity of either cellular or
oncogenic ras. Mol Cell Biol 11:40534064[Abstract/Free Full Text]
-
Koch WJ, Hawes BE, Allen LF, Lefkowitz RJ 1994 Direct evidence
that Gi-coupled receptor stimulation of mitogen-activated
protein kinase is mediated by Gß
activation of
p21ras. Proc Natl Acad Sci USA 91:1270612710[Abstract/Free Full Text]
-
Imamoto A, Soriano P 1993 Disruption of the csk gene, encoding
a negative regulator of Src family tyrosine kinases, leads to neural
tube defects and embryonic lethality in mice. Cell 73:11171124[CrossRef][Medline]
-
Avruch J, Zhang X-F, Kyriakis JM 1994 Raf meets Ras:
completing the framework of a signal transduction pathway. Trends
Biochem Sci 19:279283[CrossRef][Medline]
-
Morrison DK, Cutler Jr RE 1997 The complexity of Raf-1
regulation. Curr Opin Cell Biol 9:174179[CrossRef][Medline]
-
Marais R, Light Y, Paterson HF, Marshall CJ 1995 Ras recruits
Raf-1 to the plasma membrane for activation by tyrosine
phosphorylation. EMBO J 14:31363145[Medline]
-
Neel B 1993 Structure and function of SH2-domain containing
tyrosine phosphatase. Semin Cell Biol 4:419432[CrossRef][Medline]
-
Rivard N, McKenzie FR, Brondello J-M, Pouysségur J 1995 The phosphotyrosine phosphatase PTP1D, but not PTP1C, is an essential
mediator of fibroblast proliferation induced by tyrosine kinase and G
protein-coupled receptors. J Biol Chem 270:1101711024[Abstract/Free Full Text]
-
Lorenz U, Ravichandran KS, Burakoff SJ, Neel BG 1996 Lack of
SHPT1 results in src-family kinase hyperactivation and thymocyte
hyperresponsiveness. Proc Natl Acad Sci USA 93:96249629[Abstract/Free Full Text]
-
Somani A-K, Bignon JS, Mills GB, Siminovitch KA, Branch DR 1997 Src kinase activity is regulated by the SHP-1 protein-tyrosine
phosphatase. J Biol Chem 272:2111321119[Abstract/Free Full Text]
-
Wright JH, Drueckes P, Bartoe J, Zhao Z, Shen SH, Krebs EG 1997 A role for the SHP-2 tyrosine phosphatase in nerve growth-induced
PC12 cell differentiation. Mol Biol Cell 8:15751585[Abstract]
-
Marais R, Wynne J, Treisman R 1993 The SRF accessory protein
Elk-1 contains a growth factor-regulated transcriptional activation
domain. Cell 73:381393[CrossRef][Medline]
-
Misra-Press A, Rim CS, Yao H, Roberson MS, Stork PJS 1995 A
novel mitogen-activated protein kinase phosphatase: structure,
expression and regulation. J Biol Chem 270:1458714596[Abstract/Free Full Text]
-
Roberson MS, Misra-Press A, Laurance ME, Stork PJS, Maurer RA 1995 A role for mitogen activated protein kinase in mediating the
ability of gonadotropin-releasing hormone to activate the glycoprotein
hormone
-subunit promoter. Mol Cell Biol 15:35313539[Abstract]
-
Hazlerigg DG, Thompson M, Hastings MH, Morgan PJ 1996 Regulation of mitogen-activated protein kinase in the pars tuberalis of
the ovine pituitary: interactions between melatonin, insulin-like
growth factor-1, and forskolin. Endocrinology 137:210218[Abstract]
-
Conrad KE, Oberwetter JM, Vaillancourt R, Johnson GL,
Gutierrez-Hartmann A 1994 Identification of the functional components
of the ras signaling pathway regulating pituitary cell-specific gene
expression. Mol Cell Biol 14:15531565[Abstract/Free Full Text]
-
Yan G-Z, Ziff EB 1997 Nerve growth factor induces
transcription of the p21 WAF1/CIP1 and cyclin D1 genes in PC12 cells by
activating the Sp1 transcription factor. J Neurosci 17:61226132[Abstract/Free Full Text]
-
Olson MF, Paterson HF, Marshall CJ 1988 Signals from Ras and
Rho GTPases interact to regulate expression of
p21Waf1/Cip1. Nature 394:295299
-
Della Rocca GJ, van Biesen T, Daaka Y, Luttrell KK, Luttrell
LM, Lefkowitz RJ 1997 Ras-dependent mitogen-activated protein kinase
activation by G protein-coupled receptors. J Biol Chem 272:1912519132[Abstract/Free Full Text]
-
Inglese J, Koch WJ, Touhara K, Lefkowitz RJ 1995 ß
interactions with PH domains and Ras-MAPK signaling pathways. Trends
Biochem Sci 20:151156[CrossRef][Medline]
-
Lopez-Llasaca M, Crespo P, Pellicci PG, Gutkind JS, Wetzker R 1997 Linkage of G protein-coupled receptors to the MAPK signaling
pathway through PI 3-kinase
. Science 275:394397[Abstract/Free Full Text]
-
Cohen NA, Sha Q, Makhina EN, Lopatin AN, Linder ME, Snyder SH,
Nichols CG 1996 Inhibition of an inward rectifier potassium channel
(Kir2.3) by G-protein beta gamma subunits. J Biol Chem 271:3230132305[Abstract/Free Full Text]
-
Sakanaka C, Ferby I, Waga I, Bito H, Shimizu T 1994 On the
mechanism of cytosolic phosholipase A2 activation in CHO cells carrying
somatostatin receptor: wortmannin-sensitive pathway to activate
mitogen-activated protein kinase. Biochem Biophys Res Commun 205:1823[CrossRef][Medline]
-
Garnovskaya MN, van Biesen T, Hawe B, Casanas Ramos S,
Lefkowitz RJ, Raymond JR 1996 Ras-dependent activation of fibroblast
mitogen-activated protein kinase by 5-HT1A receptor via a G protein
beta gamma-subunit-initiated pathway. Biochemistry 35:1371613722[CrossRef][Medline]
-
Crespo P, Xu N, Simonds WF, Gutkind JS 1994 Ras-dependent
activation of MAP kinase pathway mediated by G-protein beta gamma
subunits. Nature 369:418420[CrossRef][Medline]
-
Ptasznik A, Traynor-Kaplan A, Bokoch GM 1995 G protein-coupled
chemoattractant receptors regulate lyn tyrosine kinase-shc adapter
protein signaling complexes. J Biol Chem 270:1996919973[Abstract/Free Full Text]
-
van Biesen T, Hawes BE, Luttrell DK, Krueger KM, Touhara K,
Porfiri E, Sakaue M, Luttrell LM, Lefkowitz RJ 1995 Receptor-tyrosine-kinase- and Gß
-mediated MAP kinase
activation by a common signalling pathway. Nature 376:781784[CrossRef][Medline]
-
Hawes BE, Luttrell LM, van Biesen T, Lefkowitz RJ 1996 Phosphatidylinositol 3-kinase is an early intermediate in the G
ß
-mediated mitogen-activated protein kinase signaling pathway.
J Biol Chem 271:1213312136[Abstract/Free Full Text]
-
Duckworth BC, Cantley LC 1997 Conditional inhibition of the
mitogen-activated protein kinase cascade by wortmannin. J Biol
Chem 272:2766527670[Abstract/Free Full Text]
-
Dent P, Jelinek T, Morrison DK, Weber MJ, Sturgill TW 1995 Reversal of Raf-1 activation by purified and membrane-associated
protein phosphatases. Science 268:19021906[Abstract/Free Full Text]
-
Lopez F, Esteve J-P, Buscail L, Delesque N, Saint-Laurent N,
Theveniau M, Nahmias C, Vaysse N, Susini C 1997 The tyrosine
phosphatase SHP-1 associates with the sst2 somatostatin receptor and is
an essential component of sst2-mediated inhibitory growth signaling.
J Biol Chem 272:2444824454