help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furlow, J. D.
Right arrow Articles by Brown, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furlow, J. D.
Right arrow Articles by Brown, D. D.
Molecular Endocrinology 13 (12): 2076-2089
Copyright © 1999 by The Endocrine Society

In Vitro and in Vivo Analysis of the Regulation of a Transcription Factor Gene by Thyroid Hormone during Xenopus laevis Metamorphosis

J. David Furlow and Donald D. Brown

Section of Neurobiology, Physiology, and Behavior (J.D.F.) Division of Biological Sciences University of California, Davis, California 95616
Carnegie Institution of Washington (D.D.B.) Department of Embryology Baltimore, Maryland 21210


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A novel, basic region leucine zipper transcription factor (TH/bZIP) is dramatically up-regulated at the climax of metamorphosis in Xenopus laevis. It can be induced in tadpoles prematurely by thyroid hormone (TH) with kinetics that are intermediate between early and late Xenopus TH response genes. A small amount of early, cycloheximide-resistant up-regulation is observed, but the majority of TH/bZIP mRNA accumulation occurs after 12 h of treatment in parallel with late response gene induction. There are two genomic TH/bZIP genes in the pseudotetraploid X. laevis genome that are coordinately regulated. They have highly conserved regulatory regions that contain two conserved, adjoining DR+4 thyroid response elements (TRE) in opposite orientation. The early/late TH induction kinetics has been reproduced in transient transfection assays. The secondary rise of transcriptional activity requires DNA regions other than the TREs and, therefore, the interaction of transcription factors other than the TH receptors. Finally, the regulatory region of the TH/bZIP gene has been used to drive green fluorescent protein in transgenic X. laevis tadpoles. Regulation of the transgene during spontaneous and induced metamorphosis mimics that of the endogenous TH/bZIP gene. The newly developed X. laevis transgenesis method has distinct advantages for the analysis of transcriptional regulatory elements over transient transfection assays and will be useful for further in vivo studies of TH-response gene regulation during development.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Amphibian metamorphosis is a thyroid hormone (TH)-dependent developmental event. The rising level of TH from the developing tadpole’s thyroid gland induces a timed series of functional and morphological changes leading to the formation of a frog (1). These TH-induced morphogenetic changes are the result of regulated gene expression changes (2, 3), a view that was suggested originally from the ability of protein and RNA synthesis inhibitors to block TH-induced tissue responses in organ culture (4). The discovery that TH receptors (TRs) are nuclear proteins that behave as ligand-regulated transcription factors (5, 6) strongly supports the role of transcriptional control in metamorphosis. All vertebrates studied to date have two highly conserved TR isoforms encoded by separate genes that are designated TH receptor {alpha} (TR{alpha}) and TH receptor ß (TRß) (7, 8). The X. laevis TRs behave similarly to the mammalian and avian TRs in terms of their ligand and DNA binding properties, their requirement to heterodimerize with retinoid X receptors (RXRs) for high-affinity DNA binding (9), and the ability to repress transcription in the absence of ligand (10). In X. laevis, TR{alpha} appears during embryogenesis and is present throughout tadpole life, while the mRNA (11, 12) and protein (13) levels of TRß, which is an early, or direct, response gene of TH, follows the endogenous TH concentration.

Most progress in our understanding of the molecular basis of TH action has occurred in mammalian systems. These studies have focused on synthetic TH response elements (TREs) or natural elements and promoters from a few model genes. However, many response genes studied in mammals are only regulated a few fold by TH, while the TH-regulated genes in X. laevis tadpoles are induced greater than 10-fold by the hormone (14, 15). A large number of cDNAs have been cloned corresponding to genes that are activated by TH with distinct kinetic profiles, and in tissues undergoing dramatic morphological changes as a result of the hormone. TH rapidly and directly induces a set of transcription factors including TRß (16) and the zinc finger transcription factor xBTEB (2). This early response is resistant to protein synthesis inhibitors. Indeed, both the TRß (17) and xBTEB (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation) genes contain high-affinity, nearly identical TREs that are a close match to optimized synthetic TREs studied in mammals. The second wave of changes in gene expression occurs in the second day after TH treatment and results in the production of gene products involved in tissue-specific responses. In the tail, for instance, several late genes encode secreted, membrane-bound, or cytoplasmic proteases that are likely to be involved in tissue breakdown (2). Thus, the study of TH action in metamorphosis provides the opportunity to study a hormonally controlled gene expression cascade from the time of TH binding to its receptor until the ultimate morphogenetic response of a given tissue.

We began our analysis of the TH-induced waves of gene expression with a gene that encodes a member of the basic leucine zipper family of transcription factors, TH/bZIP (15, 18). This gene is up-regulated in tadpoles by exogenous TH from an undetectable baseline, and it is abruptly activated at the climax of spontaneous metamorphosis in a variety of tadpole tissues. TH/bZIP cDNA fragments were isolated independently in screens for TH response genes in tail (15) and intestine (19). Because the Xenopus laevis genome is tetraploid at most loci (20), two related TH/bZIP cDNAs derived from duplicated genes were found independently and are expressed with identical kinetics during spontaneous and induced metamorphosis. The two copies of this gene were called originally genes 8 and 9 (15, 19). In contrast to TRß and xBTEB, the kinetics of TH/bZIP up-regulation by TH is intermediate between early and late genes; i.e. a small amount of mRNA is synthesized beginning soon after after TH addition, but the bulk of up-regulation occurs after a delay of 12 h (15) in parallel with a number of late responding genes, including those encoding secreted proteases (2, 15). Nevertheless, the small, early phase of TH/bZIP up-regulation is at least partially resistant to cycloheximide (15, 18). The behavior of these genes in response to TH is reminiscent of the early/late class of ecdysone response genes in Drosophila (21) or delayed primary hormone response genes in mammals (22). In the Xenopus tail and intestine, the TH/bZIP genes are not activated until metamorphic climax, at the peak of circulating TH levels. By this time, direct response genes are maximally induced and have already been rising for 2 or 3 days (15).

The delayed nature of the full induction of the TH/bZIP genes suggests that they might be responding primarily to rising levels of TRß, other induced transcription factors, or both. We therefore sought to find the TREs and other key regulatory elements of the early/late TH/bZIP genes as part of a systematic analysis of TH-mediated gene induction during metamorphosis. In addition, we have adopted the recently established transgenic method (23) for X. laevis to confirm features of the TH/bZIP promoter in vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Expression of TH Response Genes, TRs, and RXRs in the Tadpole Tail
Accumulation of mRNA after TH induction in the tadpole tail demonstrates the difference between the simple direct response kinetics [xBTEB (Fig. 1AGo) and TRß (Fig. 1BGo)] and the early/late response of TH/bZIP mRNA (Fig. 1AGo). xBTEB and TRß are maximally induced by 12 h, while TH/bZIP mRNA is just beginning to be detected at that point. Expression profiles of the mRNA for two isoforms of RXR ({alpha} and ß) and TR{alpha} confirm that they are all expressed in the tail before hormone treatment, but they are just marginally regulated. RXR{gamma} was not detected in the tail under these conditions.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Kinetics of TH Induction of xBTEB, TH/bZIP, and xTRß mRNA in Tadpole Tails

Stage 50 tadpoles were treated with 100 nM T3 for the indicated times, and total tail RNA was analyzed by Northern blotting using the indicated cDNA probes. A, The relative abundance of the xBTEB and TH/bZIP mRNAs was compared and normalized to the expression of the constitutive rpL8 mRNA. Levels of mRNA are expressed as normalized phosphorimager units. Black squares, xBTEB; open circles, TH/bZIP. B, The abundance of the xTR{alpha} (black squares), xTRß (black circles), xRXR{alpha} (open squares), and xRXRß (open circles) mRNAs were quantitated at the indicated times after T3 treatment as in panel A.

 
Genomic Organization of the TH/bZIP Genes
Southern analysis of X. laevis homozygous diploid DNA (24) with a probe from the first exon of TH/bZIP shows that there are two genomic copies (Fig. 2AGo) as there are for many X. laevis genes. The genes previously referred to as genes 8 and 9 (15, 19) are referred to here as TH/bZIP A and B, respectively. We cloned both genomic copies of the TH/bZIP gene (A and B) including 20 kb upstream from the transcription start site (Fig. 2BGo). Both TH/bZIP genes A and B encode polyadenylated messages of 5, 3, and 2 kb (14). A single intron splits the 5'-untranslated region (UTR). TH/bZIP exon 2 contains 90 of the 220 bp of 5'-UTR, the entire ~1 kb coding sequence, and adjacent 3'-UTR including a consensus A2UA3 signal at the expected position to produce the 2-kb mRNA species. We do not know whether any additional introns split the 3'-UTRs which give rise to the 3 kb and 5 kb TH/bZIP messages. The extent of divergence of the two genes was analyzed by sequencing 1 kb of genomic DNA surrounding the start site of transcription (Fig. 2BGo). Exon 1 is completely conserved between the two genes, and high sequence conservation persists for approximately 250 bp upstream, presumably corresponding to promoter sequences. In both the intron and 5' of the promoter, sequence conservation drops rapidly to 30–40%. This genomic analysis demonstrates the simplicity of the structure of the TH/bZIP genes and confirms their duplication in the X. laevis genome. In addition, the genes have diverged enough to permit a meaningful comparison of conserved regulatory elements.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. Mapping of High-Affinity TR/RXR Binding Sites in the TH/bZIP A and B Genes

A, Southern blot analysis of X. laevis homozygous diploid DNA digested with BstXI, HindIII, or PstI and hybridized with a TH/bZIP 5'-flanking region/exon 1 probe (-246 to +130). B, The percent nucleotide identity from -500 bp to +500 bp relative to the transcription start site of TH/bZIP A and B is indicated on the diagram, with the region representing exon 1 in black. The TH/bZIP gene structure is represented above; black boxes, noncoding sequences; open box, coding sequences; black bar represents 5 kb of genomic sequence. Arrow represents the transcription start site. C, Reverse gel shift assays were performed using 35S-labeled TR{alpha}, cold RXR{alpha}, and AluI-digested genomic clones or PCR-amplified fragments for the two TH/bZIP genes or {lambda} Gem-11 DNA. Free and DNA-bound TR{alpha} were separated on 4% polyacrylamide gels. Only the TH/bZIP A and TH/bZIP B exon 1-containing clones contained TR/RXR binding sites. Only the results for TH/bZIP B DNA are shown here. Two binding sites mapped to the promoter/exon 1 region of each gene (-246 to +130) and were further mapped by generating the indicated PCR fragments (right hand panel). The numbers above the lanes refer to the DNA fragments used in the mobility shift assay. The region containing the two TR/RXR binding sites are indicated below (-246 to +130), with the PCR fragments used to map the binding sites represented as horizontal lines. Fragment 1, -175 to +130; 2, -81 to +130; 3, +19 to +130; 4, -246 to +43; 5, -246 to -61; 6, -246 to -156. Black rectangles, Candidate TREs (site 1 and site 2); arrow, transcription start site (+1). D, Sequence comparison in the region surrounding exon 1 of the TH/bZIP genes. Dots indicate conserved nucleotides; horizontal lines indicate deletions inferred for one gene or the other to optimize alignment. The inverted solid triangle indicates the transcription start site at (+1). The positions of the two TR/RXR binding sites are shaded, underlined with arrows, and designated TRE1 and TRE2. The thick vertical line at +130 denotes the exon 1/intron 1 splice junction. Numbers to the right of the aligned sequences denote the base pair position relative to the transcription start site [determined by sequencing a number of 5'-rapid amplification of cDNA ends (RACE)-generated clones (2 )]. Potential transcription factor binding sites are noted (54 ), such as those for E box factors, GATA factors, AP2, SP1, and several GAGA sites (GAGAG) (43 ). A consensus TATA box is located at -31. AluI sites flanking the TREs in TH/bZIP B are also noted with a vertical line. Lightly shaded areas indicate repetitive DNA, with thin vertical lines indicating the boundaries of each repeat. Repeats in the 5'-flanking region of TH/bZIP A are not related to the intron repeats in TH/bZIP A and B. The GenBank accession numbers for TH/bZIP A and TH/bZIP B genomic sequences are AF192491 and AF192492, respectively.

 
Isolation of High-Affinity TR Binding Sites in the TH/bZIP Genes
A reverse gel shift (25, 26) was adopted to map high-affinity genomic binding sites for TRs around the TH/bZIP transcription units (Fig. 2CGo). Briefly, the TH/bZIP genomic clones (still in the {lambda} cloning vector) and the cloning vector alone were digested in parallel with a frequent cutting enzyme such as AluI. Each set of DNA fragments was mixed with in vitro translated, 35S-labeled xTR{alpha} or xTRß with or without in vitro translated heterodimer partners xRXR{alpha} or xRXRß. RXR{alpha} and RXRß are expressed ubiquitously in tadpole tissues (Ref. 9 and J. D. Furlow and D. D. Brown, unpublished results), including the tail (Fig. 1BGo) and therefore are available to serve as partners for TR heterodimerization at metamorphosis. DNA fragments containing a TR binding site (TRE) can complex with the heterodimer and cause the labeled TR protein to migrate into the gel. The genomic clones containing specific TREs were then subcloned and reanalyzed until the binding sites were identified.

In approximately 45 kb of cloned genomic TH/bZIP B DNA and 15 kb of TH/bZIP A DNA, only two insert-specific shifted bands were identified in a region near the start site of transcription of both TH/bZIP A and B. Figure 2CGo shows the result for TH/bZIP B and {lambda} DNAs digested with AluI and assayed using TR{alpha}/RXR{alpha} heterodimers. The same results were obtained when the genomic clones were assayed with TR{alpha}/RXRß, TRß/RXR{alpha}, or TRß/RXRß heterodimers. No binding was detected with TR{alpha} or TRß alone (data not shown).

PCR was used to amplify and subclone regions of both genes that included all of exon 1 and 246 bp of the 5'-flanking region (-246 to +130) as well as progressively smaller fragments from each end. These deletions defined the boundaries of each TRE in the mobility shift assay (Fig. 2CGo). Two adjacent TR/RXR binding sites were identified. Each site can independently form a complex with the heterodimer (lower band, lanes 1, 2, 4, and 5) while together they each bind a heterodimer and form the slower moving complex (upper band, lanes 1 and 4). Sequencing revealed that an AluI site does not separate the two potential TREs (Fig. 2DGo), further supporting this interpretation. This region includes a consensus TATA box at -30 and many potential sites for other known transcription factors (Fig. 2DGo). Two direct repeats with similarity to mammalian TREs (designated TRE1 and TRE2) are located between positions -102 and -58 in both genes. Other more diverged direct repeats can be found in the region, but they do not bind TRs under these conditions.

High-affinity TR binding sequences that are selective for TH induction are described as a perfect direct repeat of AGGTCA separated by 4 bp (27, 28). The early response xBTEB (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation) and TRß gene (17) TREs are a close match to this synthetic, optimal TRE (Fig. 3AGo). TH/bZIP TRE1 is also a close match, while TH/bZIP TRE2 is more divergent. These results indicate that the X. laevis TRs recognize much the same DR+4 TRE sequences as do mammalian TRs, a result anticipated by the high sequence homology in the DNA binding domains of X. laevis and mammalian TRs (7). The expanded cognate TRE sequence identified by selection of optimal sequences in vitro (28, 29) includes a preferred T in the third position of the four nucleotide linker region, a characteristic of all identified Xenopus TREs to date.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. The X. laevis TH/bZIP TREs Behave as Conventional TREs in Gel Shift and Transient Transfection Assays

A, TRE sequences are aligned from Xenopus TRß, xBTEB, TH/bZIP (TRE1 and TRE2) genes, and the rat GH gene (rGH). Positions of the TREs relative to the transcription start sites are indicated to the right. Shaded nucleotides are identical to those in the consensus DR+4 TRE identified by binding site selection using mammalian TRs (27 28 ). Additional tolerated nucleotides are indicated below the DR+4 TRE sequence. Arrows underline sequences related to the AGGTCA core half-site. B, Gel shift assays with a 32P-labeled TRE and in vitro translated X. laevis TR{alpha}/RXR{alpha} were used to demonstrate direct binding to each TH/bZIP TRE. Lane 1 shows unprogrammed wheat germ extract. Remaining lanes show TR{alpha}/RXR{alpha} binding to a consensus TRE, competed with or without (-) a 1000-fold excess of the indicated unlabeled double-stranded TH/bZIP TRE-derived oligonucleotides or a random oligonucleotide. C, Transient transfection assays of a luciferase reporter driven by xBTEB and TH/bZIP TREs in a heterologous promoter. X. laevis XLA cells were transiently transfected with the indicated TRE constructs, and extracts were assayed for luciferase activity 48 h after treatment with (black bars) or without (open bars) 100 nM T3. Luciferase activity was normalized to total protein in the extract [relative light units (RLU)/µg]. Each point was done in triplicate, and the error bars represent SEM. Arrows indicate the number and orientation of TRE half-sites inserted into the {Delta}MTV-luciferase construct. An X in the half-site arrow means that a G residue was changed to a T residue. D, Dose-response curve of xBTEB and TH/bZIP TRE1+TRE2 {Delta}MTV-luciferase constructs. Expression is presented as fold induction in T3 treated over untreated cells. Open circles, xBTEB TRE construct; black squares, TH/bZIP TRE1+TRE2 construct. Error bars represent SEM.

 
To test binding of TRs directly to TH/bZIP TRE sequences, the binding of TR/RXR complexes to a labeled consensus TRE was competed with DNAs containing the combined, individual, or mutated versions of TREs derived from the TH/bZIP promoter (Fig. 3BGo). TRE1 competed completely while the more divergent TRE2 was slightly less effective. As is the case with mammalian TREs, the G residues at the second and third positions of the second half-site are absolutely required for binding. In addition, an RXR is absolutely required for binding under our conditions (data not shown). No significant differences in binding to any of these sequences were found using TR{alpha} or TRß with either heterodimer partner RXR{alpha} or RXRß (data not shown).

Behavior of the TREs in Transient Transfection Assays
The ability of the TH/bZIP TREs to mediate TH-induced transcription was tested by transient transfection using a TH-responsive Xenopus kidney cell line, XLA. First, various TREs were cloned 40 bp upstream of the start site of a truncated minimal mouse mammary tumor virus (MMTV) promoter ({Delta}MTV) driving the expression of the firefly luciferase gene (30). The single xBTEB TRE permits strong TH-induced up-regulation of the reporter (Fig. 3CGo). When both TH/bZIP TREs are together (TH/bZIP TRE1+ TRE2, separated by 5 bp as in the native promoter), strong activation of the construct is observed that is equal to or greater than the xBTEB TRE. The activation of the coupled TH/bZIP TREs is more than additive over the activation of each TRE alone (Fig. 3CGo). The second and third G residues of the 3' half-sites are again absolutely required for induction, as they are in binding assays. We consistently observe a 15- to 30-fold activation of the xBTEB or coupled TH/bZIP TREs in the context of this heterologous promoter without the need for cotransfection of TRs in XLA cells. A mammalian TRE from the rat GH gene is induced barely over the vector alone. Despite the apparent synergistic interaction of the TH/bZIP TREs, the single xBTEB and coupled TH/bZIP TREs mediate transcriptional activation with very similar dose-response curves (Fig. 3DGo).

We tested the transcriptional activation of the TH/bZIP TREs in the context of their own promoter. The conserved region of the TH/bZIP promoters (including exon 1, -246 to +130 relative to the transcription start site) was cloned upstream of the luciferase gene and assayed for TH induction in transiently transfected XLA cells (Fig. 4AGo). A consistent 5- to 10-fold induction was detected using the wild-type promoter, and no induction is observed when both TREs are deleted. Curiously, deletion of the weaker TRE2 resulted in an even stronger induction of the reporter gene. Nevertheless, at least one of the two TREs (TRE1) is required for TH induction of the TH/bZIP promoter in these assays.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Transient Transfection Assays of TH/bZIP Promoter

A, TH/bZIP B wild-type or TRE deleted promoters (-246 to +130 bp) were placed upstream of luciferase gene and transfected into Xenopus XLA cells. Cell extracts were assayed for luciferase activity and normalized to micrograms of protein (RLU/µg x 10-3) after treatment for 48 h with (black bars) or without (white bars) 100 nM T3. Schematics of constructs are shown left. Open boxes indicate positions of TREs, BamHI indicates the site of TRE replacement by a BamHI site, and arrows indicate the transcription start site. B, Kinetics of T3 induction of TH/bZIP B wild-type promoter construct (open circles) vs. TH/bZIP TRE1+TRE2 in the {Delta}MTV promoter (black squares), expressed as fold induction of T3 treated vs. untreated cells. C, Kinetics of T3 induction of TH/bZIP promoter constructs, with the xBTEB TRE inserted into the deleted TRE2 site (black squares) vs. the TH/bZIP TRE2 reinserted into the deletion site (open circles). D, Kinetics of T3 induction of the wild-type TH/bZIP promoter construct cotransfected with a xTR{alpha} expression vector (black squares), a xTRß expression vector (black diamonds), or a control vector (open circles). In all cases, each point was done in triplicate, and the error bars represent SEM.

 
Importantly, the TH/bZIP promoter reproduces early/late kinetics of the endogenous gene in the transient transfection assay (Fig. 4BGo). There is a low level of early up-regulation, eventually reaching maximal induction at 24 h after TH addition. By contrast, there is a rapid and steady increase of luciferase activity induced from the TH/bZIP TREs in the heterologous {Delta}MTV promoter (Fig. 4BGo). The TH/bZIP TREs and the xBTEB TRE are induced nearly identically in the {Delta}MTV promoter (data not shown). Our preliminary results indicate that the early xBTEB promoter fused to its TRE containing enhancer shows a more rapid response than TH/bZIP promoter as well (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation). Two different approaches were used in an attempt to override the sluggish early induction of the TH/bZIP promoter. First, replacing the weaker TH/bZIP TRE2 with the potent xBTEB TRE in the context of the TH/bZIP promoter did not change the overall early/late kinetics, although the final induction level was higher (Fig. 4CGo). In addition, cotransfection of expression plasmids for xTR{alpha} or xTRß resulted in higher final levels of induction but only after this initial slow response phase (Fig. 4DGo). We conclude that sequences in the TH/bZIP promoter other than the TREs account for the characteristic early/late response of the TH/bZIP gene.

Analysis of the TH/bZIP Promoter in Transgenic X. laevis Tadpoles
The ultimate test of a proposed regulatory sequence’s role in governing the expression of a gene is its ability to direct proper temporal and spatial expression of a reporter gene in a living animal. A new transgenic method developed for X. laevis (23) has become a powerful tool to over- or misexpress wild-type or mutated proteins that play a role in early development (23) or metamorphosis (31).

We tested the ability of the TH/bZIP promoter to mediate faithful induction of a transgene in transgenic tadpoles. The TH-inducible TH/bZIP B promoter region used in the above transient transfection studies was inserted upstream of the green fluorescent protein (GFP) cDNA (32). We created more than 20 transgenic tadpoles by sperm nuclear transplantation as described previously (23, 31). Ten of these tadpoles were treated with TH. Six became strongly fluorescent, two weakly fluoresced, and two did not respond. GFP expression was only detected in T3-treated animals (Fig. 5Go, A and B). Strong expression was observed in the brain (especially the ventricles, Fig. 5EGo), various cartilages in the head including Meckel’s cartilage, and the ceratohyals (Fig. 5Go, A and B), the intestine (Fig. 5FGo), and the limb buds (Fig. 5DGo). Low level expression is seen in the epidermis as well. In the tail, the highest expression is in the spinal cord and inside the notochord (Fig. 5CGo). The expression pattern of the transgene is in excellent agreement with previously described in situ and Northern hybridization patterns for TH/bZIP (15, 19, 33, 34, 35). In particular, the TH/bZIP promoter drives transgene expression in areas that proliferate in response to TH. No expression was seen in larval muscle or gills, which do not express TH/bZIP normally (34, 35). All animals that were positive for transgene expression showed the same pattern of induction. In addition, transgenic animals carrying the TH/bZIP promoter whose TREs had been deleted did not show any detectable expression before or after T3 treatment (data not shown).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. Expression of the TH/bZIP Promoter Transgene during Induced Metamorphosis

Transgenic X. laevis tadpoles were created using the TH/bZIP B gene promoter (-246 to +130, including the two TREs) driving the expression of a GFP cDNA. Stage 45 transgenic tadpoles (1 week old) were treated with (+T3, A and B and C–F) and without (-T3, A and B) 30 nM T3 for 1 week. Panel A, Ventral view of transgenic tadpole under UV light before and after T3 treatment. P, Pronephros; L, lens; HL, hindlimb; I, intestine; FL, forelimb; B, brain; CH, ceratohyals (cartilage); MC, Meckel’s cartilage. Panel B, Same view as in panel A, with some added white light to visualize animals. Panel C, Higher magnification view of the side of the tail (+T3). NC, Notochord cells; SC, spinal cord. Panel D, Higher magnification view of hindlimb buds (+T3). Panel E, Higher magnification view of dorsal head (+T3). Note high expression of the transgene in ventricles of the brain. Panel F, Higher magnification view of intestine, dissected out of the animal to avoid pigment.

 
The other 10 transgenic tadpoles carrying the wild-type TH/bZIP promoter driving GFP were observed as they underwent spontaneous metamorphosis about 1 month later. Four tadpoles activated GFP expression strongly at metamorphic climax (Fig. 6Go), two did so weakly, and four showed no detectable fluorescence. The onset of transgene expression at stage 59/60 coincided well with the stage when the endogenous TH/bZIP genes are activated (15). Tissues where GFP expression was highest included proliferating and differentiating cartilage of the head, and differentiating adult muscle of the head and limbs. Overall, transgene expression was much higher in the body, the brain, and the intestine, all sites of normal TH/bZIP expression. While TH/bZIP mRNA disappears at later stages of metamorphosis in the intestine (19), we observed induced GFP expression in the above tissues even in newly metamorphosed froglets. Consistent with in situ hybridization data (34), transgene expression in the tail was limited to lines of fluorescence around larval muscle (Fig. 6BGo), as well as deeper spinal cord and notochord expression. We consistently observed strong transgene expression in the epiphyseal growth plates of the bones in limbs and digits (Fig. 6CGo), another area of proliferating and differentiating cartilage.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 6. Expression of the TH/bZIP Promoter Transgene during Spontaneous Metamorphosis

A, Stage 62 TH/bZIP B promoter-GFP transgenic tadpole under UV light, ventral view. FL, Forelimb; HL, hindlimb. B, View of dorsal tail. *, Streaks of GFP expression along larval muscle. C, Closeup of hindlimb foot. White circle, localized GFP expression at ends of ossifying bone, which are likely epiphyseal growth plates.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Amphibian metamorphosis is an excellent model system in which to understand the molecular basis of TH action in vertebrates, particularly during development. Similarities between amphibians and mammals include the role of the pituitary-thyroid negative feedback loop and the structure and relative biological efficacy of the thyroid hormones themselves (36). TH synthesis by the thyroid gland is inhibited by the same goitrogens that function in mammals. Amphibian TR{alpha} and TRß are closely homologous with their counterparts in all vertebrates studied to date (7). The change from tadpole to frog is entirely dependent upon endogenous TH. Metamorphosis can be induced precociously simply by adding TH to the rearing medium, manipulations that are difficult if not impossible for higher vertebrates in developmental contexts. Because of the accessibility of amphibian tadpoles, it has been possible to identify many genes that are up- and down-regulated dramatically by TH during metamorphosis (2, 3). Many of the genes that have been studied in mammals as TH-response genes respond only after days of treatment, and their up-regulation has not been shown to require protein synthesis so it is not certain that they are direct TH-response genes (16, 37). In many cases, TH-response genes in mammals are only up-regulated a few fold over baseline. It has been difficult to derive generalizations about the contribution of the TREs and flanking regulatory sequences to the speed and magnitude of TH responses because no systematic studies of the mechanisms of induction of different classes of response genes within the same cell have been undertaken (22). For this reason, we have begun a study of the mechanism of transcriptional activation of the most dramatically up-regulated genes from different kinetic classes that were identified in the screen for TH-induced genes during X. laevis metamorphosis.

Even though xBTEB, TRß, and TH/bZIP are direct response genes as determined by at least partial resistance to cycloheximide when induced with exogenous TH, the kinetics of their spontaneous and induced up-regulation are very different. xBTEB and TRß respond rapidly to TH induction, while the TH/bZIP genes have an early low level of up-regulation, followed several hours later by the greatest part of the response. This delayed mRNA accumulation parallels those of the latest responding genes in the tail resorption program that is expressed completely by 48 h. During spontaneous metamorphosis, the TH/bZIP genes are among the latest to be induced in the tail and in other tissues. TH/bZIP expression sharply rises only at metamorphic climax, several days after early response genes have been induced in response to rising, circulating TH levels. Thus, it was formally possible that the TH/bZIP genes did not contain TREs or they were very weak, requiring the up-regulation of TRß before full transcriptional activation could be achieved.

The TREs, Flanking Sequences, and the Timing of TH Induction
We find that both duplicated copies of the TH/bZIP gene contain bona fide TREs in their conserved promoters just upstream of their TATA boxes. They are identical in sequence and position in these two coordinately regulated genes that were duplicated and began to diverge some 30 million years ago (38). The TH/bZIP TREs bind with relatively high affinity to TR/RXR heterodimers and confer strong TH inducibility on a heterologous promoter. At least one of these TREs must be present to achieve activation of the native TH/bZIP promoter in transient transfection assays (Fig. 4Go) or in transgenic tadpoles (Figs. 5Go and 6Go).

Two simple possibilities for the differential induction between early response genes and the TH/bZIP genes are the different relative binding affinities of their respective TREs for TRs or a preference of the TH/bZIP TREs for TRß over TR{alpha}. This is an important consideration because during metamorphosis TRß protein appears before the large secondary activation of TH/bZIP (13). No biochemical differences were noted between TR{alpha} and TRß binding to the TH/bZIP TREs. In addition, a transient transfection assay in a cell line that up-regulates its endogenous TRß gene from a low baseline demonstrated strong and rapid TH induction of early and early/late gene TREs in a heterologous promoter (Figs. 3DGo and 4Go). Moreover, both the single xBTEB TRE and the coupled TH/bZIP TREs respond to TH with very similar time courses and dose-response curves when they are inserted into the same heterologous promoter. Our data suggest that the different kinetic responses of the two kinds of TH-inducible genes cannot be accounted for by their slightly different TRE configurations.

DNA sequences flanking hormone response elements have been shown to affect the specificity and magnitude of a transcriptional response to a given hormone (39, 40). In fact, the promoters and enhancer sequences of the early and the biphasic X. laevis TH response genes cloned so far are markedly different. The TH/bZIP genes have a TATA box while the xBTEB and TRß genes do not. Binding sites for additional transcription factors differ between the promoters of the two kinetic classes of genes. In particular, the region in which the TH/bZIP TREs are embedded contains a striking number of potential GAGA factor sites that have been found near a number of Drosophila genes that rearrange their chromatin upon induction (41). Paradoxically, GAGA factor bound constitutively to Drosophila heat shock genes is proposed to allow rapid induction by opening chromatin to allow constitutive heat shock transcription factor access (42). Also, GAGA factor sites are found in the promoter of the early ecdysone response gene E74 in Drosophila (43), and the early TH-response gene stromelysin-3 in X. laevis (44). Although no vertebrate GAGA factor homolog has been isolated yet, we detected specific, but constitutive, specific binding of proteins from tadpole brain and tail nuclear extracts to TH/bZIP GAGA sequences (data not shown).

The induction of other transcription factors that work in parallel with the TRs may also be required for the early/late profile of the TH/bZIP genes. No obvious sites for known induced transcription factors other than TRß were observed in the TH/bZIP promoter by sequence analysis, but not all of the induced transcription factor genes may have been cloned by previous subtractive hybridization and candidate gene approaches. A GC-rich sequence located at the transcription start site may warrant more investigation, since the TH-induced xBTEB transcription factor binds to related GC-rich sequences. However, the abundant, ubiquitous, and constitutively expressed Sp1 transcription factor effectively masks xBTEB binding to such sites in in vitro DNA binding assays using various tissue and cultured cell extracts (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation). Finally, other non-DNA binding factors, such as induced TR coactivators (45), may be involved.

In Vivo Analysis of TH-Regulated Gene Expression during Metamorphosis
Transient transfection assays provide a rapid and sensitive means to test large numbers of constructs for regulation by a particular hormone or other regulator. The major limitation of these assays is the inability to gain a clear understanding of how a gene is regulated in different cell types, at different times of development, or under the influence of proper cell connections to the extracellular matrix and adjacent cells. In addition, transfected plasmids are not properly wrapped in chromatin (46). This may have misleading consequences in interpreting results of transfection studies to fully understand the spatial and temporal transcriptional regulation of an endogenous gene of interest. Recently, a series of studies were conducted on the Xenopus TRßA gene promoter and its associated TRE, which was assembled into chromatin upon injection into Xenopus oocytes (10, 47, 48, 49). First, these studies suggest that repression of the TRßA promoter in the absence of TH is the result of the assembly of a repressive chromatin state over start site mediated by unliganded TR/RXR. This repression is at least partly dependent on histone deacetylase activity (10, 49). Second, transcriptional activation in this system involves the localized disruption of chromatin structure, but that process alone may not completely explain hormone-regulated transcriptional activation (48). In light of these findings, the delayed kinetics of the TH/bZIP genes may be the result of a more completely repressed state to overcome than is found in early response genes, requiring qualitative or quantitative differences in the assembly of chromatin remodeling complexes at early/late promoters. Repression of the TH/bZIP genes until metamorphosis is probably more complicated than assembly of repressive chromatin mediated by TR/RXR complexes because the genes are silent throughout the entire length of embryonic and larval development until TH levels peak at metamorphic climax.

The new transgenic technique for X. laevis integrates DNA before first cleavage so that the construct is replicated along with host chromatin (23). The ability to create large numbers of transgenic animals presents a new way to analyze the transcriptional regulation of genes integrated in chromatin in all cells of a live, developing animal. This is demonstrated by the faithful expression of a reporter gene in patterns that are highly similar to the known expression patterns of the endogenous TH/bZIP genes (Figs. 5Go and 6Go). The TREs are required for the regulation of these genes not only in vitro but also in vivo. Because of the variability of levels of expression between individuals and the stability of the GFP protein, the subtle kinetics of TH induction can not be done currently in F0 animals using this reporter. However, this method provides a rapid screen for the role of TRE-flanking sequences in the developmentally and spatially restricted up-regulation of this transcription factor gene. Most importantly, we can envision using this methodology to determine the in vivo roles of TR isoforms and other constitutive and induced transcription factors in governing the precise TH-mediated regulation of the TH/bZIP and other response genes at metamorphosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Northern and Southern Blot Hybridization
Stage 50 X. laevis tadpoles were treated with 100 nM T3 (Sigma, St. Louis, MO) added directly to the water for the indicated lengths of time. Total RNA from tail and limb buds was isolated and analyzed by Northern hybridization as described previously (50). Ten micrograms of total RNA were loaded for each time point. Radiolabeled probes were obtained from +1 to +750 of xBTEB cDNA, +249 to +1434 of TH/bZIP B, +248 to +1318 of xTRßA1 cDNA (7), and the full-length rpL8 cDNA (51). After washing, blots were analyzed using a Storm PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and IMAGEQUANT Version 1.2 software. The mRNA for rpL8 is constant during development (51), so hybridization signals were normalized to rpL8 expression at each time point.

For Southern blot analysis, 10 µg homozygous diploid genomic X. laevis DNA (24) was digested with restriction enzymes and electrophoresed on a 0.7% agarose gel. The gel was transferred to Nytran Plus nylon membranes (Schleicher & Schuell, Inc., Keene, NH) (52) and hybridized with DNA from within exon 1 (-246 to +130) of TH/bZIP B using previously described hybridization conditions (15).

Genomic Cloning
A homozygous diploid X. laevis genomic DNA library (gift of Keith Joho) in {lambda} GEM-11 vector (Promega Corp., Madison, WI) was screened using a full-length (2.1 kb) TH/bZIP A cDNA probe as described (53). Partially purified {lambda} phage DNA from clones that were still positive after three rounds of screening was isolated from 250 ml liquid cultures (52). {lambda} DNA was further purified by RNase A digestion, polyethylene glycol precipitation, phenol/chloroform extraction, and ethanol precipitation with ammonium acetate. Restriction maps of the genomic clones and approximate positions of coding sequences were determined by digestion with various restriction enzymes followed by Southern hybridization with primers specific to each end of the vector or to TH/bZIP cDNA sequences. PCR using Taq extender (Stratagene, La Jolla, CA), and combinations of vector and cDNA-derived primers determined orientation and position of the exons. Genomic clones and plasmid-based subclones were sequenced using gene-specific primers by automated sequencing (PE Applied Biosystems, Norwalk, CT). Potential transcription factor binding sites were identified by analyzing the TH/bZIP gene sequences using the Signal Scan program on the NIH World Wide Web server, Signal Scan (54), and the TFD (55) and TRANSFAC (56) databases.

In Vitro Translation of Receptor Proteins
Capped X. laevis TR{alpha} and TRß mRNAs were synthesized in vitro as described previously (13). X. laevis RXR{alpha} cDNA was obtained as a gift from B. Blumberg and E. DeRobertis (57), and xRXRß cDNA was a gift from R. Old (58). The coding sequences of xRXR{alpha} and xRXRß were PCR amplified and subcloned into pSP64A (Promega Corp.) for in vitro transcription. Cold or [35S]methionine-labeled receptor proteins were produced by in vitro translation of 2 µg mRNA in wheat germ extract (Promega Corp.) as described previously (13). Production of full-length receptor protein was assessed by SDS-PAGE and autoradiography (data not shown). We typically produce 200,000–500,000 trichloroacetic acid-precipitable cpm/µl with a 15–45% efficiency of incorporation.

Gel Shift Assays
Reverse gel shift assays were performed as described by Urness and Thummel (26) with some modifications. Purified {lambda} DNA from individual genomic clones, {lambda} GEM-11 DNA (Promega Corp.), and genomic subclones in pBluescript II KS- (Stratagene) were digested with RsaI or AluI and purified by phenol/chloroform extraction and ethanol precipitation. Digested {lambda} DNA (1.5 µg) or about 0.2 µg digested plasmid DNA (6 x 10-14 M, 4 nM final DNA concentration) was mixed with 0.5 µl in vitro translated 35S-labeled TR{alpha} or ß and 1 µl unlabeled, in vitro translated RXR{alpha} or -ß or unprogrammed wheat germ extract in binding buffer [20 mM Tris Cl, (pH 7.6), 150 mM KCl, 3 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol) and sonicated 1 µg poly(dI-dC) in a final volume of 15 µl. After incubation at room temperature for 30 min, the reactions were cooled on ice, mixed with 5 µl loading buffer (26), and loaded on prerun 4% (29:1) polyacrylamide gels in 0.5x Tris-borate-EDTA (TBE). The gels were electrophoresed in 0.5 x TBE at 200 V at 4 C for 2 h, fixed for 1 h in 50% methanol/10% acetic acid, rehydrated with water for 10 min, dried under vacuum, and autoradiographed.

For standard gel shift assays (cold protein, labeled DNA), oligonucleotides were annealed by heating in 10 mM Tris Cl (pH 8.0), 1 mM EDTA, 100 mM NaCl to 90 C for 10 min and then cooled over several hours to room temperature for use as probes or unlabeled competitor. Both strands are shown for the DR+4 oligonucleotide; only the top strand (5'-3') is shown for the rest of the oligonucleotides. Each annealed oligo had a 5'-HindIII overhang for end labeling or cloning (see below). TRE half-sites are bold; mutated bases are underlined:

DR+4 TRE: 5'-ACGTTCAGGGAAGGTCATCTGAGGTCACAGCTTA-3' 3'-AGTCCCTTCCAGTAGACTCCAGTGTCGAATTCGA-5'

xBTEB TRE: ACGTTCAGGGAAGTTCATCTGAGGACACAGCTTA

bZIP TRE1: AGCTTGCACTAGGGTTAAGTAAGGTGAAT-GCTCA

bZIP mTRE1: AGCTTGCACTAGGGTTAAGTAATTTGAAT-GCTCA

bZIP TRE2: AGCTTAATGCTCAGCCTCATTTGAACTCT-GTAGA

bZIP mTRE2: AGCTTAATGCTCAGTTTCATTTGAACTCT-GTAGA

bZIP TRE1

+TRE2: AGCTTGGGTTAAGTAAGGTGAATGCTCAGCC-TCATTTGAACTCTG

bZIP mTRE1

+TRE2: AGCTTGGGTTAAGTAATTTGAATGCTCAGCCT-CATTTGAACTCTG

bZIP TRE1

+mTRE2: AGCTTGGGTTAAGTAAGGTGAATGCTCAGT-TTCATTTGAACTCTG

bZIP mTRE1

+mTRE2: AGCTTGGGTTAAGTAATTTGAATGCTCAGTT-TCATTTGAACTCTG

GH TRE: AGCTTAAAGGTAAGATCAGGGACGTGACCG-CAGA

Random: AGCTTCTAAAAAACGTTATGTAACGGA

The wild-type xBTEB TRE oligo was end labeled by filling in with 32P-dCTP, cold dATP, dGTP, and dTTP, and the Klenow fragment of DNA polymerase. Labeled oligos were purified using G-25 spin columns (52). Reactions were carried out under the same conditions as for reverse shift assays, this time using 1 µl each unlabeled xTR{alpha} and RXR{alpha}, binding buffer with 150 mM KCl, 1 µg sonicated poly(dI-dC), 10% glycerol, a constant amount of labeled wild-type xBTEB TRE (30,000 cpm), and with or without a 1000-fold molar excess of the indicated cold competitor oligo in a 30 µl reaction volume. After adding 10 µl 4x loading dye, reactions were electrophoresed on 6% (29:1) polyacrylamide gels as above. Gels were dried directly and autoradiographed.

Transient Transfection Assays
TRE-containing constructs were cloned by ligating annealed oligos (see above) into the single HindIII site of {Delta}MTV-luciferase (30). The parent {Delta}MTV-luciferase vector was kindly provided by Ron Evans (Salk Institute, San Diego, CA). DNA from -246 to +130 of TH/bZIP was amplified by PCR (using oligos with incorporated SacI and XhoI sites) and subcloned into the pGL2 basic vector (Promega Corp.) upstream of the luciferase gene. The TREs were deleted together or individually by inverse PCR of the TH/bZIP promoter in pBluescript KS- (Stratagene) using primers that are oriented in opposite directions, flank the sites to be deleted, and contain BamHI sites. The religated PCR products then contain a BamHI site substituted for both TH/bZIP TREs or TH/bZIP TRE2 alone. For some experiments, the xBTEB TRE oligo or the TH/bZIP TRE2 oligo were synthesized with BamHI ends and then ligated into the newly created BamHI sites in the mutated TH/bZIP constructs lacking TRE2. The mutated TH/bZIP sequences were then amplified by PCR for cloning into pGL2-Basic as was done for the wild-type promoter. For cotransfection of TR expression vectors, xTR{alpha}A and xTRßA1 coding sequences were cloned downstream of the miw promoter (a hybrid RSV LTR and chicken ß-actin promoter) (59) (gifts of Akira Kanamori, National Research Institute of Aquaculture, Tamaki, Japan). All constructs were checked for correct sequence, orientation, and number of TRE inserts by sequencing as above. Plasmids were purified with Qiagen (Chatsworth, CA) midiprep kits before transfection.

Monolayer cultures of X. laevis XLA cells were maintained in 70% Liebovitz L-15 medium (Life Technologies, Inc., Gaithersburg, MD) with 10% FBS (Life Technologies, Inc.) at 24–26 C with air. For transfection, each well in Falcon six-well tissue culture plates (Becton Dickinson, Lincoln Park, NJ) was seeded with 1.5 x 105 cells and grown overnight in 70% L-15 with 10% resin-stripped FBS (60). Cells were transfected by mixing 0.2 µg reporter construct (TREs in {Delta}MTV-Luc) or 0.1 µg genomic constructs in pGL2 vector and pCS2+ßGalactosidase (a gift of Dave Turner, Fred Hutchinson Cancer Research Center, Seattle, WA) to a final DNA concentration of 1 µg/well with 4 µl/well Lipofectamine reagent (Life Technologies, Inc.) according to the instructions of the manufacturer. In cotransfection experiments with TR{alpha} or ß expression vectors, 0.1 µg TH/bZIP promoter-pGL2 was mixed with 0.25 µg pmiwTR{alpha}A, pmiwTRßA1, or the parent pmiw vector as control. The amount of pCS2+ßGalactosidase was adjusted to yield a final amount of 1 µg/well transfected DNA. After 24 h, cells were washed, and incubated with 70% L-15 plus stripped FBS with or without the indicated T3 concentration. Cells from each well were harvested at the indicated times by scraping, washing once in PBS, and lysing in 125 µl 250 mM Tris Cl, pH 7.8, by three freeze/thaw cycles. Extracts were assayed for luciferase (61) and ß-galactosidase (52) activity and normalized to total protein in the extract (Bradford assay kit, Pierce Chemical Co., Rockford, IL).

Transgenic X. laevis
-246 to +130 of the wild-type or TRE1 and TRE2 deleted TH/bZIP promoter was amplified by PCR incorporating XhoI and HindIII restriction sites on the 5'- and 3'-ends of the fragment. This fragment was cloned into pCS2+GFP* (a gift of Dave Turner and Nicholas Marsh-Armstrong, Carnegie Institution of Washington, Baltimore, MD) at the SalI and HindIII sites, replacing the cytomegalovirus promoter with TH/bZIP promoter sequences. The GFP reporter used was a point mutant containing a serine-to-cysteine switch at amino acid 65 (31). Transgenic animals were created using NotI-linearized constructs and NotI restriction enzyme as previously described (31). Some animals were treated for 1 week with 30 nM T3, and others were allowed to develop through metamorphosis and observed at 1- to 2-day intervals. Images were captured before and after T3 treatment and at metamorphic climax using a Leica Corp. fluorescent dissecting microscope and video camera as described elsewhere (31). Large images were assembled using Adobe Pagemaker (Adobe Systems, Inc., San Jose, CA).


    ACKNOWLEDGMENTS
 
The authors wish to thank Akira Kanamori and Zhou Wang for their gifts of various constructs, reagents, and advice during the course of this work. We are extremely grateful to Haochu Huang and Nick Marsh-Armstrong for help with the transgenesis protocols. Helpful criticism of the manuscript by our colleagues is gratefully acknowledged. Eddie Jordan, Allison Pinder, Benjamin Remo, and Allison Better provided excellent technical support at various points in the project.


    FOOTNOTES
 
Address requests for reprints to: David Furlow, Section of Neurobiology, Physiology, and Behavior, University of California, One Shields Avenue, Davis, California 95616-8519.

This research was supported by a National Research Service Award fellowship to J.D.F. and grants from the NIH (2 R01 GM-22395) and the G. Harold and Leila Y. Mathers Charitable Foundation to D.D.B.

Received for publication June 30, 1999. Revision received August 16, 1999. Accepted for publication August 19, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Dodd MHI, Dodd JM 1976 The biology of metamorphosis. In: Lofts B (ed) Physiology of the Amphibia. Academic Press, New York, pp 467–599
  2. Brown DD, Wang Z, Furlow JD, Kanamori A, Schwartzman RA, Remo BF, Pinder A 1996 The thyroid hormone-induced tail resorption program during Xenopus laevis metamorphosis. Proc Natl Acad Sci USA 93:1924–1929[Abstract/Free Full Text]
  3. Shi YB 1996 Thyroid hormone-regulated early and late genes during amphibian metamorphosis. In: Gilbert LI, Tata JR, Atkinson BG (eds) Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York, pp 505–538
  4. Tata JR 1966 Requirement for RNA and protein synthesis for induced regression of the tadpole tail in organ culture. Dev Biol 13:77–94[CrossRef][Medline]
  5. Sap J, Munoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Beug H, Vennstrom B 1986 The c-erb-A protein is a high-affinity receptor for thyroid hormone. Nature 324:635–640[CrossRef][Medline]
  6. Weinberger C, Thompson CC, Ong ES, Lebo R, Gruol DJ, Evans RM 1986 The c-erb-A gene encodes a thyroid hormone receptor. Nature 324:641–646[CrossRef][Medline]
  7. Yaoita Y, Shi YB, Brown DD 1990 Xenopus laevis {alpha} and ß thyroid hormone receptors. Proc Natl Acad Sci USA 87:7090–7094[Abstract/Free Full Text]
  8. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  9. Wong J, Shi YB 1995 Coordinated regulation of and transcriptional activation by Xenopus thyroid hormone and retinoid X receptors. J Biol Chem 270:18479–18483[Abstract/Free Full Text]
  10. Wong J, Shi YB, Wolffe AP 1995 A role for nucleosome assembly in both silencing and activation of the Xenopus TR ß A gene by the thyroid hormone receptor. Genes Dev 9:2696–2711[Abstract/Free Full Text]
  11. Yaoita Y, Brown DD 1990 A correlation of thyroid hormone receptor gene expression with amphibian metamorphosis. Genes Dev 4:1917–1924[Abstract/Free Full Text]
  12. Kawahara A, Baker BS, Tata JR 1991 Developmental and regional expression of thyroid hormone receptor genes during Xenopus metamorphosis. Development 112:933–943[Abstract]
  13. Eliceiri BP, Brown DD 1994 Quantitation of endogenous thyroid hormone receptors {alpha} and ß during embryogenesis and metamorphosis in Xenopus laevis. J Biol Chem 269:24459–24465[Abstract/Free Full Text]
  14. Wang Z, Brown DD 1991 A gene expression screen. Proc Natl Acad Sci USA 88:11505–11509[Abstract/Free Full Text]
  15. Wang Z, Brown DD 1993 Thyroid hormone-induced gene expression program for amphibian tail resorption. J Biol Chem 268:16270–16278[Abstract/Free Full Text]
  16. Kanamori A, Brown DD 1992 The regulation of thyroid hormone receptor ß genes by thyroid hormone in Xenopus laevis. J Biol Chem 267:739–745[Abstract/Free Full Text]
  17. Ranjan M, Wong J, Shi YB 1994 Transcriptional repression of Xenopus TR ß gene is mediated by a thyroid hormone response element located near the start site. J Biol Chem 269:24699–24705[Abstract/Free Full Text]
  18. Ishizuya-Oka A, Ueda S, Shi YB 1997 Temporal and spatial regulation of a putative transcriptional repressor implicates it as playing a role in thyroid hormone-dependent organ transformation. Dev Genet 20:329–337[CrossRef][Medline]
  19. Shi YB, Brown DD 1993 The earliest changes in gene expression in tadpole intestine induced by thyroid hormone. J Biol Chem 268:20312–20317[Abstract/Free Full Text]
  20. Graf JD, Kobel HR 1991 Genetics of Xenopus laevis. Methods Cell Biol 36:19–34[Medline]
  21. Thummel CS 1996 Files on steroids–Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet 12:306–310[CrossRef][Medline]
  22. Dean DM, Sanders MM 1996 Ten years after: reclassification of steroid-responsive genes. Mol Endocrinol 10:1489–1495[Abstract/Free Full Text]
  23. Kroll KL, Amaya E 1996 Transgenic Xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development 122:3173–3183[Abstract]
  24. Krotoski DM, Reinschmidt DC, Tompkins R 1985 Developmental mutants isolated from wild-caught Xenopus laevis by gynogenesis and inbreeding. J Exp Zool 233:443–449[CrossRef][Medline]
  25. Hope IA, Struhl K 1985 GCN4 protein, synthesized in vitro, binds HIS3 regulatory sequences: implications for general control of amino acid biosynthetic genes in yeast. Cell 43:177–188[CrossRef][Medline]
  26. Urness LD, Thummel CS 1990 Molecular interactions within the ecdysone regulatory hierarchy: DNA binding properties of the Drosophila ecdysone-inducible E74A protein. Cell 63:47–61[CrossRef][Medline]
  27. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  28. Kurokawa R, Yu VC, Naar A, Kyakumoto S, Han Z, Silverman S, Rosenfeld MG, Glass CK 1993 Differential orientations of the DNA-binding domain and carboxy-terminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7:1423–1435[Abstract/Free Full Text]
  29. Katz RW, Koenig RJ 1993 Nonbiased identification of DNA sequences that bind thyroid hormone receptor {alpha} 1 with high affinity. J Biol Chem 268:19392–19397[Abstract/Free Full Text]
  30. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  31. Huang H, Marsh-Armstrong N, Brown DD 1999 Metamorphosis is inhibited in transgenic Xenopus laevis tadpoles that overexpress type III deiodinase. Proc Natl Acad Sci USA 96:962–967[Abstract/Free Full Text]
  32. Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC 1994 Green fluorescent protein as a marker for gene expression. Science 263:802–805[Abstract/Free Full Text]
  33. Denver RJ, Pavgi S, Shi YB 1997 Thyroid hormone-dependent gene expression program for Xenopus neural development. J Biol Chem 272:8179–8188[Abstract/Free Full Text]
  34. Berry DL, Rose CS, Remo BF, Brown DD 1998 The expression pattern of thyroid hormone response genes in remodeling tadpole tissues defines distinct growth and resorption gene expression programs. Dev Biol 203:24–35[CrossRef][Medline]
  35. Berry DL, Schwartzman RA, Brown DD 1998 The expression pattern of thyroid hormone response genes in the tadpole tail identifies multiple resorption programs. Dev Biol 203:12–23[CrossRef][Medline]
  36. Kikuyama S, Kawamura K, Tanaka S, Yamamoto K 1993 Aspects of amphibian metamorphosis: hormonal control. Int Rev Cytol 145:105–148[Medline]
  37. Santos A, Perez-Castillo A, Wong NC, Oppenheimer JH 1987 Labile proteins are necessary for T3 induction of growth hormone mRNA in normal rat pituitary and rat pituitary tumor cells. J Biol Chem 262:16880–16884[Abstract/Free Full Text]
  38. Bisbee CA, Baker MA, Wilson AC, Haji-Azimi I, Fischberg M 1977 Albumin phylogeny for clawed frogs (Xenopus). Science 195:785–787[Abstract/Free Full Text]
  39. Lucas PC, Granner DK 1992 Hormone response domains in gene transcription. Annu Rev Biochem 61:1131–1173[CrossRef][Medline]
  40. Robins DM, Scheller A, Adler AJ 1994 Specific steroid response from a nonspecific DNA element. J Steroid Biochem Mol Biol 49:251–255
  41. Lis J, Wu C 1993 Protein traffic on the heat shock promoter: parking, stalling, and trucking along. Cell 74:1–4[CrossRef][Medline]
  42. Tsukiyama T, Becker PB, Wu C 1994 ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of GAGA transcription factor. Nature 367:525–532[CrossRef][Medline]
  43. Soeller WC, Oh CE, Kornberg TB 1993 Isolation of cDNAs encoding the Drosophila GAGA transcription factor. Mol Cell Biol 13:7961–7970[Abstract/Free Full Text]
  44. Li J, Liang VC, Sedgwick T, Wong J, Shi YB 1998 Unique organization and involvement of GAGA factors in transcriptional regulation of the Xenopus stromelysin-3 gene. Nucleic Acids Res 26:3018–3025[Abstract/Free Full Text]
  45. Freedman LP 1999 Increasing the complexity of coactivation in nuclear receptor signaling. Cell 97:5–8[CrossRef][Medline]
  46. Smith CL, Hager GL 1997 Transcriptional regulation of mammalian genes in vivo. A tale of two templates. J Biol Chem 272:27493–27496[Free Full Text]
  47. Wong J, Li Q, Levi BZ, Shi YB, Wolffe AP 1997 Structural and functional features of a specific nucleosome containing a recognition element for the thyroid hormone receptor. EMBO J 16:7130–7145[CrossRef][Medline]
  48. Wong J, Shi YB, Wolffe AP 1997 Determinants of chromatin disruption and transcriptional regulation instigated by the thyroid hormone receptor: hormone-regulated chromatin disruption is not sufficient for transcriptional activation. EMBO J 16:3158–3171[CrossRef][Medline]
  49. Wong J, Patterton D, Imhof A, Guschin D, Shi YB, Wolffe AP 1998 Distinct requirements for chromatin assembly in transcriptional repression by thyroid hormone receptor and histone deacetylase. EMBO J 17:520–534[CrossRef][Medline]
  50. Furlow JD, Berry DL, Wang Z, Brown DD 1997 A set of novel tadpole specific genes expressed only in the epidermis are down-regulated by thyroid hormone during Xenopus laevis metamorphosis. Dev Biol 182:284–298[CrossRef][Medline]
  51. Shi YB, Liang VC 1994 Cloning and characterization of the ribosomal protein L8 gene from Xenopus laevis. Biochim Biophys Acta 1217:227–228[Medline]
  52. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed. 2. Cold Spring Harbor Press, Cold Spring Harbor, NY
  53. Shi YB, Yaoita Y, Brown DD 1992 Genomic organization and alternative promoter usage of the two thyroid hormone receptor ß genes in Xenopus laevis. J Biol Chem 267:733–738[Abstract/Free Full Text]
  54. Prestridge DS 1991 SIGNAL SCAN: a computer program that scans DNA sequences for eukaryotic transcriptional elements. Comput Appl Biosci 7:203–206[Abstract/Free Full Text]
  55. Ghosh D 1990 A relational database of transcription factors. Nucleic Acids Res 18:1749–1756[Abstract/Free Full Text]
  56. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, Kolchanov NA 1998 Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26:362–367[Abstract/Free Full Text]
  57. Blumberg B, Mangelsdorf DJ, Dyck JA, Bittner DA, Evans RM, De Robertis EM 1992 Multiple retinoid-responsive receptors in a single cell: families of retinoid "X" receptors and retinoic acid receptors in the Xenopus egg. Proc Natl Acad Sci USA 89:2321–2325[Abstract/Free Full Text]
  58. Marklew S, Smith DP, Mason CS, Old RW 1994 Isolation of a novel RXR from Xenopus that most closely resembles mammalian RXR ß and is expressed throughout early development. Biochim Biophys Acta 1218:267–272[Medline]
  59. Nakamura A, Okumura J, Muramatsu T 1998 Quantitative analysis of luciferase activity of viral and hybrid promoters in bovine preimplantation embryos. Mol Reprod Dev 49:368–373[CrossRef][Medline]
  60. Samuels HH, Stanley F, Casanova J 1979 Depletion of L-3,5,3'-triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone. Endocrinology 105:80–85[Abstract/Free Full Text]
  61. Brasier AR, Tate JE, Habener JF 1989 Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7:1116–1122[Medline]



This article has been cited by other articles:


Home page
JEMHome page
S. Kamizono, G. S. Duncan, M. G. Seidel, A. Morimoto, K. Hamada, G. Grosveld, K. Akashi, E. F. Lind, J. P. Haight, P. S. Ohashi, et al.
Nfil3/E4bp4 is required for the development and maturation of NK cells in vivo
J. Exp. Med., December 21, 2009; 206(13): 2977 - 2986.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Matsuda, B. D. Paul, C. Y. Choi, T. Hasebe, and Y.-B. Shi
Novel Functions of Protein Arginine Methyltransferase 1 in Thyroid Hormone Receptor-Mediated Transcription and in the Regulation of Metamorphic Rate in Xenopus laevis
Mol. Cell. Biol., February 1, 2009; 29(3): 745 - 757.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Wang, H. Matsuda, and Y.-B. Shi
Developmental Regulation and Function of Thyroid Hormone Receptors and 9-cis Retinoic Acid Receptors during Xenopus tropicalis Metamorphosis
Endocrinology, November 1, 2008; 149(11): 5610 - 5618.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Bagamasbad, K. L. Howdeshell, L. M. Sachs, B. A. Demeneix, and R. J. Denver
A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor
J. Biol. Chem., January 25, 2008; 283(4): 2275 - 2285.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
B. Linder, E. Mentele, K. Mansperger, T. Straub, E. Kremmer, and R. A.W. Rupp
CHD4/Mi-2beta activity is required for the positioning of the mesoderm/neuroectoderm boundary in Xenopus
Genes & Dev., April 15, 2007; 21(8): 973 - 983.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Paul, D. R. Buchholz, L. Fu, and Y.-B. Shi
SRC-p300 Coactivator Complex Is Required for Thyroid Hormone-induced Amphibian Metamorphosis
J. Biol. Chem., March 9, 2007; 282(10): 7472 - 7481.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. R. Buchholz, B. D. Paul, and Y.-B. Shi
Gene-specific Changes in Promoter Occupancy by Thyroid Hormone Receptor during Frog Metamorphosis: IMPLICATIONS FOR DEVELOPMENTAL GENE REGULATION
J. Biol. Chem., December 16, 2005; 280(50): 41222 - 41228.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S.-i. Sugiyama, N. Shimada, H. Miyoshi, and K. Yamauchi
Detection of Thyroid System-Disrupting Chemicals Using in Vitro and in Vivo Screening Assays in Xenopus laevis
Toxicol. Sci., December 1, 2005; 88(2): 367 - 374.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Paul, D. R. Buchholz, L. Fu, and Y.-B. Shi
Tissue- and Gene-specific Recruitment of Steroid Receptor Coactivator-3 by Thyroid Hormone Receptor during Development
J. Biol. Chem., July 22, 2005; 280(29): 27165 - 27172.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. D. Paul, L. Fu, D. R. Buchholz, and Y.-B. Shi
Coactivator Recruitment Is Essential for Liganded Thyroid Hormone Receptor To Initiate Amphibian Metamorphosis
Mol. Cell. Biol., July 1, 2005; 25(13): 5712 - 5724.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
Y. Kudo and K. Yamauchi
In Vitro and in Vivo Analysis of the Thyroid Disrupting Activities of Phenolic and Phenol Compounds in Xenopus laevis
Toxicol. Sci., March 1, 2005; 84(1): 29 - 37.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. J. Mengeling, F. Pan, and M. L. Privalsky
Novel Mode of Deoxyribonucleic Acid Recognition by Thyroid Hormone Receptors: Thyroid Hormone Receptor {beta}-Isoforms Can Bind as Trimers to Natural Response Elements Comprised of Reiterated Half-Sites
Mol. Endocrinol., January 1, 2005; 19(1): 35 - 51.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. R. Buchholz, A. Tomita, L. Fu, B. D. Paul, and Y.-B. Shi
Transgenic Analysis Reveals that Thyroid Hormone Receptor Is Sufficient To Mediate the Thyroid Hormone Signal in Frog Metamorphosis
Mol. Cell. Biol., October 15, 2004; 24(20): 9026 - 9037.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Furlow, H. Y. Yang, M. Hsu, W. Lim, D. J. Ermio, G. Chiellini, and T. S. Scanlan
Induction of Larval Tissue Resorption in Xenopus laevis Tadpoles by the Thyroid Hormone Receptor Agonist GC-1
J. Biol. Chem., June 18, 2004; 279(25): 26555 - 26562.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Luria and J. D. Furlow
Spatiotemporal retinoid-X receptor activation detected in live vertebrate embryos
PNAS, June 15, 2004; 101(24): 8987 - 8992.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Tomita, D. R. Buchholz, and Y.-B. Shi
Recruitment of N-CoR/SMRT-TBLR1 Corepressor Complex by Unliganded Thyroid Hormone Receptor for Gene Repression during Frog Development
Mol. Cell. Biol., April 15, 2004; 24(8): 3337 - 3346.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. R. Buchholz, S.-C. V. Hsia, L. Fu, and Y.-B. Shi
A Dominant-Negative Thyroid Hormone Receptor Blocks Amphibian Metamorphosis by Retaining Corepressors at Target Genes
Mol. Cell. Biol., October 1, 2003; 23(19): 6750 - 6758.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. T. Alarid, M. T. Preisler-Mashek, and N. M. Solodin
Thyroid Hormone Is an Inhibitor of Estrogen-Induced Degradation of Estrogen Receptor-{alpha} Protein: Estrogen-Dependent Proteolysis Is Not Essential for Receptor Transactivation Function in the Pituitary
Endocrinology, August 1, 2003; 144(8): 3469 - 3476.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. C. Helbing, K. Werry, D. Crump, D. Domanski, N. Veldhoen, and C. M. Bailey
Expression Profiles of Novel Thyroid Hormone-Responsive Genes and Proteins in the Tail of Xenopus laevis Tadpoles Undergoing Precocious Metamorphosis
Mol. Endocrinol., July 1, 2003; 17(7): 1395 - 1409.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. M. Sachs, P. L. Jones, E. Havis, N. Rouse, B. A. Demeneix, and Y.-B. Shi
Nuclear Receptor Corepressor Recruitment by Unliganded Thyroid Hormone Receptor in Gene Repression during Xenopus laevis Development
Mol. Cell. Biol., December 15, 2002; 22(24): 8527 - 8538.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Lim, N.-H. Nguyen, H. Y. Yang, T. S. Scanlan, and J. D. Furlow
A Thyroid Hormone Antagonist That Inhibits Thyroid Hormone Action in Vivo
J. Biol. Chem., September 13, 2002; 277(38): 35664 - 35670.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. D. Furlow and A. Kanamori
The Transcription Factor Basic Transcription Element-Binding Protein 1 Is a Direct Thyroid Hormone Response Gene in the Frog Xenopus laevis
Endocrinology, September 1, 2002; 143(9): 3295 - 3305.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
W. Lim and J. D. Furlow
Ribozyme suppression of endogenous thyroid hormone receptor activity in Xenopus laevis cells
Nucleic Acids Res., August 1, 2002; 30(15): 3490 - 3496.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. M. Sachs and Y.-B. Shi
Targeted chromatin binding and histone acetylation in vivo by thyroid hormone receptor during amphibian development
PNAS, November 8, 2000; (2000) 260141297.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. M. Sachs and Y.-B. Shi
Targeted chromatin binding and histone acetylation in vivo by thyroid hormone receptor during amphibian development
PNAS, November 21, 2000; 97(24): 13138 - 13143.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furlow, J. D.
Right arrow Articles by Brown, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furlow, J. D.
Right arrow Articles by Brown, D. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals