| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Endocrinology and Reproductive Medicine
Hôpital Necker (P.T., C.P., M.D., F.K.) Institut
Fédératif de Recherche (IFR-NEM) 75743 Paris
Cédex 15, France
INSERM U 135, Hormones, Gènes et
Reproduction et Laboratoire dHormonologie et Biologie
Moléculaire Hôpital de Bicêtre Assistance
Publique-Hôpitaux de Paris et Institut Fédératif
de Recherche IFR21 (I.B, G.M., A.D., E.M., M.M.) 94275 Le
Kremlin Bicêtre Cedex, France
INSERM U 407,
Faculté Médecine Lyon-Sud (A.G.) 69600 Oullins,
France
Department of Gynecology and Obstetrics (B.P.)
Hôpital Intercommunal de Créteil 94010 Creteil,
France
Department of Cytogenetics Hôpital
Necker-Enfants Malades (M.P.) 75743 Paris Cedex 15, France
Department of Gynecology and Obstetrics Hôpital Cochin
(J-R Z.) 75014 Paris, France
| ABSTRACT |
|---|
|
|
|---|
DNA sequencing showed two heterozygous mutations: Asp224Val in the extracellular domain and Leu601Val in the third extracellular loop of FSHR. Cells transfected with expression vectors encoding the wild type or the mutated Leu601Val receptors bound hormone with similar affinity, whereas binding was barely detectable with the Asp224Val mutant. Confocal microscopy showed the latter to have an impaired targeting to the cell membrane. This was confirmed by its accumulation as a mannose-rich precursor. Adenylate cyclase stimulation by FSH of the Leu601Val mutant receptor showed a 12 ± 3% residual activity, whereas in patient 1 a 24 ± 4% residual activity was detected for the Arg573Cys mutant receptor. These results are in keeping with the fact that estradiol and inhibin B levels were higher in patient 1 and that stimulation with recombinant FSH did not increase follicular size, estradiol, or inhibin B levels in patient 2 in contrast to what was observed for patient 1. Thus, differences in the residual activity of mutated FSHR led to differences in the clinical, biological, and histological phenotypes of the patient.
| INTRODUCTION |
|---|
|
|
|---|
The first mutation that was identified was the Ala189Val homozygous substitution detected in a highly consanguinous Finnish population (3). It was associated with primary amenorrhea, streak ovaries containing primordial and primary follicles but without any further follicular development (4). This observation indicated that the initiation of folliculogenesis was independent of FSH action. A similar conclusion has been very recently reached in mice with targeted disruption of the FSH receptor gene and which present a block in folliculogenesis at the preantral stage (5). On the other hand, it is well known that FSH is necessary for the development of preovulatory follicules (6, 7). Between these stages, the role of FSH for preantral or early antral follicles is still under discussion due to the lack of appropriate experimental models.
Recently we have described a novel phenotype associated with partial loss-of-function mutations of the FSH receptor (8). In this case the patient had primo-secondary amenorrhea, high gonadotropin levels (especially FSH), and normal sized ovaries. Ultrasonography, ovarian histology, and immunocytochemistry showed a normal follicular development up to a small antral stage (follicles of 5 mm) and then a disruption at further stages. We now report a second such case associated with two different mutations. The patient presented primary amenorrhea and her antral follicles developed only to a size of 3 mm. She was a compound heterozygote bearing an Asp224Val or a Leu601Val mutation on each allele. As reported in the previous patient, transfection studies showed altered but not suppressed function of the mutated receptors. However the residual function was more limited than in the previous case. There was thus a correlation between receptor activity measured in vitro and the in vivo findings, i.e. the phenotype and the most advanced stage to which follicular development could proceed.
The propositus was a 19 yr-old Caucasian woman who consulted for
primary amenorrhea. Puberty had occurred at the age of 13, with normal
development of secondary sex characteristics. The patient was the
second daughter of two nonconsanguinous parents. Her 21-yr-old sister
described menstrual irregularity since her first menstruations at age
14. The patients height was 174 cm and her weight 73 kg. Plasma FSH
and LH were high, 63 and 26 IU/liter, respectively [normal (N):
48]. Plasma E2 levels were low: 4080 pmol/liter (N:
701000), and testosterone plasma level was 1.7 nmol/liter (N:
0.72.1 nmol/liter),
4-androstenedione was 8.4 nmol/liter (N: <5
nmol/liter) and dehydroepiandrosterone was 48.1
nmol/liter (N: 740 nmol/liter). Sex hormone binding globulin
was at a normal low level: 34 nmol/liter (N: 3069 nmol/liter). Plasma
concentration of inhibin B was low, 30 pg/ml (N: 60175 pg/ml). No
antithyroid or antiovary autoantibody could be detected. The karyotype
was normal: 46,XX. Pelvic ultrasonography showed a normal uterus and
normal sized ovaries. Ten to 12 follicles of 3 mm were detected,
regularly spread in each ovary. Under coelioscopy, two biopsies were
performed on each ovary. The patient received an oral
estrogen-progestin treatment (ethinyl-estradiol, 50 µg, and
norgestrel, 500 µg) for 3 months. At the end of this treatment,
plasma LH and FSH were low (1 IU/liter). An ovarian stimulation by
recombinant FSH (Puregon, Organon, Puteaux,
France) was performed with doses increased every 34 days until a
cumulative dose of 5625 IU had been obtained. It was monitored by
hormone assays and pelvic ultrasonographies.
The study was approved by the review boards of the different institutions. Informed consent was obtained from the patient and her family.
| RESULTS |
|---|
|
|
|---|
|
|
Altered Surface Targeting and Processing of the Asp224Val Receptor
Mutant
Impaired FSH binding to cells expressing the Asp224Val
mutant receptor could have been due either to a modification of the
binding site or to an alteration in receptor cellular trafficking. To
distinguish between these two possibilities, cells were transfected
with the wild-type or the mutated receptors, and receptor distribution
was studied (Fig. 3
). Transfected cells
were incubated with an antibody directed against the extracellular
domain of the receptor. When the cells were permeabilized with saponin
before the incubation with the antibody, a strong intracellular
staining was observed in all cases. When the cells were not
permeabilized, labeling was observed on the cell surface for cells
expressing the wild-type receptor or the Leu601Val mutant, but no
labeling was observed for cells expressing the Asp224Val mutant
receptor.
|
As shown in Fig. 4
, two species
corresponding to the wild-type receptor were detected as previously
described (10). The highest molecular mass species of
approximately 87 kDa was resistant to endoglycosidase H but sensitive
to N-glycanase F and resolved into an approximately 75 kDa
species. It corresponds to the mature receptor, which has undergone a
complete glycosylation and which is expressed at the cell surface (10).
The approximately 81 kDa species was sensitive to both
N-glycanase F and endoglycosidase H and resolved into an
approximately 75 kDa species. It thus corresponds to a protein with
high-mannose moïeties, which has been shown to be a precursor
of the FSHR (10). Such a precursor accumulates in the endoplasmic
reticulum (11).
|
Histological and Immunohistochemical Studies of the Ovary
Histological examination of ovarian biopsies showed a normal
number of healthy primordial and primary follicles (Fig. 5A
). Secondary follicles also displayed a
normal morphology (Fig. 5B
). Three antral follicles were found in the
biopsies: the two smaller (0.22 and 0.28 mm) were apparently normal
(not shown), whereas the larger (diameter: 0.81 mm) was clearly
degenerating (Fig. 5C
). It had an irregular antrum containing remnants
of granulosa cell layers. The basal lamina was thick and irregular and
the theca interna was hypertrophied (100150 µm).
|
hydroxylase
(P450c17) (Fig. 5D
Correlation of Receptor Function with Clinical and Biological
Findings in Patients with Partial Ovarian Failure and FSHR
Mutations
We have previously reported another patient (patient 1) bearing
two heterozygous mutations of the FSHR gene (8). We compared the
activity of her transfected receptors with that of the present case
(patient 2). We then related these observations to the effects of FSH
in vivo in the two patients.
The biological activity of the four mutated FSHRs was compared with
that of the wild-type receptor (Fig. 6
).
Similar transfection efficiencies were assessed using a
ß-galactosidase assay. This experiment was reproduced four times with
similar results. The mutations yielded receptors with residual
activities of 24 ± 4% for the Arg573Asp (patient 1) and 12
± 3% for the Leu601Val (patient 2) receptor mutants, respectively,
after a maximal stimulation by FSH. Activities of the mutated receptors
Ile160Thr (patient 1) and Asp224Val (patient 2) were more severely
altered, 9 ± 2% and 4 ± 2% of the wild-type receptor,
respectively. Residual activity was therefore higher in the receptor
mutants carried by patient 1 as compared with patient 2. This could be
related to the fact that patient 1 had antral follicles developing up
to 5 mm whereas patient 2 had follicles developing only to 3 mm at
ultrasonography. Furthermore, plasma estradiol and inhibin B levels
were 70150 pmol/liter and 50 pg/ml in patient 1 and 4080 pmol/liter
and 30 pg/ml in patient 2. Patient 2, therefore, showed a lower
sensitivity to endogenous FSH than patient 1 (Table 1
).
|
|
There was thus a correlation between the FSH-stimulated in vitro activity of the mutated receptors found in the two patients and their in vivo response to endogenous and exogenous FSH.
| DISCUSSION |
|---|
|
|
|---|
POF concerns almost 1% of women under age 40 (12). It has long been suspected that POF could be due, in some cases, to an ovarian resistance to gonadotropin stimulation, since a few patients with amenorrhea but also presence of follicles at ovarian histology have been reported (13). This FSH resistance ovary syndrome is better understood now that inactivating mutations of the FSHR gene have been described. A first homozygous mutation (Ala189Val) was identified in a Finnish population of ovarian dysgenesis (3), with primary amenorrhea and delayed puberty in most cases (4). Histological study of the ovaries in some of these patients showed a streak or hypoplastic aspect and the presence of primordial and primary follicles with impaired follicular development at further stages. The mutation dramatically impaired receptor function. This mutation has not been detected in patients outside of Finland who display the same phenotype (1, 8, 14). More recently, we reported the case of a patient (patient 1) who was a compound heterozygote for two inactivating mutations of the FSHR (8). The phenotype of this patient was different from the one described in the Finnish population. Indeed, patient 1 presented with secondary amenorrhea, normal sized ovaries including antral follicles up to 5 mm. The mutations impaired, but did not abolish, FSHR function.
By analogy with the molecular defects found in the related LH or TSH receptors (reviews in Refs. 2, 15), we postulated that such partial cases may be more frequently observed than complete loss of FSHR function. Indeed, patient 2 was also found to have partial impairment of FSHR function. Clinically, this patient had a more severe phenotype with primary amenorrhea. She had smaller follicles than those of patient 1 at ultrasonography and a complete absence of response to recombinant FSH at a total dose of 5625 IU, which elicited in patient 1 a progressive increase in follicular growth (from 5 to 8.3 mm), and plasma concentrations of estradiol (from 35 to 240 pmol/liter) and inhibin B (from 50 to 125 pg/ml).
Functional analysis of the mutated receptors revealed a correlation with the phenotypes observed. Indeed, in the Finnish report, the homozygous extracellular mutation of the FSHR yielded a receptor with no significant response to hormone in vitro (3). Patient 1 was a compound heterozygote; one of the two mutations, the Arg573Cys mutation, yielded a receptor with a residual 24 ± 4% activity when compared with the wild-type receptor. In the case of patient 2, one of the two mutant receptors, the Leu601Val mutant, had 12 ± 3% residual activity when compared with the wild-type receptor. In both patients the other mutant receptors were almost completely inactive.
Interestingly, in both patients 1 and 2, follicular development occurred up to the antral stage, but ultrasonographic examination showed that it proceeded up to a follicular size of 5 mm in patient 1 and only 3 mm in patient 2. The fact that FSH stimulation was able to increase follicular size as well as estradiol, and inhibin B secretion in patient 1 indicated that ovarian follicles of this patient were partly responsive to high concentrations of FSH. In Patient 2, the same maximal dose of recombinant FSH was ineffective, and this can be explained by a more pronounced alteration of receptor function associated with a less important initial follicular development.
FSH effects on follicular growth and maturation differ markedly at various developmental stages. A body of evidence indicates that in mice and rats initiation of follicular growth, when a resting follicle enters the growth phase, does not require FSH (16, 17). The absence of FSHR gene expression in nongrowing human follicles confirms this point (18). Evidence points to the need of FSH for further follicular development between the primary and the antral stage. In rat models, hypophysectomy or GnRH antagonist administration leads to an almost complete absence of follicular growth beyond the secondary stage (19). The same pattern has been obtained in xenografts of human ovarian tissues in hypogonadal SCID/hpg mice, (20). Finally, in mice bearing a homozygous invalidation of either the FSHß (21) or the FSHR (5) gene, development was blocked before the antral stage. In humans, clinical observations also suggest FSH independence during the first steps of follicular development. In situations where low levels of circulating gonadotropins are present, i.e. prepubertally or in women with hypogonadotropic hypogonadism or with mutations of FSHß, morphological examination of the ovaries revealed the existence of small preantral follicles but few antral follicles, indicating that gonadotropin deficiency is associated mainly with a disruption of the final stages of preovulatory folliculogenesis (6, 22, 23, 24, 25).
The arrest of follicular development at a relatively precise stage in each of our two patients suggests that a different FSH or receptor activity is necessary to promote the maturation of antral follicles in each case. Growth may be arrested at various stages depending on how severely FSHR function is impaired.
A different mechanism has been proposed in preovulatory follicles. A threshold concentration of FSH must be reached. But once started, the final follicular development proceeds up to the ultimate stages, even if the concentration of FSH decreases (7, 26).
Immunohistochemical studies of the ovaries of patient 2 revealed only a faint staining for 3ß-hydroxysteroid dehydrogenase (3ß-HSD). This observation is also in agreement with a more pronounced defect in follicular development than in patient 1, in whom theca cells were found to express this enzyme. It has been shown during preovulatory follicle maturation in pigs that maximal expression of theca 3ß-HSD was observed only 4 days after maximal expression of P450 aromatase and P450c17 (27). This led to the proposal that 3ß-HSD is rate limiting for the overall follicular steroidogenesis by limiting the substrate for P450c17.
The cellular expression of the mutated receptors highlights the crucial role of two residues in FSHR function. The Asp224Val mutation (patient 2) yielded a receptor that was not expressed at the cell membrane. A similar situation was found for the Ile160Thr receptor mutant (patient 1). The study of the glycosylation of the mutated receptors indicates that they carry mannose-rich carbohydrates and have thus not reached the Golgi apparatus. This impairment of receptor cell trafficking may be due to an altered receptor conformation, which impedes the further progression of the receptor in other cellular compartments. The accumulation of misfolded proteins triggers the ER unfolded response inducing the selective synthesis of endoplasmic reticulum chaperones that bind to misfolded exportable proteins (28, 29, 30). This accumulation, alternatively, may be due to the lack of interaction of the mutated receptor with a specific chaperone necessary for proper receptor folding (31).
The Leu601Val substitution was characterized by an impairment in signal transduction, without any change in its affinity for FSH. It thus highlights the role of the third extracellular loop in FSHR transduction. However, mutation of the same leucine 601 [numbered Leu583 by Ryu et al. (32)] into an alanine improved hormone binding affinity by 4- to 6-fold, indicating an inverse relationship with cAMP stimulation. This observation led to the suggestion that leucine 601 interacted with the ectodomain and constrained hormone binding in the wild-type receptor (32). We could not confirm this hypothesis since repeated experiments in our study failed to detect a significant difference in FSH binding affinities of the wild-type and of the mutated receptor. Leucine 601 may thus be involved in maintaining the proper conformation of exoloop 3 and of the adjacent transmembrane helices 6 and 7. The latter have been shown to be important in signal transduction (33).
In conclusion, novel mutations of the FSHR have been identified that lead to a novel clinical phenotype. There was a correlation between the residual activity of the mutated receptors and the phenotype. These new observations offer a model to understand the role of FSH during the early steps of follicular development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Expression Vectors Encoding Mutated FSHRs
The human FSHR cDNA cloned into the pSG5 expression vector has
been described elsewhere (8). The mutations were introduced into the
pSG5-FSHR plasmid vector by oligonucleotide-mediated mutagenesis using
PCR.
The Leu601Val substitution was engineered with two mutagenic primers: a direct primer A1: 5'-AGGTGCCCGTCATCACTGTGTCCAA-3' and a reverse primer B1: 5'-CACAGTGATGACGGGCACCTTGAGG-3' starting, respectively, at positions 1793 and 1813 of the cDNA sequence (+1 corresponds to the first nucleotide of the initiation codon) (35). The mutated base is underlined.
Two other primers were used. Primer C1: GCTGCTCATTGCATCAGTTGATATCCATAC; and primer D1: GAGGGACAAGTATGTAAGTGGAACCACTGG, starting at positions 1245 and 2036, respectively, of the cDNA sequence. A fragment of 821 bp containing the mutation was constructed in two pieces. The first fragment was obtained by PCR using oligonucleotides A1 and D1. The second fragment was obtained using oligonucleotides B1 and C1. The full-length product of 821 bp was obtained by hybridization of the two fragments and PCR amplification using primers C1 and D1. After digestion with PfIMI (there are two PfIMI sites located at distances of 413 and 298 bp on either side of the mutation), the fragment was ligated into the pSG5-hFSHR vector, which had been previously digested with PfIMI. The Asp224Val substitution was generated using a similar strategy. Two mutagenic primers were used: a direct primer A2 (5'-GTCATTCTAGTTATTTCAAGAACAAGGATC-3') and a reverse primer B2 (5'- CCTTGTTCTTGAAATAACTAGAATGACTGG-3') starting at position 467 and 492 of the cDNA sequence, respectively (the mutated base is underlined). The two other primers were C2 (GGACCTGGAGAAAATAGAGATCTCTC-AGAA) and D2 (GACCCCTAGCCTGAGTCATATAATCAACTT) and started at positions 210 and 929 of the cDNA sequence, respectively.
The full-length fragment of 719 bp containing the Asp224Val mutation was digested with AflII and Bsu36 I (the restriction sites were located 141 bp upstream and 242 bp, respectively, downstream from the mutation), purified, and ligated to the pSG5-FSHR vector digested with the same restriction enzymes.
All constructs were verified by double-strand sequencing.
Study of FSH Binding to the Wild-Type and Mutated
Receptors
COS-7 cells were transfected with the wild-type and the mutated
receptors using Superfect (Qiagen, Chatsworth, CA) as
previously described (8). Forty-eight hours later, cells were incubated
for 1 h at 30 C with 400,000 cpm/ml of radioiodinated FSH
(Amersham Pharmacia Biotech, Arlington Heights, IL;
specific activity, 135 µCi/µg) as previously described (8). The
incubations were performed in the absence or in the presence of
increasing concentrations of unlabeled recombinant FSH. Nonspecific
binding was determined in samples containing an excess (10 µg/ml) of
unlabeled FSH and subtracted from the total binding. All experiments
were performed twice with triplicate samples. Transfection efficiencies
were estimated by cotransfecting pRSV-ßgal and measuring
ß-galactosidase activity in the cells. Similar efficiencies were
observed when expression vectors encoding either the wild-type or the
mutated FSHRs were used.
cAMP Assay
cAMP was measured as previously described (8) after 45 min
incubation of transfected cells with varying concentrations of FSH
(10-11 to 10-7 M) (Metrodine,
Serono Laboratories, Inc.).
Immunofluorescence and Confocal Microscopy
Indirect immunofluorescence studies were performed on COS-7
cells transiently expressing wild-type or mutated FSHR using the
monoclonal FSHR 323 antibody (8). This antibody, which recognizes an
epitope located in the extracellular domain of the FSHR (10), allows
the study of receptor expression at the cell membrane. For this
purpose, intact cells or permeabilized cells were incubated with the
antibody as previously described (8). A Cy3-labeled rabbit antimouse
IgG (Sigma Chemical Co., St Louis, MO) was used as a
secondary antibody. Immunofluorescence was then analyzed with an
Axiovert 135M microscope (Carl Zeiss, Thornwood, NY) in
conjunction with a confocal LSM 410 laser scanning unit (Carl Zeiss) (8, 36).
Immunoblotting of FSHR
COS-7 cells were transfected as described above. They were
scraped 48 h later in PBS containing protease inhibitors. After
centrifugation at 800 x g for 10 min at 4 C, the
pellet of cells was suspended in solubilization buffer as previously
described (10). The receptor was then immunopurified from membrane
extracts using the FSHR323 antibody coupled to Affi-Gel 10. The
purified FSHR was quantified using a specific immunoenzymatic assay
(10). The receptor (300 fmol) was then deglycosylated with
N-glycanase F or endoglycosidase H as previously described
(10, 37).
The immunopurified human (h) FSHR was electrophoresed on a 8% SDS polycrylamide gel under reducing and denaturing conditions. Proteins were electrotransferred to nitrocellulose and detected using the FSHR323 antibody as previously described (10, 37).
Histological and Immunohistochemical Study
The ovarian biopsy from patient 2 was fixed in buffered formol
and embedded in paraffin. Some sections were stained with conventional
histological stains (hematoxylin-eosin, Massons trichrome) for
optical microscopy while the other sections were processed for
immunohistochemistry.
The expression of steroidogenic enzymes was studied on paraffin sections after deparaffinization and antigen retrieval in 0.01 M citrate buffer, pH 6, in a 800 W microwave oven at full power for three cycles of 5 min as described (38).
The following polyclonal rabbit antibodies were used: anti-P450-side
chain cleavage enzyme (P450scc) (39) (dilution 1:3000),
anti-3ß-HSD (40) (dilution 1:3000), anti-17
hydroxylase
(P450c17
) (41) (dilution 1:5000), and antiaromatase
(P450arom) (42) (Hauptman-Woodward Medical Research
Institute, Inc., Buffalo, NY) (dilution 1:3000). They were
incubated overnight with the sections at 4 C in a humid chamber.
Endogenous peroxidase was quenched with 3%
H2O2 in PBS (pH 7.4) for 5 min. The bound Igs
were revealed with an antirabbit biotinylated antibody and with
peroxidase-labeled streptavidin (LSAB2 immunostaining kit, DAKO Corp., Carpinteria, CA) used according to manufacturers
instructions. Aminoethylcarbazole (Sigma Chemical Co.) was
used as a chromogen and Meyers hematoxylin was used as a nuclear
counterstain. Replacement of the primary antibody with preimmune rabbit
Igs at the appropriate dilution resulted in the absence of
immunolabeling. Polyclonal anti-Von Wille- brandt factor antibody
(DAKO Corp.) was used to define thecal
vascularization.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by the INSERM, the Faculté de Médecine Paris Sud, the Délégation à la Recherche Clinique (P.H.R.C no. AOM 96133) Assistance Publique-Hôpitaux de Paris, and the Association de Recherche sur le Cancer.
1 Isabelle Beau and Philippe Touraine contributed equally to this work
and should be viewed as first authors of this paper. ![]()
Received for publication May 19, 1999. Revision received July 12, 1999. Accepted for publication July 22, 1999.
| REFERENCES |
|---|
|
|
|---|
5-
4 isomerase in the
gonads and adrenal glands of the guinea pig. Endocrinology 126:29062909[Abstract]
This article has been cited by other articles:
![]() |
B. Mandon-Pepin, P. Touraine, F. Kuttenn, C. Derbois, A. Rouxel, F. Matsuda, A. Nicolas, C. Cotinot, and M. Fellous Genetic investigation of four meiotic genes in women with premature ovarian failure Eur. J. Endocrinol., January 1, 2008; 158(1): 107 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ghadami, S.A. Salama, N. Khatoon, R. Chilvers, M. Nagamani, P.J. Chedrese, and A. Al-Hendy Toward gene therapy of primary ovarian failure: adenovirus expressing human FSH receptor corrects the Finnish C566T mutation Mol. Hum. Reprod., January 1, 2008; 14(1): 9 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Laissue, S. Christin-Maitre, P. Touraine, F. Kuttenn, O. Ritvos, K. Aittomaki, N. Bourcigaux, L. Jacquesson, P. Bouchard, R. Frydman, et al. Mutations and sequence variants in GDF9 and BMP15 in patients with premature ovarian failure. Eur. J. Endocrinol., May 1, 2006; 154(5): 739 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sundblad, V. A. Chiauzzi, L. Andreone, S. Campo, E. H. Charreau, and L. Dain Controversial role of inhibin {alpha}-subunit gene in the aetiology of premature ovarian failure Hum. Reprod., May 1, 2006; 21(5): 1154 - 1160. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Allan, A. Garcia, J. Spaliviero, M. Jimenez, and D. J. Handelsman Maintenance of Spermatogenesis by the Activated Human (Asp567Gly) FSH Receptor During Testicular Regression Due to Hormonal Withdrawal Biol Reprod, May 1, 2006; 74(5): 938 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Harris, A. L. Chand, I. M. Winship, K. Gersak, Y. Nishi, T. Yanase, H. Nawata, and A. N. Shelling INHA promoter polymorphisms are associated with premature ovarian failure Mol. Hum. Reprod., November 1, 2005; 11(11): 779 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P N Themmen An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms Reproduction, September 1, 2005; 130(3): 263 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kok, K. M. van Asselt, Y. T. van der Schouw, P. H.M. Peeters, and C. Wijmenga Genetic studies to identify genes underlying menopausal age Hum. Reprod. Update, September 1, 2005; 11(5): 483 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Goswami and G. S. Conway Premature ovarian failure Hum. Reprod. Update, July 1, 2005; 11(4): 391 - 410. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bachelot, G. Meduri, N. Massin, M. Misrahi, F. Kuttenn, and P. Touraine Ovarian Steroidogenesis and Serum Androgen Levels in Patients with Premature Ovarian Failure J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2391 - 2396. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kok, N. C. Onland-Moret, K. M. van Asselt, C. H. van Gils, Y. T. van der Schouw, D. E. Grobbee, and P. H.M. Peeters No association of estrogen receptor {alpha} and cytochrome P450c17{alpha} polymorphisms with age at menopause in a Dutch cohort Hum. Reprod., February 1, 2005; 20(2): 536 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gersak, S. E. Harris, W. J. Smale, and A. N. Shelling A novel 30 bp deletion in the FOXL2 gene in a phenotypically normal woman with primary amenorrhoea: Case report Hum. Reprod., December 1, 2004; 19(12): 2767 - 2770. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Massin, A. Gougeon, G. Meduri, E. Thibaud, K. Laborde, C. Matuchansky, E. Constancis, M.C. Vacher-Lavenu, B. Paniel, J.R. Zorn, et al. Significance of ovarian histology in the management of patients presenting a premature ovarian failure Hum. Reprod., November 1, 2004; 19(11): 2555 - 2560. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mizrachi and D. L. Segaloff Intracellularly Located Misfolded Glycoprotein Hormone Receptors Associate with Different Chaperone Proteins than Their Cognate Wild-Type Receptors Mol. Endocrinol., July 1, 2004; 18(7): 1768 - 1777. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ji, C. Lee, M. Jeoung, Y. Koo, G. A. Sievert, and T. H. Ji Trans-Activation of Mutant Follicle-Stimulating Hormone Receptors Selectively Generates Only One of Two Hormone Signals Mol. Endocrinol., April 1, 2004; 18(4): 968 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
|