help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seong, J. Y.
Right arrow Articles by Kim, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seong, J. Y.
Right arrow Articles by Kim, K.
Molecular Endocrinology 13 (11): 1882-1895
Copyright © 1999 by The Endocrine Society

Enhanced Splicing of the First Intron from the Gonadotropin-Releasing Hormone (GnRH) Primary Transcript Is a Prerequisite for Mature GnRH Messenger RNA: Presence of GnRH Neuron-Specific Splicing Factors

Jae Young Seong, Sungjin Park and Kyungjin Kim

Department of Molecular Biology and Research Center for Cell Differentiation Seoul National University Seoul 151–742, Korea


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The rat GnRH gene consists of four short exons (denoted 1, 2, 3, and 4) and three introns (A, B, and C). All three introns are spliced from the primary transcript, resulting in a mature mRNA. Northern blot and RT-PCR analyses showed that the GnRH primary transcript and its splicing intermediates are more prevalent than the mature GnRH mRNA in a variety of non-GnRH-producing tissues. To delineate the possible splicing mechanism of introns, an in vitro HeLa splicing system was used. Introns B and C were efficiently spliced, while intron A spanning between exon 1 and exon 2 was not. The retention of intron A was relieved when the 5'- and/or 3'-splice sites of intron A were point mutated based on the consensus sequence. The splicing activity was even more strengthened when a putative branchpoint site was moved to the upstream region of the pyrimidine tract of intron A. Intron A could be partially spliced when whole exons (2, 3, and 4) were linked up with intron A. There are two putative exonic splicing enhancers (ESEs) in exon 3 and exon 4. The ESE on exon 4 (ESE4) is much stronger than that on exon 3. The closer the ESE4 to the 3'-splice site of intron A, the better the splicing activity became. However, in the presence of the nuclear extract from GnRH neurons, there was an enhancement in the splicing activity notwithstanding the distance between ESE4 and 3'-splice site of intron A. These results suggest that the ESE4 functions as both the constitutive and regulated enhancer. Collectively, our study provides evidence that enhanced splicing of intron A by putative GnRH neuron-specific splicing factor(s) interacting with the ESEs is a prerequisite for mature GnRH synthesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GnRH is a key hypothalamic neuropeptide controlling mammalian reproduction and sexual development. The rat GnRH gene consists of four short exons and three large introns (1, 2). In the preoptic area (POA) of the rat, all three GnRH introns are spliced from the primary gene transcript (~4,300 bases), resulting in a mature mRNA of about 560 bases. However, despite a low level expression, the mature GnRH mRNA has been detected in numerous extrahypothalamic tissues such as the pituitary, ovary, lymphocytes, and certain brain regions (3, 4, 5, 6). GnRH RNA species retaining the intron A are expressed in human and monkey reproductive tissues (7, 8), and the GnRH primary transcript appears to be more prevalent than the mature mRNA in the rat ovary (9). Recently, Zhen et al. (10) demonstrated that there are alternative GnRH splicing variants in the mouse olfactory, hypothalamus, and immortalized GnRH cell lines (Gn11 and NLT).

Roberts and colleagues (11, 12, 13) found a relatively high prevalence of the GnRH primary transcript and its splicing intermediates in the rat and mouse POA (10–20% of the total gene transcript). In addition, the rat basal olfactory area, which contains a small amount of GnRH neurons, showed about 40% of molar ratio of the primary transcript vs. cytoplasmic mRNA and had a similar amount of the primary transcript compared with that of the POA (11). In contrast to the tissues, in immortalized GnRH-producing cells (GT1), the primary transcript and its splicing intermediates make up less than 2% of the total GnRH gene transcripts (12). The discrepancy of why the tissues contain unusually high portions of splicing intermediates is not yet clearly understood. In the present study, we found that although a variety of neural and peripheral tissues expressed much smaller amounts of the mature mRNA than in the POA, they expressed similar amounts of the GnRH primary transcript and its splicing intermediates. Together with the previous results, this result suggests the possibility that splicing intermediates may be arrested in the splicing process in non-GnRH-producing tissues and that some unspliced GnRH transcripts in the POA may originate from non-GnRH-producing cells. Since accurate and efficient splicing is obviously critical for maintaining the normal function of GnRH-producing cells, in the present study, we examined the splicing arrest of the GnRH primary transcript in non-GnRH-producing tissues and whether this arrest could be relieved by the GT1 nuclear extract (NE).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Presence of GnRH Splicing Intermediates in a Variety of Tissues
Using an antisense GnRH riboprobe, Northern blot analysis for the GnRH transcript in a variety of tissues was performed. Short-term exposure (3 days) of the hybridized membrane showed an exclusive expression of the mature GnRH mRNA in the POA, which is known to contain GnRH-producing cells (14) (Fig. 1AGo). Long-term exposure (2 weeks) revealed additional signals of the mature GnRH mRNA in the olfactory bulb (OB) and piriform cortex (PC) (Fig. 1BGo). Interestingly, several putative GnRH splicing intermediates longer than mature mRNA were seen in most tissues examined. To further define the putative GnRH splicing intermediates in these tissues, RT-PCR analyses with several sets of primers were performed. To exclude the possible DNA contamination, we used deoxyribonuclease (DNase)-treated RNA samples, and PCR reaction without RT showed no DNA or other contamination in all tissues examined (data not shown). When the RT-PCR was performed with e1-up primer located at the 5'-end of the first exon and e3-down primer near the 3'-end of the third exon, the mature GnRH mRNA signals were strongly observed in the POA, OB, and PC, which is consistent with the Northern data. In other tissues, the faint mature GnRH mRNA signals were also detected. In addition, a longer putative GnRH splicing intermediate was detected in several tissues. To identify this putative GnRH splicing intermediate, PCR products were applied to Southern hybridization with the GnRH cDNA, intron A, or intron B probes, respectively. The GnRH cDNA probe hybridized with both the mature mRNA and the longer PCR product while intron A probe hybridized only with the longer one. No hybridization signals were observed in any tissues when intron B probe was used (Fig. 2AGo). These results, confirmed by DNA sequencing analysis, indicate that the splicing intermediate contains intron A but not intron B, hence the 1A23 fragment. When the RT-PCR was carried out with the iB-up primer located in intron B and e4-down primer located in exon 4, two types of splicing intermediates were observed (Fig. 2BGo). These PCR products were subjected to Southern blot hybridization with GnRH cDNA, intron B, or intron C probes, showing that the long intermediate contains introns B and C, and the shorter one contains intron B but not intron C.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 1. Northern Blot Analysis of GnRH Transcripts in a Variety of Tissues

Total RNAs were extracted by acid guanidinium-phenol-chloroform method. Thirty micrograms of total RNA were loaded, electrophoresed in a 1.2% formaldehyde gel, and transferred to a Nytran membrane. The hybridization was performed using 32P-labeled GnRH complementary RNA. Membrane was exposed to x-ray films for 3 days (panel A) and 2 weeks (panel B). 18S RNA hybridization is seen in panel C. The arrows and arrowheads indicate mature GnRH mRNA and putative splicing intermediates, respectively.

 


View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR and Southern Blot Analyses

Total RNAs from various tissues as shown in Fig. 1Go was applied to RT-PCR analyses with several primer sets (panel A, e1-up and e3-down; panel B, iB-up and e4-down; panel C, iA-up and e3-down). To verify the putative GnRH splicing intermediates, these PCR products were subjected to Southern blot hybridization with the GnRH cDNA, intron A, intron B, or intron C. The numbers 1–11 are the same as shown in Fig. 1Go. Arrows to the right side of panel indicate expected PCR products whose structure and size are shown in diagrams. Unknown bands in panel B seem to be PCR artifacts.

 
One interesting finding is that the splicing intermediate containing intron A was prevalent in all tissues except the POA as shown in Fig. 2AGo. Low level expression of this splicing intermediate in the POA may be due to PCR competition. Because in the POA the mature mRNA is much more abundant than other splicing intermediates, only the mature mRNA may be strongly amplified. This is supported by data in Fig. 2CGo showing similar expression levels of the splicing intermediate (A23 fragment) among the tissues when iA-up and e3-down primers were used. Furthermore, from the difference in the ratio of the mature mRNA to the splicing intermediates among the POA and other tissues, it can be speculated that the splicing process of premature GnRH splicing intermediates may be arrested or minimally active in non-GnRH-producing tissues.

Intrinsic Splicing Weakness of GnRH Intron A
To examine the splicing activity of each GnRH intron, splicing substrates containing each intron and its neighboring exons were constructed. Unnecessary inner regions of the introns were partially truncated (these were denoted 1{Delta}A2, 2{Delta}B3, and 3{Delta}C4, respectively), due to the sizes of native introns being too long to be easily transcribed in vitro. Since the HeLa nuclear extract (NE) contains the general splicing machinery, the HeLa NE has been used to investigate the splicing mechanism of RNAs derived even from different species such as fly, chicken, and mouse (15, 16, 17). HeLa NE can also serve as a control NE compared with other NE containing specific splicing factors (17). Application of 2{Delta}B3 and 3{Delta}C4 RNA transcripts produced spliced exons (Fig. 3Go) and their splicing lariats, indicating that introns B and C could be efficiently spliced by the HeLa NE. However, 1{Delta}A2 could not be or was marginally spliced in this system (Fig. 3Go). This result suggests the weakness of the GnRH intron A splice sites. Note that spliced RNAs and their splicing lariats were identified by RNA size markers and running on higher percentage gels. Spliced RNAs were also confirmed by RT-PCR. There were several unexpected bands that appear to be cryptic splicing intermediates (see Fig. 3Go and following figures).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. In Vitro Splicing Activity of GnRH Introns

The 32P-labeled RNA substrates consisting of each GnRH intron and its neighboring exons were synthesized by in vitro transcription. The RNAs purified from the 6% polyacrylamide gels containing 8 M urea were incubated with HeLa NE as described in Materials and Methods. The products were electrophoresed on the 6% polyacrylamide gels containing 8 M urea and then subjected to autoradiography. RNA substrates are shown at the top of the gels, and the time of incubation is specified at the top of each lane. Illustrated RNA structures in the right sides of gels were identified by RNA size markers and running on higher percentage gels. Spliced RNA (exon-exon) was confirmed by RT-PCR using gel-purified RNAs. Other bands in this and following figures are cryptic splicing intermediate(s). The schematic diagram on the bottom panel shows the restriction map of the GnRH gene and RNA substrates. The size of substrates containing each intron and their spliced products are shown in parentheses.

 
A critical step in the splicing process appears to be the initial recognition of the correct pairs of the 5'- and 3'-splice sites by the splicing apparatus (18, 19). The 5'-consensus sequence is GURAGU, whereas the 3'-consensus contains a polypyrimidine tract followed by CAG (YnNCAG). The branchpoint sequence (BPS) located in the upstream region of the pyrimidine tract is also regarded as a part of the 3'-consensus (YNRAY) (20, 21). Based on the sequence analyses of the 5'- and 3'-splice site of intron A, we speculated that the 5'- and/or 3'-splice sites of intron A are very weak compared with those of intron B and C. To examine which splice site is the limiting factor in the splicing activity of intron A, the 5'- and 3'-splice sites were point mutated toward consensus sequence. Two mismatches of the 5'-splice site (GUAAAA) were replaced by GUAAGU. Three of G bases on the pyrimidine tract were changed to C and one U on anchoring site was changed to C in the 3'-splice site mutation. Furthermore, in the BPS mutation, a possible BPS of intron A was moved to the upstream region of the pyrimidine tract. While the mutation of 5'-splice site resulted in a slight effect, the mutation of 3' and/or 5' produced more significant effects. When the BPS was moved to the upstream region of pyrimidine tract, the most efficient splicing effect was observed (Fig. 4Go). These results imply that the low splicing activity of intron A may be due to the intrinsic weakness of the 3'-splice site of intron A, resulting in an arrest of splicing intermediates such as 1A234 seen in Fig. 2AGo. However, it cannot be concluded that splicing of intron A is nonexistent in non-GnRH-producing tissues, since Fig. 2AGo showed that low-level expression of the mature GnRH mRNA was observed even in non-GnRH-producing tissues. Therefore, PCR data shown in Fig. 2AGo are in part inconsistent with the in vitro splicing result in which no splicing of intron A was seen. A recent report demonstrated that suboptimal 5'- and 3'-splice sites cause retention of an intron in bovine GH pre-mRNA and that the efficient splicing of this intron is ensured by the presence of a purine-rich exonic splicing enhancer (22, 23). This postulates that enhancer-like activity of other exons (exons 3 and 4) may enhance splicing of intron A when these exons are connected to exon 2.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Site-Directed Mutation of the 5'- and 3'-Splice Sites of Intron A

The schematic diagram shows the consensus sequence of the 5'- and 3'-splice site and mutated RNA substrates. Two bases (GUAAAA) of the 5'-splice site were changed to GUAAGU. In the 3'-splice site mutation, three G were changed to C, and one U is replaced by C as indicated by bold and underlined characters. In the BPS mutation, the putative BPS within the pyrimidine tract is disrupted and moved to upstream region of the pyrimidine tract. Splicing reaction was performed for 3 h in HeLa NE. RNA size markers are shown to the left of the gel, and structures of the RNAs are illustrated on the right.

 
Activation of Intron A Splicing by the Exonic Splicing Enhancers in Exon 3 and Exon 4
The sequence analysis of the GnRH exons revealed that there are two purine-rich sequences on exon 3 (ATGGGCAAGGAGGAGGA) and exon 4 (GAAGAGGAA-GCUGGGCAGAAGAAGA) that are homologous to the exonic splicing enhancer (ESE) (24). To examine the possible enhancer-like activities of exon 3 and exon 4, the cDNA of p1{Delta}A234 was digested by several restriction enzymes (HincII, SfuI, SacI, or BamHI) (Fig. 5Go), and their RNA transcripts were applied to the splicing reaction. Although little of 1{Delta}AH was spliced, others (1{Delta}ASf, 1{Delta}ASc, and 1{Delta}ABam) that contain exon 3 and/or exon 4 showed a slightly increased splicing (Fig. 6Go). To further delineate the possible role of ESEs in exon 3 (ESE3) and exon 4 (ESE4) in the splicing activity, we connected each ESE to the 3'-splice site of intron A. Placing the ESE3 close to the 3'-splice site (1{Delta}A(CC)Sf) showed a very slight splicing effect. The weaker splicing of 1{Delta}A(CC)Sf compared with 1{Delta}ASf or 1{Delta}ASc was unexpected. However, it is possible that when exon 3 joins to exon 2, the ESE3 directly links to the five purine bases (AAGAG) at the 3'-end of exon 2 and strengthens the ESE3. 1{Delta}A(CSc)Bam containing only the ESE4 showed increased activities (Fig. 7AGo). In 1{Delta}A(CSc)Bam, although the distance between ESE4 and intron A is longer than that in 1{Delta}A(CC)Bam, similar splicing activity was detected, which may be due to the strong activity of the ESE4 and/or an additive effect of the ESE3 and ESE4. To examine the role of ESE4 in the absence of ESE3, p1{Delta}A234 was digested with HincII in exon 2 and SfuI or SacI site in exon 3. These gene constructs thus lack ESE3, and the distance between ESE4 and intron A 3'-splice site of 1{Delta}ABam (251 bases) was shortened to 112 bases or 58 bases in 1{Delta}A(HSf)Bam and 1{Delta}A(HSc)Bam RNA, respectively. Application of these RNA transcripts showed that shortening the distance between the 3'-splice site of intron A and the ESE4 led to an increase in splicing activity and that ESE4 alone was strong enough for enhancing the intron A splicing (Fig. 7BGo). These results indicate that the ESEs located in exon 3 and exon 4 may participate in the splicing of intron A, and such a partial splicing of intron A from the 1A234 may account for the extremely low-level expression of the mature GnRH mRNA in non-GnRH-producing cells (Fig. 2Go). However, this result could not explain the mechanism by which GnRH neurons efficiently splice intron A from splicing intermediates.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Schematic Diagram of RNA Substrates Used in Figs. 6–11GoGoGoGoGoGo

The presumptive ESEs are indicated by gray and black boxes, and their sequences are shown above the RNA structure. Note that ClaI sites shown in 5'-ends of exon 2 and 3 were artificially made to truncate exon 2, although the normal DNA sequence does not contain the ClaI sites. These ClaI sites happen only in the RNA constructs, 1{Delta}A(CC)Sf, 1{Delta}A(CSc)Bam, 1{Delta}A(CC)Bam. EcoRI site at the end of exon 4 originates from the vector. All details in regard to DNA construction and RNA substrates are shown in Materials and Methods. The sizes of pre-RNA and its spliced products are shown in parentheses.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Effect of the Presumptive ESEs on Intron A Splicing

In the DNA construct, p1{Delta}A234, ESEs located in exon 3 and exon 4, and restriction enzyme sites are shown in the schematic diagram. To examine the possible enhancer-like activities of exon 3 and exon 4, the cDNA of p1{Delta}A234 was digested by several restriction enzymes (HincII, SfuI, SacI, or BamHI), and their in vitro transcribed RNAs were incubated in HeLa NE for 3 h. Arrowheads indicate the spliced products.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. Distance-Dependent Activity of the ESE4

To examine the distance dependency of the ESEs, the distance between the ESEs and 3'-splice site was shortened. Using the artificially made ClaI sites in the 5'-end of exons 2 and 3, most of exon 2 sequences were deleted (p1{Delta}A(CC)34), and the digestion with ClaI and SacI produced the p1{Delta}A(CSc)4. The p1{Delta}A(CC)34 was digested by SfuI and BamHI, generating the 1{Delta}A(CC)Sf and 1{Delta}A(CC)Bam substrate RNAs, respectively. The digestion of the p1{Delta}A(CSc)34 with BamHI made 1{Delta}A(CSc)Bam RNA (panel A). The cDNA construct lacking the ESE3 was made by the digestion of p1{Delta}A234 with HincII and SfuI or SacI sites, producing 1{Delta}A(HSf)Bam and 1{Delta}A(HSc)Bam, respectively (panel B). The putative ESEs were also shown in exon 3 and exon 4. Arrowheads indicate the spliced products.

 
Presence of GT1-Specific Splicing Factor(s) Acting on the ESE of Exon 4
It can be postulated that GnRH neurons possess unique splicing factors that act on the ESEs to enhance the splicing of intron A. To examine this possibility, we isolated crude NEs from the hypothalamic GT1 neuronal cells, which are well known GnRH-producing neurons (25), and applied this GT1 NE to the splicing reaction. First, the 1{Delta}ABam RNA that contains two ESEs was examined in the absence or presence of GT1 NE. Because of the difficulty in obtaining a high concentration of GT1 NE, we were unable to totally replace HeLa NE with GT1 NE at the same concentration. Rather, we retained the total volume (10 µl) but replaced HeLa NE (50 µg) with 10 or 20 µg of GT1 NE as shown in Fig. 8Go. Although we did not use a constant concentration of NE, we found that this replacement drastically increased splicing activity of 1{Delta}ABam in a dose-dependent manner, but not in 3{Delta}C4Bam construct (please compare A and B in Fig. 8Go). This result shows that GT1 NE specifically recognizes the 1{Delta}ABam structure rather than 3{Delta}C4Bam. When 3{Delta}C4Bam RNA in which the ESE4 is close to the 3'-splice site was subjected, GT1 NE did not show an additive effect on splicing activity of 3{Delta}C4Bam RNA, but rather slightly decreased the splicing activity (Fig. 8BGo). Although the reason for the lack of increase in splicing of 3{Delta}C4Bam by GT1 NE is not clear, GT1 NE would not be required for the splicing process of highly conserved 3'-splice site such as intron C.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 8. Enhanced Splicing of Intron A in the Presence of the GT1 NE

To examine the possible participation of some splicing factors from GnRH-producing cells in GnRH pre-RNA splicing, the GT1 NE was isolated and added to the splicing reaction. The RNA substrate containing exon 1 and intron A followed by exons 2, 3, and 4 (1{Delta}ABam) was used because this RNA is mostly arrested in nonspecific tissues and consists of the putative ESEs (A). Right panel shows the effect of GT1 NE on the ESE4 when the ESE4 is near the 3'-splice site of intron A. As RNA substrate, 3{Delta}C4Bam was used in panel B. In this experiment, a half-volume (5 µl) of HeLa NE (50 µg) was used in the splicing reaction, and another half was replaced by NE storage buffer, 10 µg, or 20 µg of the GT1 NE as shown at the top of the gels. Splicing reaction was performed for 3 h. Structures of the RNAs are illustrated to the right of the gel.

 
To examine the specific action site of the GT1 NE, 1{Delta}AH, 1{Delta}ASf, 1{Delta}ASc, and 1{Delta}ABam RNA were employed to the splicing reaction in the presence of GT1 NE. Adding the GT1 NE increased the splicing activity of only 1{Delta}ABam RNA, but not in other RNAs (Fig. 9Go). This result indicates that putative regulatory splicing factor(s) from the GT1 NE specifically interacts with the ESE4 even though the ESE4 is located far from the 3'-splice site of intron A. We also examined whether enhanced splicing activity of 1{Delta}ABam RNA is due to ESE4 alone or a combinational effect of ESE4 and neighboring ESE3. Splicing activities of pre-mRNAs containing ESE3 and ESE4 (1{Delta}ABam, 1{Delta}A(CC)Bam) and containing ESE4 alone (1{Delta}A(CSc)Bam, 1{Delta}A(HSf) Bam, and 1{Delta}A(HSc)Bam) in the presence or absence of GT1 NE were examined. Complementation of GT1 NE increased the splicing activity of all constructs (Fig. 10Go), indicating that ESE4 alone is enough for interaction with GT1 NE. To further elucidate the role of ESE3 and ESE4 in intron A splicing, we mutated some purines to pyrimidines as shown in the diagram in Fig. 11Go. Mutation in ESE3 reduced the intron A splicing, suggesting a possible additive effect of ESE3 with the combination of ESE4 on intron A splicing. Mutations in ESE4 were much more effective than ESE3 mutation, and there was no difference in mutation effect between ESE4 mutations, indicating that ESE4 sequence is very specific, and thereby changes in some purine bases critically disrupted ESE4 activity (Fig. 11Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 9. The GT1 Nuclear Extract (NE) Specifically Acts on the ESE4

To examine the specific action site of the GT1 NE on the GnRH exons, the RNA substrates from the p1{Delta}A234 digested by several restriction enzymes (HincII, SfuI, SacI, or BamHI) were applied to splicing reactions. In lanes 1–4, 10 µl of HeLa NE (100 µg) were used and in lanes 5–8, 5 µl of HeLa (50 µg) and 5 µl of GT1 NE (20 µg) were used. Arrowheads indicate the spliced products. RNA structures are illustrated between the gels.

 


View larger version (52K):
[in this window]
[in a new window]
 
Figure 10. GT1 Nuclear Extract (NE) Further Increases Intron A Splicing in the Presence of ESE4 Regardless of Distance between ESE4 and 3'-Splice Site of Intron A

Splicing activities of pre-mRNAs containing ESE3 and ESE4 (1{Delta}ABam, 1{Delta}A(CC)Bam) and containing only ESE4 (1{Delta}A(CSc)Bam, 1{Delta}A(HSf)Bam and 1{Delta}A(HSc)Bam) were examined in the presence or absence of GT1 NE. For the control, 100 µg of HeLa NE were used (lanes 1, 3, 5, 7, and 9) and, to examine GT1 NE effect, splicing reactions were carried out in the mixture of 50 µg HeLa and 20 µg GT1 NE (lanes 2, 4, 6, 8, and 10). Arrowheads indicate the spliced products.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 11. Mutations in ESE3 and ESE4 Significantly Reduce Intron A Splicing

Some purines of ESE3 or ESE4 were changed to pyrimidines as indicated by the diagram. 1{Delta}ABam RNA and mutated RNAs were incubated in a HeLa (50 µg) and GT1 (20 µg) nuclear extract mixture for 3 h at 30 C.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The present study demonstrated that the GnRH primary transcript and its splicing intermediates are illegitimately transcribed in a variety of classically non-GnRH-producing tissues, and that the extremely low level of the mature GnRH mRNA, as compared with its premature splicing intermediates, is most likely due to a weakness of the intron A splice sites. Furthermore, we showed that splicing of intron A can partially occur with the help of the ESEs on GnRH exons and that a certain splicing factor derived from GT1 NE acts on the ESE of exon 4 to enhance the splicing activity of intron A. These results strongly suggest that the enhanced splicing activity of intron A is a prerequisite for mature GnRH mRNA production.

The low level transcription of GnRH mRNA as well as its unspliced transcripts has been demonstrated in several neural and peripheral tissues by the sensitive RT-PCR method (3, 4, 5, 6, 7, 8, 9). Figures 1Go and 2Go show that among splicing intermediates a very small portion appears to undergo further processing to mature mRNAs in non-POA tissues, which are detectable by the RT-PCR method. Although the biological role of such a low-level expression of mature mRNA in non-POA tissues remains to be investigated, several reports have suggested that they contribute to produce local GnRH peptides that are involved in autocrine and/or paracrine regulation in several tissues, such as pituitary, gonads, spleen, and the olfactory system (3, 4, 5, 6, 9). We cannot rule out the possibility that some part of intermediates would be released into the cytoplasm without further processing to mature GnRH mRNA (7, 8). Although a number of studies on GnRH transcript retaining intron A or lacking exon 2 have been published, their biological consequence has been poorly understood (2, 7, 8, 10).

One interesting finding of the present study is that the GnRH primary transcript and splicing intermediates are more prevalent than the mature GnRH mRNA in non-GnRH-producing tissues. This result may be closely related to the unusually high portion of the GnRH primary transcript and its splicing intermediates in the animal POA when compared with GT1 cells showing less than 2% of the premature splicing intermediates (11, 12, 13). One possible explanation for the discrepancy between GT1 cells and animal tissues is that more than 10% of the premature splicing intermediates in the POA may originate from non-GnRH-producing cells in the POA because other tissues also express premature splicing intermediates. According to the in vitro splicing finding that intron A, but not intron B and C, is poorly spliced, a predominant accumulation of 1A234 RNA in vivo would be predicted. Surprisingly, as revealed by Northern blot analysis, it is not the case; rather, there are many splicing intermediates (Fig. 1Go). Currently we do not have a clear explanation for this result. It is difficult to reconcile in vitro data with an in vivo situation. It is, however, possible that the arrest of intron A splicing may cause a rapid degradation of this splicing intermediate. Indeed, several investigators have described that nuclear posttranscriptional regulation involves changes in the stability and accumulation of primary or unspliced transcripts (26, 27, 28). One recent report showed that a large portion of the unspliced RNA is degraded before processing and transport to the cytoplasm without changes in transcriptional rate in certain conditions (29). It appears that the lack of predominant accumulation of 1A234 RNA is likely due to degradation of these intermediates. However, this possibility remains to be examined.

Recently, GnRH splicing variants containing intron A have been found in the human placenta and monkey reproductive tissues (7, 8), along with alternative GnRH splicing variants with deletion of the exon 2 in the OB and caudal hypothalamus (10). The present study showed a lesser splicing activity of intron A than those of introns B and C. Based on the consensus sequence of splice sites (15), the 5'-sequence of intron A shows two base mismatches, and the 3'-splice site has many purines within the polypyrimidine tract. More importantly, a putative BPS exists within the polypyrimidine tract, although usually the BPS locates the upstream region of the polypyrimidine tract. Recognition of the polypyrimidine tract by U2 auxiliary factor (U2AF) is essential for the binding of U2 small nuclear ribonucleoprotein (snRNP) with the BPS (30). One of the splicing factors, BBP (branchpoint bridging protein), can also interact specifically with the pre-mRNA BPS (21). The increased splicing activity of intron A, when BPS was moved to the upstream region of the pyrimidine tract, may raise the possibility of steric hindrance among U2 snRNP, U2AF, BBP, and other splicing factors in the splicing of intron A. However, this possibility should be further examined. Together with this BPS switch experiment, increased splicing activity of intron A when intron A was point-mutated to strengthen the 5'- and 3'-splice site apparently indicates the intrinsic weakness of the intron A splice sites.

Sequence analysis of GnRH exons 3 and 4 revealed that there are two purine-rich sequences, one located in the 5'-region of exon 3 and the other located in the 5'-region of exon 4. The purine-rich sequences are well known splicing enhancers that exist within exon sequences located downstream from introns containing a weak 3'-splice site in a variety of eukaryotic RNAs (15, 31, 32). The enhancers can increase the splicing activity of a weak intron without the aid of specific splicing factor(s), depending on its distance from the 3'-splice site: they must be located within 100 nucleotides of the regulated intron (15). The ESE3 appears to be very weak because shortening the distance between the ESE3 and the 3'-splice site of intron A had little effect on splicing activity. However, the ESE4 is much stronger than the ESE3. The activity of the ESE4 is highly dependent on the distance: the closer the ESE to the 3'-splice site, the stronger the splicing activity became. Usually, enhancer sequences are recognized by general splicing factors, such as SR proteins and U1 snRNP. The interaction of general splicing factors with the enhancer is enough to strengthen the binding of U2AF to the polypyrimidine tract resulting in an efficient splicing of the weak intron when the enhancer is near the 3'-splice site (18, 32). More importantly, efficient splicing activity was observed despite the long distance between ESE4 and the 3'-splice site of intron A (~250 bases) in the presence of GT1 NE. This finding suggests that some specific splicing factor(s) in GT1 NE are required to maintain the ESE activity because of the long distance from the ESE to intron A. The regulatory protein-dependent splicing activity of the enhancer sequence was shown in Drosophila doublesex (dsx) gene whose alternative splicing relies on the specific splicing factors, Tra and Tra2 (15). Recently, a neuron-specific splicing enhancer-binding protein has been identified (17) along with neuron-specific RNA-binding proteins, Hu proteins (33). Interestingly, Hu proteins showed strong homology with the Drosophila splicing factor sxl, and expression of Hu gene products revealed developmental stage specificity and different spatial distribution in the central nervous system. It was also suggested that different combinations of Hu proteins in individual neurons determine different neuron-specific aspects of posttranscriptional RNA regulation (33). These findings raise the possibility that there is a GnRH neuron-specific splicing system and associated specific splicing factors.

It is also notable that the GnRH gene uses the ESE4 to facilitate the splicing of intron A, since other ESEs are usually located downstream of the neighboring intron (24, 32). Thus, the ESE4 may not be active in the primary transcript status, but following the splicing of introns B and C from the primary transcript, ESE4 may act on the intron A splicing. Therefore, it can be assumed that there is a specified order in the GnRH transcript splicing system. Enhanced splicing activity by the interaction of GnRH neuron-specific splicing factor(s) to the ESE seems to take place in a certain condition especially when the 3'-splice site is weak. Failure of enhanced splicing of 3{Delta}C4Bam pre-mRNA with GT1 NE indicates that such an interaction between GnRH neuron-specific splicing and ESE4 appears not to be required for the splicing of introns that show highly conserved 3'-splice site like intron C. It is postulated that the proper and temporal association of the specific splicing factor(s) with the ESE4 may be another regulation mechanism to control the efficient splicing of the primary transcript. It is also possible that GT1-specific activity may require the presence of both ESE4 and ESE3. In this case, ESE3 may serve as a bridge for the interaction of ESE4 and a weak 3'-splice site. It remains to be resolved whether GT1-specific splicing factors directly bind to ESE3 and/or ESE4 or to other proteins that are already bound to ESEs.

Mass production of the mature GnRH mRNA by an efficient and accurate splicing process is required for the production of intact GnRH peptide, which is obviously critical for the normal function of GnRH neurons. Therefore, it can be assumed that the presence of the GnRH neuron-specific splicing factor(s) is one of the selection systems to maintain the specificity of GnRH neurons. Issues such as identification of the splicing factors involved in the facilitated splicing of intron A in GnRH-producing cells, and the interaction of splicing factors with GnRH exonic enhancers and their protein-protein-snRNP interaction during the splicing of intron A, should be addressed for the elucidation of splicing mechanisms in the mammalian brain.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals and Tissue Preparation
Adult female Sprague Dawley rats (weighing 200 g) were housed in a temperature-controlled condition under a 14-h light, 10-h dark photocycle (light on at 0600 h) with food and water supplied ad libitum. Rats were killed by decapitation between 1400 and 1600 h. Each brain was removed from the skull and chilled on ice. The POA and other brain regions such as the cortex, OB, PC, brain stem, and cerebellum were sampled. Of the peripheral tissues, the pituitary, ovary, testis, kidney, and adrenal gland were removed. Animal experiments were conducted in accordance with the Guidelines for the Care and Use of Experimental Animals at Seoul National University.

Northern Blot Hybridization Assay
Total RNA was extracted with the acid guanidinium thiocyanate-phenol-chloroform method (34). RNA (30 µg) was dissolved in distilled water and denatured in 50% formamide, 6.2% formaldehyde, 20 mM MOPS (3-[N-morpholino]propanesulfonic acid), 5 mM sodium acetate, and 1 mM EDTA at 60 C for 5 min. Electrophoresis was performed at 100 V for 1.5 h in a submarine 1.2% formaldehyde agarose gel. RNA was transferred to Nytran filter (pore size: 0.45 µm, Schleicher & Schuell, Inc., Dachen, Germany) for 18 h by capillary transfer. The GnRH RNA probe labeled with 32P-UTP (Amersham Pharmacia Biotech, Little Chalfort, UK) was prepared by in vitro transcription of the rat GnRH cDNA clone inserted into plasmid pGEM4, which was generously provided by Dr. Kelly Mayo (Northwestern University, Evanston, IL). Hybridization procedures and rehybridization with 18S cDNA were performed as previously described (35).

Oligonucleotides
e1-up 5'-CACTATGGTCACCAGCGGGG-3' (20 mer) e3-down 5'-AGAGCTCCTCGCAGATCCCTAAGC-3' (24 mer) e4-down 5'-GCTGCTGGGTATAGAAATGCG-3' (21 mer) iA-up 5'-CCCTCTGTGTCTTGATGTCCC-3' (21 mer) iB-up 5'-CATCACTTCTCCACCCCTTG-3' (20 mer)

RT-PCR Analyses
RT-PCR was carried out as previously described (36, 37). RNA samples (1 µg) were applied to the RT reaction mixture containing 200 U of RNaseH- moloney murine leukemia virus (MMLV) reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD), 50 pmol of random hexamer, 20 U of RNase inhibitor (Promega Corp., Madison, WI), 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 5 mM MgCl2, and 1 mM deoxynucleoside triphosphate. The RT mixture was overlaid by 50 µl of light mineral oil. The RT reaction was carried out at 37 C for 30 min followed by a 5-min denaturation period at 99 C. Subsequently, 80 µl of the PCR reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 50 pmol of upstream and downstream primers, and 2.5 U of Taq DNA polymerase (Perkin Elmer Corp., Norwalk, CT) were added. Forty cycles of PCR amplification were carried out with the condition of denaturation at 94 C for 1 min, primer annealing at 60 C for 1 min, and primer extension at 72 C for 2 min. Ten-microliter aliquots of PCR products were electrophoresed on an 1.5% agarose gel in Tris-acetate-EDTA buffer, stained with ethidium bromide, and photographed under UV illumination with Polaroid 667 film (Polaroid, Cambridge, MA).

Southern Blot Hybridization
After rinsing with bidistilled water, the gel was soaked in 0.5 M NaOH, 1 M NaCl solution for denaturation of double-strand DNA followed by resoaking in 0.5 M Tris-HCl (pH 7.4), 1.5 M NaCl solution for neutralization. The DNA was then blotted onto Nytran membrane by capillary transfer method. The Nytran membrane was prehybridized in 50% formamide, 10 x Denhardt solution, 6 x SSPE, 1% SDS, 50 µg/ml salmon sperm DNA. Hybridization was carried out overnight at 42 C in the same buffer including 32P-labeled probes. The membrane was washed twice in 6x SSPE, 0.5% SDS at room temperature for 15 min and twice in 1x SSPE, 1% SDS at 42 C for 15 min. The washed filter was exposed to x-ray film at -70 C for 1 day (36). The probes used in this study are: the intron A probe made by cutting HincII and PstI sites in the intron A; the intron B probe containing the DNA fragment from iB-up primer to SacI site in intron B; the intron C probe consisting of the SacI site in the 3'-end of exon 3 to the NcoI site in intron C; and the GnRH cDNA probe containing all exons.

DNA Constructions and In Vitro Splicing Substrates
The GnRH DNA fragment containing exon 1, intron A, exons 2 and 3 (1A23) was obtained by RT-PCR with e1-up and e3-down primers and subsequently cloned into the pGEM-T vector (Promega Corp.) (This gene construct was denoted as p1A23.) DNA fragment 1A23Sf obtained by digestion with SphI and SfuI from p1A23 was cloned into the p1234 digested with SphI and SfuI, generating p1A234. Subsequently, StyI and PstI sites within intron A were digested and ligated, resulting in p1{Delta}A234. This plasmid was linearized by HincII, SfuI, SacI, or BamHI and used as a template for in vitro transcription. In vitro transcribed RNAs from these templates were denoted as 1{Delta}AH, 1{Delta}ASf, 1{Delta}ASc, and 1{Delta}ABam, respectively (Fig. 5Go). To shorten the distance of the ESEs from the 3'-splice site of intron A, we artificially made ClaI sites near (3 bases from 5'-end) the 5'-end of exon 2 and the 5'-end of exon 3. This was cut by ClaI and ligated, which resulted in a truncation of most of exon 2 (denoted as p1{Delta}A(CC)34). The p1{Delta}A(CC)34 was further digested by ClaI and SacI and ligated to make p1{Delta}A(CSc)4. The p1{Delta}A(CC)34 was linearized by SfuI or BamHI, whose in vitro transcript was 1{Delta}A(CC)Sf or 1{Delta}A(CC)Bam. The p1{Delta}A(CSc)4 was linearized by BamHI, resulting in the 1{Delta}A(CSc)Bam RNA transcript (Fig. 7AGo). The p1{Delta}A234 was digested with HincII and SacI, and ligated, generating the p1{Delta}A2(HSc)4. The p1{Delta}A234 was digested with HincII and Sfu1, which produced the p1{Delta}A2(HSf)34. These plasmids were linearized by BamHI, producing 1{Delta}A(HSc)Bam and 1{Delta}A(HSf)Bam RNA transcripts, respectively (Fig. 7BGo). The A2B3 DNA was obtained by PCR from rat brain genomic DNA with iA-up and e3-down primers and cloned into the pGEM-T vector (denoted as pA2B3). EcoRI site in the middle of intron B was cut, and this linearized DNA was treated with the ExoIII nuclease and S1 nuclease followed by ligation, generating the pA2{Delta}B3. The HincII site in exon 2 and SacI site in exon 3 were cut, and this DNA fragment was subcloned into the pGEM4Z vector, resulting in the p2{Delta}B3. Using iB-up and e4-down primers, the pB3C4 was cloned. Intron B and a part of exon 3 were removed by digestion with ApaI and SfuI (p3C4). This clone was further digested by PstI and NcoI to remove the inner part of intron C, generating the p3{Delta}C4 (Fig. 3Go). Site-directed mutation of the 5'- and 3'-splice site of intron A was performed by PCR with mutated primers. The sequence of the 5'-splice site of intron A (GUAAAA) was substituted to GUAAGU (1{Delta}A(5'm)H) and the sequence of the 3'-splice site (UGUGUCUUGAUGUCCCUUAG) was replaced by UCUCUCUUGAUCUCCCUCAG (1{Delta}A(3'm)H). Mutation of both sites was denoted as 1{Delta}A(5'3'm)H. The 1{Delta}A(3'mBPS)H RNA has a sequence of UACUGAUCCCUCUCUCUCUUUUUCUCCCUCAG. Underlines show the changed bases from the 1{Delta}A(3'm)H, and bold characters indicate the BPS (Fig. 4Go). Site-directed mutation of the ESE3 and ESE4 was performed by PCR with mutated primers as shown in diagram of Fig. 11Go. All the final products were sequenced by Sanger dideoxy method (Sequenase 2.0, Amersham Pharmacia Biotech).

In Vitro Splicing Reactions
Pre-mRNA substrates were synthesized in 25 µl in vitro transcription reactions containing 200 ng of template DNA, 10 U of T7 RNA polymerase (Roche Molecular Biochemicals, Nutley, NJ), 0.5 mM diguanosinetriphosphate (Roche Molecular Biochemicals), 0.5 mM ATP and CTP, 0.05 mM GTP, 15 µM UTP, and 2.5 µl of [32P]UTP (Amersham Pharmacia Biotech). The RNAs were purified by electrophoresis on a 6% polyacrylamide gel containing 8 M urea. The purified RNA substrates (usually about 20,000 cpm) were applied to the splicing reaction in a total volume of 25 µl containing 5 mM HEPES, pH 7.9, 20 mM creatine phosphate, 0.4 mM ATP, 0.6% polyvinyl alcohol, 3 mM MgCl2, 100 µg HeLa NE, and 20 U RNasin according to the manufacturer’s protocols (Promega Corp.). In the case of replacement experiments in Figs. 8–11GoGoGoGo, the half-volume (50 µg) of HeLa NE was replaced by NE storage buffer, 10 µg or 20 µg of GT1 NE. The splicing reaction was performed at 30 C for 3 h and stopped by the addition of the 2x stop mix containing 0.5% SDS, 2 mM EDTA, 3 µg/ml tRNA, 0.03 M sodium acetate, and 0.03 M Tris-HCl, pH 7.4. After the phenol/chloroform extraction and subsequent ethanol precipitation, the RNAs were analyzed on 6% polyacrylamide gels containing 8 M urea (15).

GT1 NE Preparation
GT1–1 cells (kindly provided by R.I. Weiner, University of California at San Francisco, San Francisco, CA) were maintained in DMEM with 10% FCS under a humidifying atmosphere containing 5% CO2 at 37 C. About 3 x 108 GT1–1 cells were harvested from the cell culture media. The NE was prepared as described by Dignam et al. (38) with a slight modification. Several protease inhibitors (1 µg/ml aprotinin, 0.5 µg/ml leupeptin, 0.7 µg/ml pepstatin A) were included in the normal buffer containing 0.3 M HEPES (pH 7.9), 25% (vol/vol) glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), and 0.5 mM dithiothreitol (DTT). Instead of buffer D, a nuclear storage buffer containing 40 mM Tris-HCl (pH 7.4), 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 25% (vol/vol) glycerol was used. The protein concentration was usually 4–5 mg per ml.


    FOOTNOTES
 
Address requests for reprints to: Kyungjin Kim, Ph.D., Department of Molecular Biology, College of Natural Sciences, Seoul National University, Seoul 151–742, Korea.

The present study was supported in part by the Korea Science and Engineering Foundation (KOSEF) through the Research Center for Cell Differentiation and by Ministry of Science and Technology through Korea Brain Science Program.

Received for publication November 24, 1998. Revision received April 6, 1999. Accepted for publication August 4, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Adelman JP, Mason AJ, Hayflick JS, Seeburg PH 1986 Isolation of the gene and hypothalamic cDNA for the common precursor of gonadotropin-releasing hormone and prolactin-inhibiting factor in human and rat. Proc Natl Acad Sci USA 83:179–183[Abstract/Free Full Text]
  2. Bond CT, Hayflick JS, Seeburg PH, Adelman JP 1989 The rat gonadotropin-releasing hormone: SH locus: structure and hypothalamic expression. Mol Endocrinol 3:1257–1262[Abstract/Free Full Text]
  3. Oikawa M, Dargan C, Ny T, Hsueh AJW 1990 Expression of gonadotropin-releasing hormone and prothymosin-{alpha} messenger ribonucleic acid in the ovary. Endocrinology 127:2350–2356[Abstract/Free Full Text]
  4. Azad N, Emanuele NV, Halloran MM, Tentler J, Kelley M 1991 Presence of luteinizing hormone-releasing (LHRH) mRNA in rat spleen lymphocytes. Endocrinology 128:1679–1681[Abstract/Free Full Text]
  5. Pagesy P, Li JY, Berthet M, Peilon F 1992 Evidence of gonadotropin-releasing hormone mRNA in the rat anterior pituitary. Mol Endocrinol 6:523–528[Abstract/Free Full Text]
  6. Choi WS, Kim MO, Lee BJ, Kim JH, Sun W, Seong JY, Kim K 1994 Presence of gonadotropin-releasing hormone mRNA in the rat olfactory piriform cortex. Brain Res 648:148–151[CrossRef][Medline]
  7. Radovick S, Wondisford FE, Nakayama Y, Yamada M, Cutler Jr GB, Weintraub BD 1990 Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta. Mol Endocrinol 4:476–480[Abstract/Free Full Text]
  8. Dong K-W, Duval P, Zeng Z, Gordon K, Williams RF, Hodgen GD, Jones G, Kerdelhue B, Roberts JL 1996 Multiple transcription start sites for the GnRH gene in rhesus and cynomolgus monkeys: a non-human primate model for studying GnRH gene regulation. Mol Cell Endocrinol 117:121–130[CrossRef][Medline]
  9. Goubau S, Bond CT, Adelman JP, Misra V, Hynes MF, Schultz GA, Murphy BD 1992 Partial characterization of the gonadotropin-releasing hormone (GnRH) gene transcript in the rat ovary. Endocrinology 130:3098–3100[Abstract/Free Full Text]
  10. Zhen S, Dunn IC, Wray S, Liu Y, Chappell PE, Levine JE, Radovick S 1997 An alternative gonadotropin-releasing hormone (GnRH) RNA splicing product found in cultured GnRH neurons and mouse hypothalamus. J Biol Chem 272:12620–12625[Abstract/Free Full Text]
  11. Jakubowski M, Roberts JL 1994 Processing of gonadotropin-releasing hormone gene transcripts in the rat brain. J Biol Chem 269:4078–4083[Abstract/Free Full Text]
  12. Yeo TT, Gore AC, Jakubowski M, Dong KW, Blum M, Roberts JL 1996 Characterization of gonadotropin-releasing hormone gene transcripts in a mouse hypothalamic neuronal GT1 cell line. Mol Brain Res 42:255–262[Medline]
  13. Gore AC, Roberts JL 1997 Regulation of gonadotropin-releasing hormone gene expression in vivo and in vitro. Front Neuroendocrinol 18:209–245[CrossRef][Medline]
  14. Silverman A-J, Livne I, Witkin JW 1994 The gonadotropin-releasing hormone (GnRH) neuronal system: immunocytochemistry and in situ hybridization. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, vol 1:1683–1709
  15. Tian M, Maniatis T 1994 A splicing enhancer exhibits both constitutive and regulated activities. Genes Dev 8:1703–1712[Abstract/Free Full Text]
  16. Sakamoto H, Ohno M, Yasuda K, Mizumoto K, Shimura Y 1987 In vitro splicing of a chicken {delta}-crystallin pre-mRNA in a mammalian nuclear extract. J Biochem 102:1289–1301[Abstract/Free Full Text]
  17. Min H, Turck CW, Nikolic JM, Black DL 1997 A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev 11:1023–1036[Abstract/Free Full Text]
  18. Manley JL, Tacke R 1996 SR proteins and splicing control. Genes Dev 10:1569–1579[Free Full Text]
  19. Shapiro MB, Senapathy P 1987 RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155–7174[Abstract/Free Full Text]
  20. Gozani O, Feld R, Reed R 1996 Evidence that sequence-independent binding of highly conserved U2 snRNP proteins upstream of the branch site is required for assembly of spliceosomal complex A. Genes Dev 10:233–243[Abstract/Free Full Text]
  21. Berglund JA, Chua K, Abovich N, Reed R, Rosbash M 1997 The splicing factor BBP interacts specifically with the pre-mRNA branchpoint sequence UACUAAC. Cell 89:781–787[CrossRef][Medline]
  22. Dirksen WP, Hampson RK, Sun Q, Rottman FM 1994 A purine-rich exon sequence enhances alternative splicing of bovine growth hormone pre-mRNA. J Biol Chem 269:6431–6436[Abstract/Free Full Text]
  23. Dirksen WP, Sun Q, Rottman FM 1995 Multiple splicing signals control alternative intron retention of bovine growth hormone pre-mRNA. J Biol Chem 270:5346–5352[Abstract/Free Full Text]
  24. Tanaka K, Watakabe A, Shimura Y 1994 Polypurine sequences within a downstream exon function as a splicing enhancer. Mol Cell Biol 14:1347–1354[Abstract/Free Full Text]
  25. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  26. Cohen RB, Boal TR, Safer B 1990 Increased eIF-2{alpha} expression in mitogen-activated primary T lymphocytes. EMBO J 9:3831–3837[Medline]
  27. Kiledjan M, Kadesh T 1991 Post-transcriptional regulation of the human liver/bone/kidney alkaline phosphatase gene. J Biol Chem 266:4207–4213[Abstract/Free Full Text]
  28. Song MKH, Dozin B, Grieco D, Rall JE, Nikodem VM 1988 Transcriptional activation and stabilization of malic enzyme mRNA precursor by thyroid hormone. J Biol Chem 263:17970–17974[Abstract/Free Full Text]
  29. Meskini RE, Boudouresque F, Ouafik L 1997 Estrogen regulation of peptidylglycine {alpha}-amidating monooxygenase messenger ribonucleic acid levels by a nuclear posttranscriptional event. Endocrinology 138:5256–5265[Abstract/Free Full Text]
  30. Chiara MD, Gozani O, Bennett M, Champion-Arnaud P, Leon P, Reed R 1996 Identification of proteins that interact with exon sequence, splice sites, and the branchpoint sequence during each stage of spliceosome assembly. Mol Cell Biol 16:3317–3326[Abstract/Free Full Text]
  31. Lowery DE, Van Ness BG 1988 Comparison of in vitro and in vivo splice site selection in {kappa}-immunoglobulin precursor mRNA. Mol Cell Biol 8:2610–2619[Abstract/Free Full Text]
  32. Watakabe A, Tanaka K, Shimura Y 1993 The role of exon sequences in splice site selection. Genes Dev 7:407–418[Abstract/Free Full Text]
  33. Okano HJ, Darnell RB 1997 A hierarchy of Hu RNA binding proteins in developing and adult neurons. J Neurosci 17:3027–3037
  34. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  35. Seong JY, Lee YK, Lee CC, Kim K 1993 NMDA receptor antagonist decreases the progesterone-induced increase in GnRH gene expression in the rat hypothalamus. Neuroendocrinology 58:234–239[Medline]
  36. Kim K, Jarry H, Knoke I, Seong JY, Leonhardt S, Wuttke W 1993 Competitive PCR for quantitation of GnRH mRNA level in a single micropunch of the rat preoptic area. Mol Cell Endocrinol 97:153–158[CrossRef][Medline]
  37. Seong JY, Jarry H, Kühnemuth S, Leonhardt S, Wuttke W, Kim K 1995 Effect of GABAergic compounds on gonadotropin-releasing hormone receptor gene expression in the rat. Endocrinology 136:2587–2593[Abstract]
  38. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Park, M. S. Lee, S. M. Baik, E. B. Cho, G. H. Son, J. Y. Seong, K. H. Lee, and K. Kim
Nova-1 Mediates Glucocorticoid-induced Inhibition of Pre-mRNA Splicing of Gonadotropin-releasing Hormone Transcripts
J. Biol. Chem., May 8, 2009; 284(19): 12792 - 12800.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. Yue, T. A. Ponzio, R. L. Fields, and H. Gainer
Oxytocin and vasopressin gene expression and RNA splicing patterns in the rat supraoptic nucleus
Physiol Genomics, November 12, 2008; 35(3): 231 - 242.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Q. Xu, D. Walker, A. Bernardo, J. Brodbeck, M. E. Balestra, and Y. Huang
Intron-3 Retention/Splicing Controls Neuronal Expression of Apolipoprotein E in the CNS
J. Neurosci., February 6, 2008; 28(6): 1452 - 1459.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Park, J. Han, G. H. Son, M. S. Lee, S. Chung, S. H. Park, K. Park, K. H. Lee, S. Choi, J. Y. Seong, et al.
Cooperative Actions of Tra2{alpha} with 9G8 and SRp30c in the RNA Splicing of the Gonadotropin-releasing Hormone Gene Transcript
J. Biol. Chem., January 6, 2006; 281(1): 401 - 409.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. H. Son, H. Jung, J. Y. Seong, Y. Choe, D. Geum, and K. Kim
Excision of the First Intron from the Gonadotropin-releasing Hormone (GnRH) Transcript Serves as a Key Regulatory Step for GnRH Biosynthesis
J. Biol. Chem., May 9, 2003; 278(20): 18037 - 18044.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Y. Seong, J. Han, S. Park, W. Wuttke, H. Jarry, and K. Kim
Exonic Splicing Enhancer-Dependent Splicing of the Gonadotropin-Releasing Hormone Premessenger Ribonucleic Acid Is Mediated by Tra2{alpha}, a 40-Kilodalton Serine/Arginine-Rich Protein
Mol. Endocrinol., November 1, 2002; 16(11): 2426 - 2438.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Y. Seong, B. W. Kim, S. Park, G. H. Son, and K. Kim
First Intron Excision of GnRH Pre-mRNA During Postnatal Development of Normal Mice and Adult Hypogonadal Mice
Endocrinology, October 1, 2001; 142(10): 4454 - 4461.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Romano, R. Marcucci, and F. E. Baralle
Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Nucleic Acids Res., February 15, 2001; 29(4): 886 - 894.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seong, J. Y.
Right arrow Articles by Kim, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seong, J. Y.
Right arrow Articles by Kim, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals