help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D.
Right arrow Articles by Lim, A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D.
Right arrow Articles by Lim, A. T.
Molecular Endocrinology 13 (2): 344-352
Copyright © 1999 by The Endocrine Society

D5 Dopamine Receptors Mediate Estrogen-Induced Stimulation of Hypothalamic Atrial Natriuretic Factor Neurons

Dan Lee, Penny Dong, David Copolov and Alan T. Lim

Cell Biology Laboratory (D.L., P.D., D.C., A.T.L) Division of Molecular Schizophrenia Mental Health Research Institute of Victoria Parkville, Australia 3052
Department of Psychological Medicine (A.T.L.) Monash University Clayton, Australia 3168


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Whereas progesterone and dopamine share a common central pathway to modulate sexual behavior in female rats, the way in which estrogen is involved remains unclear. In a long-term rat hypothalamic cell culture system, atrial natriuretic factor-producing neurons were identified as candidate sites for integration of sex steroid action. Estrogen induces the expression of progesterone receptors in atrial natriuretic factor neurons and also augments neuronal functions by increasing expression of constitutively active D5 receptors that generate cAMP in a ligand-independent manner. Such a cross-talk mechanism allows estrogen to exert its effects via the adenylyl cyclase-cAMP system by augmenting dopamine receptor activity, an action that may play an important integrative role in facilitating female sexual behavior.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ovarian estrogen (E2) interacts centrally with the dopamine system to coordinate female reproductive functions (1, 2, 3, 4, 5). In E2-treated female rats, administration of progesterone or dopamine D1-like receptor agonists consistently elicits lordosis, a typical female sexual behavior (6, 7). The effect of D1-like receptor agonists is abolished in rats receiving progesterone receptor antagonists or antisense oligonucleotides against the progesterone receptor (8). These observations suggest that the central action of dopamine shares a common convergent pathway with that of progesterone, although some important questions from these animal studies remain unanswered. First, the phenotype or phenotypes of central neurons involved has not been characterized. Second, the neurobiochemical events related to the obligatory role of estrogen need further elucidation. Whereas the hypothalamic neurons producing GnRH play a critical role in reproductive physiology, they are unlikely to serve as common sites for this convergent interaction, as the cells in question do not possess estrogen receptors (ERs) (9). Receptors for E2, however, are present in atrial natriuretic factor (ANF)-producing neurons of the hypothalamus (10), which have been shown to modulate the production and release of hypothalamic GnRH and pituitary LH (11, 12, 13). We here present evidence that ANF neurons of the hypothalamus may constitute a common convergent site in that E2 induces both progesterone receptor and D5 receptor expression in the host cells.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Using a well characterized long-term monolayer cell culture system prepared from neonatal rat hypothalami (14, 15), we have examined the effect of E2 on the secretion of immunoreactive (ir) ANF in vitro. After 4 days of incubation with E2 (17ß-estradiol) over a range of concentrations (10-15–10-10 M), ir-ANF levels in the conditioned medium showed a dose-related increase, with an ED50 of the steroid approximating 10-12 M and an Emax of 10-10 M (Fig. 1AGo). At the concentration of 10-10 M, E2 treatment approximately doubled ir-ANF release (P < 0.01) compared with vehicle-treated control cultures. Northern blot analysis (16) also demonstrated an increase in the abundance of pro-ANF mRNA signals in E2-treated cultures (Fig. 1CGo). At 10-14 M, E2 increased pro-ANF mRNA levels by approximately 50% and signal levels were 2.5 times control at 10-10 M E2.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Stimulatory Effects of 17ß-Estradiol (E2) on the Secretion of ir-ANF and Amounts of pro-ANF mRNA in Primary Hypothalamic Cell Cultures Prepared from Neonatal Rats

A, Dose-related stimulation of E2. B, Suppression of E2 stimulation by SCH-23390, a D1-like receptor antagonist or rp-cAMP, a cAMP antagonist, and E2 potentiation of SKF-38393 (10-7 M), a D1-like receptor agonist, stimulation of ir-ANF release. C(a), Amounts of pro-ANF mRNA (upper panel) and their corresponding 18S rRNA (lower panel) from cultures treated with various doses of E2 alone or in the presence of SCH-23390 or rp-cAMP. C(b), Bar graph showing changes in pro-ANF mRNA abundance after various treatments. Statistical significance by ANOVA followed by post-hoc tests with the values shown representing mean ± SE; n = 4 to 6. The asterisks denote values significantly different from the vehicle-treated control groups (CTL); hatches indicate values significantly different from cultures treated with corresponding doses of E2; {delta} symbols indicate values significantly different from hypothalamic cells treated with SKF-38393 alone, *, #, {delta}, P < 0.05; **, ##, {delta}{delta}, P < 0.01.

 
E2 modulates gene transcription by the binding of steroid/receptor complexes to estrogen-responsive elements in DNA (17). Mapping studies of the regulatory region on the rat ANF gene in or proximal to its promoter region failed to show an estrogen response element consensus sequence (18). Increasing evidence now suggests that the adenylyl cyclase-cAMP system may cross-talk with steroid receptor-mediated effects or gene expression in various biological systems (19, 20, 21, 22). Given that the cAMP-dependent protein kinase A pathway amplifies adrenocorticoid-induced ANF production in culture (14), E2-induced stimulation of ANF neurons may similarly involve a cAMP-dependent mechanism. This is of particular potential relevance in that ANF neurons are stimulated by Dl-like receptor agonists that activate the adenylyl cyclase-cAMP system (16). To address this issue, we examined the effect of SCH-23390, a dopamine D1-like receptor antagonist, on E2 stimulation of ANF neurons. At a low dose (10-7 M) SCH-23390 (Fig. 1BGo) significantly suppressed E2-induced ir-ANF release, with baseline secretion unaffected. This effect of estrogen was also blocked by 10-4 M of rp-cAMP, a cAMP antagonist (Fig. 1BGo). The above observations on ir-ANF release were extended to show marked lowering of pro-ANF mRNA in cultures exposed to SCH-23390 or rp-cAMP (Fig. 1CGo). In addition, E2 treatment markedly enhanced the effect of SKF-38393 (10-7 M), a dopamine D1-like receptor agonist that stimulated ir-ANF release in a dose-dependent manner (Fig. 1BGo). The above results suggest that the E2-induced effects on ANF neurons are mediated, at least in part, via activation of endogenous D1-like receptors.

It is now evident that the D1-like receptor family consists of D1(D1A) and D5(D1B) receptor subtypes that have different biochemical characteristics (23, 24, 25) and distribution in the brain (26, 27, 28, 29). The lack of specific ligands for D1 and D5 receptors has delayed detailed studies of their functional differences that distinguish their involvement. To address this, specific antisense oligonucleotides for D1 and D5 receptors were synthesized and applied to our hypothalamic cultures to differentially suppress their expression. Figure 2Go shows that E2 stimulation of ir-ANF release (Fig. 2AGo) and pro-ANF mRNA expression (Fig. 2BGo) are significantly inhibited in cultures treated with antisense oligonucleotides complementary to D5 (P < 0.01) but not D1 receptor mRNA; estrogen action was not affected by sense oligonucleotides for either D5 or D1 receptor mRNA (data not shown). To determine whether E2 might also affect dopamine receptor expression, we examined mRNA abundance for D5 and D1 receptors in cultures by RT-PCR (15) before and after E2 treatment. Figure 3Go, A(b) and B(b), shows representative Southern blot analysis of D5 and D1 receptor mRNA (upper panel) and their corresponding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (lower panel) levels from the same cultures. Estrogen significantly augments the production of D5 receptor mRNA in hypothalamic cultures, in a dose-related manner [Fig. 3AGo(a)]; in contrast, levels of D1 receptor mRNA are not affected [Fig. 3BGo(a)]. Consistent with these results, recent reports have confirmed that D5 receptors are predominant in the rat hypothalamus (27, 29). This is also true in our hypothalamic cultures, confirmed by semiquantitative in situ hybridization studies of D5 and D1 receptor mRNA (data not shown). The stimulatory effect of E2 seems, therefore, to be mediated, at least in part, by enhancing overall expression of D5 but not D1 receptor mRNA in hypothalamic cells, presumably including ANF neurons. It is relevant to point out here that E2 induction of D5 receptor expression is independent of cAMP protein kinase pathway, as the effect was not blocked by rp-cAMP (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Effects of 17ß-Estradiol (E2) Alone or in the Presence of Phosphorothioate- Modified Oligonucleotides Antisense for D5 (5'-ATGTCGCGCTGAGTAGCTCG, 676–696) or D1 (5'-TTGTGAAGATGGTACCTACTCCGGCCCGAC, 425–454) Receptors

A, Effect on the secretion of ir-ANF; and B(a), the amounts of pro-ANF mRNA (upper panel) and 18 s rRNA (lower panel) in hypothalamic cell cultures. B(b), Bar graph showing changes of pro-ANF mRNA after various treatments. Statistical significance by ANOVA followed by post hoc tests with values shown representing mean ± SE, and n = 3. Asterisks denote significant changes when compared with the control group (CTL). #, Significant differences in cultures treated with similar levels of E2. *, #, P < 0.05; **, ##, P < 0.01.

 


View larger version (65K):
[in this window]
[in a new window]
 
Figure 3. Effects of 17ß-Estradiol (E2) on the Amounts of Dopamine D5 and D1 Receptor mRNA in Hypothalamic Cultures

A(a), Bar graph; and A(b), a representative of E2 dose-related effect on D5 receptor mRNA abundance. B(a), Bar graph; and B(b), levels of D1 receptor mRNA in E2 treated cultures. Statistical significance by ANOVA followed by post-hoc tests with the values shown representing mean ± SE; n = 3. The asterisks denote values significantly different from the vehicle-treated control group (CTL); *, P < 0.05; **, P < 0.01. C, Representative of cultured hypothalamic neurons showing triple staining for C(a), immunoreactive atrial natriuretic factor in immunogold silver staining; C(b), in situ hybridization of D5 receptor mRNA with rhodamine approach; and C(c), ER immunoreactivity in fluorescence. No positive signal was detected in hypothalamic cultures when incubated with anti-ANF antiserum preabsorbed with an excess amount (1 µg) of synthetic rat ANF(1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 ) (C(a), lower panel), pretreated with RNAase (C(b), lower panel), or omitted primary antiserum against ER (C(c) lower panel). D denotes triple staining as in C except in D(c) showing progesterone receptor immunoreactivity of cultures treated 4 days with E2 (10-10 M). Lower panel of D(c) shows control staining with omission of primary antiserum against progesterone receptor. Scale bar = 10 µm.

 
To confirm that ANF neurons possess both E2 and D5 receptors, we used a triple staining technique of in situ hybridization (16) for D5 receptor mRNA and immunostaining for both ir-ANF and ER. Figure 3CGo(b) shows a representative cell stained for D5 receptor mRNA that is also positive for both ir-ANF [Fig. 3CGo(a)] and ER [Fig. 3CGo(c)]. More than 80% of the ir-ANF positive cells stained simultaneously for D5 receptor mRNA signals and immunoreactive ER; this confirms that most of the ir-ANF positive cells in our cultures express D5 and ERs concurrently. In contrast, among non-ANF-stained neurons, a small proportion (<10%) of the immunoreactive ER positive cells showed positive staining for D5 receptor mRNA. Furthermore, immunoreactive progesterone receptors were also detected in greater than 70% of ir-ANF positive cells expressing D5 receptors in cultures treated for 4 days with E2 (10-10 M), but not in E2-free control cultures (Fig. 3DGo).

Although our primary hypothalamic cell cultures include endogenous dopamine producing neurons, the highest concentration of the amine detected in the culture medium at any one time, with or without E2, was less than 10-9 M, measured by HPLC (data not shown). Because approximately 10-5 M or 4 orders of magnitude higher dopamine concentration is required to induce a significant release of ANF in our cultures (16), the low level of endogenous dopamine detected in the cultures is unlikely to contribute significantly to the E2-induced functional stimulation of ANF neurons. It has recently been reported that cloned human D5 receptors show autoactivity, generating cAMP in a ligand-independent manner (24), involving the activation of adenylyl cyclase and being inhibited by D1-like receptor antagonists. To confirm that autoactivity of D5 receptors remains true across species and may account for the E2-induced effect observed in rat hypothalamic cultures, we have cloned rat dopamine D5 receptor cDNA and transfected it into Chinese hamster ovary (CHO) cells. As shown in Fig. 4AGo, the transfected cells stably expressing rat D5 receptors have a higher basal content of cAMP, about double that obtained from mock-transfected CHO cells. The receptors appear to be biologically active, because they are stimulated by SKF-38393, a D1-like receptor agonist, but not by quinpirole, a D2-like receptor agonist. Consistent with previous reports (24), this autoenhancement of cAMP generating activity is reversed in a dose-related manner by butaclamol and flupentixol, two D1-like receptor antagonists, to a level similar to that found in mock transfected cells (see Fig. 4BGo). Our present observations confirm that, like their human counterparts, rat D5 dopamine receptors indeed show intrinsic cAMP generation in a ligand-independent manner. Similar changes in terms of cAMP have also been demonstrated in our hypothalamic cell cultures, where long-term E2 treatment also induced a dose-dependent increase in culture cAMP content, which was suppressed by SCH-23390, butaclamol, or flupentixol (Fig. 4CGo). In addition, E2 also significantly enhanced cAMP content induced by SKF-38393, the D1-like receptor agonist (Fig. 4CGo).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Cell Contents of cAMP

A, In D5 receptor-transfected and MOCK CHO cells treated with SKF-38393 (SKF), a D1-like receptor agonist or quinpirole (Qui), a D2-like receptor agonist. B, In D5 receptor-transfected CHO cells receiving butaclamol (Bu) or flupentixol (Fp), two D1-like receptor antagonists. C, In E2-treated primary hypothalamic cell cultures coincubated with SKF or Bu or Fp or SCH-23390(SCH). Statistical significance by ANOVA followed by post-hoc tests with values shown representing mean ± SE. In panels A and B, asterisks denote significant changes in comparison with MOCK CHO cells (CTL), and hatches denote significant changes in comparison with D5 receptor-transfected CHO cells treated with vehicle. In panel C, asterisks denote significant changes in comparison with vehicle-treated hypothalamic cultures; @ denotes significant changes in comparison with hypothalamic cells treated with comparable levels of E2; and {delta} denotes significant changes in comparison with hypothalamic cells treated with SKF-38393 alone; *, #, @, {delta}, P < 0.05; **, ##, @@, {delta}{delta}, P <0.01.

 
E2-induced functional enhancement of ANF neurons can thus be attributed to augmented expression of D5 receptors and cAMP generation in our hypothalamic cultures. This assertion is consistent with the observation that the E2-induced D5 receptor expression described here is seen after 4 days of low levels of E2 (10-13 M and greater), and involves synthesis of new proteins and is cyclohexamide sensitive. Cyclohexamide (5 µg/ml) significantly suppressed 10-10 M of E2 induced ir-ANF release (from 128.3 ± 4.9 to 61.5 ± 8.4; n = 4; P < 0.01) under the same conditions as described in Fig. 1Go. It is important to point out that the effect of E2 described here is different from that reported earlier by other investigators, where an acute application of high concentrations of E2 directly activated the adenylyl cyclase-cAMP system in a manner not requiring synthesis of new proteins (21).

In summary, estrogen has long been believed to play a role in brain functions by modulating the action of the central dopaminergic system (3, 4, 5, 6) through dopamine receptor numbers, binding characteristics, and dopamine uptake (30, 31, 32). In addition to its direct effect on progesterone receptor synthesis, direct enhancement of D5 receptor expression should now be included as one of the mechanisms by which the ovarian steroid estrogen mediates its neurobiological effects in the brain.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Cultures
Neonatal rat hypothalamic cultures were prepared (14, 33, 34, 35) by enzymatic dispersion of hypothalami removed from 2- to 3-day-old Sprague-Dawley rat pups. The dispersed cells were maintained (1 million cells per 22- mm well) in HEPES-buffered DMEM (HDME) supplemented with 8% FCS at 37 C in 10% CO2. All release studies were conducted on the seventh day of culture and extended over a period of 4 days. The drugs were applied every 24 h to the cultures. Four hours after the last application of vehicle or drugs, conditioned media were removed and extracted for immunoreactive ir-ANF release measurement by double-antibody RIA (14, 35, 36, 37). To determine the intracellular cAMP, the culture media were replenished with fresh culture medium containing isobutylmethylxanthine for 30 min at 37 C after a 4-day treatment with various doses of E2. The cells were then incubated with D1-like receptor agonist or antagonists in the presence of E2 for 15 min. The reaction was terminated by aspirating the medium, adding 1 ml of stop solution (0.01 M of HCL in ethanol) and placing at room temperature for 30 min. The extracts were lyophilized and reconstituted for RIA (16). Intracellular cAMP was then extracted and quantified using RIA modified from the method described by Marley (38). Each of the experiments was performed at least three times; within an experiment, the results of an individual condition represented the average of three to four cultured wells. Results presented here are the mean of three or more separate experiments from different batches of cell preparations.

Northern Blot Analysis
After treatment, cells were lysed directly in the well by adding 0.5 ml of TRIZOL Reagent (Life Technologies, Gaithersburg, MD). The cell lysate from three individual wells, each with 106 cells, were harvested by pipetting and pooled together as a single sample for the study. The cytoplasmic RNA was further extracted by chloroform and precipitated with isopropyl alcohol. Twelve micrograms of total RNA from each of the samples fractionated by electrophoresis through formaldehyde-agarose gel were transferred to nylon membrane and hybridized with digoxigenin-labeled ANF-antisense oligonucleotide probes (14, 33, 34, 35, 39, 40, 41, 42) and visualized by colorimetric reaction. The signals of individual bands for pro-ANF mRNA were measured as integrated optical densities (IOD) by a computer based Image-Pro Plus version 3 (Media Cybernetics, Silver Spring, MD) taking the vehicle-treated controls as 100% for statistical comparison. After signal analysis, the same blots were reprobed with digoxigenin-labeled 18 S rRNA oligonucleotide. The IOD readings of each band of pro-mRNA from various treatment groups were adjusted to the IOD of corresponding bands of 18 S rRNA; the values were then expressed as a percentage of that of the vehicle-treated controls.

RT-PCR
The expression of D5 mRNA in the hypothalamic cultures was determined using RT-PCR techniques (15). The rat D5 cDNA sequences were obtained from GenBank under sequence number M69118. The 5'-sense primer for PCR amplification of D5 cDNA (5'-GGCTGGGATTACAGAGGCAACTGG) is located at bases 734–757 of the sequence, and the 3'-antisense primer (5'-TCTCCTTCTTGATGGACGCTCGC) is complementary to bases 1527–1549. PCR with this primer pair produced 816-bp fragments from rat genomic DNA (not shown) and from cDNA generated from RNA extracts. For GAPDH RT-PCR, PCR primers were designed according to two published rat GAPDH cDNA sequences of the same length with 98.3% sequence identity (GenBank nos. X02231/X00972 and M17701) (43, 44). The 5'-sense primer (5'-GTGATGCTGGTGCTGAGTATGTCG) is located at bases 328–351 of the sequence, and the 3'-antisense primer (5'-GTGGATGCAGGGATGATGTTCTGG) is complementary to bases 674–697. PCR with these primers produced 370 bp fragments of GAPDH from rat cDNA made from RNA extracts.

Hypothalamic cultures were treated with vehicle or various doses of E2 (10-14 to 10-10 M) for 4 days. After treatment, cells were lysed by Trizol (see Northern Blot Analysis) and extracted by chloroform and precipitated with isopropyl alcohol. The possible contamination of DNA was excluded by incubation with RNase-free DNase (Boehringer, Indianapolis, IN) in 1 U/µl DNAase digestion buffer (140 mM sodium chloride, 10 mM magnesium chloride, 10 mM Tris, 1 mM dithiothreitol, pH 8.0) for 30 min at 37 C and phenol extracted. The cytoplasmic RNA samples were then reverse transcripted with SuperScrip Preamplification System (Boehringer) in a total volume of 20 µl using 0.5 µl of oligo (dT) for 60 min at 42 C. Two microliters of each cDNA sample were added to a PCR reaction mixture containing 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris, 50 µM deoxynucleoside triphosphates, and 20 pmol of the sense and antisense primers for D5 receptor in a total volume of 50 µl. Five picomoles of the sense and antisense primers for GAPDH, used as an internal control, were also added to the reaction mixture. The mixtures were overlaid with 75 µl of mineral oil and heated to 99 C for 5 min; 1.25 U Taq polymerase (Boehringer) were added to each mixture. The reaction series were initiated on a Perkin-Elmer/Cetus (Norwalk, CT) thermal cycler (95 C, 1 min; 59 C, 1 min; 72 C, 1 min; 30 cycles). A 7-min incubation at 72 C was added at the end to ensure complete extension. A negative control experiment was performed by omitting reverse transcriptase in the cDNA synthesis reaction. To draw a standard curve, RTs were carried out from total RNA extracted from 0.06 to 6 vehicle-treated wells (0.25–24 µg). The amplification curve was linear between 0.5 and 12 µg total RNA for both D5 and GAPDH. Consequently, for quantitative analysis, RTs were carried out with total RNA extracted from 1 well (~4 µg) from each of the treated groups.

Aliquots of the amplified DNA samples were loaded onto agarose gels and fractionated; a single lane in each gel contained a DNA mol wt marker VI (Boehringer). The gels were transferred onto nylon membrane and cut into two parts according to their molecular sizes. The membrane with higher mol wt bands was hybridized with 24 mer digoxigenin- labeled antisense oligonucleotide probes complementary to D5 cDNA (5'-TGGCAGCACACACTAGCACGTTCC, 857–880); the second part of the membrane with lower mol wt bands was hybridized with 24 mer digoxigenin-labeled antisense oligonucleotide probes complementary to rat GAPDH cDNA (5'-GCCATCCACAGTCTTCTGAGTGGC, 612–635). The hybridization signals were detected with similar methods as described in Northern Blot Analysis. The signals of individual bands for RT-PCR D5, measured as integrated optical densities by the Image-Pro Plus version 3, were further standardized against those of GAPDH for comparison.

Similar procedures were followed to measure the expression of D1 receptor mRNA in the hypothalamic cultures. The rat Dl cDNA sequences were obtained from GenBank under sequence no. M35077. The 5'-sense primer (5'-AGAAGGTTGAGCAGGACGTATGC) is located at bases 977–999 of the sequence, and the 3'-antisense primer (5'-AAGCCCAAGGGAACTCGTGG) is complementary to bases 1780–1799. PCR with these primers produced 823 bp fragment from rat cDNA made from RNA extracts of D1 receptor mRNA. The standard amplification curves for the D1 were almost the same as those for D5 receptor. For quantitative analysis of Dl receptor mRNA level, the RTs were also carried out with total RNA extracted from one well from each treated group. The Southern blot for D1 receptor cDNA was hybridized with digoxigenin-labeled oligonucleotide probes of 30 mer corresponding to the 5–14 amino acids of rat D1 receptor.

Triple Staining
Cells treated with vehicle or 10-10 M E2 were washed and fixed with 3% phosphate buffered paraformaldehyde (34, 42). After fixation, the cells were washed in PBS, incubated in prehybridization buffer, and incubated overnight at 37 C with 24 mer digoxigenin-labeled antisense oligonucleotide probes (100 pmol/ml) complementary to D5 cDNA (5'-TGGCAGCACACACTAGCACGTTCC, 857–880). The cultures were then washed for 3 h with decreasing concentrations of saline-sodium citrate. In colocalization studies, Fab segments of sheep antiserum raised against digoxigenin and conjugated with rhodamine [tetramethylrhodamine isothiocyanate (TRITC), 1:40; Boehringer-Mannheim] were added together with ANF antiserum (R178, 1:50) of rabbit and monoclonal ER antiserum (1:100, Chemicon International, Inc., Temecula, CA) or monoclonal progesterone receptor antiserum (1:100, Calbiochem, La Jolla, CA) in Tris buffer containing 1% BSA and 0.3% Triton X-100 overnight at 4 C. The cells were then washed and incubated concurrently with fluorescein isothiocyanate-conjugated sheep antimouse Fab antiserum (1:40) and gold-conjugated swine antirabbit IgG antiserum (1:200) for 60 min. At the end of the incubation, wells were washed and applied with silver enhancement. After a short incubation, the intensity of gold staining was monitored through a microscope and the reaction was terminated by washing with tap water. The cells were then mounted in glycerol-Tris buffer containing 1 mg/ml p-phenylenediamine to minimize fluorescence bleaching (45) during microphotography with a Nikon DIAPHOT model TMD microscope (Nikon, Inc., Garden City, NY). Fluorescein isothiocyanate and TRITC were viewed with Epi-fluorescence filter combination B-2E and G-2A, respectively.

Specificity of the ir-ANF staining was demonstrated by the absence of specific staining when primary antisera were replaced with Tris buffer, normal rabbit serum, or anti-ANF antiserum preabsorbed with an excess amount of synthetic rat ANF(99–126). Specificity of immunoreactive estrogen or progesterone receptor was confirmed by absence of specific staining when primary antisera were replaced with Tris buffer. In the case of in situ hybridization, to eliminate the possibility of false positive staining, the replacement of antisense probe with sense probe, pretreatment of fixed cultures with RNase, coincubation with excess of unlabeled oligo probes, application of antidigoxigenin antiserum without probe, or application of second antisera alone was carried out. For triple staining, negative controls that employed either primary antiserum or oligonucleotide probe alone in the presence of one of the noncorresponding second antisera were included. In all cases, no significant staining was observed above background.

Construction of Mammalian Expression D5 Receptor Vector, CHO Cell Transfection, and Measurement for cAMP
Total RNA was extracted from cultured rat hypothalamus by TRIZOL and amplified by RT-PCR. Primers corresponding to 5'-(TTCTCGAGCTACTCAGCGCGACATGC, 672–697, XhoI site underlined) and 3'-(TTCTATGCAGCAGACTACAGAAAGC, 2240–2264) untranslated regions of rat D5 receptor cDNA were used in the PCR to amplify the full-length cDNA encoding the rat D5 receptor. Hot start PCRs were initiated as described above, followed by 35 cycles of 95 C for 1 min, 62 C for 1 min, and 72 C for 1 min, with a final extension at 72 C for 7 min. The PCR products were purified using the QIAquick Spin purification kit from Bresatec (Thebarton, SA, Australia), and the nucleotide sequence was confirmed by dideoxy sequencing of double-strand DNA using DNA sequencing system from Promega following the manufacturer’s instructions. Briefly, the samples were analyzed by electrophoresis on a 6% polyacrylamide, 7 M urea gel, dried onto whatman 3M paper, and exposed to x-ray film (Kodak BioMax, MR-1, Eastman-Kodak, Rochester, NY) for 16 h at -70 C. The sequence of the amplified cDNA is identical to the published rat D5 receptor sequence. The cDNA was then modified by adding a HindIII linker at the 3'-end and cloned into the SalI and HindIII sites of a mammalian expression vector pAX (a gift from Dr. Gillian Hayes of Garvan Institute of Medical Research, Sydney, Australia) to generate pAXD5 (46), in which expression of cDNA is driven by the human ß-actin promoter.

CHO cells were grown in {alpha}-medium (GIBCO/BRL) supplemented with 8% FCS in six-well dishes (35 mm; Costar, Cambridge, MA; 2 x 106 cells per dish) and transfected at 90%–100% confluence using a modified calcium phosphate method with D5 receptor DNA, pAXD5 or wild-type pAX vector (MOCK). The amount of DNA was 10 µg/well for maximal expression. After transfection (4 h), CHO cells were shocked with 15% glycerol in PBS for 3 min, washed with PBS, and fed with fresh culture medium. After a recovery period (24 h), cells were trypsinized and replated in {alpha}-medium containing geneticin (G418) for the isolation of stable transformants. Selection of stably transformed cells was over a period of 4 weeks in the presence of 800 µg/ml G418, after which time clonal cell lines were isolated by dilution cloning. Successful transfection of D5 receptor in CHO cells was confirmed by in situ hybridization with digoxigenin-labeled oligonucleotide complementary to D5 cDNA (5'-TGGCAGCACACACTAGCACGTTCC, 857–880) and by RT-PCR the total RNA extracted from CHO cells with primers corresponding to the coding regions of rat D5 receptor cDNA described above, followed by Southern blotting with digoxigenin-labeled oligonucleotide complementary to D5 cDNA (5'-TCTCCTTCTTGATGGACGCTCGC, 1527–1549). To determine the intracellular cAMP, the transfected cells were seeded in a 24-well cell culture cluster (16 mm; Costar, Cambridge, MA; 0.4 x 106 cells per well). Two days later, the culture medium was replaced by fresh {alpha}-medium containing isobutylmethylxanthine for 30 min at 37 C, and the cells were then incubated with various drugs for 15 min. The reaction was terminated by adding 0.5 ml of stop solution, and the intracellular cAMP was then extracted and quantified using RIA (see Cell Cultures).

Experimental Animals
All the animal studies were conducted in accordance with the principle and procedures outlined in the "Australia Code of Practice for the Care and Use of Animals for Scientific Purposes" and approved by the Animal Ethics Committee of the Institute.


    ACKNOWLEDGMENTS
 
We are grateful to Professor John Funder for constructive comments.


    FOOTNOTES
 
Address requests for reprints to: Dr Alan T. Lim, Cell Biology Laboratory, Division of Molecular Schizophrenia, Mental Health Research Institute of Victoria, 155 Oak Street, Parkville, Victoria, Australia 3052.

This work was supported by the Woods Family Research Program, a contracted research grant from the State Health Department of Victoria, and an equipment grant from The Rebecca L. Cooper Medical Research Foundation Ltd. Sydney, Australia.

Received for publication June 24, 1998. Revision received September 30, 1998. Accepted for publication October 13, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Fink G 1988 Oestrogen and progesterone interactions in the control of gonadotrophin and prolactin secretion. J Steroid Biochem 30:169–178[CrossRef][Medline]
  2. McEwen BS 1992 Steroid hormones: effect on brain development and function. Horm Res 37[Supp13]:1–10
  3. Di Paolo T 1994 Modulation of brain dopamine transmission by sex steroids. Rev Neurosci 5:27–41[Medline]
  4. Bosse R, Di Paolo T 1995 Dopamine and GABAA receptor imbalance after ovariectomy in rats: model of menopause. J Psychiatry Neurosci 20:364–371[Medline]
  5. Halbreich U, Piletz J, Halaris A 1992 Influence of gonadal hormones on neurotransmitters, receptor, cognition and mood. Clin Neuropharmacol 15 [Suppl 1]:590A–591A
  6. Melis MR, Argiolas A 1995 Dopamine and sexual behavior. Neurosci Biobehav Rev 19:19–38[CrossRef][Medline]
  7. O’Malley BW, Schrader WT, Mani S, Smith C, Weigel NL, Conneely OM, Clark JH 1995 An alternative ligand-independent pathway for activation of steroid receptors. Recent Prog Horm Res 50:333–347
  8. Mani SK, Allen JM, Clark JM, Blaustein JD, O’Malley BW 1994 Convergent pathways for steroid hormone- and neurotransmitter-induced rat sexual behavior [published erratum appears in Science 1995 Jun 30;268(5219):1833]. Science 265:1246–1249[Abstract/Free Full Text]
  9. Sullivan KA, Witkin JW, Ferin M, Silverman AJ 1995 Gonadotropin-releasing hormone neurons in the rhesus macaque are not immunoreactive for the estrogen receptor. Brain Res 685:198–200[CrossRef][Medline]
  10. Watson REJ, Hutchinson RK, Langub MCJ, Landis JW, Seksaria S, Rainey DM, Keil LC 1994 Colocalization of natriuretic peptide and estrogen receptor immunoreactivities in preoptic nuclei in the female rat. J Neuroendocrinol 6:79–87[CrossRef][Medline]
  11. Samson WK, Alexander BD, Skala KD, Huang FL, Fulton RJ 1992 Central peptidergic mechanisms controlling reproductive hormone secretion: novel methodology reveals a role for the natriuretic peptides. Can J Physiol Pharmacol 70:773–778[Medline]
  12. Rodriguez Lopez P, Ehlerding A, Leonhardt S, Jarry H, Wuttke W 1993 Effects of angiotensin II and atrial natriuretic peptide on LH release are exerted in the preoptic area: possible involvement of gamma-aminobutyric acid (GABA). Exp Clin Endocrinol 101:350–355[Medline]
  13. Samson WK, Agulia MC, Bianchi R 1988 Atrial natriuretic factor inhibits luteinizing hormone secretion in the rat: evidence for hypothalamic site of action. Endocrinology 122:1573–1582[Abstract]
  14. Huang W, Choi CL, Yang Z, Copolov DL, Lim AT 1991 Forskolin induced immunoreactive atrial natriuretic peptide secretion and pro-ANP mRNA expression of hypothalamic neurons in culture: modulation by glucocorticoids. Endocrinology 128:2591–2600[Abstract]
  15. Lee D, Huang W, Copolov DL, Lim AT 1995 Glucocorticoids inhibit Dlb, but not D2, receptor-mediated effects on hypothalamic atrial natriuretic factor neurons. Endocrinology 136:5570–5576[Abstract]
  16. Lee D, Huang W, Lim AT 1995 Dl receptors mediate dopamine stimulation of irANF release and pro-ANF mRNA expression of rat hypothalamic neurons in culture. Endocrinology 131:911–918[Abstract]
  17. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  18. Ruskciaho H 1992 Atrial natriuretic peptide: synthesis, release, and metabolism. Pharmacol Rev 44:479–602[Medline]
  19. Denner LA, Weigel NL, Maxwell BL, Schrader WT, O’Malley BW 1990 Regulation of progesterone receptor-mediated transcription by phosphorylation. Science 250:1740–1743[Abstract/Free Full Text]
  20. Cho H, Aronica SM, Katzenellenbogen BS 1994 Regulation of progesterone receptor gene expression in MCF-7 breast cancer cells: a comparison of the effects of cyclic adenosine 3',5'-monophosphate, estradiol, insulin-like growth factor-I, and serum factors. Endocrinology 134: 658–664
  21. Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. Proc Natl Acad Sci USA 91:8517–8521[Abstract/Free Full Text]
  22. Aronica SM, Katzenellenbogen BS 1993 Stimulation of estrogen receptor-mediated transcription and alteration in the phosphorylation state of the rat uterine estrogen receptor by estrogen, cyclic adenosine monophosphate, and insulin-like growth factor-I. Mol Endocrinol 7:743–752[Abstract/Free Full Text]
  23. Civelli O, Bunzow JR, Grandy DK 1993 Molecular diversity of the dopamine receptors. Annu Rev Pharmacol Toxicol 33:281–307[CrossRef][Medline]
  24. Tiberi M, Caron MG 1994 High agonist-independent activity is a distinguishing feature of the dopamine D1B receptor subtype. J Biol Chem 269:27925–27931[Abstract/Free Full Text]
  25. Kimura K, White BH, Sidhu A 1995 Coupling of human D-1 dopamine receptors to different guanine nucleotide binding proteins. Evidence that D-1 dopamine receptors can couple to both Gs and G(o). J Biol Chem 270:14672–14678[Abstract/Free Full Text]
  26. Bergson C, Mrzljak L, Smiley JF, Pappy M, Levenson R, Goldman Rakic PS 1995 Regional, cellular, and subcellular variations in the distribution of D1 and D5 dopamine receptors in primate brain. J Neurosci 15:7821–7836[Abstract]
  27. Tiberi M, Jarvie KR, Silvia C, Falardeau P, Gingrich JA, Godinot N, Bertrand L, Yang Feng TL, Fremeau RTJ, Caron MG 1991 Cloning, molecular characterization, and chromosomal assignment of a gene encoding a second D1 dopamine receptor subtype: differential expression pattern in rat brain compared with the D1A receptor. Proc Natl Acad Sci USA 88:7491–7495[Abstract/Free Full Text]
  28. Meador Woodruff JH, Grandy DK, Van Tol HH, Damask SP, Little KY, Civelli O, Watson SJJ 1994 Dopamine receptor gene expression in the human medial temporal lobe. Neuropsychopharmacology 10:239–248[Medline]
  29. Meador Woodruff JH, Mansour A, Grandy DK, Damask SP, Civelli O, Watson SJJ 1992 Distribution of D5 dopamine receptor mRNA in rat brain. Neurosci Lett 145:209–212[CrossRef][Medline]
  30. Di Paolo T, Bedard PJ, Dupont A, Poyet P, Labric F 1982 Effects of estradiol on intact and denervated striatal dopamine receptors and on dopamine levels: a biochemical and behavioral study. Can J Physiol Pharmacol 60:350–357[Medline]
  31. Levesque D, Di Paolo T 1991 Dopamine receptor reappearance after irreversible receptor blockade: effect of chronic estradiol treatment of ovariectomized rats. Mol Pharmacol 39:659–665[Abstract]
  32. Levesque D, Gagne B, Barden N, Di Paolo T 1992 Chronic estradiol treatment increases anterior pituitary but not striatal D2 dopamine receptor mRNA levels in rats. Neurosci Lett 140:5–8[CrossRef][Medline]
  33. Huang W, Lee D, Yang Z, Copolov DL, Lim AT 1992 Norepinephrine stimulates immunoreactive (ir) atrial natriuretic peptide (ANP) secretion and pro-ANP mRNA expression from rat hypothalamic neurons in culture: effect of ß2-adrenoceptors. Endocrinology 130:2426–2428[Abstract]
  34. Lee D, Huang W, Yang Z, Copolov DL, Lim AT 1992 In vitro evidence for modulation of morphological and functional development of hypothalamic ir-ANP neurons by 3'5'-cyclic-adenosine monophosphate. Endocrinology 131:911–918
  35. Huang W, Lee D, Yang Z, Copolov DL, Lim AT 1992 Plasticity of adrenoceptor responsiveness on irANP secretion and pro-ANP mRNA expression in hypothalamic neuron cultures: modulation by dexamethasone. Endocrinology 131:1562–1564[Abstract]
  36. Bush AI, Huang W, Copolov DL, Lim AT 1990 Hypothalamic atrial natriuretic peptide secretion plasticity: differential modulation of {alpha}- and ß-adrenoceptors. Neuroendocrinology 52:65–69[Medline]
  37. Lim AT, Dean B, Copolov DL 1990 Evidence for post-translational processing of auriculin B to atriopeptin III immediately prior to secretion by hypothalamic neurons in culture. Endocrinology 127:2598–2600[Abstract]
  38. Marley PD, Thomson KA, Jachno K, Johnston MJ 1991 Histamine-induced increases in cyclic AMP levels in bovine adrenal medullary cells. Br J Pharmacol 104:839–846[Medline]
  39. Huang W, Lee D, Yang Z, Casley DJ, Throsby M, Copolov DL, Johnston CI, Lim AT 1992 Evidence for ANP(5–28) production by rat placental cytotrophoblasts. Endocrinology 131:919–924[Abstract]
  40. Throsby M, Lee D, Huang W, Yang Z, Copolov DL, Lim AT 1991 Evidence for ANP(5x28) production by macrophages of the rat spleen: an immunochemical and non-radioactive in situ hybridization approach. Endocrinology 129:991–1000[Abstract]
  41. Lee D, Huang W, Copolov DL, Lim AT 1994 D2 receptors mediate dopamine suppression of irANF release and pro-ANF mRNA expression of rat hypothalamic neurons in culture. Mol Cell Neurosci 5:523–529[CrossRef][Medline]
  42. Throsby M, Yang Z, Lee D, Huang W, Copolov DL, Lim AT 1993 Co-expression of atrial natriuretic factor and ß-endorphin in a sub-population of rat splenic macrophages: age-related differences. Endocrinology 133:2889–2896[Abstract]
  43. Tso JY, Sun XH, Kao TH, Reece KS, Wu R 1985 Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res 13:2485–2502[Abstract/Free Full Text]
  44. Piechaczyk M, Blanchard JM, Riaad EI Sabouty S, Dani C, Marty L, Jeanteur P 1984 Unusual abundance of vertebrate 3-phosphate dehydrogenase pseudogenes. Nature 312:469–471[CrossRef][Medline]
  45. Johnson GD, Nogueira Araujo GMC 1981 A simple method of reducing the fading of immunofluorescence during microscopy. J Immunol Methods 43:349–350[CrossRef][Medline]
  46. Hayes G, Biden TJ, Selbie LA, Shine J 1992 Structural subtypes of the dopamine D2 receptor are functionally distinct: expression of the cloned D2A and D2B subtypes in a heterologous cell line. Mol Endocrinol 6:920–926[Abstract]



This article has been cited by other articles:


Home page
J Biomol ScreenHome page
P. Blommel, G. T. Hanson, and K. W. Vogel
Multiplexing Fluorescence Polarization Assays to Increase Information Content Per Screen: Applications for Screening Steroid Hormone Receptors
J Biomol Screen, June 1, 2004; 9(4): 294 - 302.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
K. Tumova, R. M. Iwasiow, and M. Tiberi
Insight into the Mechanism of Dopamine D1-like Receptor Activation. EVIDENCE FOR A MOLECULAR INTERPLAY BETWEEN THE THIRD EXTRACELLULAR LOOP AND THE CYTOPLASMIC TAIL
J. Biol. Chem., February 28, 2003; 278(10): 8146 - 8153.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D.
Right arrow Articles by Lim, A. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D.
Right arrow Articles by Lim, A. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals