| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Section of Neurobiology, Physiology, and Behavior (J.D.F.)
Division of Biological Sciences University of California, Davis,
California 95616
Carnegie Institution of Washington
(D.D.B.) Department of Embryology Baltimore, Maryland 21210
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(TR) and TH receptor ß (TRß)
(7, 8). The X. laevis TRs behave similarly to the mammalian
and avian TRs in terms of their ligand and DNA binding properties,
their requirement to heterodimerize with retinoid X receptors (RXRs)
for high-affinity DNA binding (9), and the ability to repress
transcription in the absence of ligand (10). In X. laevis,
TR appears during embryogenesis and is present throughout tadpole
life, while the mRNA (11, 12) and protein (13) levels of TRß, which
is an early, or direct, response gene of TH, follows the endogenous TH
concentration. Most progress in our understanding of the molecular basis of TH action has occurred in mammalian systems. These studies have focused on synthetic TH response elements (TREs) or natural elements and promoters from a few model genes. However, many response genes studied in mammals are only regulated a few fold by TH, while the TH-regulated genes in X. laevis tadpoles are induced greater than 10-fold by the hormone (14, 15). A large number of cDNAs have been cloned corresponding to genes that are activated by TH with distinct kinetic profiles, and in tissues undergoing dramatic morphological changes as a result of the hormone. TH rapidly and directly induces a set of transcription factors including TRß (16) and the zinc finger transcription factor xBTEB (2). This early response is resistant to protein synthesis inhibitors. Indeed, both the TRß (17) and xBTEB (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation) genes contain high-affinity, nearly identical TREs that are a close match to optimized synthetic TREs studied in mammals. The second wave of changes in gene expression occurs in the second day after TH treatment and results in the production of gene products involved in tissue-specific responses. In the tail, for instance, several late genes encode secreted, membrane-bound, or cytoplasmic proteases that are likely to be involved in tissue breakdown (2). Thus, the study of TH action in metamorphosis provides the opportunity to study a hormonally controlled gene expression cascade from the time of TH binding to its receptor until the ultimate morphogenetic response of a given tissue.
We began our analysis of the TH-induced waves of gene expression with a gene that encodes a member of the basic leucine zipper family of transcription factors, TH/bZIP (15, 18). This gene is up-regulated in tadpoles by exogenous TH from an undetectable baseline, and it is abruptly activated at the climax of spontaneous metamorphosis in a variety of tadpole tissues. TH/bZIP cDNA fragments were isolated independently in screens for TH response genes in tail (15) and intestine (19). Because the Xenopus laevis genome is tetraploid at most loci (20), two related TH/bZIP cDNAs derived from duplicated genes were found independently and are expressed with identical kinetics during spontaneous and induced metamorphosis. The two copies of this gene were called originally genes 8 and 9 (15, 19). In contrast to TRß and xBTEB, the kinetics of TH/bZIP up-regulation by TH is intermediate between early and late genes; i.e. a small amount of mRNA is synthesized beginning soon after after TH addition, but the bulk of up-regulation occurs after a delay of 12 h (15) in parallel with a number of late responding genes, including those encoding secreted proteases (2, 15). Nevertheless, the small, early phase of TH/bZIP up-regulation is at least partially resistant to cycloheximide (15, 18). The behavior of these genes in response to TH is reminiscent of the early/late class of ecdysone response genes in Drosophila (21) or delayed primary hormone response genes in mammals (22). In the Xenopus tail and intestine, the TH/bZIP genes are not activated until metamorphic climax, at the peak of circulating TH levels. By this time, direct response genes are maximally induced and have already been rising for 2 or 3 days (15).
The delayed nature of the full induction of the TH/bZIP genes suggests that they might be responding primarily to rising levels of TRß, other induced transcription factors, or both. We therefore sought to find the TREs and other key regulatory elements of the early/late TH/bZIP genes as part of a systematic analysis of TH-mediated gene induction during metamorphosis. In addition, we have adopted the recently established transgenic method (23) for X. laevis to confirm features of the TH/bZIP promoter in vivo.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
) and TRß (Fig. 1B)]
and the early/late response of TH/bZIP mRNA (Fig. 1A). xBTEB and TRß
are maximally induced by 12 h, while TH/bZIP mRNA is just
beginning to be detected at that point. Expression profiles of the mRNA
for two isoforms of RXR ( and ß) and TR confirm that they are
all expressed in the tail before hormone treatment, but they are just
marginally regulated. RXR
was not detected in the tail under these
conditions.
|
) as there are
for many X. laevis genes. The genes previously referred to
as genes 8 and 9 (15, 19) are referred to here as TH/bZIP A and B,
respectively. We cloned both genomic copies of the TH/bZIP gene (A and
B) including 20 kb upstream from the transcription start site (Fig. 2B). Both TH/bZIP genes A and B encode polyadenylated messages of 5, 3,
and 2 kb (14). A single intron splits the 5'-untranslated region
(UTR). TH/bZIP exon 2 contains 90 of the 220 bp of 5'-UTR, the entire
1 kb coding sequence, and adjacent 3'-UTR including a consensus
A2UA3 signal at the expected position to
produce the 2-kb mRNA species. We do not know whether any additional
introns split the 3'-UTRs which give rise to the 3 kb and 5 kb TH/bZIP
messages. The extent of divergence of the two genes was analyzed by
sequencing 1 kb of genomic DNA surrounding the start site of
transcription (Fig. 2B). Exon 1 is completely conserved between the two
genes, and high sequence conservation persists for approximately 250 bp
upstream, presumably corresponding to promoter sequences. In both the
intron and 5' of the promoter, sequence conservation drops rapidly to
30–40%. This genomic analysis demonstrates the simplicity of the
structure of the TH/bZIP genes and confirms their duplication in the
X. laevis genome. In addition, the genes have diverged
enough to permit a meaningful comparison of conserved regulatory
elements.
|
). Briefly, the TH/bZIP genomic clones (still in the 
cloning vector) and the cloning vector alone were digested in parallel
with a frequent cutting enzyme such as AluI. Each set of DNA
fragments was mixed with in vitro translated,
35S-labeled xTR or xTRß with or without in
vitro translated heterodimer partners xRXR or xRXRß. RXR
and RXRß are expressed ubiquitously in tadpole tissues (Ref. 9 and
J. D. Furlow and D. D. Brown, unpublished results), including
the tail (Fig. 1B) and therefore are available to serve as partners for
TR heterodimerization at metamorphosis. DNA fragments containing a TR
binding site (TRE) can complex with the heterodimer and cause the
labeled TR protein to migrate into the gel. The genomic clones
containing specific TREs were then subcloned and reanalyzed until the
binding sites were identified.
In approximately 45 kb of cloned genomic TH/bZIP B DNA and 15 kb of
TH/bZIP A DNA, only two insert-specific shifted bands were identified
in a region near the start site of transcription of both TH/bZIP A and
B. Figure 2C shows the result for TH/bZIP B and DNAs digested with
AluI and assayed using TR/RXR heterodimers. The same
results were obtained when the genomic clones were assayed with
TR/RXRß, TRß/RXR, or TRß/RXRß heterodimers. No binding
was detected with TR or TRß alone (data not shown).
PCR was used to amplify and subclone regions of both genes that
included all of exon 1 and 246 bp of the 5'-flanking region (-246 to
+130) as well as progressively smaller fragments from each end. These
deletions defined the boundaries of each TRE in the mobility shift
assay (Fig. 2C). Two adjacent TR/RXR binding sites were identified.
Each site can independently form a complex with the heterodimer (lower
band, lanes 1, 2, 4, and 5) while together they each bind a heterodimer
and form the slower moving complex (upper band, lanes 1 and 4).
Sequencing revealed that an AluI site does not separate the
two potential TREs (Fig. 2D), further supporting this interpretation.
This region includes a consensus TATA box at -30 and many potential
sites for other known transcription factors (Fig. 2D). Two direct
repeats with similarity to mammalian TREs (designated TRE1 and TRE2)
are located between positions -102 and -58 in both genes. Other more
diverged direct repeats can be found in the region, but they do not
bind TRs under these conditions.
High-affinity TR binding sequences that are selective for TH induction
are described as a perfect direct repeat of AGGTCA separated by 4 bp
(27, 28). The early response xBTEB (J. D. Furlow, A. Kanamori, and
D. D. Brown, manuscript in preparation) and TRß gene (17) TREs
are a close match to this synthetic, optimal TRE (Fig. 3A). TH/bZIP TRE1 is also a close match,
while TH/bZIP TRE2 is more divergent. These results indicate that the
X. laevis TRs recognize much the same DR+4 TRE sequences as
do mammalian TRs, a result anticipated by the high sequence homology in
the DNA binding domains of X. laevis and mammalian TRs (7).
The expanded cognate TRE sequence identified by selection of optimal
sequences in vitro (28, 29) includes a preferred T in the
third position of the four nucleotide linker region, a characteristic
of all identified Xenopus TREs to date.
|
). TRE1 competed completely
while the more divergent TRE2 was slightly less effective. As is the
case with mammalian TREs, the G residues at the second and third
positions of the second half-site are absolutely required for binding.
In addition, an RXR is absolutely required for binding under our
conditions (data not shown). No significant differences in binding to
any of these sequences were found using TR or TRß with either
heterodimer partner RXR or RXRß (data not shown).
Behavior of the TREs in Transient Transfection Assays
The ability of the TH/bZIP TREs to mediate TH-induced
transcription was tested by transient transfection using a
TH-responsive Xenopus kidney cell line, XLA. First, various
TREs were cloned 40 bp upstream of the start site of a truncated
minimal mouse mammary tumor virus (MMTV) promoter (
MTV)
driving the expression of the firefly luciferase gene (30). The single
xBTEB TRE permits strong TH-induced up-regulation of the reporter (Fig. 3C). When both TH/bZIP TREs are together (TH/bZIP TRE1+ TRE2, separated
by 5 bp as in the native promoter), strong activation of the construct
is observed that is equal to or greater than the xBTEB TRE. The
activation of the coupled TH/bZIP TREs is more than additive over the
activation of each TRE alone (Fig. 3C). The second and third G residues
of the 3' half-sites are again absolutely required for induction, as
they are in binding assays. We consistently observe a 15- to 30-fold
activation of the xBTEB or coupled TH/bZIP TREs in the context of this
heterologous promoter without the need for cotransfection of TRs in XLA
cells. A mammalian TRE from the rat GH gene is induced barely over the
vector alone. Despite the apparent synergistic interaction of the
TH/bZIP TREs, the single xBTEB and coupled TH/bZIP TREs mediate
transcriptional activation with very similar dose-response curves (Fig. 3D).
We tested the transcriptional activation of the TH/bZIP TREs in the
context of their own promoter. The conserved region of the TH/bZIP
promoters (including exon 1, -246 to +130 relative to the
transcription start site) was cloned upstream of the luciferase gene
and assayed for TH induction in transiently transfected XLA cells (Fig. 4A). A consistent 5- to 10-fold induction
was detected using the wild-type promoter, and no induction is observed
when both TREs are deleted. Curiously, deletion of the weaker TRE2
resulted in an even stronger induction of the reporter gene.
Nevertheless, at least one of the two TREs (TRE1) is required for TH
induction of the TH/bZIP promoter in these assays.
|
). There is
a low level of early up-regulation, eventually reaching maximal
induction at 24 h after TH addition. By contrast, there is a rapid
and steady increase of luciferase activity induced from the TH/bZIP
TREs in the heterologous MTV promoter (Fig. 4B). The TH/bZIP TREs
and the xBTEB TRE are induced nearly identically in the MTV promoter
(data not shown). Our preliminary results indicate that the early xBTEB
promoter fused to its TRE containing enhancer shows a more rapid
response than TH/bZIP promoter as well (J. D. Furlow, A. Kanamori,
and D. D. Brown, manuscript in preparation). Two different
approaches were used in an attempt to override the sluggish early
induction of the TH/bZIP promoter. First, replacing the weaker TH/bZIP
TRE2 with the potent xBTEB TRE in the context of the TH/bZIP promoter
did not change the overall early/late kinetics, although the final
induction level was higher (Fig. 4C). In addition, cotransfection of
expression plasmids for xTR or xTRß resulted in higher final
levels of induction but only after this initial slow response phase
(Fig. 4D). We conclude that sequences in the TH/bZIP promoter other
than the TREs account for the characteristic early/late response of the
TH/bZIP gene.
Analysis of the TH/bZIP Promoter in Transgenic X.
laevis Tadpoles
The ultimate test of a proposed regulatory sequence’s role in
governing the expression of a gene is its ability to direct proper
temporal and spatial expression of a reporter gene in a living animal.
A new transgenic method developed for X. laevis (23) has
become a powerful tool to over- or misexpress wild-type or mutated
proteins that play a role in early development (23) or metamorphosis
(31).
We tested the ability of the TH/bZIP promoter to mediate faithful
induction of a transgene in transgenic tadpoles. The TH-inducible
TH/bZIP B promoter region used in the above transient transfection
studies was inserted upstream of the green fluorescent protein (GFP)
cDNA (32). We created more than 20 transgenic tadpoles by sperm nuclear
transplantation as described previously (23, 31). Ten of these tadpoles
were treated with TH. Six became strongly fluorescent, two weakly
fluoresced, and two did not respond. GFP expression was only detected
in T3-treated animals (Fig. 5, A and B). Strong expression was
observed in the brain (especially the ventricles, Fig. 5E), various
cartilages in the head including Meckel’s cartilage, and the
ceratohyals (Fig. 5, A and B), the intestine (Fig. 5F), and the limb
buds (Fig. 5D). Low level expression is seen in the epidermis as well.
In the tail, the highest expression is in the spinal cord and inside
the notochord (Fig. 5C). The expression pattern of
the transgene is in excellent agreement with previously described
in situ and Northern hybridization patterns for TH/bZIP (15, 19, 33, 34, 35). In particular, the TH/bZIP promoter drives transgene
expression in areas that proliferate in response to TH. No expression
was seen in larval muscle or gills, which do not express TH/bZIP
normally (34, 35). All animals that were positive for transgene
expression showed the same pattern of induction. In addition,
transgenic animals carrying the TH/bZIP promoter whose TREs had been
deleted did not show any detectable expression before or after
T3 treatment (data not shown).
|
), two did so weakly, and four showed no
detectable fluorescence. The onset of transgene expression at stage
59/60 coincided well with the stage when the endogenous TH/bZIP genes
are activated (15). Tissues where GFP expression was highest included
proliferating and differentiating cartilage of the head, and
differentiating adult muscle of the head and limbs. Overall, transgene
expression was much higher in the body, the brain, and the intestine,
all sites of normal TH/bZIP expression. While TH/bZIP mRNA disappears
at later stages of metamorphosis in the intestine (19), we observed
induced GFP expression in the above tissues even in newly metamorphosed
froglets. Consistent with in situ hybridization data (34),
transgene expression in the tail was limited to lines of fluorescence
around larval muscle (Fig. 6B), as well as deeper spinal cord and
notochord expression. We consistently observed strong transgene
expression in the epiphyseal growth plates of the bones in limbs and
digits (Fig. 6C), another area of proliferating and differentiating
cartilage.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and TRß are closely homologous with their counterparts in all
vertebrates studied to date (7). The change from tadpole to frog is
entirely dependent upon endogenous TH. Metamorphosis can be induced
precociously simply by adding TH to the rearing medium, manipulations
that are difficult if not impossible for higher vertebrates in
developmental contexts. Because of the accessibility of amphibian
tadpoles, it has been possible to identify many genes that are up- and
down-regulated dramatically by TH during metamorphosis (2, 3). Many of
the genes that have been studied in mammals as TH-response genes
respond only after days of treatment, and their up-regulation has not
been shown to require protein synthesis so it is not certain that they
are direct TH-response genes (16, 37). In many cases, TH-response genes
in mammals are only up-regulated a few fold over baseline. It has been
difficult to derive generalizations about the contribution of the TREs
and flanking regulatory sequences to the speed and magnitude of TH
responses because no systematic studies of the mechanisms of induction
of different classes of response genes within the same cell have been
undertaken (22). For this reason, we have begun a study of the
mechanism of transcriptional activation of the most dramatically
up-regulated genes from different kinetic classes that were identified
in the screen for TH-induced genes during X. laevis
metamorphosis. Even though xBTEB, TRß, and TH/bZIP are direct response genes as determined by at least partial resistance to cycloheximide when induced with exogenous TH, the kinetics of their spontaneous and induced up-regulation are very different. xBTEB and TRß respond rapidly to TH induction, while the TH/bZIP genes have an early low level of up-regulation, followed several hours later by the greatest part of the response. This delayed mRNA accumulation parallels those of the latest responding genes in the tail resorption program that is expressed completely by 48 h. During spontaneous metamorphosis, the TH/bZIP genes are among the latest to be induced in the tail and in other tissues. TH/bZIP expression sharply rises only at metamorphic climax, several days after early response genes have been induced in response to rising, circulating TH levels. Thus, it was formally possible that the TH/bZIP genes did not contain TREs or they were very weak, requiring the up-regulation of TRß before full transcriptional activation could be achieved.
The TREs, Flanking Sequences, and the Timing of TH Induction
We find that both duplicated copies of the TH/bZIP gene contain
bona fide TREs in their conserved promoters just upstream of their TATA
boxes. They are identical in sequence and position in these two
coordinately regulated genes that were duplicated and began to diverge
some 30 million years ago (38). The TH/bZIP TREs bind with relatively
high affinity to TR/RXR heterodimers and confer strong TH inducibility
on a heterologous promoter. At least one of these TREs must be present
to achieve activation of the native TH/bZIP promoter in transient
transfection assays (Fig. 4) or in transgenic tadpoles (Figs. 5 and 6).
Two simple possibilities for the differential induction between early
response genes and the TH/bZIP genes are the different relative binding
affinities of their respective TREs for TRs or a preference of the
TH/bZIP TREs for TRß over TR. This is an important consideration
because during metamorphosis TRß protein appears before the large
secondary activation of TH/bZIP (13). No biochemical differences were
noted between TR and TRß binding to the TH/bZIP TREs. In addition,
a transient transfection assay in a cell line that up-regulates its
endogenous TRß gene from a low baseline demonstrated strong and rapid
TH induction of early and early/late gene TREs in a heterologous
promoter (Figs. 3D and 4). Moreover, both the single xBTEB TRE and the
coupled TH/bZIP TREs respond to TH with very similar time courses and
dose-response curves when they are inserted into the same
heterologous promoter. Our data suggest that the different kinetic
responses of the two kinds of TH-inducible genes cannot be accounted
for by their slightly different TRE configurations.
DNA sequences flanking hormone response elements have been shown to affect the specificity and magnitude of a transcriptional response to a given hormone (39, 40). In fact, the promoters and enhancer sequences of the early and the biphasic X. laevis TH response genes cloned so far are markedly different. The TH/bZIP genes have a TATA box while the xBTEB and TRß genes do not. Binding sites for additional transcription factors differ between the promoters of the two kinetic classes of genes. In particular, the region in which the TH/bZIP TREs are embedded contains a striking number of potential GAGA factor sites that have been found near a number of Drosophila genes that rearrange their chromatin upon induction (41). Paradoxically, GAGA factor bound constitutively to Drosophila heat shock genes is proposed to allow rapid induction by opening chromatin to allow constitutive heat shock transcription factor access (42). Also, GAGA factor sites are found in the promoter of the early ecdysone response gene E74 in Drosophila (43), and the early TH-response gene stromelysin-3 in X. laevis (44). Although no vertebrate GAGA factor homolog has been isolated yet, we detected specific, but constitutive, specific binding of proteins from tadpole brain and tail nuclear extracts to TH/bZIP GAGA sequences (data not shown).
The induction of other transcription factors that work in parallel with the TRs may also be required for the early/late profile of the TH/bZIP genes. No obvious sites for known induced transcription factors other than TRß were observed in the TH/bZIP promoter by sequence analysis, but not all of the induced transcription factor genes may have been cloned by previous subtractive hybridization and candidate gene approaches. A GC-rich sequence located at the transcription start site may warrant more investigation, since the TH-induced xBTEB transcription factor binds to related GC-rich sequences. However, the abundant, ubiquitous, and constitutively expressed Sp1 transcription factor effectively masks xBTEB binding to such sites in in vitro DNA binding assays using various tissue and cultured cell extracts (J. D. Furlow, A. Kanamori, and D. D. Brown, manuscript in preparation). Finally, other non-DNA binding factors, such as induced TR coactivators (45), may be involved.
In Vivo Analysis of TH-Regulated Gene Expression during
Metamorphosis
Transient transfection assays provide a rapid and sensitive means
to test large numbers of constructs for regulation by a particular
hormone or other regulator. The major limitation of these assays is the
inability to gain a clear understanding of how a gene is regulated in
different cell types, at different times of development, or under the
influence of proper cell connections to the extracellular matrix and
adjacent cells. In addition, transfected plasmids are not properly
wrapped in chromatin (46). This may have misleading consequences in
interpreting results of transfection studies to fully understand the
spatial and temporal transcriptional regulation of an endogenous gene
of interest. Recently, a series of studies were conducted on the
Xenopus TRßA gene promoter and its associated TRE, which
was assembled into chromatin upon injection into Xenopus
oocytes (10, 47, 48, 49). First, these studies suggest that repression of
the TRßA promoter in the absence of TH is the result of the assembly
of a repressive chromatin state over start site mediated by unliganded
TR/RXR. This repression is at least partly dependent on histone
deacetylase activity (10, 49). Second, transcriptional activation in
this system involves the localized disruption of chromatin structure,
but that process alone may not completely explain hormone-regulated
transcriptional activation (48). In light of these findings, the
delayed kinetics of the TH/bZIP genes may be the result of a more
completely repressed state to overcome than is found in early response
genes, requiring qualitative or quantitative differences in the
assembly of chromatin remodeling complexes at early/late promoters.
Repression of the TH/bZIP genes until metamorphosis is probably more
complicated than assembly of repressive chromatin mediated by TR/RXR
complexes because the genes are silent throughout the entire length of
embryonic and larval development until TH levels peak at metamorphic
climax.
The new transgenic technique for X. laevis integrates DNA
before first cleavage so that the construct is replicated along with
host chromatin (23). The ability to create large numbers of transgenic
animals presents a new way to analyze the transcriptional regulation of
genes integrated in chromatin in all cells of a live, developing
animal. This is demonstrated by the faithful expression of a reporter
gene in patterns that are highly similar to the known expression
patterns of the endogenous TH/bZIP genes (Figs. 5 and 6). The TREs are
required for the regulation of these genes not only in vitro
but also in vivo. Because of the variability of levels of
expression between individuals and the stability of the GFP protein,
the subtle kinetics of TH induction can not be done currently in
F0 animals using this reporter. However, this method
provides a rapid screen for the role of TRE-flanking sequences in the
developmentally and spatially restricted up-regulation of this
transcription factor gene. Most importantly, we can envision using this
methodology to determine the in vivo roles of TR isoforms
and other constitutive and induced transcription factors in governing
the precise TH-mediated regulation of the TH/bZIP and other response
genes at metamorphosis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
For Southern blot analysis, 10 µg homozygous diploid genomic X. laevis DNA (24) was digested with restriction enzymes and electrophoresed on a 0.7% agarose gel. The gel was transferred to Nytran Plus nylon membranes (Schleicher & Schuell, Inc., Keene, NH) (52) and hybridized with DNA from within exon 1 (-246 to +130) of TH/bZIP B using previously described hybridization conditions (15).
Genomic Cloning
A homozygous diploid X. laevis genomic DNA library
(gift of Keith Joho) in GEM-11 vector (Promega Corp.,
Madison, WI) was screened using a full-length (2.1 kb) TH/bZIP A cDNA
probe as described (53). Partially purified phage DNA from clones
that were still positive after three rounds of screening was isolated
from 250 ml liquid cultures (52). DNA was further purified by RNase
A digestion, polyethylene glycol precipitation, phenol/chloroform
extraction, and ethanol precipitation with ammonium acetate.
Restriction maps of the genomic clones and approximate positions of
coding sequences were determined by digestion with various restriction
enzymes followed by Southern hybridization with primers specific to
each end of the vector or to TH/bZIP cDNA sequences. PCR using
Taq extender (Stratagene, La Jolla, CA), and
combinations of vector and cDNA-derived primers determined orientation
and position of the exons. Genomic clones and plasmid-based subclones
were sequenced using gene-specific primers by automated sequencing
(PE Applied Biosystems, Norwalk, CT). Potential
transcription factor binding sites were identified by analyzing the
TH/bZIP gene sequences using the Signal Scan program on the NIH World
Wide Web server, Signal Scan (54), and the TFD (55) and TRANSFAC
(56) databases.
In Vitro Translation of Receptor Proteins
Capped X. laevis TR and TRß mRNAs were
synthesized in vitro as described previously (13). X.
laevis RXR cDNA was obtained as a gift from B. Blumberg and E.
DeRobertis (57), and xRXRß cDNA was a gift from R. Old (58). The
coding sequences of xRXR and xRXRß were PCR amplified and
subcloned into pSP64A (Promega Corp.) for in
vitro transcription. Cold or [35S]methionine-labeled
receptor proteins were produced by in vitro translation of 2
µg mRNA in wheat germ extract (Promega Corp.) as
described previously (13). Production of full-length receptor protein
was assessed by SDS-PAGE and autoradiography (data not shown). We
typically produce 200,000–500,000 trichloroacetic acid-precipitable
cpm/µl with a 15–45% efficiency of incorporation.
Gel Shift Assays
Reverse gel shift assays were performed as described by Urness
and Thummel (26) with some modifications. Purified DNA from
individual genomic clones, GEM-11 DNA (Promega Corp.),
and genomic subclones in pBluescript II KS- (Stratagene)
were digested with RsaI or AluI and purified by
phenol/chloroform extraction and ethanol precipitation. Digested
DNA (1.5 µg) or about 0.2 µg digested plasmid DNA (6 x
10-14 M, 4 nM final DNA
concentration) was mixed with 0.5 µl in vitro translated
35S-labeled TR or ß and 1 µl unlabeled, in
vitro translated RXR or -ß or unprogrammed wheat germ extract
in binding buffer [20 mM Tris Cl, (pH 7.6), 150
mM KCl, 3 mM MgCl2, 1
mM EDTA, 1 mM dithiothreitol) and sonicated 1
µg poly(dI-dC) in a final volume of 15 µl. After incubation at room
temperature for 30 min, the reactions were cooled on ice, mixed with 5
µl loading buffer (26), and loaded on prerun 4% (29:1)
polyacrylamide gels in 0.5x Tris-borate-EDTA (TBE). The gels
were electrophoresed in 0.5 x TBE at 200 V at 4 C for 2 h,
fixed for 1 h in 50% methanol/10% acetic acid, rehydrated with
water for 10 min, dried under vacuum, and autoradiographed.
For standard gel shift assays (cold protein, labeled DNA), oligonucleotides were annealed by heating in 10 mM Tris Cl (pH 8.0), 1 mM EDTA, 100 mM NaCl to 90 C for 10 min and then cooled over several hours to room temperature for use as probes or unlabeled competitor. Both strands are shown for the DR+4 oligonucleotide; only the top strand (5'-3') is shown for the rest of the oligonucleotides. Each annealed oligo had a 5'-HindIII overhang for end labeling or cloning (see below). TRE half-sites are bold; mutated bases are underlined:
DR+4 TRE: 5'-ACGTTCAGGGAAGGTCATCTGAGGTCACAGCTTA-3' 3'-AGTCCCTTCCAGTAGACTCCAGTGTCGAATTCGA-5'
xBTEB TRE: ACGTTCAGGGAAGTTCATCTGAGGACACAGCTTA
bZIP TRE1: AGCTTGCACTAGGGTTAAGTAAGGTGAAT-GCTCA
bZIP mTRE1: AGCTTGCACTAGGGTTAAGTAATTTGAAT-GCTCA
bZIP TRE2: AGCTTAATGCTCAGCCTCATTTGAACTCT-GTAGA
bZIP mTRE2: AGCTTAATGCTCAGTTTCATTTGAACTCT-GTAGA
bZIP TRE1
+TRE2: AGCTTGGGTTAAGTAAGGTGAATGCTCAGCC-TCATTTGAACTCTG
bZIP mTRE1
+TRE2: AGCTTGGGTTAAGTAATTTGAATGCTCAGCCT-CATTTGAACTCTG
bZIP TRE1
+mTRE2: AGCTTGGGTTAAGTAAGGTGAATGCTCAGT-TTCATTTGAACTCTG
bZIP mTRE1
+mTRE2: AGCTTGGGTTAAGTAATTTGAATGCTCAGTT-TCATTTGAACTCTG
GH TRE: AGCTTAAAGGTAAGATCAGGGACGTGACCG-CAGA
Random: AGCTTCTAAAAAACGTTATGTAACGGA
The wild-type xBTEB TRE oligo was end labeled by filling in with
32P-dCTP, cold dATP, dGTP, and dTTP, and the Klenow
fragment of DNA polymerase. Labeled oligos were purified using G-25
spin columns (52). Reactions were carried out under the same conditions
as for reverse shift assays, this time using 1 µl each unlabeled
xTR and RXR, binding buffer with 150 mM KCl, 1 µg
sonicated poly(dI-dC), 10% glycerol, a constant amount of labeled
wild-type xBTEB TRE (30,000 cpm), and with or without a 1000-fold molar
excess of the indicated cold competitor oligo in a 30 µl reaction
volume. After adding 10 µl 4x loading dye, reactions were
electrophoresed on 6% (29:1) polyacrylamide gels as above. Gels were
dried directly and autoradiographed.
Transient Transfection Assays
TRE-containing constructs were cloned by ligating annealed
oligos (see above) into the single HindIII site of
MTV-luciferase (30). The parent MTV-luciferase vector was kindly
provided by Ron Evans (Salk Institute, San Diego, CA). DNA from -246
to +130 of TH/bZIP was amplified by PCR (using oligos with incorporated
SacI and XhoI sites) and subcloned into the pGL2
basic vector (Promega Corp.) upstream of the luciferase
gene. The TREs were deleted together or individually by inverse PCR of
the TH/bZIP promoter in pBluescript KS- (Stratagene)
using primers that are oriented in opposite directions, flank the sites
to be deleted, and contain BamHI sites. The religated PCR
products then contain a BamHI site substituted for both
TH/bZIP TREs or TH/bZIP TRE2 alone. For some experiments, the xBTEB TRE
oligo or the TH/bZIP TRE2 oligo were synthesized with BamHI
ends and then ligated into the newly created BamHI sites in
the mutated TH/bZIP constructs lacking TRE2. The mutated TH/bZIP
sequences were then amplified by PCR for cloning into pGL2-Basic as was
done for the wild-type promoter. For cotransfection of TR expression
vectors, xTRA and xTRßA1 coding sequences were cloned downstream
of the miw promoter (a hybrid RSV LTR and chicken ß-actin
promoter) (59) (gifts of Akira Kanamori, National Research Institute of
Aquaculture, Tamaki, Japan). All constructs were checked for
correct sequence, orientation, and number of TRE inserts by sequencing
as above. Plasmids were purified with Qiagen (Chatsworth,
CA) midiprep kits before transfection.
Monolayer cultures of X. laevis XLA cells were maintained in
70% Liebovitz L-15 medium (Life Technologies, Inc.,
Gaithersburg, MD) with 10% FBS (Life Technologies, Inc.)
at 24–26 C with air. For transfection, each well in Falcon six-well
tissue culture plates (Becton Dickinson, Lincoln Park, NJ) was
seeded with 1.5 x 105 cells and grown overnight in
70% L-15 with 10% resin-stripped FBS (60). Cells were transfected by
mixing 0.2 µg reporter construct (TREs in MTV-Luc) or 0.1 µg
genomic constructs in pGL2 vector and pCS2+ßGalactosidase (a gift of
Dave Turner, Fred Hutchinson Cancer Research Center, Seattle, WA) to a
final DNA concentration of 1 µg/well with 4 µl/well Lipofectamine
reagent (Life Technologies, Inc.) according to the
instructions of the manufacturer. In cotransfection experiments with
TR or ß expression vectors, 0.1 µg TH/bZIP promoter-pGL2
was mixed with 0.25 µg pmiwTRA,
pmiwTRßA1, or the parent pmiw vector as
control. The amount of pCS2+ßGalactosidase was adjusted to yield a
final amount of 1 µg/well transfected DNA. After 24 h, cells
were washed, and incubated with 70% L-15 plus stripped FBS with or
without the indicated T3 concentration. Cells from each
well were harvested at the indicated times by scraping, washing once in
PBS, and lysing in 125 µl 250 mM Tris Cl, pH 7.8, by
three freeze/thaw cycles. Extracts were assayed for luciferase (61) and
ß-galactosidase (52) activity and normalized to total protein in the
extract (Bradford assay kit, Pierce Chemical Co.,
Rockford, IL).
Transgenic X. laevis
-246 to +130 of the wild-type or TRE1 and TRE2 deleted TH/bZIP
promoter was amplified by PCR incorporating XhoI and
HindIII restriction sites on the 5'- and 3'-ends of the
fragment. This fragment was cloned into pCS2+GFP* (a gift of Dave
Turner and Nicholas Marsh-Armstrong, Carnegie Institution of
Washington, Baltimore, MD) at the SalI and
HindIII sites, replacing the cytomegalovirus promoter
with TH/bZIP promoter sequences. The GFP reporter used was a point
mutant containing a serine-to-cysteine switch at amino acid 65 (31).
Transgenic animals were created using NotI-linearized
constructs and NotI restriction enzyme as previously
described (31). Some animals were treated for 1 week with 30
nM T3, and others were allowed to develop
through metamorphosis and observed at 1- to 2-day intervals. Images
were captured before and after T3 treatment and at
metamorphic climax using a Leica Corp. fluorescent
dissecting microscope and video camera as described elsewhere (31).
Large images were assembled using Adobe Pagemaker (Adobe Systems, Inc.,
San Jose, CA).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
This research was supported by a National Research Service Award fellowship to J.D.F. and grants from the NIH (2 R01 GM-22395) and the G. Harold and Leila Y. Mathers Charitable Foundation to D.D.B.
Received for publication June 30, 1999. Revision received August 16, 1999. Accepted for publication August 19, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ß thyroid hormone receptors. Proc Natl Acad Sci USA 87:7090–7094 and ß during embryogenesis and metamorphosis in
Xenopus laevis. J Biol Chem 269:24459–24465 1 with high affinity.
J Biol Chem 268:19392–19397This article has been cited by other articles:
 |
|
 |
|
  H. Matsuda, B. D. Paul, C. Y. Choi, T. Hasebe, and Y.-B. Shi Novel Functions of Protein Arginine Methyltransferase 1 in Thyroid Hormone Receptor-Mediated Transcription and in the Regulation of Metamorphic Rate in Xenopus laevis Mol. Cell. Biol., February 1, 2009; 29(3): 745 - 757. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Wang, H. Matsuda, and Y.-B. Shi Developmental Regulation and Function of Thyroid Hormone Receptors and 9-cis Retinoic Acid Receptors during Xenopus tropicalis Metamorphosis Endocrinology, November 1, 2008; 149(11): 5610 - 5618. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Bagamasbad, K. L. Howdeshell, L. M. Sachs, B. A. Demeneix, and R. J. Denver A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor J. Biol. Chem., January 25, 2008; 283(4): 2275 - 2285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Linder, E. Mentele, K. Mansperger, T. Straub, E. Kremmer, and R. A.W. Rupp CHD4/Mi-2beta activity is required for the positioning of the mesoderm/neuroectoderm boundary in Xenopus Genes & Dev., April 15, 2007; 21(8): 973 - 983. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Paul, D. R. Buchholz, L. Fu, and Y.-B. Shi SRC-p300 Coactivator Complex Is Required for Thyroid Hormone-induced Amphibian Metamorphosis J. Biol. Chem., March 9, 2007; 282(10): 7472 - 7481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Buchholz, B. D. Paul, and Y.-B. Shi Gene-specific Changes in Promoter Occupancy by Thyroid Hormone Receptor during Frog Metamorphosis: IMPLICATIONS FOR DEVELOPMENTAL GENE REGULATION J. Biol. Chem., December 16, 2005; 280(50): 41222 - 41228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-i. Sugiyama, N. Shimada, H. Miyoshi, and K. Yamauchi Detection of Thyroid System-Disrupting Chemicals Using in Vitro and in Vivo Screening Assays in Xenopus laevis Toxicol. Sci., December 1, 2005; 88(2): 367 - 374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Paul, D. R. Buchholz, L. Fu, and Y.-B. Shi Tissue- and Gene-specific Recruitment of Steroid Receptor Coactivator-3 by Thyroid Hormone Receptor during Development J. Biol. Chem., July 22, 2005; 280(29): 27165 - 27172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Paul, L. Fu, D. R. Buchholz, and Y.-B. Shi Coactivator Recruitment Is Essential for Liganded Thyroid Hormone Receptor To Initiate Amphibian Metamorphosis Mol. Cell. Biol., July 1, 2005; 25(13): 5712 - 5724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kudo and K. Yamauchi In Vitro and in Vivo Analysis of the Thyroid Disrupting Activities of Phenolic and Phenol Compounds in Xenopus laevis Toxicol. Sci., March 1, 2005; 84(1): 29 - 37. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Mengeling, F. Pan, and M. L. Privalsky Novel Mode of Deoxyribonucleic Acid Recognition by Thyroid Hormone Receptors: Thyroid Hormone Receptor {beta}-Isoforms Can Bind as Trimers to Natural Response Elements Comprised of Reiterated Half-Sites Mol. Endocrinol., January 1, 2005; 19(1): 35 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Buchholz, A. Tomita, L. Fu, B. D. Paul, and Y.-B. Shi Transgenic Analysis Reveals that Thyroid Hormone Receptor Is Sufficient To Mediate the Thyroid Hormone Signal in Frog Metamorphosis Mol. Cell. Biol., October 15, 2004; 24(20): 9026 - 9037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Furlow, H. Y. Yang, M. Hsu, W. Lim, D. J. Ermio, G. Chiellini, and T. S. Scanlan Induction of Larval Tissue Resorption in Xenopus laevis Tadpoles by the Thyroid Hormone Receptor Agonist GC-1 J. Biol. Chem., June 18, 2004; 279(25): 26555 - 26562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Luria and J. D. Furlow Spatiotemporal retinoid-X receptor activation detected in live vertebrate embryos PNAS, June 15, 2004; 101(24): 8987 - 8992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tomita, D. R. Buchholz, and Y.-B. Shi Recruitment of N-CoR/SMRT-TBLR1 Corepressor Complex by Unliganded Thyroid Hormone Receptor for Gene Repression during Frog Development Mol. Cell. Biol., April 15, 2004; 24(8): 3337 - 3346. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Buchholz, S.-C. V. Hsia, L. Fu, and Y.-B. Shi A Dominant-Negative Thyroid Hormone Receptor Blocks Amphibian Metamorphosis by Retaining Corepressors at Target Genes Mol. Cell. Biol., October 1, 2003; 23(19): 6750 - 6758. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. T. Alarid, M. T. Preisler-Mashek, and N. M. Solodin Thyroid Hormone Is an Inhibitor of Estrogen-Induced Degradation of Estrogen Receptor-{alpha} Protein: Estrogen-Dependent Proteolysis Is Not Essential for Receptor Transactivation Function in the Pituitary Endocrinology, August 1, 2003; 144(8): 3469 - 3476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. Helbing, K. Werry, D. Crump, D. Domanski, N. Veldhoen, and C. M. Bailey Expression Profiles of Novel Thyroid Hormone-Responsive Genes and Proteins in the Tail of Xenopus laevis Tadpoles Undergoing Precocious Metamorphosis Mol. Endocrinol., July 1, 2003; 17(7): 1395 - 1409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Sachs, P. L. Jones, E. Havis, N. Rouse, B. A. Demeneix, and Y.-B. Shi Nuclear Receptor Corepressor Recruitment by Unliganded Thyroid Hormone Receptor in Gene Repression during Xenopus laevis Development Mol. Cell. Biol., December 15, 2002; 22(24): 8527 - 8538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Lim, N.-H. Nguyen, H. Y. Yang, T. S. Scanlan, and J. D. Furlow A Thyroid Hormone Antagonist That Inhibits Thyroid Hormone Action in Vivo J. Biol. Chem., September 13, 2002; 277(38): 35664 - 35670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Furlow and A. Kanamori The Transcription Factor Basic Transcription Element-Binding Protein 1 Is a Direct Thyroid Hormone Response Gene in the Frog Xenopus laevis Endocrinology, September 1, 2002; 143(9): 3295 - 3305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Lim and J. D. Furlow Ribozyme suppression of endogenous thyroid hormone receptor activity in Xenopus laevis cells Nucleic Acids Res., August 1, 2002; 30(15): 3490 - 3496. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Sachs and Y.-B. Shi Targeted chromatin binding and histone acetylation in vivo by thyroid hormone receptor during amphibian development PNAS, November 8, 2000; (2000) 260141297. [Abstract] [Full Text]
|
|
|
|
|
|
L. M. Sachs and Y.-B. Shi Targeted chromatin binding and histone acetylation in vivo by thyroid hormone receptor during amphibian development PNAS, November 21, 2000; 97(24): 13138 - 13143. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
