Molecular Endocrinology 13 (2): 344-352
Copyright © 1999 by The Endocrine Society
D5 Dopamine Receptors Mediate Estrogen-Induced Stimulation of Hypothalamic Atrial Natriuretic Factor Neurons
Dan Lee,
Penny Dong,
David Copolov and
Alan T. Lim
Cell Biology Laboratory (D.L., P.D., D.C., A.T.L) Division of
Molecular Schizophrenia Mental Health Research Institute of
Victoria Parkville, Australia 3052
Department of
Psychological Medicine (A.T.L.) Monash University Clayton,
Australia 3168
 |
ABSTRACT
|
|---|
Whereas progesterone and dopamine share a common
central pathway to modulate sexual behavior in female rats, the way in
which estrogen is involved remains unclear. In a long-term rat
hypothalamic cell culture system, atrial natriuretic factor-producing
neurons were identified as candidate sites for integration of sex
steroid action. Estrogen induces the expression of progesterone
receptors in atrial natriuretic factor neurons and also augments
neuronal functions by increasing expression of constitutively active
D5 receptors that generate cAMP in a
ligand-independent manner. Such a cross-talk mechanism allows estrogen
to exert its effects via the adenylyl cyclase-cAMP system by augmenting
dopamine receptor activity, an action that may play an important
integrative role in facilitating female sexual behavior.
 |
INTRODUCTION
|
|---|
Ovarian estrogen (E2) interacts centrally with the
dopamine system to coordinate female reproductive functions (1, 2, 3, 4, 5). In
E2-treated female rats, administration of progesterone or
dopamine D1-like receptor agonists consistently elicits
lordosis, a typical female sexual behavior (6, 7). The effect of
D1-like receptor agonists is abolished in rats receiving
progesterone receptor antagonists or antisense oligonucleotides against
the progesterone receptor (8). These observations suggest that the
central action of dopamine shares a common convergent pathway with that
of progesterone, although some important questions from these animal
studies remain unanswered. First, the phenotype or phenotypes of
central neurons involved has not been characterized. Second, the
neurobiochemical events related to the obligatory role of estrogen need
further elucidation. Whereas the hypothalamic neurons producing GnRH
play a critical role in reproductive physiology, they are unlikely to
serve as common sites for this convergent interaction, as the cells in
question do not possess estrogen receptors (ERs) (9). Receptors for
E2, however, are present in atrial natriuretic factor
(ANF)-producing neurons of the hypothalamus (10), which have been shown
to modulate the production and release of hypothalamic GnRH and
pituitary LH (11, 12, 13). We here present evidence that ANF neurons of the
hypothalamus may constitute a common convergent site in that
E2 induces both progesterone receptor and D5
receptor expression in the host cells.
 |
RESULTS AND DISCUSSION
|
|---|
Using a well characterized long-term monolayer cell culture system
prepared from neonatal rat hypothalami (14, 15), we have examined the
effect of E2 on the secretion of immunoreactive (ir) ANF
in vitro. After 4 days of incubation with E2
(17ß-estradiol) over a range of concentrations
(10-1510-10 M), ir-ANF levels
in the conditioned medium showed a dose-related increase, with an
ED50 of the steroid approximating 10-12
M and an Emax of 10-10
M (Fig. 1A
). At the concentration
of 10-10 M, E2 treatment
approximately doubled ir-ANF release (P < 0.01)
compared with vehicle-treated control cultures. Northern blot analysis
(16) also demonstrated an increase in the abundance of pro-ANF mRNA
signals in E2-treated cultures (Fig. 1C
). At
10-14 M, E2 increased pro-ANF mRNA
levels by approximately 50% and signal levels were 2.5 times control
at 10-10 M E2.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 1. Stimulatory Effects of 17ß-Estradiol
(E2) on the Secretion of ir-ANF and Amounts of pro-ANF mRNA
in Primary Hypothalamic Cell Cultures Prepared from Neonatal Rats
A, Dose-related stimulation of E2. B, Suppression of
E2 stimulation by SCH-23390, a D1-like receptor
antagonist or rp-cAMP, a cAMP antagonist, and E2
potentiation of SKF-38393 (10-7 M), a
D1-like receptor agonist, stimulation of ir-ANF release.
C(a), Amounts of pro-ANF mRNA (upper panel) and their
corresponding 18S rRNA (lower panel) from cultures
treated with various doses of E2 alone or in the presence
of SCH-23390 or rp-cAMP. C(b), Bar graph showing changes in pro-ANF
mRNA abundance after various treatments. Statistical significance by
ANOVA followed by post-hoc tests with the values shown representing
mean ± SE; n = 4 to 6. The
asterisks denote values significantly different from the
vehicle-treated control groups (CTL); hatches indicate
values significantly different from cultures treated with corresponding
doses of E2; symbols indicate values significantly
different from hypothalamic cells treated with SKF-38393 alone, *, #,
, P < 0.05; **, ##,  ,
P < 0.01.
|
|
E2 modulates gene transcription by the binding of
steroid/receptor complexes to estrogen-responsive elements in DNA (17).
Mapping studies of the regulatory region on the rat ANF gene in or
proximal to its promoter region failed to show an estrogen response
element consensus sequence (18). Increasing evidence now
suggests that the adenylyl cyclase-cAMP system may cross-talk with
steroid receptor-mediated effects or gene expression in various
biological systems (19, 20, 21, 22). Given that the cAMP-dependent protein
kinase A pathway amplifies adrenocorticoid-induced ANF production in
culture (14), E2-induced stimulation of ANF neurons may
similarly involve a cAMP-dependent mechanism. This is of particular
potential relevance in that ANF neurons are stimulated by
Dl-like receptor agonists that activate the adenylyl
cyclase-cAMP system (16). To address this issue, we examined the
effect of SCH-23390, a dopamine D1-like receptor
antagonist, on E2 stimulation of ANF neurons. At a low dose
(10-7 M) SCH-23390 (Fig. 1B
) significantly
suppressed E2-induced ir-ANF release, with baseline
secretion unaffected. This effect of estrogen was also blocked by
10-4 M of rp-cAMP, a cAMP antagonist
(Fig. 1B
). The above observations on ir-ANF release were extended to
show marked lowering of pro-ANF mRNA in cultures exposed to SCH-23390
or rp-cAMP (Fig. 1C
). In addition, E2 treatment markedly
enhanced the effect of SKF-38393 (10-7 M), a
dopamine D1-like receptor agonist that stimulated ir-ANF
release in a dose-dependent manner (Fig. 1B
). The above results suggest
that the E2-induced effects on ANF neurons are mediated, at
least in part, via activation of endogenous D1-like
receptors.
It is now evident that the D1-like receptor family consists
of D1(D1A) and D5(D1B)
receptor subtypes that have different biochemical characteristics
(23, 24, 25) and distribution in the brain (26, 27, 28, 29). The lack of specific
ligands for D1 and D5 receptors has delayed
detailed studies of their functional differences that distinguish their
involvement. To address this, specific antisense oligonucleotides for
D1 and D5 receptors were synthesized and
applied to our hypothalamic cultures to differentially suppress their
expression. Figure 2
shows that
E2 stimulation of ir-ANF release (Fig. 2A
) and pro-ANF mRNA
expression (Fig. 2B
) are significantly inhibited in cultures treated
with antisense oligonucleotides complementary to D5
(P < 0.01) but not D1 receptor mRNA;
estrogen action was not affected by sense oligonucleotides for either
D5 or D1 receptor mRNA (data not shown). To
determine whether E2 might also affect dopamine receptor
expression, we examined mRNA abundance for D5 and
D1 receptors in cultures by RT-PCR (15) before and after
E2 treatment. Figure 3
, A(b) and B(b), shows
representative Southern blot analysis of D5 and
D1 receptor mRNA (upper panel) and their
corresponding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA
(lower panel) levels from the same cultures. Estrogen
significantly augments the production of D5 receptor mRNA
in hypothalamic cultures, in a dose-related manner [Fig. 3A
(a)]; in
contrast, levels of D1 receptor mRNA are not affected
[Fig. 3B
(a)]. Consistent with these results, recent reports have
confirmed that D5 receptors are predominant in the rat
hypothalamus (27, 29). This is also true in our hypothalamic cultures,
confirmed by semiquantitative in situ hybridization studies
of D5 and D1 receptor mRNA (data not shown).
The stimulatory effect of E2 seems, therefore, to be
mediated, at least in part, by enhancing overall expression of
D5 but not D1 receptor mRNA in hypothalamic
cells, presumably including ANF neurons. It is relevant to point out
here that E2 induction of D5 receptor
expression is independent of cAMP protein kinase pathway, as the effect
was not blocked by rp-cAMP (data not shown).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 2. Effects of 17ß-Estradiol (E2) Alone
or in the Presence of Phosphorothioate- Modified Oligonucleotides
Antisense for D5 (5'-ATGTCGCGCTGAGTAGCTCG, 676696) or
D1 (5'-TTGTGAAGATGGTACCTACTCCGGCCCGAC, 425454) Receptors
A, Effect on the secretion of ir-ANF; and B(a), the amounts of pro-ANF
mRNA (upper panel) and 18 s rRNA (lower
panel) in hypothalamic cell cultures. B(b), Bar graph showing
changes of pro-ANF mRNA after various treatments. Statistical
significance by ANOVA followed by post hoc tests with values shown
representing mean ± SE, and n = 3.
Asterisks denote significant changes when compared with
the control group (CTL). #, Significant differences in cultures treated
with similar levels of E2. *, #, P <
0.05; **, ##, P < 0.01.
|
|

View larger version (65K):
[in this window]
[in a new window]
|
Figure 3. Effects of 17ß-Estradiol (E2) on the
Amounts of Dopamine D5 and D1 Receptor mRNA in
Hypothalamic Cultures
A(a), Bar graph; and A(b), a representative of E2
dose-related effect on D5 receptor mRNA abundance. B(a),
Bar graph; and B(b), levels of D1 receptor mRNA in
E2 treated cultures. Statistical significance by ANOVA
followed by post-hoc tests with the values shown representing
mean ± SE; n = 3. The asterisks
denote values significantly different from the vehicle-treated control
group (CTL); *, P < 0.05; **,
P < 0.01. C, Representative of cultured
hypothalamic neurons showing triple staining for C(a), immunoreactive
atrial natriuretic factor in immunogold silver staining; C(b),
in situ hybridization of D5 receptor mRNA
with rhodamine approach; and C(c), ER immunoreactivity in fluorescence.
No positive signal was detected in hypothalamic cultures when incubated
with anti-ANF antiserum preabsorbed with an excess amount (1 µg) of
synthetic rat ANF(1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 ) (C(a), lower panel), pretreated with RNAase (C(b),
lower panel), or omitted primary antiserum against ER
(C(c) lower panel). D denotes triple staining as in C
except in D(c) showing progesterone receptor immunoreactivity of
cultures treated 4 days with E2 (10-10
M). Lower panel of D(c) shows control
staining with omission of primary antiserum against progesterone
receptor. Scale bar = 10 µm.
|
|
To confirm that ANF neurons possess both E2 and
D5 receptors, we used a triple staining technique of
in situ hybridization (16) for D5 receptor mRNA
and immunostaining for both ir-ANF and ER. Figure 3C
(b) shows a
representative cell stained for D5 receptor mRNA that is
also positive for both ir-ANF [Fig. 3C
(a)] and ER [Fig. 3C
(c)].
More than 80% of the ir-ANF positive cells stained simultaneously for
D5 receptor mRNA signals and immunoreactive ER; this
confirms that most of the ir-ANF positive cells in our cultures express
D5 and ERs concurrently. In contrast, among non-ANF-stained
neurons, a small proportion (<10%) of the immunoreactive ER positive
cells showed positive staining for D5 receptor mRNA.
Furthermore, immunoreactive progesterone receptors were also detected
in greater than 70% of ir-ANF positive cells expressing D5
receptors in cultures treated for 4 days with E2
(10-10 M), but not in E2-free
control cultures (Fig. 3D
).
Although our primary hypothalamic cell cultures include endogenous
dopamine producing neurons, the highest concentration of the amine
detected in the culture medium at any one time, with or without
E2, was less than 10-9 M, measured
by HPLC (data not shown). Because approximately 10-5
M or 4 orders of magnitude higher dopamine concentration is
required to induce a significant release of ANF in our cultures (16),
the low level of endogenous dopamine detected in the cultures is
unlikely to contribute significantly to the E2-induced
functional stimulation of ANF neurons. It has recently been reported
that cloned human D5 receptors show autoactivity,
generating cAMP in a ligand-independent manner (24), involving the
activation of adenylyl cyclase and being inhibited by
D1-like receptor antagonists. To confirm that autoactivity
of D5 receptors remains true across species and may account
for the E2-induced effect observed in rat hypothalamic
cultures, we have cloned rat dopamine D5 receptor cDNA and
transfected it into Chinese hamster ovary (CHO) cells. As shown in Fig. 4A
, the transfected cells stably expressing
rat D5 receptors have a higher basal content of cAMP, about
double that obtained from mock-transfected CHO cells. The receptors
appear to be biologically active, because they are stimulated by
SKF-38393, a D1-like receptor agonist, but not by
quinpirole, a D2-like receptor agonist. Consistent with
previous reports (24), this autoenhancement of cAMP generating activity
is reversed in a dose-related manner by butaclamol and flupentixol, two
D1-like receptor antagonists, to a level similar to that
found in mock transfected cells (see Fig. 4B
). Our present observations
confirm that, like their human counterparts, rat D5
dopamine receptors indeed show intrinsic cAMP generation in a
ligand-independent manner. Similar changes in terms of cAMP have also
been demonstrated in our hypothalamic cell cultures, where long-term
E2 treatment also induced a dose-dependent increase in
culture cAMP content, which was suppressed by SCH-23390, butaclamol, or
flupentixol (Fig. 4C
). In addition, E2 also significantly
enhanced cAMP content induced by SKF-38393, the D1-like
receptor agonist (Fig. 4C
).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4. Cell Contents of cAMP
A, In D5 receptor-transfected and MOCK CHO cells treated
with SKF-38393 (SKF), a D1-like receptor agonist or
quinpirole (Qui), a D2-like receptor agonist. B, In
D5 receptor-transfected CHO cells receiving butaclamol (Bu)
or flupentixol (Fp), two D1-like receptor antagonists. C,
In E2-treated primary hypothalamic cell cultures
coincubated with SKF or Bu or Fp or SCH-23390(SCH). Statistical
significance by ANOVA followed by post-hoc tests with values shown
representing mean ± SE. In panels A and B,
asterisks denote significant changes in comparison with
MOCK CHO cells (CTL), and hatches denote significant
changes in comparison with D5 receptor-transfected CHO
cells treated with vehicle. In panel C, asterisks denote
significant changes in comparison with vehicle-treated hypothalamic
cultures; @ denotes significant changes in comparison with
hypothalamic cells treated with comparable levels of E2;
and denotes significant changes in comparison with hypothalamic
cells treated with SKF-38393 alone; *, #, @, ,
P < 0.05; **, ##, @@,  , P
<0.01.
|
|
E2-induced functional enhancement of ANF neurons can thus
be attributed to augmented expression of D5 receptors and
cAMP generation in our hypothalamic cultures. This assertion is
consistent with the observation that the E2-induced
D5 receptor expression described here is seen after 4 days
of low levels of E2 (10-13 M and
greater), and involves synthesis of new proteins and is cyclohexamide
sensitive. Cyclohexamide (5 µg/ml) significantly suppressed
10-10 M of E2 induced ir-ANF
release (from 128.3 ± 4.9 to 61.5 ± 8.4; n = 4;
P < 0.01) under the same conditions as described in
Fig. 1
. It is important to point out that the effect of E2
described here is different from that reported earlier by other
investigators, where an acute application of high concentrations of
E2 directly activated the adenylyl cyclase-cAMP system in a
manner not requiring synthesis of new proteins (21).
In summary, estrogen has long been believed to play a role in brain
functions by modulating the action of the central dopaminergic system
(3, 4, 5, 6) through dopamine receptor numbers, binding characteristics, and
dopamine uptake (30, 31, 32). In addition to its direct effect on
progesterone receptor synthesis, direct enhancement of D5
receptor expression should now be included as one of the mechanisms by
which the ovarian steroid estrogen mediates its neurobiological effects
in the brain.
 |
MATERIALS AND METHODS
|
|---|
Cell Cultures
Neonatal rat hypothalamic cultures were prepared (14, 33, 34, 35) by
enzymatic dispersion of hypothalami removed from 2- to 3-day-old
Sprague-Dawley rat pups. The dispersed cells were maintained (1 million
cells per 22- mm well) in HEPES-buffered DMEM (HDME) supplemented with
8% FCS at 37 C in 10% CO2. All release studies were
conducted on the seventh day of culture and extended over a period of 4
days. The drugs were applied every 24 h to the cultures. Four
hours after the last application of vehicle or drugs, conditioned media
were removed and extracted for immunoreactive ir-ANF release
measurement by double-antibody RIA (14, 35, 36, 37). To determine the
intracellular cAMP, the culture media were replenished with fresh
culture medium containing isobutylmethylxanthine for 30 min at
37 C after a 4-day treatment with various doses of E2. The
cells were then incubated with D1-like receptor agonist or
antagonists in the presence of E2 for 15 min. The reaction
was terminated by aspirating the medium, adding 1 ml of stop solution
(0.01 M of HCL in ethanol) and placing at room temperature
for 30 min. The extracts were lyophilized and reconstituted for RIA
(16). Intracellular cAMP was then extracted and quantified using RIA
modified from the method described by Marley (38). Each of the
experiments was performed at least three times; within an experiment,
the results of an individual condition represented the average of three
to four cultured wells. Results presented here are the mean of three or
more separate experiments from different batches of cell
preparations.
Northern Blot Analysis
After treatment, cells were lysed directly in the well by adding
0.5 ml of TRIZOL Reagent (Life Technologies, Gaithersburg, MD). The
cell lysate from three individual wells, each with 106
cells, were harvested by pipetting and pooled together as a single
sample for the study. The cytoplasmic RNA was further extracted by
chloroform and precipitated with isopropyl alcohol. Twelve micrograms
of total RNA from each of the samples fractionated by electrophoresis
through formaldehyde-agarose gel were transferred to nylon membrane and
hybridized with digoxigenin-labeled ANF-antisense oligonucleotide
probes (14, 33, 34, 35, 39, 40, 41, 42) and visualized by colorimetric reaction.
The signals of individual bands for pro-ANF mRNA were measured as
integrated optical densities (IOD) by a computer based Image-Pro Plus
version 3 (Media Cybernetics, Silver Spring, MD) taking the
vehicle-treated controls as 100% for statistical comparison. After
signal analysis, the same blots were reprobed with digoxigenin-labeled
18 S rRNA oligonucleotide. The IOD readings of each band of pro-mRNA
from various treatment groups were adjusted to the IOD of corresponding
bands of 18 S rRNA; the values were then expressed as a percentage of
that of the vehicle-treated controls.
RT-PCR
The expression of D5 mRNA in the hypothalamic
cultures was determined using RT-PCR techniques (15). The rat
D5 cDNA sequences were obtained from GenBank under sequence
number M69118. The 5'-sense primer for PCR amplification of
D5 cDNA (5'-GGCTGGGATTACAGAGGCAACTGG) is located at bases
734757 of the sequence, and the 3'-antisense primer
(5'-TCTCCTTCTTGATGGACGCTCGC) is complementary to bases 15271549. PCR
with this primer pair produced 816-bp fragments from rat genomic DNA
(not shown) and from cDNA generated from RNA extracts. For GAPDH
RT-PCR, PCR primers were designed according to two published rat GAPDH
cDNA sequences of the same length with 98.3% sequence identity
(GenBank nos. X02231/X00972 and M17701) (43, 44). The 5'-sense primer
(5'-GTGATGCTGGTGCTGAGTATGTCG) is located at bases 328351 of the
sequence, and the 3'-antisense primer (5'-GTGGATGCAGGGATGATGTTCTGG) is
complementary to bases 674697. PCR with these primers produced 370 bp
fragments of GAPDH from rat cDNA made from RNA extracts.
Hypothalamic cultures were treated with vehicle or various doses of
E2 (10-14 to 10-10 M)
for 4 days. After treatment, cells were lysed by Trizol (see
Northern Blot Analysis) and extracted by chloroform and
precipitated with isopropyl alcohol. The possible contamination of DNA
was excluded by incubation with RNase-free DNase (Boehringer,
Indianapolis, IN) in 1 U/µl DNAase digestion buffer (140
mM sodium chloride, 10 mM magnesium chloride,
10 mM Tris, 1 mM dithiothreitol, pH 8.0) for 30
min at 37 C and phenol extracted. The cytoplasmic RNA samples were then
reverse transcripted with SuperScrip Preamplification System
(Boehringer) in a total volume of 20 µl using 0.5 µl of oligo (dT)
for 60 min at 42 C. Two microliters of each cDNA sample were
added to a PCR reaction mixture containing 1.5 mM
MgCl2, 50 mM KCl, 10 mM Tris, 50
µM deoxynucleoside triphosphates, and 20 pmol of
the sense and antisense primers for D5 receptor in a total
volume of 50 µl. Five picomoles of the sense and antisense primers
for GAPDH, used as an internal control, were also added to the reaction
mixture. The mixtures were overlaid with 75 µl of mineral oil and
heated to 99 C for 5 min; 1.25 U Taq polymerase (Boehringer)
were added to each mixture. The reaction series were initiated on a
Perkin-Elmer/Cetus (Norwalk, CT) thermal cycler (95 C, 1 min; 59 C, 1
min; 72 C, 1 min; 30 cycles). A 7-min incubation at 72 C was added at
the end to ensure complete extension. A negative control experiment was
performed by omitting reverse transcriptase in the cDNA synthesis
reaction. To draw a standard curve, RTs were carried out from total RNA
extracted from 0.06 to 6 vehicle-treated wells (0.2524 µg). The
amplification curve was linear between 0.5 and 12 µg total RNA for
both D5 and GAPDH. Consequently, for quantitative analysis,
RTs were carried out with total RNA extracted from 1 well (
4 µg)
from each of the treated groups.
Aliquots of the amplified DNA samples were loaded onto agarose gels and
fractionated; a single lane in each gel contained a DNA mol wt marker
VI (Boehringer). The gels were transferred onto nylon membrane and cut
into two parts according to their molecular sizes. The membrane with
higher mol wt bands was hybridized with 24 mer digoxigenin-
labeled antisense oligonucleotide probes complementary to
D5 cDNA (5'-TGGCAGCACACACTAGCACGTTCC, 857880); the
second part of the membrane with lower mol wt bands was hybridized with
24 mer digoxigenin-labeled antisense oligonucleotide probes
complementary to rat GAPDH cDNA (5'-GCCATCCACAGTCTTCTGAGTGGC,
612635). The hybridization signals were detected with similar methods
as described in Northern Blot Analysis. The signals of
individual bands for RT-PCR D5, measured as integrated
optical densities by the Image-Pro Plus version 3, were further
standardized against those of GAPDH for comparison.
Similar procedures were followed to measure the expression of
D1 receptor mRNA in the hypothalamic cultures. The rat
Dl cDNA sequences were obtained from GenBank under sequence
no. M35077. The 5'-sense primer (5'-AGAAGGTTGAGCAGGACGTATGC) is located
at bases 977999 of the sequence, and the 3'-antisense primer
(5'-AAGCCCAAGGGAACTCGTGG) is complementary to bases 17801799. PCR
with these primers produced 823 bp fragment from rat cDNA made from RNA
extracts of D1 receptor mRNA. The standard amplification
curves for the D1 were almost the same as those for
D5 receptor. For quantitative analysis of Dl
receptor mRNA level, the RTs were also carried out with total RNA
extracted from one well from each treated group. The Southern blot for
D1 receptor cDNA was hybridized with digoxigenin-labeled
oligonucleotide probes of 30 mer corresponding to the 514 amino acids
of rat D1 receptor.
Triple Staining
Cells treated with vehicle or 10-10 M
E2 were washed and fixed with 3% phosphate buffered
paraformaldehyde (34, 42). After fixation, the cells were washed in
PBS, incubated in prehybridization buffer, and incubated overnight at
37 C with 24 mer digoxigenin-labeled antisense oligonucleotide probes
(100 pmol/ml) complementary to D5 cDNA
(5'-TGGCAGCACACACTAGCACGTTCC, 857880). The cultures were then washed
for 3 h with decreasing concentrations of saline-sodium
citrate. In colocalization studies, Fab segments of sheep
antiserum raised against digoxigenin and conjugated with rhodamine
[tetramethylrhodamine isothiocyanate (TRITC), 1:40;
Boehringer-Mannheim] were added together with ANF antiserum (R178,
1:50) of rabbit and monoclonal ER antiserum (1:100, Chemicon
International, Inc., Temecula, CA) or monoclonal progesterone receptor
antiserum (1:100, Calbiochem, La Jolla, CA) in Tris buffer containing
1% BSA and 0.3% Triton X-100 overnight at 4 C. The cells were then
washed and incubated concurrently with fluorescein
isothiocyanate-conjugated sheep antimouse Fab antiserum (1:40)
and gold-conjugated swine antirabbit IgG antiserum (1:200) for 60 min.
At the end of the incubation, wells were washed and applied with silver
enhancement. After a short incubation, the intensity of gold staining
was monitored through a microscope and the reaction was terminated by
washing with tap water. The cells were then mounted in glycerol-Tris
buffer containing 1 mg/ml p-phenylenediamine to minimize
fluorescence bleaching (45) during microphotography with a Nikon
DIAPHOT model TMD microscope (Nikon, Inc., Garden City, NY).
Fluorescein isothiocyanate and TRITC were viewed with
Epi-fluorescence filter combination B-2E and G-2A, respectively.
Specificity of the ir-ANF staining was demonstrated by the absence of
specific staining when primary antisera were replaced with Tris
buffer, normal rabbit serum, or anti-ANF antiserum preabsorbed with an
excess amount of synthetic rat ANF(99126). Specificity of
immunoreactive estrogen or progesterone receptor was confirmed by
absence of specific staining when primary antisera were replaced with
Tris buffer. In the case of in situ hybridization, to
eliminate the possibility of false positive staining, the replacement
of antisense probe with sense probe, pretreatment of fixed cultures
with RNase, coincubation with excess of unlabeled oligo probes,
application of antidigoxigenin antiserum without probe, or application
of second antisera alone was carried out. For triple staining, negative
controls that employed either primary antiserum or oligonucleotide
probe alone in the presence of one of the noncorresponding second
antisera were included. In all cases, no significant staining was
observed above background.
Construction of Mammalian Expression D5
Receptor Vector, CHO Cell Transfection, and Measurement for cAMP
Total RNA was extracted from cultured rat hypothalamus by
TRIZOL and amplified by RT-PCR. Primers corresponding to
5'-(TTCTCGAGCTACTCAGCGCGACATGC, 672697, XhoI
site underlined) and 3'-(TTCTATGCAGCAGACTACAGAAAGC,
22402264) untranslated regions of rat D5 receptor cDNA
were used in the PCR to amplify the full-length cDNA encoding the rat
D5 receptor. Hot start PCRs were initiated as described
above, followed by 35 cycles of 95 C for 1 min, 62 C for 1 min, and 72
C for 1 min, with a final extension at 72 C for 7 min. The PCR products
were purified using the QIAquick Spin purification kit from Bresatec
(Thebarton, SA, Australia), and the nucleotide sequence was
confirmed by dideoxy sequencing of double-strand DNA using DNA
sequencing system from Promega following the manufacturers
instructions. Briefly, the samples were analyzed by electrophoresis on
a 6% polyacrylamide, 7 M urea gel, dried onto whatman 3M
paper, and exposed to x-ray film (Kodak BioMax, MR-1, Eastman-Kodak,
Rochester, NY) for 16 h at -70 C. The sequence of the amplified
cDNA is identical to the published rat D5 receptor
sequence. The cDNA was then modified by adding a HindIII
linker at the 3'-end and cloned into the SalI and
HindIII sites of a mammalian expression vector pAX (a gift
from Dr. Gillian Hayes of Garvan Institute of Medical Research, Sydney,
Australia) to generate pAXD5 (46), in which expression of
cDNA is driven by the human ß-actin promoter.
CHO cells were grown in
-medium (GIBCO/BRL) supplemented with
8% FCS in six-well dishes (35 mm; Costar, Cambridge, MA; 2 x
106 cells per dish) and transfected at 90%100%
confluence using a modified calcium phosphate method with
D5 receptor DNA, pAXD5 or wild-type pAX vector
(MOCK). The amount of DNA was 10 µg/well for maximal expression.
After transfection (4 h), CHO cells were shocked with 15% glycerol in
PBS for 3 min, washed with PBS, and fed with fresh culture medium.
After a recovery period (24 h), cells were trypsinized and replated in
-medium containing geneticin (G418) for the isolation of stable
transformants. Selection of stably transformed cells was over a period
of 4 weeks in the presence of 800 µg/ml G418, after which time clonal
cell lines were isolated by dilution cloning. Successful transfection
of D5 receptor in CHO cells was confirmed by in
situ hybridization with digoxigenin-labeled oligonucleotide
complementary to D5 cDNA (5'-TGGCAGCACACACTAGCACGTTCC,
857880) and by RT-PCR the total RNA extracted from CHO cells
with primers corresponding to the coding regions of rat D5
receptor cDNA described above, followed by Southern blotting with
digoxigenin-labeled oligonucleotide complementary to D5
cDNA (5'-TCTCCTTCTTGATGGACGCTCGC, 15271549). To determine the
intracellular cAMP, the transfected cells were seeded in a 24-well cell
culture cluster (16 mm; Costar, Cambridge, MA; 0.4 x
106 cells per well). Two days later, the culture medium was
replaced by fresh
-medium containing isobutylmethylxanthine
for 30 min at 37 C, and the cells were then incubated with various
drugs for 15 min. The reaction was terminated by adding 0.5 ml of stop
solution, and the intracellular cAMP was then extracted and quantified
using RIA (see Cell Cultures).
Experimental Animals
All the animal studies were conducted in accordance with the
principle and procedures outlined in the "Australia Code of Practice
for the Care and Use of Animals for Scientific Purposes" and approved
by the Animal Ethics Committee of the Institute.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Professor John Funder for constructive
comments.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr Alan T. Lim, Cell Biology Laboratory, Division of Molecular Schizophrenia, Mental Health Research Institute of Victoria, 155 Oak Street, Parkville, Victoria, Australia 3052.
This work was supported by the Woods Family Research Program, a
contracted research grant from the State Health Department of Victoria,
and an equipment grant from The Rebecca L. Cooper Medical
Research Foundation Ltd. Sydney, Australia.
Received for publication June 24, 1998.
Revision received September 30, 1998.
Accepted for publication October 13, 1998.
 |
REFERENCES
|
|---|
-
Fink G 1988 Oestrogen and progesterone interactions in
the control of gonadotrophin and prolactin secretion. J Steroid Biochem 30:169178[CrossRef][Medline]
-
McEwen BS 1992 Steroid hormones: effect on brain development
and function. Horm Res 37[Supp13]:110
-
Di Paolo T 1994 Modulation of brain dopamine transmission by
sex steroids. Rev Neurosci 5:2741[Medline]
-
Bosse R, Di Paolo T 1995 Dopamine and GABAA
receptor imbalance after ovariectomy in rats: model of menopause.
J Psychiatry Neurosci 20:364371[Medline]
-
Halbreich U, Piletz J, Halaris A 1992 Influence of gonadal
hormones on neurotransmitters, receptor, cognition and mood. Clin
Neuropharmacol 15 [Suppl 1]:590A591A
-
Melis MR, Argiolas A 1995 Dopamine and sexual behavior.
Neurosci Biobehav Rev 19:1938[CrossRef][Medline]
-
OMalley BW, Schrader WT, Mani S, Smith C, Weigel NL,
Conneely OM, Clark JH 1995 An alternative ligand-independent pathway
for activation of steroid receptors. Recent Prog Horm Res 50:333347
-
Mani SK, Allen JM, Clark JM, Blaustein JD, OMalley BW 1994 Convergent pathways for steroid hormone- and
neurotransmitter-induced rat sexual behavior [published erratum
appears in Science 1995 Jun 30;268(5219):1833]. Science 265:12461249[Abstract/Free Full Text]
-
Sullivan KA, Witkin JW, Ferin M, Silverman AJ 1995 Gonadotropin-releasing hormone neurons in the rhesus macaque are not
immunoreactive for the estrogen receptor. Brain Res 685:198200[CrossRef][Medline]
-
Watson REJ, Hutchinson RK, Langub MCJ, Landis JW, Seksaria S,
Rainey DM, Keil LC 1994 Colocalization of natriuretic peptide and
estrogen receptor immunoreactivities in preoptic nuclei in the female
rat. J Neuroendocrinol 6:7987[CrossRef][Medline]
-
Samson WK, Alexander BD, Skala KD, Huang FL, Fulton RJ 1992 Central peptidergic mechanisms controlling reproductive hormone
secretion: novel methodology reveals a role for the natriuretic
peptides. Can J Physiol Pharmacol 70:773778[Medline]
-
Rodriguez Lopez P, Ehlerding A, Leonhardt S, Jarry H, Wuttke W 1993 Effects of angiotensin II and atrial natriuretic peptide on LH
release are exerted in the preoptic area: possible involvement of
gamma-aminobutyric acid (GABA). Exp Clin Endocrinol 101:350355[Medline]
-
Samson WK, Agulia MC, Bianchi R 1988 Atrial natriuretic factor
inhibits luteinizing hormone secretion in the rat: evidence for
hypothalamic site of action. Endocrinology 122:15731582[Abstract/Free Full Text]
-
Huang W, Choi CL, Yang Z, Copolov DL, Lim AT 1991 Forskolin
induced immunoreactive atrial natriuretic peptide secretion and pro-ANP
mRNA expression of hypothalamic neurons in culture: modulation by
glucocorticoids. Endocrinology 128:25912600[Abstract/Free Full Text]
-
Lee D, Huang W, Copolov DL, Lim AT 1995 Glucocorticoids
inhibit Dlb, but not D2, receptor-mediated
effects on hypothalamic atrial natriuretic factor neurons.
Endocrinology 136:55705576[Abstract]
-
Lee D, Huang W, Lim AT 1995 Dl receptors mediate
dopamine stimulation of irANF release and pro-ANF mRNA expression of
rat hypothalamic neurons in culture. Endocrinology 131:911918[Abstract/Free Full Text]
-
Tsai MJ, OMalley BW 1994 Molecular mechanisms of action of
steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451486[CrossRef][Medline]
-
Ruskciaho H 1992 Atrial natriuretic peptide: synthesis,
release, and metabolism. Pharmacol Rev 44:479602[Medline]
-
Denner LA, Weigel NL, Maxwell BL, Schrader WT, OMalley BW 1990 Regulation of progesterone receptor-mediated transcription by
phosphorylation. Science 250:17401743[Abstract/Free Full Text]
-
Cho H, Aronica SM, Katzenellenbogen BS 1994 Regulation of
progesterone receptor gene expression in MCF-7 breast cancer cells: a
comparison of the effects of cyclic adenosine 3',5'-monophosphate,
estradiol, insulin-like growth factor-I, and serum factors.
Endocrinology 134: 658664
-
Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action
via the cAMP signaling pathway: stimulation of adenylate cyclase and
cAMP-regulated gene transcription. Proc Natl Acad Sci USA 91:85178521[Abstract/Free Full Text]
-
Aronica SM, Katzenellenbogen BS 1993 Stimulation of estrogen
receptor-mediated transcription and alteration in the phosphorylation
state of the rat uterine estrogen receptor by estrogen, cyclic
adenosine monophosphate, and insulin-like growth factor-I. Mol
Endocrinol 7:743752[Abstract/Free Full Text]
-
Civelli O, Bunzow JR, Grandy DK 1993 Molecular diversity of
the dopamine receptors. Annu Rev Pharmacol Toxicol 33:281307[CrossRef][Medline]
-
Tiberi M, Caron MG 1994 High agonist-independent activity is a
distinguishing feature of the dopamine D1B receptor subtype. J
Biol Chem 269:2792527931[Abstract/Free Full Text]
-
Kimura K, White BH, Sidhu A 1995 Coupling of human D-1
dopamine receptors to different guanine nucleotide binding proteins.
Evidence that D-1 dopamine receptors can couple to both Gs and G(o).
J Biol Chem 270:1467214678[Abstract/Free Full Text]
-
Bergson C, Mrzljak L, Smiley JF, Pappy M, Levenson R, Goldman
Rakic PS 1995 Regional, cellular, and subcellular variations in the
distribution of D1 and D5 dopamine receptors in
primate brain. J Neurosci 15:78217836[Abstract]
-
Tiberi M, Jarvie KR, Silvia C, Falardeau P, Gingrich JA,
Godinot N, Bertrand L, Yang Feng TL, Fremeau RTJ, Caron MG 1991 Cloning, molecular characterization, and chromosomal assignment of a
gene encoding a second D1 dopamine receptor subtype:
differential expression pattern in rat brain compared with the
D1A receptor. Proc Natl Acad Sci USA 88:74917495[Abstract/Free Full Text]
-
Meador Woodruff JH, Grandy DK, Van Tol HH, Damask SP, Little
KY, Civelli O, Watson SJJ 1994 Dopamine receptor gene expression in the
human medial temporal lobe. Neuropsychopharmacology 10:239248[Medline]
-
Meador Woodruff JH, Mansour A, Grandy DK, Damask SP, Civelli
O, Watson SJJ 1992 Distribution of D5 dopamine receptor
mRNA in rat brain. Neurosci Lett 145:209212[CrossRef][Medline]
-
Di Paolo T, Bedard PJ, Dupont A, Poyet P, Labric F 1982 Effects of estradiol on intact and denervated striatal dopamine
receptors and on dopamine levels: a biochemical and behavioral study.
Can J Physiol Pharmacol 60:350357[Medline]
-
Levesque D, Di Paolo T 1991 Dopamine receptor reappearance
after irreversible receptor blockade: effect of chronic estradiol
treatment of ovariectomized rats. Mol Pharmacol 39:659665[Abstract]
-
Levesque D, Gagne B, Barden N, Di Paolo T 1992 Chronic
estradiol treatment increases anterior pituitary but not striatal
D2 dopamine receptor mRNA levels in rats. Neurosci Lett 140:58[CrossRef][Medline]
-
Huang W, Lee D, Yang Z, Copolov DL, Lim AT 1992 Norepinephrine
stimulates immunoreactive (ir) atrial natriuretic peptide (ANP)
secretion and pro-ANP mRNA expression from rat hypothalamic neurons in
culture: effect of ß2-adrenoceptors. Endocrinology 130:24262428[Abstract/Free Full Text]
-
Lee D, Huang W, Yang Z, Copolov DL, Lim AT 1992 In
vitro evidence for modulation of morphological and functional
development of hypothalamic ir-ANP neurons by 3'5'-cyclic-adenosine
monophosphate. Endocrinology 131:911918
-
Huang W, Lee D, Yang Z, Copolov DL, Lim AT 1992 Plasticity of
adrenoceptor responsiveness on irANP secretion and pro-ANP mRNA
expression in hypothalamic neuron cultures: modulation by
dexamethasone. Endocrinology 131:15621564[Abstract/Free Full Text]
-
Bush AI, Huang W, Copolov DL, Lim AT 1990 Hypothalamic atrial
natriuretic peptide secretion plasticity: differential modulation of
- and ß-adrenoceptors. Neuroendocrinology 52:6569[Medline]
-
Lim AT, Dean B, Copolov DL 1990 Evidence for
post-translational processing of auriculin B to atriopeptin III
immediately prior to secretion by hypothalamic neurons in culture.
Endocrinology 127:25982600[Abstract/Free Full Text]
-
Marley PD, Thomson KA, Jachno K, Johnston MJ 1991 Histamine-induced increases in cyclic AMP levels in bovine adrenal
medullary cells. Br J Pharmacol 104:839846[Medline]
-
Huang W, Lee D, Yang Z, Casley DJ, Throsby M, Copolov DL,
Johnston CI, Lim AT 1992 Evidence for ANP(528) production by rat
placental cytotrophoblasts. Endocrinology 131:919924[Abstract/Free Full Text]
-
Throsby M, Lee D, Huang W, Yang Z, Copolov DL, Lim AT 1991 Evidence for ANP(5x28) production by macrophages of the rat spleen: an
immunochemical and non-radioactive in situ hybridization approach.
Endocrinology 129:9911000[Abstract/Free Full Text]
-
Lee D, Huang W, Copolov DL, Lim AT 1994 D2
receptors mediate dopamine suppression of irANF release and pro-ANF
mRNA expression of rat hypothalamic neurons in culture. Mol Cell
Neurosci 5:523529[CrossRef][Medline]
-
Throsby M, Yang Z, Lee D, Huang W, Copolov DL, Lim AT 1993 Co-expression of atrial natriuretic factor and ß-endorphin in a
sub-population of rat splenic macrophages: age-related differences.
Endocrinology 133:28892896[Abstract/Free Full Text]
-
Tso JY, Sun XH, Kao TH, Reece KS, Wu R 1985 Isolation and
characterization of rat and human glyceraldehyde-3-phosphate
dehydrogenase cDNAs: genomic complexity and molecular evolution of the
gene. Nucleic Acids Res 13:24852502[Abstract/Free Full Text]
-
Piechaczyk M, Blanchard JM, Riaad EI Sabouty S, Dani C, Marty
L, Jeanteur P 1984 Unusual abundance of vertebrate 3-phosphate
dehydrogenase pseudogenes. Nature 312:469471[CrossRef][Medline]
-
Johnson GD, Nogueira Araujo GMC 1981 A simple method of
reducing the fading of immunofluorescence during microscopy. J
Immunol Methods 43:349350[CrossRef][Medline]
-
Hayes G, Biden TJ, Selbie LA, Shine J 1992 Structural subtypes
of the dopamine D2 receptor are functionally distinct:
expression of the cloned D2A and D2B subtypes
in a heterologous cell line. Mol Endocrinol 6:920926[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
P. Blommel, G. T. Hanson, and K. W. Vogel
Multiplexing Fluorescence Polarization Assays to Increase Information Content Per Screen: Applications for Screening Steroid Hormone Receptors
J Biomol Screen,
June 1, 2004;
9(4):
294 - 302.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tumova, R. M. Iwasiow, and M. Tiberi
Insight into the Mechanism of Dopamine D1-like Receptor Activation. EVIDENCE FOR A MOLECULAR INTERPLAY BETWEEN THE THIRD EXTRACELLULAR LOOP AND THE CYTOPLASMIC TAIL
J. Biol. Chem.,
February 28, 2003;
278(10):
8146 - 8153.
[Abstract]
[Full Text]
[PDF]
|
 |
|