| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
and Estrogen Receptors
INSERM U148 Hormones and Cancer and University of Montpellier
(S.T., S.B., A.B., V.C.) 34090 Montpellier, France
INSERM U414-Centre de Biochimie Structurale (E.M., C.A.R.)
34060 Montpellier, France
INSERM U439 (J.-L.B.) 34090
Montpellier, France
| ABSTRACT |
|---|
|
|
|---|
(human transcriptional intermediary factor
1
). We first optimized conditions for the coactivator-dependent
receptor ligand assay to lower ED50, and we
then analyzed the ability of various natural and synthetic estrogens to
allow the binding of the two types of proteins. Results were compared
with the respective affinities of these ligands for the receptor. We
then developed a protein-protein-DNA assay allowing the quantification
of cofactor-ER-estrogen response element (ERE) complex formation in the
presence of ligand and used measurements of fluorescence anisotropy to
define the equilibrium binding parameters of the interaction. We
demonstrated that the leucine-charged domain of hTIF1
is sufficient
to interact with ERE-bound ER
in a ligand-dependent manner and
showed that binding of ER
onto DNA does not significantly affect its
hormone-dependent association with TIF1
. Finally, we show that,
mainly in the absence of hormone, hTIF1
interacts better with ERß
than with ER
independently of the presence of ERE. | INTRODUCTION |
|---|
|
|
|---|
and ß, have been identified, the latter being isolated
quite recently in rat, human, and mouse (3, 4). ER
and -ß, which
exhibit distinct patterns of expression, are colocalized in several
tissues and are able to form heterodimers that can be activated by
ligand. To achieve efficient regulation of gene expression, these
receptors must interact with different types of molecules: 1) the
steroid hormone, 2) the DNA response element, and 3) various proteins
acting as transcriptional cofactors.
The DNA-binding domain, located in the central part of the receptor,
contains two zinc fingers, which recognize the estrogen response
element (ERE) (5). Ligand binding activity is located in the C-terminal
E domain of the receptor. In human ER
, critical amino acids have
been identified by alanine scanning (6) and recent data obtained from
crystal structure of 17ß-estradiol (E2)-bound ligand
binding domain confirm that residues located in helix H11 are part of
the E2-binding pocket (7, 8). Depending on the ligand size
and shape, a distinct set of residues is involved in the binding (6, 8).
Transcription is mediated by means of two activation functions (AFs),
AF-1 located in the N-terminal domain and AF-2 located in the
hormone-binding domain. One essential element required for the activity
of AF-2 is a C-terminal amphipathic
-helix (9) shown to be essential
for transcriptional activation by nuclear receptors. The mechanism
whereby this stimulation is achieved involves a ligand-induced swing of
the corresponding helix as revealed, for instance, by the crystal
structure of retinoid receptors [retinoic acid receptor-
(RAR
)
and retinoid X receptor-
(RXR
)], thyroid hormone receptors
(TR
), and ER
ligand-binding domains (7, 10, 11, 12). This
conformational transition then allows interaction with transcriptional
intermediary factors (TIFs) or coactivators (Refs. 13, 14, 15 for reviews).
Proteins from the SRC-1 (steroid receptor coactivator 1) family
together with CBP (CREB-binding protein)/p300 (16) and p/CAF
(p300/CBP associated factor) (17) possess intrinsic histone
acetyltransferases activities (18, 19, 20) and form a large multimeric
complex with activated nuclear receptors. In addition, two newly
discovered complexes [TRAP (thyroid hormone receptor-associated
protein)/DRIP (vitamin D3 receptor-interacting
protein)] (21, 22), which are in part homologous to the
mediator (23) complex, could connect nuclear receptors to the basal
transcription machinery.
The modular structure of nuclear receptors allows the activating domains to function independently and autonomously when fused to a heterologous DNA-binding domain. However, it was suggested that, due to conformational changes, binding of one partner (either ligand or DNA) could modulate the association of the receptor with the second molecule. Although several studies using various techniques (24, 25, 26) have analyzed the effects of ligands on the ability of ER to bind an ERE, the question is still debated. On the other hand, it has been shown that transcription factors (27), and ER in particular (28), are modified in an allosteric manner by DNA response elements. For instance, it was shown, using an equilibrium binding assay, that upon ERE binding one molecule of 4-hydroxytamoxifen (OHT) ligand could dissociate from the ER dimer (29).
Less work has been done on the modulation of ER interaction with cofactors. Since it was at the basis of their characterization, it is known that E2 is necessary for binding of coactivators to AF-2 (Refs. 13, 14, 30 and references therein). However, it has not been demonstrated whether there is a direct relationship between the affinity of a given ligand for the receptor and its ability to induce the binding of cofactors. As previously suggested (31), it is possible that, depending on the ligand shape, the conformational change of the receptor could be affected and this, as a consequence, could alter the interaction interface for intermediary transcription factors. The extreme situation occurs with antiestrogenic molecules that have good affinities for the receptor but, due to a different binding mode, do not allow a proper alignment of helix H12 over the ligand cavity and therefore disrupt the overall surface topography of the domain and the recruitment of coactivators (7, 8).
Concerning the effects of DNA binding on the association of cofactors
to ER
, White et al. (32) have shown that binding of SRC-1
on ER
mutants was E2-dependent in solution but became
constitutive when mutant receptors were bound onto immobilized
biotinylated ERE. Other studies suggest that DNA binding indeed plays
an active role in regulating the interaction between nuclear receptors
and cofactors. Peroxisome proliferator-activated receptor (PPAR
)
interacts strongly with N-CoR (nuclear receptor corepressor) and SMRT
(silencing mediator of retinoid and thyroid hormone receptors)
in solution but not when bound to a DNA response element (33).
Similarly, DNA exerts allosteric regulation on hRAR
conformation and
binding to SRC-1 and RIP (receptor interacting protein)140 in
response to various ligands (34).
In the present study, we have investigated how ligand and DNA
binding influence the in vitro interaction between ER
and
the transcription intermediary factor hTIF1
. We have analyzed the
ability of various natural and synthetic estrogens to allow the binding
of the two partners, and results were compared with their respective
affinities for the receptor. We then used a protein-protein-DNA assay
(PPDA) allowing the quantification of ERE-ER-cofactor complex formation
in the presence of ligand. We also studied the interaction with ERß
and performed a mutagenesis analysis of the hTIF1
leucine-charged
domain (LCD). This report contributes to a better understanding of the
different parameters governing the association between a member of the
nuclear receptor superfamily and one of their transcriptional
cofactors.
| RESULTS |
|---|
|
|
|---|
and ER
in
Vitro
cDNA has been isolated from mouse (35) and human (36)
libraries using, respectively, the yeast two-hybrid system and a
protein-protein interaction-based assay. In vitro, TIF1
was shown to interact with the hormone-binding domain of several
nuclear receptors in the presence of the cognate hormone and, in the
case of ER
, we (36) and others (35, 37) have demonstrated that
binding of ER
was clearly estrogen dependent. As shown in Fig. 1A
on a
glutathione-S-transferase (GST)-hTIF1
fusion protein is
increased in the presence of E2 and not in the presence of
various antiestrogenic compounds such as OHT, LY117018, or ICI164384 or
in the presence of a glucocorticoïd receptor agonist
(dexamethasone).
|
, was due to our experimental conditions, which
significantly lowered ligand affinity. As shown in Fig. 1
onto GST-hTIF1
was detectable even
in the presence of 0.1 nM E2. However, when
detergent concentrations were further diminished, ligand effect was
lost due to an increased binding in the absence of hormone. In the
presence of high concentrations of detergent, similar effects were
observed with disulfide bond-reducing agents such as dithiothreitol or
ß-mercaptoethanol, which increased both basal and
E2-stimulated interaction between GST-hTIF1
and ER
,
whereas incubation in the presence of hydrogen peroxide almost
completely abolished ligand effect (data not shown). These observations
suggested that formation of disulfide bonds could alter ER
conformation and its in vitro interaction with ligand and/or
with cofactors.
Using the optimized conditions (i.e. in the presence of
0.01% detergent), we then compared the effect of increasing
concentrations of E2 on the interaction between ER
and
GST fusion proteins containing fragments of either hTIF1
or hSRC-1.
The nuclear receptor interaction regions of the two cofactors
contained, respectively, one or three LCDs that exhibit the consensus
sequence LxxLL necessary for the recognition of liganded nuclear
receptors (39). As shown in Fig. 2
, interaction of ER
with both hTIF1
and SRC-1 was E2
dose dependent. The EC50s (0.6 nM) were
identical for the two proteins and corresponded to the previously
described affinity of the ligand for the receptor (for a review see
Ref. 40). The amplitude of the E2 effect was also identical
with the two cofactors and was therefore not correlated to the number
of LCDs.
|
or, conversely, depending on the shape of the ligand, are there
different conformations with different affinities for the various
effectors?
To approach this question, we analyzed the ability of different
estrogens, natural and synthetic, to increase the interaction between
hTIF1
and ER
. We used the synthetic nonsteroidal agonist
diethylstilbestrol (DES) and two metabolites of E2, namely
estrone (E1) and estriol (E3). According to
the literature, these three compounds exhibit variable binding
affinities for ER
compared with E2. The affinity of DES
is slightly higher than that of E2 whereas E1
and E3 have a 5- to 10-fold lower affinity for ER
(40, 41). In our hands, the relative binding affinities of DES,
E1, and E3, determined in the same buffer
conditions as the protein-protein interaction assay (presence of 0.01%
NP40), were, respectively, 302, 0.93, and 1.26 with
E2 being arbitrarily set at 100.
When we performed the same type of in vitro
interaction assay as in Fig. 2
, using GST-hTIF1
in the presence of
increasing concentrations (1 pM to 1 µM) of
E2, DES, E1, or E3, we observed
with all four ligands a dose-dependent binding of the labeled ER
onto GST-hTIF1
(Fig. 3
). The
EC50 values obtained from this assay roughly correlated
with compound affinities since E2 and DES were more potent
than E1 and E3. However, the rank order of
potency for the different compounds (E2 > DES >
E3 > E1) was slightly different than the
order of affinity (DES > E2 >> E3 and
E1). In these conditions, the most pronounced dissociation
was observed between E1 and E3, which exhibited
comparable affinities for the receptor but a strong difference in their
abilities to induce binding of ER
to GST-hTIF1
. It should be
noted that similar ranking of the four ligands was obtained in the same
assay using GST-hSRC1 (data not shown).
|
for DNA-bound
ER
, fluorescence anisotropy assays were performed using
baculovirus-expressed purified human ER
and a fluorescein-labeled
35-bp oligonucleotide bearing a perfect ERE. Anisotropy (mA =
[(III - IL)/(III + 2
IL)] x 1000) is the ratio of the difference between
parallel (III) and perpendicularly (IL) emitted
fluorescence to the total intensity (III + 2
IL) when parallel excitation is employed and provides a
measure of the rotational mobility of the fluorophore in question. When
the fluorophore is covalently bound to a macromolecule, its rotational
properties will reflect, in part, the rotational properties of the
macromolecule. The larger the molecule, the more slowly it will rotate.
Thus, the values expressed in milli-anisotropy units (mA) will increase
for larger molecules. This principle has been used for the study of a
large number of biomolecular interactions, in particular those
involving proteins and nucleic acids (42, 43, 44).
Figure 4
shows the results of titrations
of a solution containing 1 nM in fluorescein-labeled ERE
and 50 nM in full-length human ER
. Under these
conditions of concentration, all of the target DNA molecules are bound
by receptor, since the receptor concentration is 10-fold the
dissociation constant (41). In absence of ER
, the anisotropy of the
fluorescence emission of the fluorescein bound to the 5'-end of the
target ERE was 60 mA. Upon addition of 50 nM ER
, the
value increased to 104 mA, indicating that the ER-ERE complex has a
significantly longer overall correlation time (and is thus
significantly larger) than the free ERE.
|
were then added to the above solution, and the anisotropy
of the fluorescein-labeled ERE was measured for each point. In the
presence of 1 µM E2, there was a significant
increase in the value of the anisotropy, indicating interaction of
GST-hTIF1
with the ERE-bound ER
over the tested concentration
range, between 0.01 and 1 µM GST-hTIF1
. In the
presence of OHT, no significant increase in anisotropy was observed,
thus confirming the absence of interaction between the two proteins. In
the absence of ligand (ethanol alone), the increase in anisotropy was
observed to occur only above 1 µM in GST-hTIF1
,
implying a much lower affinity for the ER-ERE complex (not shown).
The anisotropy profile in the presence of E2 was fit to a
simple model of one molecule of GST-hTIF1
per ER-ERE complex. The
line through the points represents the results of this fit, and the
dissociation constant (Kd) for the interaction was
recovered to be 2 x 10-7 M. Since the
conditions of concentration under which we worked result in 49
nM free ER
, the GST-hTIF1
may also interact with the
free receptor. However, since the receptor does not bear any
fluorophore detectable in our experiments, these complexes cannot be
quantitated. Titrations were also carried out in the presence of
E1 and E3 (data not shown). However, although
the anisotropy increased over approximately the same range of
concentration as observed in the presence of E2, the
overall change in anisotropy was too small for a detailed analysis of
the data.
Effect of DNA Binding of ER
on Its Interaction with hTIF1
To determine whether DNA binding of ER
could modify its
interaction with TIF1
, we developed a modified version of the GST
pull-down assay using GST-hTIF1
, reticulocyte
lysate-expressed ER
, and an oligonucleotide containing a perfect
ERE. We first used 32P-labeled DNA to monitor the formation
of a ERE-ER
-hTIF1
ternary complex. As shown in Fig. 5
, A and B, retention of the labeled ERE
onto GST-hTIF1
was receptor mediated since no specific binding was
observed using unprogrammed reticulocyte lysate. Formation of the
ternary complex was increased (>10-fold) in the presence of estrogen
but not in the presence of antiestrogen. Hormonal effects were
comparable to those obtained for the interaction of labeled ER
onto
GST-hTIF1
(36). Similar results were obtained when we first
incubated the labeled ERE with ER before loading the mixture onto
GST-hTIF1
or when we added the labeled DNA onto the preformed
GST-hTIF1
-ER
complex (data not shown). The formation of the
ERE-ER
-hTIF1
ternary complex was almost maximal after 1 h
and remained stable for at least 24 h (Fig. 5C
). Using the same
experimental conditions that allow the binding of DNA-bound ER
onto
GST-hTIF1
, we then investigated the effects of increasing
concentrations of cold ERE on the binding of 35S-labeled
ER
. We demonstrated that the addition of ERE did not significantly
alter either the basal or estrogen-induced in vitro
interaction of ER
with TIF1
(Fig. 6A
). Moreover, the EC50
values for the different ligands were compared in the presence or
absence of ERE. Results shown for E2 in Fig. 6B
revealed no
significant differences upon DNA binding of the receptor.
|
|
with the two ERs,
ER
and ERß. Using the protein-protein-DNA assay conditions in the
presence or absence of ERE (Fig. 7A
was higher with ERß than with
ER
, and this effect was more pronounced in the absence of added
ligand. Similar results were obtained in classical pull-down conditions
(Fig. 7B
.
|

was sufficient to mediate its binding
onto liganded nuclear receptors. As shown in Fig. 8
(sequence
SILTSLLLN) fused to the GST were sufficient to retain specifically the
ER-ERE complex in an estrogen-dependent manner. This sequence contains
the consensus motif LxxLL present in a variable number of copies in
different nuclear receptor cofactors (39). We then performed alanine
scanning to determine which residues of this LCD are important for
in vitro interaction between hTIF1
and ER
. Mutation of
any of the hydrophobic residues at position -1, +1, +4, or +5 resulted
in a complete loss of the interaction. By contrast, replacement of one
amino acid at position +2 or +3 did not significantly modify the
binding to ER
, whereas mutation of residues at position +6 or +7
decreased the interaction by 4- to 5-fold (Fig. 8B
and ERß in the presence of E2 was also compared for
wild-type LCD together with several mutants (positions +2, +3, +6, and
+7). As shown in Fig. 8C
by mutations at position +6 and +7, thus
supporting results shown in Fig. 7
|
| DISCUSSION |
|---|
|
|
|---|
cDNA was initially isolated from mouse (35) and human (36)
libraries using, respectively, the two-hybrid system or an in
vitro protein-protein interaction assay. TIF1
and the related
protein TIF1ß may play a role in transcription repression through the
formation of inactive heterochromatin by interacting both with the KRAB
repression domain and with the heterochromatin-associated proteins
HP1
and MOD1 (45). The current hypothesis from Chambons laboratory
is that binding of liganded nuclear receptors to TIF1
may disrupt
these interactions and thus promote the conversion to open chromatin.
Such an effect of TIF1
could result from protein-protein interaction
with nuclear receptors without requiring their binding to DNA. However,
a recent paper revealed that TIF1
is an autokinase that also
phosphorylates transcription factors such as TFIIE
, TAF
(TBP-associated factor)II28, and TAFII55
(46), suggesting that hTIF1
could, in addition, act on the basal
transcription machinery when the receptors are bound onto DNA. Our data
suggest that, at least in vitro, the interaction of ER
with hTIF1
is not significantly different in the presence or absence
of an excess of a consensus ERE.
A recent report from Takeshita et al. (47) suggested that
the ligand-dependent binding of ER
and TRß1 to the C-terminal
moiety of SRC-1 [amino acids (aa) 12371441] was abolished in the
presence of DNA, whereas the ligand-dependent association of these
receptors with the central part of SRC-1 (aa 595780) was not
affected. However, in our hands, we were able to obtain
ligand-dependent formation of an ER-ERE complex onto GST-SRC-1 (aa
12411441) (data not shown). In addition, White et al. (32)
demonstrated that the binding of full-length SRC-1 to DNA-bound
wild-type full-length ER
was also ligand dependent. By contrast,
several constitutively active mouse ER
mutants (Y541D for instance)
interacted with SRC-1 in a ligand-dependent manner off DNA but not when
prebound onto DNA. Therefore, under certain conditions, a
conformational change of ER could occur upon DNA binding and modify its
interaction with some transcriptional coregulators. A still unresolved
aspect of the question concerns what occurs when receptors
transactivate in an ERE-independent manner through protein-protein
interaction with AP1 for example (48, 49, 50). The possibility that binding
of cofactors to ER
is also modulated when ER is recruited by
tethering with other transcription factors remains to be analyzed.
In addition to the fact that TIF1
may play a specific role among the
different cofactors, it also exhibits some particularities in terms of
interaction with nuclear receptors. Most of the proteins that recognize
liganded nuclear receptors (such as RIP140 or those belonging to the
SRC-1 family) possess multiple copies of the consensus LCD (39, 51). It
has been shown that binding of SRC-1 requires the presence of two
functional AF2 domains (52). More recently, an x-ray crystallographic
study revealed that two consecutive LCDs of a single SRC-1 molecule can
contact both subunits of a PPAR
homodimer (53). However, other data
indicate that two TIF2 molecules bind a nuclear receptor heterodimer
with the existence of an allosteric effect upon coactivator binding
influencing the unliganded partner of the heterodimer (54). In
addition, multiple interaction domains within a given coactivator can
function synergistically (55, 56) and also provide a source of
diversity in terms of nuclear receptor specificity (52, 57, 58, 59). By
contrast, a single LCD has been found in hTIF1
(35, 36), suggesting
that the stoichiometry of nuclear receptor-hTIF1
interaction could
be equimolar.
Our mutagenesis analysis of this motif by alanine scanning emphasizes
the importance of the two pairs of hydrophobic residues as previously
reported by others (39, 45, 57, 59, 60). Whereas leucine is almost
always found at positions +1, +4, and +5, there is a flexibility in
terms of residue that could be accomodated at position -1. The
determination of x-ray crystal structure of a PPAR
-SRC-1 complex
revealed, in the ligand-binding domain of the receptor, the existence
of a charged clamp made of the glutamate in H12 and the lysine in H3,
which establishes hydrogen bonds with residues in the LCD (53).
Depending on the nature of the sequences flanking the LCD, either N
terminal (61) or C terminal (58) to the core LxxLL motif, the
interaction exhibits some selectivity, and further mutagenesis will be
necessary to define all the determinants.
Specificity could be further regulated by ligand itself, as suggested
by the study conducted with PPAR
, which showed that, depending on
the ligand, different residues flanking the LCD are required for
high-affinity binding (58). In addition, selective interaction of
coactivators with the vitamin D3 receptor also appears to
be conditioned by the ligand structure (62). More recently, affinity
selection of peptides indicated that different binding surfaces on
ER
are exposed in response to different ligands (63). Our data on
ER
-TIF1
interaction also support the idea that ligand-specific
alterations of receptor structure may influence its capacity to recruit
transcription cofactors. The most striking difference was observed with
E1 and may suggest that the hydrogen bond interaction of
17ß-OH with residue H524 in H11 could play a role in the formation of
a proper interface for TIF1
(7). This is consistent with the
literature showing that regulation of gene expression or cell
proliferation by ER ligands is not directly related to their affinity
for the receptor (Ref. 64 and references therein). In addition, some of
the effects detectable in cell-free systems may not be obtained in cell
culture conditions due to ligand metabolism.
Based on fluorescence anisotropy measurements, the dissociation
constant for the interaction between hTIF1
and DNA-bound ER
was
recovered to be 2 x 10-7 M. This
apparent affinity was similar to that of other protein-protein
interactions between transcription factors such as the binding of CBP
to the phospho-CREB-CRE (cAMP response element) complex (43). Using
fluorescence resonance energy transfer, the interaction between
biotinylated SRC-1 (aa 568780) and the ER
ligand-binding domain
(aa 302595) was recently found to have an apparent Kd of
43 nM (65). This difference could reflect either a real
higher affinity of SRC-1, which could be due to the higher number of
LCD or to the experimental conditions since in the latter study, ER
was not full-length and not on DNA. However, consistent with the first
hypothesis, competition data suggest that TIF1
exhibits a lower
affinity for ER
than other cofactors (66). Moreover, using peptide
competition, the apparent affinities of GRIP-1-isolated LCDs were found
between 0.8 and 3.2 µM (60).
Under our experimental conditions, we found that, especially in the
absence of ligand, hTIF1
and SRC-1 (data not shown) interacted more
efficiently with ERß than with ER
. This effect was observed
independently of the presence of DNA and with wild-type or mutant LCDs.
Consistent with these observations, previous reports have indicated
that different coactivators such as SRC-1 (67) or GRIP1 (68) augmented
significantly the transcriptional activity of ERß in the absence of
ligand. By contrast, another study (69), using the BIAcore technology
to approach the affinity of SRC-3 with ERs, revealed a higher affinity
for ER
(Kdapp
1 nM). Additional
work will be necessary to determine the physiological relevance of
these observations and to define which regions of the receptor account
for the increase in basal association with some cofactors and not with
others. The major challenge in the field will be to define precisely
for each receptor the specificity of its association with the complex
repertoire of transcriptional cofactors. This specificity could vary
largely depending on the ligand, on the nature of the response element,
and on the promoter context in a given cell, thus explaining the
diversity of transcription intermediary factors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and GST-SRC1
were described previously (36, 70). GST-LCD was constructed by
inserting the double-stranded oligonucleotide:
gatccatactcacctccctgctcttaaattg gtatgagtggagggacgagaatttaacttaa
encoding from residues 720 to 728 of human TIF1
into the
BamHI/EcoRI sites of pGEX-2TK (Pharmacia Biotech, Piscataway, NJ). Human ER cDNAs were in pSG5 vector
under the control of the bacterial T7 polymerase promoter.
GST Pull-Down Assay
In vitro binding assays were performed essentially as
described previously (71). Briefly, 35S-labeled ER
was
cell free synthesized using the TNT lysate system (Promega Corp., Madison, WI) and incubated overnight at 4 C with purified
bacterially expressed GST-TIFs fusion proteins in the absence or
presence of the cognate ligands at various concentrations. Protein
interactions were analyzed either by counting or by SDS-PAGE followed
by fluorography (Amplify; Amersham Pharmacia Biotech,
Arlington Heights, IL) and quantification using a Phosphorimager (Fujix
BAS1000, Fuji, Stamford, CT). In some cases, the
gel was stained with Coomassie Brilliant Blue (Bio-Rad Laboratories, Inc., Richmond, CA) before fluorography, to
visualize the GST fusion proteins present in each track.
Protein-Protein-DNA Assay (PPDA)
The double-stranded oligonucleotide corresponding to the
vitellogenin A2 ERE (72) was 32P labeled using Klenow
enzyme. Binding reactions (60 µl) were performed for 20 min at room
temperature, in the presence or absence of ligands (1
µM), using 10 µl of ER-primed reticulocyte and the ERE
(2.5 nM) in TKE buffer (10 mM Tris, pH 7.5, 75
mM KCl, 0.5 mM EDTA) plus 0.5 mM
dithiothreitol (DTT), 0.1 µg/µl poly(dIdC), and protease
inhibitors. Depending on the conditions, the labeled component was
either the receptor (35S) or the ERE (32P).
GST fusion proteins loaded on glutathione Sepharose beads were then added in 420 µl TKE buffer in the presence of the appropriate ligand (1 µM). Binding reactions were performed overnight at 4 C and after two washes with TKE buffer, binding of either 32P ERE or 35S ER was quantified by ß counting. In some experiments, ER was first incubated with GST fusion proteins with or without E2, and after three washes, 32P-labeled ERE was then added at the same concentration in the same buffer. When both the ER and ERE were labeled, bound molecules were analyzed on a 12% polyacrylamide denaturing gel and exposed on a phosphorimager.
Ligand-Binding Assay
Competition experiments were performed essentially as described
(25) using ER
-transfected COS-1 cells.
Fluorescence Anisotropy Measurements
The target oligonucleotides of the following sequences were
purchased in HPLC-purified form from Eurogentec (Angers,
France):
5'-F-AGC TTC GAG GAG GTC ACA GTG ACC TGG AGC GGA TC-3'
3'-TCG AAG CTC CTC CAG TGT CAC TGG ACC TCG CCT AG-5'
The sense strand was 5'-labeled with a fluorescein phosphoramidite
bearing a six-carbon linker. TLC revealed no free dye in the stock
sample of the sense strand. The labeling ratio was determined by
absorption to be 75% using an extinction coefficient for fluorescein
at pH 7.6 at 488 nm of 90 x 103 cm-1
M-1, and an extinction coefficient for
the oligonucleotide at 260 nm of 3.4785 x 106
cm-1 M-1. Annealing to
make the double-stranded labeled ERE (F-ERE) was carried out by heating
a solution at 140 µM for 10 min at 85 C and then cooling
to room temperature. Baculovirus-expressed human ER
was purchased in
95% purified form from Panvera Corp. (Madison, WI). Activity before
purchase was determined by [3H]E2 binding
assays. DNA binding affinity was controlled by anisotropy assays as
described elsewhere (44).
Anisotropy titrations were carried out using a Beacon 2000 Variable
Temperature Fluorescence Polarization System (Panvera Corp.) set at 21
C. ER
titrations were performed by adding increasingly larger
aliquots of purified receptor to separate tubes of the buffer
containing the fluorescein-labeled target oligonucleotide.
For titrations of GST-hTIF1
onto the preformed ER/F-ERE
complex, GST-hTIF1
aliquots, prepared as described (43), were
successively added to 200 µl of a solution containing 1
nM F-ERE, 50 nM ER (which places it about
10-fold above the Kd and thus ensures that all of the F-ERE
is bound by receptor) and 1 µM E2 or other
ligand. Control in the absence of ligand was carried out by adding 1
µl of ethanol. Aliquots were added such that at the highest
concentrations of GST-TIF1
tested, the dilution factor was only
10%, ensuring that the ER/F-ERE complex remained stable. The buffer
was otherwise 50 mM Tris, 200 mM NaCl, 0.1
mM DTT, pH 7.6. Anisotropy values for each titration are
the result of the average of five to seven acquisitions. Due to small
instrumental differences from day to day, all values were normalized to
the value of the anisotropy of the ER/F-ERE complex before addition of
GST-hTIF1
. Binding curves were analyzed using a simple model of 1
GST-hTIF1
molecule binding to the ER/F-ERE complex using BIOEQS
software (developed by the authors; contact C. A. Royer,
royer@tome.cbs.univ_montpl.Fr) (73).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by the Institut National de la Santé et de la Recherche Médicale, the University of Montpellier I, the Ligue Nationale contre le Cancer, the Association pour la Recherche sur le Cancer, and by funds from the Institut de Recherches Internationales SERVIER (to S.T.).
Received for publication February 12, 1999. Revision received July 26, 1999. Accepted for publication August 20, 1999.
| REFERENCES |
|---|
|
|
|---|
. Nature 375:377382[CrossRef][Medline]
and
TIF1ß in the epigenetic control of transcription by nuclear
receptors. EMBO J 15:67016715[Medline]
is a protein kinase that is hyperphosphorylated upon interaction with
liganded nuclear receptors. J Biol Chem 273:1619916204
and ERß at AP1 sites. Science 277:15081510
. Nature 395:137143[CrossRef][Medline]
and ERß. Proc Natl Acad Sci USA 96:39994004
and ß form heterodimers on DNA. J Biol Chem 272:1985819862