help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thénot, S.
Right arrow Articles by Cavaillès, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thénot, S.
Right arrow Articles by Cavaillès, V.
Molecular Endocrinology 13 (12): 2137-2150
Copyright © 1999 by The Endocrine Society

Effect of Ligand and DNA Binding on the Interaction between Human Transcription Intermediary Factor 1{alpha} and Estrogen Receptors

Sandrine Thénot, Sandrine Bonnet, Abdelhay Boulahtouf, Emmanuel Margeat, Catherine A. Royer, Jean-Louis Borgna and Vincent Cavaillès

INSERM U148 Hormones and Cancer and University of Montpellier (S.T., S.B., A.B., V.C.) 34090 Montpellier, France
INSERM U414-Centre de Biochimie Structurale (E.M., C.A.R.) 34060 Montpellier, France
INSERM U439 (J.-L.B.) 34090 Montpellier, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Hormonal regulation of gene activity is mediated by nuclear receptors acting as ligand-activated transcription factors. To achieve efficient regulation of gene expression, these receptors must interact with different type of molecules: 1) the steroid hormone, 2) the DNA response element, and 3) various proteins acting as transcriptional cofactors. In the present study, we have investigated how ligand and DNA binding influence the in vitro interaction between estrogen receptors (ERs) and the transcription intermediary factor hTIF1{alpha} (human transcriptional intermediary factor 1{alpha}). We first optimized conditions for the coactivator-dependent receptor ligand assay to lower ED50, and we then analyzed the ability of various natural and synthetic estrogens to allow the binding of the two types of proteins. Results were compared with the respective affinities of these ligands for the receptor. We then developed a protein-protein-DNA assay allowing the quantification of cofactor-ER-estrogen response element (ERE) complex formation in the presence of ligand and used measurements of fluorescence anisotropy to define the equilibrium binding parameters of the interaction. We demonstrated that the leucine-charged domain of hTIF1{alpha} is sufficient to interact with ERE-bound ER{alpha} in a ligand-dependent manner and showed that binding of ER{alpha} onto DNA does not significantly affect its hormone-dependent association with TIF1{alpha}. Finally, we show that, mainly in the absence of hormone, hTIF1{alpha} interacts better with ERß than with ER{alpha} independently of the presence of ERE.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In various target tissues, estrogens regulate cell growth and differentiation by acting through estrogen receptors (ERs), which belong to a superfamily of nuclear receptors that function as ligand-dependent transcription factors (1, 2). Two estrogen-binding receptors, {alpha} and ß, have been identified, the latter being isolated quite recently in rat, human, and mouse (3, 4). ER{alpha} and -ß, which exhibit distinct patterns of expression, are colocalized in several tissues and are able to form heterodimers that can be activated by ligand. To achieve efficient regulation of gene expression, these receptors must interact with different types of molecules: 1) the steroid hormone, 2) the DNA response element, and 3) various proteins acting as transcriptional cofactors.

The DNA-binding domain, located in the central part of the receptor, contains two zinc fingers, which recognize the estrogen response element (ERE) (5). Ligand binding activity is located in the C-terminal E domain of the receptor. In human ER{alpha}, critical amino acids have been identified by alanine scanning (6) and recent data obtained from crystal structure of 17ß-estradiol (E2)-bound ligand binding domain confirm that residues located in helix H11 are part of the E2-binding pocket (7, 8). Depending on the ligand size and shape, a distinct set of residues is involved in the binding (6, 8).

Transcription is mediated by means of two activation functions (AFs), AF-1 located in the N-terminal domain and AF-2 located in the hormone-binding domain. One essential element required for the activity of AF-2 is a C-terminal amphipathic {alpha}-helix (9) shown to be essential for transcriptional activation by nuclear receptors. The mechanism whereby this stimulation is achieved involves a ligand-induced swing of the corresponding helix as revealed, for instance, by the crystal structure of retinoid receptors [retinoic acid receptor-{gamma} (RAR{gamma}) and retinoid X receptor-{alpha} (RXR{alpha})], thyroid hormone receptors (TR{alpha}), and ER{alpha} ligand-binding domains (7, 10, 11, 12). This conformational transition then allows interaction with transcriptional intermediary factors (TIFs) or coactivators (Refs. 13, 14, 15 for reviews). Proteins from the SRC-1 (steroid receptor coactivator 1) family together with CBP (CREB-binding protein)/p300 (16) and p/CAF (p300/CBP associated factor) (17) possess intrinsic histone acetyltransferases activities (18, 19, 20) and form a large multimeric complex with activated nuclear receptors. In addition, two newly discovered complexes [TRAP (thyroid hormone receptor-associated protein)/DRIP (vitamin D3 receptor-interacting protein)] (21, 22), which are in part homologous to the mediator (23) complex, could connect nuclear receptors to the basal transcription machinery.

The modular structure of nuclear receptors allows the activating domains to function independently and autonomously when fused to a heterologous DNA-binding domain. However, it was suggested that, due to conformational changes, binding of one partner (either ligand or DNA) could modulate the association of the receptor with the second molecule. Although several studies using various techniques (24, 25, 26) have analyzed the effects of ligands on the ability of ER to bind an ERE, the question is still debated. On the other hand, it has been shown that transcription factors (27), and ER in particular (28), are modified in an allosteric manner by DNA response elements. For instance, it was shown, using an equilibrium binding assay, that upon ERE binding one molecule of 4-hydroxytamoxifen (OHT) ligand could dissociate from the ER dimer (29).

Less work has been done on the modulation of ER interaction with cofactors. Since it was at the basis of their characterization, it is known that E2 is necessary for binding of coactivators to AF-2 (Refs. 13, 14, 30 and references therein). However, it has not been demonstrated whether there is a direct relationship between the affinity of a given ligand for the receptor and its ability to induce the binding of cofactors. As previously suggested (31), it is possible that, depending on the ligand shape, the conformational change of the receptor could be affected and this, as a consequence, could alter the interaction interface for intermediary transcription factors. The extreme situation occurs with antiestrogenic molecules that have good affinities for the receptor but, due to a different binding mode, do not allow a proper alignment of helix H12 over the ligand cavity and therefore disrupt the overall surface topography of the domain and the recruitment of coactivators (7, 8).

Concerning the effects of DNA binding on the association of cofactors to ER{alpha}, White et al. (32) have shown that binding of SRC-1 on ER{alpha} mutants was E2-dependent in solution but became constitutive when mutant receptors were bound onto immobilized biotinylated ERE. Other studies suggest that DNA binding indeed plays an active role in regulating the interaction between nuclear receptors and cofactors. Peroxisome proliferator-activated receptor (PPAR{gamma}) interacts strongly with N-CoR (nuclear receptor corepressor) and SMRT (silencing mediator of retinoid and thyroid hormone receptors) in solution but not when bound to a DNA response element (33). Similarly, DNA exerts allosteric regulation on hRAR{alpha} conformation and binding to SRC-1 and RIP (receptor interacting protein)140 in response to various ligands (34).

In the present study, we have investigated how ligand and DNA binding influence the in vitro interaction between ER{alpha} and the transcription intermediary factor hTIF1{alpha}. We have analyzed the ability of various natural and synthetic estrogens to allow the binding of the two partners, and results were compared with their respective affinities for the receptor. We then used a protein-protein-DNA assay (PPDA) allowing the quantification of ERE-ER-cofactor complex formation in the presence of ligand. We also studied the interaction with ERß and performed a mutagenesis analysis of the hTIF1{alpha} leucine-charged domain (LCD). This report contributes to a better understanding of the different parameters governing the association between a member of the nuclear receptor superfamily and one of their transcriptional cofactors.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ligand-Dependent Interaction between hTIF1{alpha} and ER{alpha} in Vitro
TIF1{alpha} cDNA has been isolated from mouse (35) and human (36) libraries using, respectively, the yeast two-hybrid system and a protein-protein interaction-based assay. In vitro, TIF1{alpha} was shown to interact with the hormone-binding domain of several nuclear receptors in the presence of the cognate hormone and, in the case of ER{alpha}, we (36) and others (35, 37) have demonstrated that binding of ER{alpha} was clearly estrogen dependent. As shown in Fig. 1AGo, the retention of in vitro translated 35S-labeled full-length ER{alpha} on a glutathione-S-transferase (GST)-hTIF1{alpha} fusion protein is increased in the presence of E2 and not in the presence of various antiestrogenic compounds such as OHT, LY117018, or ICI164384 or in the presence of a glucocorticoïd receptor agonist (dexamethasone).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. In Vitro Interaction of ER{alpha} with GST-hTIF1{alpha}

A, Pull-down experiment using a GST-hTIF1{alpha} fusion protein to precipitate in vitro expressed 35S-labeled ER{alpha} as described in Materials and Methods using 0.5% detergent. The experiment was done either in the absence of ligand (C) or in the presence of 1 µM E2, OHT, LY117018 (LY), ICI 164,384 (ICI), or Dexamethasone (Dex). Similar amounts of GST-hTIF1{alpha} fusion protein were used as judged by Coomassie Blue staining of the gel before fluorography. Results were expressed as percent of maximum. B, In vitro expressed 35S-labeled ER{alpha} was incubated in batch assays with GST-hTIF1{alpha} with (+) or without (-) 1 µM of E2 and in the presence of decreasing concentrations of NP40 as indicated. The position of precipitated labeled ER{alpha} is indicated on the left. C, Protein interactions detected in panel B were quantified using a Phosphorimager and expressed in arbitrary units.

 
When we performed dose-response experiments with E2 concentrations ranging from 1 pM to 1 µM in the conditions that we previously described (38), hormone-dependent interaction was only detectable at 10 nM and maximal at 1 µM (data not shown). This shift toward high concentrations of ligand, as compared with the known affinity of E2 for ER{alpha}, was due to our experimental conditions, which significantly lowered ligand affinity. As shown in Fig. 1Go, B and C, when similar protein-protein interaction assays were performed with decreased concentrations of detergent (0.05 or 0.01% NP40), ligand-dependent binding of ER{alpha} onto GST-hTIF1{alpha} was detectable even in the presence of 0.1 nM E2. However, when detergent concentrations were further diminished, ligand effect was lost due to an increased binding in the absence of hormone. In the presence of high concentrations of detergent, similar effects were observed with disulfide bond-reducing agents such as dithiothreitol or ß-mercaptoethanol, which increased both basal and E2-stimulated interaction between GST-hTIF1{alpha} and ER{alpha}, whereas incubation in the presence of hydrogen peroxide almost completely abolished ligand effect (data not shown). These observations suggested that formation of disulfide bonds could alter ER{alpha} conformation and its in vitro interaction with ligand and/or with cofactors.

Using the optimized conditions (i.e. in the presence of 0.01% detergent), we then compared the effect of increasing concentrations of E2 on the interaction between ER{alpha} and GST fusion proteins containing fragments of either hTIF1{alpha} or hSRC-1. The nuclear receptor interaction regions of the two cofactors contained, respectively, one or three LCDs that exhibit the consensus sequence LxxLL necessary for the recognition of liganded nuclear receptors (39). As shown in Fig. 2Go, interaction of ER{alpha} with both hTIF1{alpha} and SRC-1 was E2 dose dependent. The EC50s (0.6 nM) were identical for the two proteins and corresponded to the previously described affinity of the ligand for the receptor (for a review see Ref. 40). The amplitude of the E2 effect was also identical with the two cofactors and was therefore not correlated to the number of LCDs.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Estradiol Dose Response on ER{alpha}-Coactivator Interaction

The ability of increasing concentrations of E2 to induce an interaction between ER{alpha} and GST-hTIF1{alpha} or GST-hSRC1 was tested in pull-down experiments as described in Fig. 1Go using 0.01% NP40. The average with SD of three independent experiments, not triplicates, is shown. EC50 is approximately 0.6 nM.

 
Relationship between Ligand Affinity and Potency
In the molecular pharmacology of steroid hormone in which three partners (ligand, receptor and effector) are implicated, an important question remains the relationship between ligand affinity for the receptor measured as the dissociation constant and its potency, corresponding in our case to its ability to induce a conformation of the receptor, which allows in vitro binding of the effector. In other words, is there a single agonist-bound conformation of ER{alpha} or, conversely, depending on the shape of the ligand, are there different conformations with different affinities for the various effectors?

To approach this question, we analyzed the ability of different estrogens, natural and synthetic, to increase the interaction between hTIF1{alpha} and ER{alpha}. We used the synthetic nonsteroidal agonist diethylstilbestrol (DES) and two metabolites of E2, namely estrone (E1) and estriol (E3). According to the literature, these three compounds exhibit variable binding affinities for ER{alpha} compared with E2. The affinity of DES is slightly higher than that of E2 whereas E1 and E3 have a 5- to 10-fold lower affinity for ER{alpha} (40, 41). In our hands, the relative binding affinities of DES, E1, and E3, determined in the same buffer conditions as the protein-protein interaction assay (presence of 0.01% NP40), were, respectively, 302, 0.93, and 1.26 with E2 being arbitrarily set at 100.

When we performed the same type of in vitro interaction assay as in Fig. 2Go, using GST-hTIF1{alpha} in the presence of increasing concentrations (1 pM to 1 µM) of E2, DES, E1, or E3, we observed with all four ligands a dose-dependent binding of the labeled ER{alpha} onto GST-hTIF1{alpha} (Fig. 3Go). The EC50 values obtained from this assay roughly correlated with compound affinities since E2 and DES were more potent than E1 and E3. However, the rank order of potency for the different compounds (E2 > DES > E3 > E1) was slightly different than the order of affinity (DES > E2 >> E3 and E1). In these conditions, the most pronounced dissociation was observed between E1 and E3, which exhibited comparable affinities for the receptor but a strong difference in their abilities to induce binding of ER{alpha} to GST-hTIF1{alpha}. It should be noted that similar ranking of the four ligands was obtained in the same assay using GST-hSRC1 (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Potency of Natural and Synthetic Estrogens

A, The autoradiograms show representative pull-down experiments using GST-hTIF1{alpha} to precipitate ER{alpha} in the presence of 0.01% NP40. Increasing concentrations of four different ligands (E2, E1, E3, DES) were used. B, The dose-response curves correspond to the data shown in panel A. For each ligand, results are expressed as percent of maximum value obtained with E2. The experiment was repeated three times with similar results.

 
Equilibrium Binding Assay Using Fluorescence Polarization
To characterize the affinity of hTIF1{alpha} for DNA-bound ER{alpha}, fluorescence anisotropy assays were performed using baculovirus-expressed purified human ER{alpha} and a fluorescein-labeled 35-bp oligonucleotide bearing a perfect ERE. Anisotropy (mA = [(III - IL)/(III + 2 IL)] x 1000) is the ratio of the difference between parallel (III) and perpendicularly (IL) emitted fluorescence to the total intensity (III + 2 IL) when parallel excitation is employed and provides a measure of the rotational mobility of the fluorophore in question. When the fluorophore is covalently bound to a macromolecule, its rotational properties will reflect, in part, the rotational properties of the macromolecule. The larger the molecule, the more slowly it will rotate. Thus, the values expressed in milli-anisotropy units (mA) will increase for larger molecules. This principle has been used for the study of a large number of biomolecular interactions, in particular those involving proteins and nucleic acids (42, 43, 44).

Figure 4Go shows the results of titrations of a solution containing 1 nM in fluorescein-labeled ERE and 50 nM in full-length human ER{alpha}. Under these conditions of concentration, all of the target DNA molecules are bound by receptor, since the receptor concentration is 10-fold the dissociation constant (41). In absence of ER{alpha}, the anisotropy of the fluorescence emission of the fluorescein bound to the 5'-end of the target ERE was 60 mA. Upon addition of 50 nM ER{alpha}, the value increased to 104 mA, indicating that the ER-ERE complex has a significantly longer overall correlation time (and is thus significantly larger) than the free ERE.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. Analysis of the Interaction Affinity between ER{alpha} and hTIF1{alpha} Using Fluorescence Polarization Anisotropy

Anisotropy titrations were carried out as described in Materials and Methods using purified ER{alpha} and GST-hTIF1{alpha} in the presence of 1 µM E2 or OHT. Values are the result of averaging data from two to four individual titrations. Binding curves were analyzed using BIOEQS software (73 ). Uncertainties represent 67% confidence levels obtained from rigorous confidence limit testing of the recovered affinity.

 
Aliquots of a 73 µM stock solution of purified GST-hTIF1{alpha} were then added to the above solution, and the anisotropy of the fluorescein-labeled ERE was measured for each point. In the presence of 1 µM E2, there was a significant increase in the value of the anisotropy, indicating interaction of GST-hTIF1{alpha} with the ERE-bound ER{alpha} over the tested concentration range, between 0.01 and 1 µM GST-hTIF1{alpha}. In the presence of OHT, no significant increase in anisotropy was observed, thus confirming the absence of interaction between the two proteins. In the absence of ligand (ethanol alone), the increase in anisotropy was observed to occur only above 1 µM in GST-hTIF1{alpha}, implying a much lower affinity for the ER-ERE complex (not shown).

The anisotropy profile in the presence of E2 was fit to a simple model of one molecule of GST-hTIF1{alpha} per ER-ERE complex. The line through the points represents the results of this fit, and the dissociation constant (Kd) for the interaction was recovered to be 2 x 10-7 M. Since the conditions of concentration under which we worked result in 49 nM free ER{alpha}, the GST-hTIF1{alpha} may also interact with the free receptor. However, since the receptor does not bear any fluorophore detectable in our experiments, these complexes cannot be quantitated. Titrations were also carried out in the presence of E1 and E3 (data not shown). However, although the anisotropy increased over approximately the same range of concentration as observed in the presence of E2, the overall change in anisotropy was too small for a detailed analysis of the data.

Effect of DNA Binding of ER{alpha} on Its Interaction with hTIF1{alpha}
To determine whether DNA binding of ER{alpha} could modify its interaction with TIF1{alpha}, we developed a modified version of the GST pull-down assay using GST-hTIF1{alpha}, reticulocyte lysate-expressed ER{alpha}, and an oligonucleotide containing a perfect ERE. We first used 32P-labeled DNA to monitor the formation of a ERE-ER{alpha}-hTIF1{alpha} ternary complex. As shown in Fig. 5Go, A and B, retention of the labeled ERE onto GST-hTIF1{alpha} was receptor mediated since no specific binding was observed using unprogrammed reticulocyte lysate. Formation of the ternary complex was increased (>10-fold) in the presence of estrogen but not in the presence of antiestrogen. Hormonal effects were comparable to those obtained for the interaction of labeled ER{alpha} onto GST-hTIF1{alpha} (36). Similar results were obtained when we first incubated the labeled ERE with ER before loading the mixture onto GST-hTIF1{alpha} or when we added the labeled DNA onto the preformed GST-hTIF1{alpha}-ER{alpha} complex (data not shown). The formation of the ERE-ER{alpha}-hTIF1{alpha} ternary complex was almost maximal after 1 h and remained stable for at least 24 h (Fig. 5CGo). Using the same experimental conditions that allow the binding of DNA-bound ER{alpha} onto GST-hTIF1{alpha}, we then investigated the effects of increasing concentrations of cold ERE on the binding of 35S-labeled ER{alpha}. We demonstrated that the addition of ERE did not significantly alter either the basal or estrogen-induced in vitro interaction of ER{alpha} with TIF1{alpha} (Fig. 6AGo). Moreover, the EC50 values for the different ligands were compared in the presence or absence of ERE. Results shown for E2 in Fig. 6BGo revealed no significant differences upon DNA binding of the receptor.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. The Protein-Protein-DNA Assay

A, Ligand-dependent interaction of hTIF1{alpha} with ER{alpha} in solution or bound onto DNA. GST-hTIF1{alpha} was incubated either with 35S-labeled ER{alpha} (left panel) or with cold ER{alpha} prebound onto a 32P-labeld ERE (right panel). In both conditions, a control corresponding to the use of unprogrammed reticulocyte lysate (URL) was added. Incubation were performed in the absence of ligand (C) or in the presence of 1 µM E2 (E) or OHT (O), and quantifications were made by ß counting. B, Representative autoradiogram of the assay performed with both receptor and ERE labeled. After washing, the labeled components, retained onto GST-hTIF1{alpha} in the absence or presence of E2, were separated by gel electrophoresis and detected using a Phosphorimager. Inputs (1/10) corresponding to labeled ER{alpha} and ERE are shown on the left (lanes 1 and 2). C, Time course of the binding of the ER-ERE complex onto hTIF1{alpha}. In vitro expressed ER{alpha} was prebound onto labeled ERE and incubated with GST-hTIF1{alpha} in the absence (triangle) or presence (solid circles) of E2. Ternary complex formation was measured by ß counting as a function of time. Controls correspond to the binding of 32P-labeled ERE in the presence of unprogrammed reticulocyte lysate (open circles).

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. In Vitro Interaction of ER{alpha} with GST-hTIF1{alpha} in the Presence of ERE

A, Ligand-dependent interaction of 35S-labeled ER{alpha} with GST-hTIF1{alpha} was analyzed using PPDA conditions with increasing concentrations of cold ERE. The interactions were quantified using a Phosphorimager. The results of a representative autoradiogram (expressed as percent of control) are shown as the mean of triplicates ± SD. Open boxes correspond to binding in the absence of ligand and black boxes represent binding in the presence of 1 µM E2. B, Effect of increasing concentrations of E2 on the interaction of 35S-labeled ER{alpha} with GST-hTIF1{alpha} in the presence (solid circles) or absence (open circles) of cold ERE (100 pM). Binding was analyzed as in panel A and results represent mean of two determinations.

 
We then compared the interaction of GST-hTIF1{alpha} with the two ERs, ER{alpha} and ERß. Using the protein-protein-DNA assay conditions in the presence or absence of ERE (Fig. 7AGo), we found that interaction on GST-hTIF1{alpha} was higher with ERß than with ER{alpha}, and this effect was more pronounced in the absence of added ligand. Similar results were obtained in classical pull-down conditions (Fig. 7BGo), when receptors were tested either separately or simultaneously for their ability to interact with GST-hTIF1{alpha}.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 7. In Vitro Interaction of hTIF1{alpha} with ER{alpha} and -ß

A, Ligand-dependent interaction of 35S-labeled ER{alpha} or -ß with GST-hTIF1{alpha} was analyzed using PPDA conditions and quantified using a Phosphorimager. Results were obtained either in the absence or presence of ERE and represent the mean of two independent experiments. B, Pull-down experiment using GST-hTIF1{alpha} to precipitate in vitro expressed 35S-labeled ER{alpha} or ERß either in the absence of ligand (C) or in the presence of 1 µM E2 (E). Binding of the two receptors was analyzed either separately or in the same assay. Aliquots of labeled ER{alpha} and -ß translation products are shown (lane I), and their position is indicated on the right.

 
Characterization of the Nuclear Receptor-Binding Site on hTIF1{alpha}
We (36) and others (35) previously demonstrated that a short region of human or mouse TIF1{alpha} was sufficient to mediate its binding onto liganded nuclear receptors. As shown in Fig. 8Go, nine residues of hTIF1{alpha} (sequence SILTSLLLN) fused to the GST were sufficient to retain specifically the ER-ERE complex in an estrogen-dependent manner. This sequence contains the consensus motif LxxLL present in a variable number of copies in different nuclear receptor cofactors (39). We then performed alanine scanning to determine which residues of this LCD are important for in vitro interaction between hTIF1{alpha} and ER{alpha}. Mutation of any of the hydrophobic residues at position -1, +1, +4, or +5 resulted in a complete loss of the interaction. By contrast, replacement of one amino acid at position +2 or +3 did not significantly modify the binding to ER{alpha}, whereas mutation of residues at position +6 or +7 decreased the interaction by 4- to 5-fold (Fig. 8BGo). The binding to ER{alpha} and ERß in the presence of E2 was also compared for wild-type LCD together with several mutants (positions +2, +3, +6, and +7). As shown in Fig. 8CGo, no significant differences were obtained for mut+2 and mut+3 compared with wild type, whereas binding to ERß was less affected than ER{alpha} by mutations at position +6 and +7, thus supporting results shown in Fig. 7Go.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 8. Effects of Mutations in the hTIF1{alpha} LCD on Interaction with DNA-Bound ERs

A, The amino acid sequence and position numbers of hTIF1{alpha} LCD are shown together with the LxxLL consensus. B, Alanine scanning mutagenesis analysis of the hTIF1{alpha} LCD. Height mutants of the LCD were generated as GST fusion proteins (mut-1 to mut+7), and their ability to interact in a ligand-dependent manner with an ER-ERE complex was assessed as described in Fig. 5Go and compared with the wild-type sequence (WT). GST alone was also used as a negative control. Results are expressed as percent of WT in the presence of E2 and correspond to the mean ± SD of several independent experiments (number indicated in brackets). C, Interaction of hTIF1{alpha} mutants with ER{alpha} and ERß. The wild-type hTIF1{alpha} LCD together with four alanine mutants were tested for their ability to interact with ERE-bound ER{alpha} or ERß. Results are expressed as percent of wild-type LCD and correspond to the mean ± SD of at least five independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TIF1{alpha} cDNA was initially isolated from mouse (35) and human (36) libraries using, respectively, the two-hybrid system or an in vitro protein-protein interaction assay. TIF1{alpha} and the related protein TIF1ß may play a role in transcription repression through the formation of inactive heterochromatin by interacting both with the KRAB repression domain and with the heterochromatin-associated proteins HP1{alpha} and MOD1 (45). The current hypothesis from Chambon’s laboratory is that binding of liganded nuclear receptors to TIF1{alpha} may disrupt these interactions and thus promote the conversion to open chromatin. Such an effect of TIF1{alpha} could result from protein-protein interaction with nuclear receptors without requiring their binding to DNA. However, a recent paper revealed that TIF1{alpha} is an autokinase that also phosphorylates transcription factors such as TFIIE{alpha}, TAF (TBP-associated factor)II28, and TAFII55 (46), suggesting that hTIF1{alpha} could, in addition, act on the basal transcription machinery when the receptors are bound onto DNA. Our data suggest that, at least in vitro, the interaction of ER{alpha} with hTIF1{alpha} is not significantly different in the presence or absence of an excess of a consensus ERE.

A recent report from Takeshita et al. (47) suggested that the ligand-dependent binding of ER{alpha} and TRß1 to the C-terminal moiety of SRC-1 [amino acids (aa) 1237–1441] was abolished in the presence of DNA, whereas the ligand-dependent association of these receptors with the central part of SRC-1 (aa 595–780) was not affected. However, in our hands, we were able to obtain ligand-dependent formation of an ER-ERE complex onto GST-SRC-1 (aa 1241–1441) (data not shown). In addition, White et al. (32) demonstrated that the binding of full-length SRC-1 to DNA-bound wild-type full-length ER{alpha} was also ligand dependent. By contrast, several constitutively active mouse ER{alpha} mutants (Y541D for instance) interacted with SRC-1 in a ligand-dependent manner off DNA but not when prebound onto DNA. Therefore, under certain conditions, a conformational change of ER could occur upon DNA binding and modify its interaction with some transcriptional coregulators. A still unresolved aspect of the question concerns what occurs when receptors transactivate in an ERE-independent manner through protein-protein interaction with AP1 for example (48, 49, 50). The possibility that binding of cofactors to ER{alpha} is also modulated when ER is recruited by tethering with other transcription factors remains to be analyzed.

In addition to the fact that TIF1{alpha} may play a specific role among the different cofactors, it also exhibits some particularities in terms of interaction with nuclear receptors. Most of the proteins that recognize liganded nuclear receptors (such as RIP140 or those belonging to the SRC-1 family) possess multiple copies of the consensus LCD (39, 51). It has been shown that binding of SRC-1 requires the presence of two functional AF2 domains (52). More recently, an x-ray crystallographic study revealed that two consecutive LCDs of a single SRC-1 molecule can contact both subunits of a PPAR{gamma} homodimer (53). However, other data indicate that two TIF2 molecules bind a nuclear receptor heterodimer with the existence of an allosteric effect upon coactivator binding influencing the unliganded partner of the heterodimer (54). In addition, multiple interaction domains within a given coactivator can function synergistically (55, 56) and also provide a source of diversity in terms of nuclear receptor specificity (52, 57, 58, 59). By contrast, a single LCD has been found in hTIF1{alpha} (35, 36), suggesting that the stoichiometry of nuclear receptor-hTIF1{alpha} interaction could be equimolar.

Our mutagenesis analysis of this motif by alanine scanning emphasizes the importance of the two pairs of hydrophobic residues as previously reported by others (39, 45, 57, 59, 60). Whereas leucine is almost always found at positions +1, +4, and +5, there is a flexibility in terms of residue that could be accomodated at position -1. The determination of x-ray crystal structure of a PPAR{gamma}-SRC-1 complex revealed, in the ligand-binding domain of the receptor, the existence of a charged clamp made of the glutamate in H12 and the lysine in H3, which establishes hydrogen bonds with residues in the LCD (53). Depending on the nature of the sequences flanking the LCD, either N terminal (61) or C terminal (58) to the core LxxLL motif, the interaction exhibits some selectivity, and further mutagenesis will be necessary to define all the determinants.

Specificity could be further regulated by ligand itself, as suggested by the study conducted with PPAR{gamma}, which showed that, depending on the ligand, different residues flanking the LCD are required for high-affinity binding (58). In addition, selective interaction of coactivators with the vitamin D3 receptor also appears to be conditioned by the ligand structure (62). More recently, affinity selection of peptides indicated that different binding surfaces on ER{alpha} are exposed in response to different ligands (63). Our data on ER{alpha}-TIF1{alpha} interaction also support the idea that ligand-specific alterations of receptor structure may influence its capacity to recruit transcription cofactors. The most striking difference was observed with E1 and may suggest that the hydrogen bond interaction of 17ß-OH with residue H524 in H11 could play a role in the formation of a proper interface for TIF1{alpha} (7). This is consistent with the literature showing that regulation of gene expression or cell proliferation by ER ligands is not directly related to their affinity for the receptor (Ref. 64 and references therein). In addition, some of the effects detectable in cell-free systems may not be obtained in cell culture conditions due to ligand metabolism.

Based on fluorescence anisotropy measurements, the dissociation constant for the interaction between hTIF1{alpha} and DNA-bound ER{alpha} was recovered to be 2 x 10-7 M. This apparent affinity was similar to that of other protein-protein interactions between transcription factors such as the binding of CBP to the phospho-CREB-CRE (cAMP response element) complex (43). Using fluorescence resonance energy transfer, the interaction between biotinylated SRC-1 (aa 568–780) and the ER{alpha} ligand-binding domain (aa 302–595) was recently found to have an apparent Kd of 43 nM (65). This difference could reflect either a real higher affinity of SRC-1, which could be due to the higher number of LCD or to the experimental conditions since in the latter study, ER{alpha} was not full-length and not on DNA. However, consistent with the first hypothesis, competition data suggest that TIF1{alpha} exhibits a lower affinity for ER{alpha} than other cofactors (66). Moreover, using peptide competition, the apparent affinities of GRIP-1-isolated LCDs were found between 0.8 and 3.2 µM (60).

Under our experimental conditions, we found that, especially in the absence of ligand, hTIF1{alpha} and SRC-1 (data not shown) interacted more efficiently with ERß than with ER{alpha}. This effect was observed independently of the presence of DNA and with wild-type or mutant LCDs. Consistent with these observations, previous reports have indicated that different coactivators such as SRC-1 (67) or GRIP1 (68) augmented significantly the transcriptional activity of ERß in the absence of ligand. By contrast, another study (69), using the BIAcore technology to approach the affinity of SRC-3 with ERs, revealed a higher affinity for ER{alpha} (Kdapp ~ 1 nM). Additional work will be necessary to determine the physiological relevance of these observations and to define which regions of the receptor account for the increase in basal association with some cofactors and not with others. The major challenge in the field will be to define precisely for each receptor the specificity of its association with the complex repertoire of transcriptional cofactors. This specificity could vary largely depending on the ligand, on the nature of the response element, and on the promoter context in a given cell, thus explaining the diversity of transcription intermediary factors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recombinant Vectors
The recombinant vectors allowing expression in Escherichia coli of GST-TIF1{alpha} and GST-SRC1 were described previously (36, 70). GST-LCD was constructed by inserting the double-stranded oligonucleotide: gatccatactcacctccctgctcttaaattg gtatgagtggagggacgagaatttaacttaa encoding from residues 720 to 728 of human TIF1{alpha} into the BamHI/EcoRI sites of pGEX-2TK (Pharmacia Biotech, Piscataway, NJ). Human ER cDNAs were in pSG5 vector under the control of the bacterial T7 polymerase promoter.

GST Pull-Down Assay
In vitro binding assays were performed essentially as described previously (71). Briefly, 35S-labeled ER{alpha} was cell free synthesized using the TNT lysate system (Promega Corp., Madison, WI) and incubated overnight at 4 C with purified bacterially expressed GST-TIFs fusion proteins in the absence or presence of the cognate ligands at various concentrations. Protein interactions were analyzed either by counting or by SDS-PAGE followed by fluorography (Amplify; Amersham Pharmacia Biotech, Arlington Heights, IL) and quantification using a Phosphorimager (Fujix BAS1000, Fuji, Stamford, CT). In some cases, the gel was stained with Coomassie Brilliant Blue (Bio-Rad Laboratories, Inc., Richmond, CA) before fluorography, to visualize the GST fusion proteins present in each track.

Protein-Protein-DNA Assay (PPDA)
The double-stranded oligonucleotide corresponding to the vitellogenin A2 ERE (72) was 32P labeled using Klenow enzyme. Binding reactions (60 µl) were performed for 20 min at room temperature, in the presence or absence of ligands (1 µM), using 10 µl of ER-primed reticulocyte and the ERE (2.5 nM) in TKE buffer (10 mM Tris, pH 7.5, 75 mM KCl, 0.5 mM EDTA) plus 0.5 mM dithiothreitol (DTT), 0.1 µg/µl poly(dIdC), and protease inhibitors. Depending on the conditions, the labeled component was either the receptor (35S) or the ERE (32P).

GST fusion proteins loaded on glutathione Sepharose beads were then added in 420 µl TKE buffer in the presence of the appropriate ligand (1 µM). Binding reactions were performed overnight at 4 C and after two washes with TKE buffer, binding of either 32P ERE or 35S ER was quantified by ß counting. In some experiments, ER was first incubated with GST fusion proteins with or without E2, and after three washes, 32P-labeled ERE was then added at the same concentration in the same buffer. When both the ER and ERE were labeled, bound molecules were analyzed on a 12% polyacrylamide denaturing gel and exposed on a phosphorimager.

Ligand-Binding Assay
Competition experiments were performed essentially as described (25) using ER{alpha}-transfected COS-1 cells.

Fluorescence Anisotropy Measurements
The target oligonucleotides of the following sequences were purchased in HPLC-purified form from Eurogentec (Angers, France):

5'-F-AGC TTC GAG GAG GTC ACA GTG ACC TGG AGC GGA TC-3'

3'-TCG AAG CTC CTC CAG TGT CAC TGG ACC TCG CCT AG-5'

The sense strand was 5'-labeled with a fluorescein phosphoramidite bearing a six-carbon linker. TLC revealed no free dye in the stock sample of the sense strand. The labeling ratio was determined by absorption to be 75% using an extinction coefficient for fluorescein at pH 7.6 at 488 nm of 90 x 103 cm-1 M-1, and an extinction coefficient for the oligonucleotide at 260 nm of 3.4785 x 106 cm-1 M-1. Annealing to make the double-stranded labeled ERE (F-ERE) was carried out by heating a solution at 140 µM for 10 min at 85 C and then cooling to room temperature. Baculovirus-expressed human ER{alpha} was purchased in 95% purified form from Panvera Corp. (Madison, WI). Activity before purchase was determined by [3H]E2 binding assays. DNA binding affinity was controlled by anisotropy assays as described elsewhere (44).

Anisotropy titrations were carried out using a Beacon 2000 Variable Temperature Fluorescence Polarization System (Panvera Corp.) set at 21 C. ER{alpha} titrations were performed by adding increasingly larger aliquots of purified receptor to separate tubes of the buffer containing the fluorescein-labeled target oligonucleotide.

For titrations of GST-hTIF1{alpha} onto the preformed ER/F-ERE complex, GST-hTIF1{alpha} aliquots, prepared as described (43), were successively added to 200 µl of a solution containing 1 nM F-ERE, 50 nM ER (which places it about 10-fold above the Kd and thus ensures that all of the F-ERE is bound by receptor) and 1 µM E2 or other ligand. Control in the absence of ligand was carried out by adding 1 µl of ethanol. Aliquots were added such that at the highest concentrations of GST-TIF1{alpha} tested, the dilution factor was only 10%, ensuring that the ER/F-ERE complex remained stable. The buffer was otherwise 50 mM Tris, 200 mM NaCl, 0.1 mM DTT, pH 7.6. Anisotropy values for each titration are the result of the average of five to seven acquisitions. Due to small instrumental differences from day to day, all values were normalized to the value of the anisotropy of the ER/F-ERE complex before addition of GST-hTIF1{alpha}. Binding curves were analyzed using a simple model of 1 GST-hTIF1{alpha} molecule binding to the ER/F-ERE complex using BIOEQS software (developed by the authors; contact C. A. Royer, royer@tome.cbs.univ_montpl.Fr) (73).


    ACKNOWLEDGMENTS
 
We thank M. G. Parker and S. Mosselman for plasmids and J. Y. Cance for photographs.


    FOOTNOTES
 
Address requests for reprints to: Vincent Cavailles, INSERM U148 Hormones and Cancer and University of Montepellier, 60 rue de Navacelles, 34090 Montpellier, France.

This work was supported by the Institut National de la Santé et de la Recherche Médicale, the University of Montpellier I, the Ligue Nationale contre le Cancer, the Association pour la Recherche sur le Cancer, and by funds from the Institut de Recherches Internationales SERVIER (to S.T.).

Received for publication February 12, 1999. Revision received July 26, 1999. Accepted for publication August 20, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Parker MG, Arbuckle N, Dauvois S, Danielian P, White R 1993 Structure and function of the estrogen receptor. Ann NY Acad Sci 684:119–126[Abstract]
  2. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  3. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  4. Giguere V, Tremblay A, Tremblay GB 1998 Estrogen receptor ß: re-evaluation of estrogen and antiestrogen signaling. Steroids 63:335–339[CrossRef][Medline]
  5. Gronemeyer H, Laudet V 1995 Transcription factors 3: nuclear receptors. Protein Profile 2:1173–1308[Medline]
  6. Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1996 Identification of amino acids in the hormone binding domain of the human estrogen receptor important in estrogen binding. J Biol Chem 271:20053–20059[Abstract/Free Full Text]
  7. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  8. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  9. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  10. Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  11. Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD, Fletterick RJ 1995 A structural role for hormone in the thyroid hormone receptor. Nature 378:690–697[CrossRef][Medline]
  12. Bourguet W, Ruff M, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-{alpha}. Nature 375:377–382[CrossRef][Medline]
  13. Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai MJ, O’Malley BW 1997 Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–164
  14. Jenster G 1998 Coactivators and corepressors as mediators of nuclear receptor function: an update. Mol Cell Endocrinol 143:1–7[CrossRef][Medline]
  15. Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9:140–147[CrossRef][Medline]
  16. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  17. Blanco JC, Minucci S, Lu J, Yang XJ, Walker KK, Chen H, Evans RM, Nakatani Y, Ozato K 1998 The histone acetylase PCAF is a nuclear receptor coactivator. Genes Dev 12:1638–1651[Abstract/Free Full Text]
  18. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  19. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  20. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  21. Fondell JD, Ge H, Roeder RG 1996 Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. Proc Natl Acad Sci USA 93:8329–8333[Abstract/Free Full Text]
  22. Rachez C, Lemon BD, Suldan Z, Bromleigh V, Gamble M, Naar AM, Erdjument-Bromage H, Tempst P, Freedman LP 1999 Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. Nature 398:824–828[CrossRef][Medline]
  23. Gu W, Malik S, Ito M, Yuan CX, Fondell JD, Zhang X, Martinez E, Qin J, Roeder RG 1999 A novel human SRB/MED-containing cofactor complex, SMCC, involved in transcription regulation. Mol Cell 3:97–108[CrossRef][Medline]
  24. Zhuang Y, Katzenellenbogen BS, Shapiro DJ 1995 Estrogen receptor mutants which do not bind 17ß-estradiol dimerize and bind to the estrogen response element in vivo. Mol Endocrinol 9:457–466[Abstract]
  25. Aliau S, Groblewski T, Borgna JL 1995 The effect of free DNA on the interactions of the estrogen receptor bound to hormone, partial antagonist or pure antagonist with target DNA. Eur J Biochem 231:204–213[Medline]
  26. Cheskis BJ, Karathanasis S, Lyttle CR 1997 Estrogen receptor ligands modulate its interaction with DNA. J Biol Chem 272:11384–11391[Abstract/Free Full Text]
  27. Lefstin JA, Yamamoto KR 1998 Allosteric effects of DNA on transcriptional regulators. Nature 392:885–888[CrossRef][Medline]
  28. Wood JR, Greene GL, Nardulli AM 1998 Estrogen response elements function as allosteric modulators of estrogen receptor conformation. Mol Cell Biol 18:1927–1934[Abstract/Free Full Text]
  29. Klinge CM, Traish AM, Bambara RA, Hilf R 1996 Dissociation of 4-hydroxytamoxifen, but not estradiol or tamoxifen aziridine, from the estrogen receptor as the receptor binds estrogen response element DNA. J Steroid Biochem Mol Biol 57:51–66[CrossRef][Medline]
  30. Glass CK, Rosenfeld MG, Rose DW, Kurokawa R, Kamei Y, Xu L, Torchia J, Ogliastro MH, Westin S 1997 Mechanisms of transcriptional activation by retinoic acid receptors. Biochem Soc Trans 25:602–605[Medline]
  31. Katzenellenbogen JA, O’Malley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol Endocrinol 10:119–131[CrossRef][Medline]
  32. White R, Sjoberg M, Kalkhoven E, Parker MG 1997 Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine. EMBO J 16:1427–1435[CrossRef][Medline]
  33. Zamir I, Dawson J, Lavinsky RM, Glass CK, Rosenfeld MG, Lazar MA 1997 Cloning and characterization of a corepressor and potential component of the nuclear hormone receptor repression complex. Proc Natl Acad Sci USA 94:14400–14405[Abstract/Free Full Text]
  34. Mouchon A, Delmotte MH, Formstecher P, Lefebvre P 1999 Allosteric regulation of the discriminative responsiveness of retinoic acid receptor to natural and synthetic ligands by retinoid X receptor and DNA. Mol Cell Biol 19:3073–3085[Abstract/Free Full Text]
  35. Le Douarin B, Pierrat B, vom Baur E, Chambon P, Losson R 1995 A new version of the two-hybrid assay for detection of protein-protein interactions. Nucleic Acids Res 23:876–878[Free Full Text]
  36. Thenot S, Henriquet C, Rochefort H, Cavailles V 1997 Differential interaction of nuclear receptors with the putative human transcriptional coactivator hTIF1. J Biol Chem 272:12062–12068[Abstract/Free Full Text]
  37. vom Baur E, Zechel C, Heery D, Heine MJ, Garnier JM, Vivat V, Le Douarin B, Gronemeyer H, Chambon P, Losson R 1996 Differential ligand-dependent interactions between the AF-2 activating domain of nuclear receptors and the putative transcriptional intermediary factors mSUG1 and TIF1. EMBO J 15:110–124[Medline]
  38. Cavailles V, Dauvois S, Danielian PS, Parker MG 1994 Interaction of proteins with transcriptionally active estrogen receptors. Proc Natl Acad Sci USA 91:10009–10013[Abstract/Free Full Text]
  39. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  40. Anstead GM, Carlson KE, Katzenellenbogen JA 1997 The estradiol pharmacophore: ligand structure-estrogen receptor binding affinity relationships and a model for the receptor binding site. Steroids 62:268–303[CrossRef][Medline]
  41. Kuiper GG, Gustafsson JA 1997 The novel estrogen receptor-ß subtype: potential role in the cell- and promoter-specific actions of estrogens and anti-estrogens. FEBS Lett 410:87–90[CrossRef][Medline]
  42. LeTilly V, Royer CA 1993 Fluorescence anisotropy assays implicate protein-protein interactions in regulating trp repressor DNA binding. Biochemistry 32:7753–7758[CrossRef][Medline]
  43. Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH 1994 Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223–226[CrossRef][Medline]
  44. Ozers MS, Hill JJ, Ervin K, Wood JR, Nardulli JM, Royer CA, Gorski J 1997 Equilibrium binding of estrogen receptor with DNA using fluorescence anisotropy. J Biol Chem 272:30405–30411[Abstract/Free Full Text]
  45. Le Douarin B, Nielsen AL, Garnier JM, Ichinose H, Jeanmougin F, Losson R, Chambon P 1996 A possible involvement of TIF1{alpha} and TIF1ß in the epigenetic control of transcription by nuclear receptors. EMBO J 15:6701–6715[Medline]
  46. Fraser RA, Heard DJ, Adam S, Lavigne AC, Le Douarin B, Tora L, Losson R, Rochette-Egly C, Chambon P 1998 The putative cofactor TIF1{alpha} is a protein kinase that is hyperphosphorylated upon interaction with liganded nuclear receptors. J Biol Chem 273:16199–16204[Abstract/Free Full Text]
  47. Takeshita A, Yen PM, Ikeda M, Cardona GR, Liu Y, Koibuchi N, Norwitz ER, Chin WW 1998 Thyroid hormone response elements differentially modulate the interactions of thyroid hormone receptors with two receptor binding domains in the steroid receptor coactivator-1. J Biol Chem 273:21554–21562[Abstract/Free Full Text]
  48. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract]
  49. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  50. Philips A, Teyssier C, Galtier F, Rivier-Covas C, Rey JM, Rochefort H, Chalbos D 1998 FRA-1 expression level modulates regulation of activator protein-1 activity by estradiol in breast cancer cells. Mol Endocrinol 12:973–985[Abstract/Free Full Text]
  51. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  52. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  53. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–143[CrossRef][Medline]
  54. Leers J, Treuter E, Gustafsson JA 1998 Mechanistic principles in NR box-dependent interaction between nuclear hormone receptors and the coactivator TIF2. Mol Cell Biol 18:6001–6013[Abstract/Free Full Text]
  55. Schmidt S, Baniahmad A, Eggert M, Schneider S, Renkawitz 1998 Multiple receptor interaction domains of GRIP1 function in synergy. Nucleic Acids Res 26:1191–1197[Abstract/Free Full Text]
  56. Hong H, Darimont BD, Ma H, Yang L, Yamamoto KR, Stallcup MR 1999 An additional region of coactivator GRIP1 required for interaction with the hormone-binding domains of a subset of nuclear receptors. J Biol Chem 274:3496–3502[Abstract/Free Full Text]
  57. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313[Abstract/Free Full Text]
  58. McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J, Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK, Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 12:3357–3368[Abstract/Free Full Text]
  59. Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J 17:507–519[CrossRef][Medline]
  60. Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev 12:3343–3356[Abstract/Free Full Text]
  61. Mak HY, S Hoare, PM Henttu, MG Parker 1999 Molecular determinants of the estrogen receptor-coactivator interface. Mol Cell Biol 19:3895–3903[Abstract/Free Full Text]
  62. Takeyama KI, Masuhiro Y, Fuse H, Endoh H, Murayama A, Kitanaka S, Suzawa M, Yanagisawa J, Kato S 1999 Selective interaction of vitamin D receptor with transcriptional coactivators by a vitamin D analog. Mol Cell Biol 19:1049–1055[Abstract/Free Full Text]
  63. Paige LA, Christensen DJ, Gron H, Norris JD, Gottlin EB, Padilla KM, CY Chang CY, Ballas LM, Hamilton PT, McDonnell DP, Fowlkes DM 1999 Estrogen receptor (ER) modulators each induce distinct conformational changes in ER {alpha} and ERß. Proc Natl Acad Sci USA 96:3999–4004[Abstract/Free Full Text]
  64. VanderKuur JA, Hafner MS, Christman JK, Brooks SC 1993 Effects of estradiol-17ß analogues on activation of estrogen response element regulated chloramphenicol acetyltransferase expression. Biochemistry 32:7016–7021[CrossRef][Medline]
  65. Zhou G, Cummings R, Li Y, Mitra S, Wilkinson HA, Elbrecht A, Hermes JD, Schaeffer JM, Smith RG, Moller DE 1998 Nuclear receptors have distinct affinities for coactivators: characterization by fluorescence resonance energy transfer. Mol Endocrinol 12:1594–1604[Abstract/Free Full Text]
  66. Eng FC, Barsalou A, Akutsu N, Mercier I, Zechel C, Mader S, White JH 1998 Different classes of coactivators recognize distinct but overlapping binding sites on the estrogen receptor ligand binding domain. J Biol Chem 273:28371–28377[Abstract/Free Full Text]
  67. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  68. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol Endocrinol 12:1605–1618[Abstract/Free Full Text]
  69. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frail DE 1998 A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273:27645–27653[Abstract/Free Full Text]
  70. Cowley SM, Hoare S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  71. Cavailles V, Dauvois S, L’Horset F, Lopez G, Hoare S, Kushner PJ, Parker MG 1995 Nuclear factor RIP140 modulates transcriptional activation by th