help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, Y.
Right arrow Articles by Duckworth, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, Y.
Right arrow Articles by Duckworth, M. L.
Molecular Endocrinology 13 (3): 385-399
Copyright © 1999 by The Endocrine Society

Identification of a Placental-Specific Enhancer in the Rat Placental Lactogen II Gene That Contains Binding Sites for Members of the Ets and AP-1 (Activator Protein 1) Families of Transcription Factors

Yuxiang Sun and Mary Lynn Duckworth

Department of Physiology University of Manitoba Winnipeg, Manitoba, Canada R3E 3J7


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We previously identified a 3-kb proximal 5'-flanking region of the rat placental lactogen (rPLII) gene1 that is important for reporter gene transcription in the rat trophoblast cell line, Rcho, and targets expression to the placentas of transgenic mice. In our current studies we have used further deletion analysis and transfection studies in Rcho and GC cells to map more precisely the locations of regulatory elements involved in this placental expression. We show that sequences between -1435 and -765 are necessary for minimal expression in Rcho cells and that there are negative regulatory elements between -3031 to -2838 and -1729 to -1435. Most importantly, we have identified a fragment between -1793 to -1729 that is essential for expression levels characteristic of the complete 3-kb 5'-region. When linked to the herpes simplex thymidine kinase minimal promoter, this fragment acts as an enhancing element in Rcho but not GC cells. Deoxyribonuclease I (DNAse I) protection and electrophoretic mobility shift assays with nuclear extracts and in vitro translated proteins identify binding sites for members of the activator protein-1 (AP-1) and Ets families of transcription factors. Site-directed mutagenesis of the individual AP-1- and Ets-binding sites leads to a partial loss of the enhancing activity; a double AP-1/Ets mutation leads to a complete loss of activity, demonstrating the functional importance of these sites. By these criteria, putative GATA-binding sites located within the enhancing fragment are not active. These new data suggest an important role for this enhancing fragment in rPLII placental giant cell expression and are the first to implicate a member of the Ets family in the regulation of this gene family.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although the placenta is vital to mammalian fetal survival and development, the factors that regulate placental cell-specific gene expression have not been extensively studied. The few genes that have been examined have come from more than one species and from a variety of placental cell types. The activator protein-2 (AP-2) transcription factor, originally described as the trophoblast specific element-binding protein, has been identified as important for the placental expression of the hCG {alpha}- and ß-subunit genes (1, 2, 3, 4) and potentially has a role in the placental expression of some other genes (5, 6). Its involvement in the regulation of these several genes and its role in the developmental regulation of other cell types has led to speculation that AP-2 may participate in a developmental cascade during trophoblast differentiation (1). The GATA (7, 8), Fos/Jun (AP-1) (9), and TEF (10, 11) families of transcription factors have also been implicated in the placental expression of some genes. None of these factors, however, are expressed only in placenta, suggesting that there are further protein/protein interactions that give specificity. The recently characterized basic helix-loop-helix transcription factors Mash-2 (12) and Hand-1 (13, 14, 15, 16, 17) (previously called Hxt, eHAND, Thing-1) have been shown to be essential for determination of specific placental cell types; no target genes have been identified for either factor, although there is indirect evidence that mouse placental lactogen I (PLI) may be regulated by Hand-1 (15). The limited data available make it difficult to decide whether there may be a specific transcription factor or combinations of factors important for placental-specific gene expression or whether factors will vary from gene to gene. It would be particularly useful to be able to study the transcriptional regulation of multiple genes expressed in a specific placental cell type, thereby allowing direct comparisons of the cis- and trans-acting factors involved.

The PRL-related genes expressed in the placentas of rats and mice represent an important resource for such studies. This is a large gene family expressed according to developmentally distinct expression patterns involving both specific placental cell types and temporal expression (18, 19, 20). PLI and PLII are the archetypes of these genes, being originally identified as placental proteins that could bind to the PRL receptor and that were highly expressed either early (PLI) or late (PLII) in pregnancy (21, 22, 23, 24). We and others (25, 26) have shown by in situ hybridization studies in rat placenta that, at early times after implantation, only rPLI mRNA is expressed in the primary and secondary giant cells of the placenta. At midpregnancy, rPLII transcription is activated and for a brief time both mRNAs are expressed in the same cells (25). From midpregnancy to term, only rPLII mRNA is expressed in the basal zone giant cells and in newly differentiated giant cells in the labyrinth region of the chorioallantoic placenta (27). A similar developmental switch has been shown for the mouse PLs (28, 29). Where sequence is available for comparison, the 5'-flanking sequences of the homologs of the rat and mouse PLI and PLII genes are highly related, suggesting that common factors may regulate these genes in the two species. There is little similarity, however, between the PLI and PLII 5'-flanking sequences (Ref. 30 and M. L. Duckworth, unpublished data). The expression of the PLI and PLII genes in the same giant cell type provides a useful model system for investigating whether common transcription factors or combinations of factors regulate the expression of these genes in this placental cell type or whether different regulatory factors are used that may reflect their different temporal expression patterns.

The factors important for mouse PLI (mPLI) expression have been studied by transfection assays in the rat choriocarcinoma cell line, Rcho-1 (31). This cell line and the closely related Rcho line (32) differentiate in culture to the giant cell type and are known to express several members of the rat PRL family of placental hormones specific to that cell type (25, 26). Mouse PLI expression has been shown to be dependent on both AP-1 (9) and GATA 2/3 sites (7) contained in a 274-bp 5'-flanking fragment immediately upstream of the transcription start site. Both GATA 2 and 3 are expressed in mouse placental giant cells (7). Although GATA 2 and 3 are also expressed in nonplacental cell types, coexpression of either with a mPLI -274 5'-flanking/Cat reporter construct in mouse L cells, which lack this transcription factor, is sufficient to stimulate reporter gene expression. Targeted disruption of GATA 2/3 in mice leads to a 50% loss of mPLI mRNA, suggesting that although important there are other factors also required for normal expression of this gene (33). We have found that a similar 5'-flanking region of the rat PLI gene is sufficient to regulate reporter gene expression in Rcho cells (34) and conserves the identified GATA and AP-1 sites in essentially identical locations (M. L. Duckworth, unpublished data).

GATA 2/3-deficient mouse embryos die in utero at day 10.5 to 11.5 from massive defects in several organ systems (35, 36), thereby preventing any determination of possible effects on mPLII transcription. We have recently shown that 3 kb of the rPLII gene 5'-flanking region proximal to the transcription start site are sufficient to direct luciferase reporter gene expression in Rcho cells and in the placentas of transgenic mice (30). In this current study, we identify sequences within this rPLII region that act as a placental cell enhancer. Our results suggest that placental-specific expression of PLI and PLII are regulated differently in the same giant cell type.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Deletion Analysis of the rPLII 5'-Flanking Region
We previously determined that sequences within a SacI/PvuII (-3031 to +64) fragment of the rPLII 5'-flanking region were sufficient to direct luciferase reporter gene expression in the rat trophoblast Rcho cell line and the placentas of transgenic mice (30) but were inactive in the rat pituitary GC cell line, suggesting that this region contains important sequences for placental-specific gene expression. To identify the active region(s) within this fragment, we constructed chimeric luciferase reporter clones containing various deletions in this 5'-fragment and tested them for activity using transient transfection assays in the Rcho cell line. The 3'-end of all fragments begins at +64. The results are shown in Fig. 1Go. Sequences within both the -1729 and -1435 5'-flanking fragments produced significantly higher levels of luciferase expression (P < 0.05) than the promoterless control; these levels were, however, significantly lower than the -3031 fragment itself (P < 0.05), suggesting the presence of enhancing sequences in the region between -3031 and -1729. The -1435 fragment showed a slight but significantly higher activity than the -1729 fragment, suggesting the presence of inhibitory sequences between -1729 and -1435. A construct in which an EcoRI fragment (-2838 to -1729) was deleted from the -3031 5'-fragment produced a further reduction in luciferase expression, resulting in luciferase levels that were no longer significantly different from the promoterless vector control. These results indicated that enhancer sequences important for rPLII expression were located within this -2838/-1729 EcoRI fragment and that there were further negative regulatory elements between -3031 and -2838.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Deletion Analysis of the rPLII 5'-Flanking Region

A restriction enzyme map of this region is shown with the transcription start site indicated by a bent arrow. A series of deletion fragments were cloned into the luciferase reporter vector, pXP2, and tested for expression in Rcho cells by transient transfection assays. All constructs begin at nucleotide +64. Luciferase activity was measured in light units/mg protein. All values have been corrected for plasmid uptake as described in Materials and Methods. Results are from two to four experiments where the number of separate transfections is 6 for -118 and -765 and at least 12 for -3031, -1729, -1435, deletion clone, and pXP2. Results are mean ± SEM expressed relative to the pXP2 vector control, which was set at 1. Statistical significance (P < 0.05) was established by an unpaired Student’s t test. Asterisks indicate constructs that are significantly less active than the entire 3031-bp 5'-flanking fragment indicating the loss of enhancing sequences. Double asterisks indicate constructs that also have significantly higher activity than the construct deleted for -2838 to -1729, suggesting the presence of inhibitory sequences between -3031/-2838 and -1729/-1435.

 
We have previously shown that sequences within a -765/+64 fragment were insufficient to support reporter gene expression in Rcho cells (30). Our further data suggest that there are important sequences between -1435 and -765 that support minimum rPLII expression.

Functional Analysis of Sequences between -2838 and -1729 Identifies a Placental-Specific Enhancer Region
To test whether sequences between -2838 and -1729 act as a placental-specific enhancer, we cloned the EcoRI fragment in forward and reverse orientations into the luciferase vector, pT81luc (37), which contains a minimal herpes simplex thymidine kinase (TK) promoter. Each construct was transfected into Rcho cells grown for either 6 or 14 days before transfection and into rat pituitary GC cells. Cultures were assayed for luciferase expression 48 h later. The results are shown in Fig. 2Go. Both the 5'->3' and 3'->5' orientations showed significant (P < 0.05) increases in luciferase activity over the minimal TK promoter in the Rcho cells, but neither orientation was active in the pituitary GC cells. These transfection data confirm that sequences within the -2838 to -1729 fragment are important for placental cell expression. The involvement of DNA sequences in this fragment with the temporal-specific expression of rPLII is less clear. The enhancing effect of the -2838/-1729 fragment in the Rcho cells was seen whether cultures were transfected after 6 days in culture, when rPLII mRNA was present at only very low levels, or after 14 days when rPLII mRNA was more highly expressed (25).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Sequences between -2838 and -1729 Act as a Placental Cell-Specific Enhancer

The EcoRI fragment containing these sequences was cloned in 5'->3' (E/EFTKpluc) and 3'->5' orientations (E/ERTKpluc) in the luciferase vector pT81luc, which contains the minimal herpes simplex thymidine kinase promoter. Constructs were transfected into Rcho cells grown for either 6 days or 14 days after plating and into rat pituitary GC cells. Luciferase expression was assayed after 48 h. Rcho cells express primarily rPLI mRNA at day 6 and express significant levels of rPLII at about day 14. Results shown are from four separate transfections. Luciferase activity (mean ± SEM) is expressed relative to the pT81luc vector control, which was set at 1. Statistical significance (*, P < 0.05) was established by an unpaired Student’s t test. Both orientations of this fragment produced significantly higher levels of luciferase activity than the controls only in Rcho cells. There was no difference in activity between these Rcho cells cultured for different times.

 
To identify specific sequences within the -2838 to -1729 fragment that are involved in the enhancing activity, we constructed a series of luciferase clones containing various restriction enzyme subfragments of the 1109-bp EcoRI fragment in pT81luc. All fragments were assessed in the 5'->3' orientation. These constructs were transfected into Rcho cells grown for 6 days, and cell extracts were analyzed for luciferase activity 48 h after transfection. The constructs and results are shown in Fig. 3Go. The enhancing activity was localized within a 65-bp HphI/EcoRI fragment at the 3'-end of the 1109-bp fragment. There was no significant difference between the luciferase activities of all the constructs that contained this 3'-sequence.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Deletion Analysis of the -2838 to -1729 Fragment Identifies an Enhancing Region at Its 3'-End

A restriction enzyme map of the enhancing EcoRI fragment indicates the sites used for subcloning into the minimal thymidine kinase promoter vector, pT81luc. Transfections were carried out in Rcho cells grown for 6 days. Results shown are from at least six separate transfections. Luciferase activity (mean ± SEM) is shown relative to the vector control. All fragments that contain the most 3'-sequence in the EcoRI fragment (F3, F5, F7, F9) have significantly higher activity (P < 0.05) than the vector control, which was set at 1. There is no significant difference between the activities of these fragments. Fragments that do not contain this sequence (F1, F2, F4, F6, F8) are not significantly different from the vector control.

 
DNAse I Protection Analysis of the Enhancing Fragment Identifies Two Protected Regions Containing AP-1- and Ets-Binding Sites
During the course of these experiments the complete sequence of the 1109- bp EcoRI fragment was determined and examined for the presence of known transcription factor-binding sites. Binding sites for the GATA, Fos/Jun (AP-1), and basic helix-loop-helix families of transcription factors, which have been implicated in the placental expression of several genes or in the determination of placental cell types, were highly represented throughout. Most, however, were in regions that did not enhance luciferase expression. To identify which site(s) in the enhancing fragment were important in the placental expression of the rPLII gene, we carried out DNAse I protection studies using nuclear extracts prepared from late-term dissected rat placental labyrinth region, which represents the region of highest rPLII expression, and the Rcho (harvested as described after 6 days), and GC cell lines. Figure 4Go shows an autoradiogram of a representative DNAse I protection experiment. What appear to be two separate but adjacent regions were protected in identical patterns by the placental labyrinth and Rcho nuclear extracts; nuclear extracts of the GC cell line, in which the enhancing fragment was inactive, showed distinctly different protection patterns in these regions. The sequence of the protected areas from approximately -1765 to -1730 is underlined in Fig. 5Go.



View larger version (99K):
[in this window]
[in a new window]
 
Figure 4. DNAse I Protection Analysis Identifies Two Adjacent Regions in the Enhancing Fragment That Are Protected by Rat Placental Labyrinth and Rcho but Not GC Nuclear Extracts

The antisense strand of F5 was end labeled, incubated with increasing amounts of placental labyrinth (20–80 µg), Rcho (10–40 µg), or GC (20, 40 µg) nuclear extracts, and partially digested with DNAse I. The labeled strand digested in the absence of protein is designated -NE. G+A indicates a Maxam and Gilbert sequencing reaction that was used as a marker. Two adjacent protected regions (FP1, FP2) are seen with the labyrinth and Rcho extracts; a different pattern is seen with the GC extract. A new hypersensitive site, marked by an arrow, is visible in FP1 in the placental/Rcho lanes. This is a characteristic shift in sensitivity from the adjacent nucleotide as compared with the -NE lane. The protected regions contain sequences for putative Ets (F1) and AP-1-binding sites (FP2).

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Features of the 151-bp StuI/EcoRI Fragment (F7) Containing Placental-Specific Enhancing Activity

Putative Ets- and AP-1-binding sites that were protected from DNAse I digestion by rat placental labyrinth and Rcho nuclear extracts are shown in bold. The approximate regions protected by these extracts are underlined and labeled F1 and F2, respectively. This region is shown as double-stranded since the footprints were best observed on the antisense strand. The arrow marks a new hypersensitive site. Putative GATA sites in the context of a direct repeat sequence are also marked in bold. Other putative AP-1 sites in this fragment are shown in lower case. The HphI site, which further divides this fragment into an inactive 5' >(F8) and an active 3' (F9) fragment, is indicated below the line, separating the GATA sites. Asterisks mark the nucleotides that were altered by site-directed mutagenesis for functional analysis of the binding sites.

 
Placental cell footprint 1 (FP1) contained a consensus binding site for a member of the Ets family of transcription factors (38). Footprint 2 (FP2) closely resembled an AP-1-binding site (39, 40). A distinguishing feature of FP1 in the presence of the placental/Rcho nuclear extracts was a shift in DNAse I sensitivity from one nucleotide in the absence of nuclear extract to the adjacent nucleotide (marked by an arrow in Fig. 4Go). The hypersensitive nucleotide is indicated by an arrow on the antisense strand in Fig. 5Go.

Functional Significance of the Ets- and AP-1-Binding Sites
To determine whether the identified Ets- and AP-1-binding sites were functionally important for placental giant cell expression, we carried out site-directed mutagenesis of the core sequences of these sites, in the context of the active 3' StuI/EcoRI fragment (F7). The sequence of this fragment with the transcription factor-binding sites is shown in Fig. 5Go. The nucleotides that were changed are indicated by asterisks. The PCR primers used to create the mutants are given in the Materials and Methods. As well as the protected Ets- and AP-1-binding sites, two sequences closely related to GATA-binding sites (AGATAT), located within the context of a direct repeat sequence, were also mutated, even though no DNAse I protection had been seen with placental/Rcho nuclear extracts in that region. Our rationale for testing the functionality of these sites was that GATA 2/3 have been implicated in the expression of several other placental expressed genes including mPLI (8). When the two putative GATA sites in the active 151-bp F7 fragment were separated by an HphI digestion, the majority of the activity remained in the 3'-F9 fragment, which already suggested that if GATA had a role in rPLII transcription, both sites were not required. We cloned fragments containing the individual mutations into pT81luc, transfected these constructs into Rcho cells, and assayed for luciferase expression. The results are shown in Fig. 6Go. Mutation of either the Ets or the AP-1 site significantly affected luciferase gene expression as compared with the wild-type sequence (P < 0.001), but neither mutation alone was sufficient to completely eliminate enhancing activity. Mutation of the Ets core sequence reduced luciferase activity by approximately 70%; a mutated AP-1 site reduced activity by approximately 40%. The luciferase activity of the double Ets/AP-1 mutant, however, was reduced to levels comparable to the vector control and was significantly different from either of the single mutants (P < 0.001). Luciferase activity of the construct with mutated GATA sites was not significantly different from the native fragment (P > 0.05), supporting the DNAse I protection data that a GATA factor is not necessary for the enhancing activity of this fragment.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. Site-Directed Mutagenesis Indicates a Role for Ets and AP-1 Family Members in rPLII Placental Cell Regulation

The consensus Ets- and AP-1-binding sites that were protected by placental cell nuclear extracts were individually and doubly mutated in the context of the StuI/EcoRI fragment as described in Materials and Methods. Two consensus GATA sites in the context of a direct repeat were also mutated. The nucleotides that were altered are indicated in Fig. 5Go. The mutated and native StuI/EcoRI pT81luc clones were transiently transfected into Rcho cultures and assayed for luciferase activity. Results are from two experiments with at least 12 separate transfections and are expressed as a percentage of the luciferase activity (mean ± SEM) of the unmutated StuI/EcoRI fragment. The individual Ets (mEts) and AP-1 (mAP-1) mutations have significantly (*) lower activity (P < 0.001) than the native fragment; the combined mEts/mAP-1 mutations reduce luciferase levels to those of the vector control. There is no significant loss of activity when the GATA sites are mutated (P > 0.05).

 
In addition to mutation of the Ets- and AP-1-binding sites, we tested the effect of overexpression of Ets2 and c-Fos/c-Jun on the F9/luciferase construct in Rcho cells (Fig. 7Go). Ets2 was chosen as a representative of the Ets family of transcription factors since we had detected Ets2, but not Ets1, mRNA in both placenta and Rcho cells (data not shown). Ets2 has been implicated in the placental expression of other genes (41, 42) and is known to interact with AP-1 proteins (43, 44). Cotransfection of the c-Fos/c-Jun expression vectors with the reporter construct produced a 2-fold increase in luciferase activity over the luciferase vector alone, as did cotransfection of the Ets2 expression clone. When Ets2/c-Fos/c-Jun were cotransfected, there was a further increase in activity, which appeared to be additive.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. Cotransfection of Ets2 and c-Fos/c-Jun Expression Vectors Increases Activity from the F9 Fragment

The human Ets2, rat c-Fos, and rat c-Jun cDNAs were cloned in the expression vector pcDNA3 for these experiments. Five micrograms each of Ets2 or c-Fos/c-Jun or Ets2/c-Fos/c-Jun were cotransfected with 10 µg of the F9/TKpluc clone into Rcho cells. The total amount of transfected plasmid was kept constant at 25 µg in all cases by the addition of pcDNA3 vector. Results shown are from three experiments with 10 separate transfections; luciferase activities are expressed relative to the F9/pT81luc clone alone, which was set at 1. Cotransfection of either Ets2 or c-Fos/c-Jun increased luciferase activity approximately 2-fold. When all three clones were cotransfected, levels were increased by approximately 4-fold. These levels were all significantly (*) higher (P < 0.05) than the F9 clone alone.

 
Electrophoretic Mobility Shift Studies of the F9 Enhancing Fragment
Although these mutagenesis and overexpression studies strongly implicated members of the Fos/Jun and Ets families of transcription factors in the function of the rPLII enhancer in trophoblast cells, we undertook to assess more directly the identity of the proteins that bound to the DNAse I-protected sequences. Electrophoretic mobility shift assays were carried out using in vitro translated c-Fos, c-Jun, Ets1, and Ets2 proteins. Results are shown in Fig. 8AGo. Using the labeled 65-bp F9 fragment as a probe, a specific retarded complex was formed with a mixture of recombinant c-Fos/c-Jun proteins, which was competed with both a consensus AP-1-binding site oligonucleotide and Jun-specific antisera but not by an unrelated oligonucleotide. A 41-bp oligonucleotide containing mutations in the AP-1 and Ets sites also did not compete. There was no shift of the fragment with recombinant c-Jun alone, suggesting that only Fos/Jun dimers were bound.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 8. Assessment of AP-1 and Ets Factor Binding to the F9 Enhancer Fragment

A, The F9 fragment binds in vitro translated AP-1, but not Ets1 or Ets2 proteins. Lane 1 contains the free probe. Lane 2 shows the complexes formed when in vitro translated c-Fos and c-Jun dimers bind to the labeled 65-bp F9 fragment. Addition of a consensus AP-1-binding site at 100-fold molar excess (lane 3) or AP-1 antisera (lane 5) specifically compete the upper band, marked by an arrow. Neither an unrelated oligonucleotide (lane 4) nor an oligonucleotide containing a mutated AP-1 site (lane 6) competes the specific complex at 500-fold molar excess. C-Jun protein alone does not produce the specific complex (lane 7). No specific complexes are formed in the presence of in vitro translated Ets1 (lane 8) or Ets2 (lane 9). B, The F9 fragment forms different complexes with placental and GC nuclear extracts. Lanes 1–6 show complexes formed with rat placenta nuclear extract. A number of complexes are produced (lane 1); those complexes that are competed with 200-fold molar excess of the probe (lane 4) are marked with arrows and numbered. None of the complexes appear to be competed by a 500-fold excess of an Ets2-binding site (lane 2), but complex 2 is competed by a 150-fold excess of a consensus AP-1 oligonucleotide (lane 3). A 41-bp oligonucleotide containing mutations in the AP-1- and Ets-binding sites at 500-fold excess does not compete for complexes 2, 3, or 4, but does compete complex 1 (lane 5). An unrelated oligonucleotide at 500-fold excess does not compete any complexes (lane 6). Complexes formed with GC nuclear extracts are shown in lanes 7–12. Neither an Ets2 nor an AP-1 consensus binding site competes at 500-fold excess for any of the complexes (lanes 8 and 9). All complexes are partially competed by unlabeled probe at 400-fold excess (lane 10), as well as by a 500-fold excess of the oligonucleotide containing mutations in the AP- and Ets-binding sites (lane 11). There is no competition by an unrelated oligonucleotide at 500-fold excess (lane 12).

 
We were unable to detect a specific shift of the F9 fragment, however, with Ets2 or the related Ets1. When either Ets protein was incubated together with c-Fos/c-Jun in the binding reaction, only the AP-1 complex was formed (data not shown), suggesting that the lack of Ets factor binding was not due to a requirement for initial formation of an AP-1 complex. Although the Ets consensus sequence always contains GGA(A) at its core and there is a degree of promiscuity among the binding sites for different Ets proteins in vitro, the specificity of binding in this family is thought to involve sequences outside the core region (38). The sequence of the protected FP1 region is related but not identical to that of the Ets1 and -2-binding sites (38) and must specify a binding site for another member of this large family.

When the F9 fragment was incubated with placental nuclear extracts, several specific complexes were formed (Fig. 8BGo). One of these was competed by both the 65-bp F9 fragment and the consensus AP-1 oligonucleotide, suggesting that it represented an interaction with c-Fos/c-Jun proteins. This complex was not competed by the oligonucleotide that contained mutations in the AP-1 and Ets consensus binding sites. At least one other complex was specifically competed with the F9 fragment, but not by the oligonucleotide with the mutated binding sites, suggesting that it may represent a complex containing an Ets family-binding protein. Neither this nor any other complex, however, was competed by a consensus Ets2 oligonucleotide. A further larger complex was specifically competed by both the F9 fragment and the oligonucleotide containing the mutations, but not by the nonspecific competitor. The composition of this complex is unclear.

The complexes formed with nuclear extracts from GC cells were markedly different from those seen with placental extracts (Fig. 8BGo). Neither the consensus AP-1 or Ets2 oligonucleotide was able to compete any of the GC cell complexes even at 500-fold molar excess. Unlike in the placental extracts, both the native F9 fragment and the oligonucleotide with the mutated AP-1- and Ets-binding sites partially competed all the complexes, suggesting that the binding to the F9 fragment in the GC extracts does not involve the core AP-1- or Ets-binding sites.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We previously identified a 3-kb proximal 5'-flanking region of the rPLII gene that is important for gene transcription in the trophoblast Rcho cell line and the placentas of transgenic mice but that does not function in the rat pituitary GC cell line (30). In our current study we have examined this rPLII 5' region in detail to identify the regulatory elements that are involved in placental cell expression.

Using deletion analysis and transfection assays with luciferase reporter constructs in Rcho cell cultures, we have identified an EcoRI fragment from -2838 to -1729, which when deleted results in a significant decrease in luciferase activity. Consistent with the presence of enhancing sequences within this fragment is its ability to activate luciferase gene expression in either a forward or reverse orientation from the herpes simplex thymidine kinase minimal promoter. Enhancement occurs in Rcho trophoblast cells but not in rat pituitary GC cells, suggesting that specific placental protein factors or complexes are binding to sequences within this fragment. The enhancement occurs whether the Rcho cultures have been grown for 6 days or 14 days before transfection. We have previously noted that our Rcho cultures express rPLI mRNA shortly after plating, essentially as soon as giant cells differentiate in these cultures, but that rPLII mRNA is expressed at only low levels until about 14 days after plating, suggesting that further developmental changes may be occurring in these cultures (25). The fact that both early and late cultures show comparable enhancement of reporter gene expression suggests that we may have identified a placental cell enhancer that is not directly involved in the temporal regulation of the rPLII gene. Nonetheless, since rPLII mRNA is still detectable in RNA blots of the earlier Rcho cultures, we cannot rule out that sufficient amounts of factors are present in these cultures to interact with the rPLII enhancer sequences and bring about increased expression. The role of these sequences for the normal developmental expression of rPLII mRNA will require further investigation.

Detailed deletion analysis of the EcoRI fragment indicates that the enhancing activity is located at -1793 to -1729 on a 3' HphI/EcoRI fragment (F9). DNAse I protection studies identify two adjacent regions between approximately -1765 and -1730 that show similar patterns of protection by nuclear extracts from late-term rat placental labyrinth and Rcho cells. FP1 appears to be protected more by the placental nuclear extracts, while footprint 2 (FP2) is protected more by the Rcho extracts at comparable protein concentrations, suggesting that the cognate factors are present in different proportions in the two nuclear extracts and that they can bind independently to the DNA. FP1 lies over a region that contains a consensus sequence for the Ets family of transcription factors (C/AGGAA/T) (38), while FP2 is related to an AP-1-binding site (39, 40). A distinctive feature of FP1, in the placental cell extracts, is the appearance of a new hypersensitive site on the noncoding strand at the nucleotide immediately 5' of the consensus Ets-binding sequence. Although nuclear extracts from GC cells show protection of the FP1 and FP2 regions, the patterns of protection are different. With GC extracts, new hypersensitive sites appear in the FP2 region and immediately 3' of the region designated FP1, neither of which are seen with the placental or Rcho cell nuclear extracts. Gel mobility shift studies also show that the complexes formed by GC extracts on the F9 fragment are markedly different from those seen with placental nuclear extract. These data strongly suggest that the complexes formed in GC cells are distinct from those in placental cells and, from our transfection studies, inactive.

Electrophoretic mobility shift studies using in vitro transcribed and translated rat c-Fos and c-Jun proteins (45) confirm that the 65-bp F9 fragment binds Fos/Jun dimers but not Jun dimers alone; a consensus AP-1 oligonucleotide-binding site is specifically able to compete this complex as well as a complex formed between the F9 fragment and placental nuclear extract. This latter complex is not competed by an oligonucleotide containing a mutant version of the F9 AP-1-binding site.

Although AP-1 transcription factors have been implicated in the placental expression of several placental genes including the mouse and rat PLI, the involvement of the Ets family of transcription factors in placental gene expression is less well documented. Ets proteins form a large family (now >33 members), which is defined by a highly conserved DNA-binding domain of about 85 amino acids (38). All family members bind DNA elements with the core consensus sequence GGAA/T (38). The specificity of these proteins appears to lie in the sequences that surround this core region, and although there is evidence of overlapping binding specificity, not all identified Ets sites bind all members of the family (46, 47). Ets1 and Ets2 have both been implicated in the placental expression of the matrix metalloprotease genes, stromelysin (MMP3) and collagenase (MMP1), in the human and have been shown to cooperate with AP-1 factors in this role (41, 43). Very recently the targeted mutation of the mouse Ets2 gene was found to have profound effects on early placental development primarily mediated through deficient expression of the MMP9 (gelatinase B) gene, which resulted in failed implantation (42). It was also observed that in the absence of Ets2, mPLI levels were elevated in the very early placenta.

Since Ets2 and Ets1 have been implicated in the expression of several of the MMP genes in placenta and we were able to detect Ets2 (although not Ets1) mRNA in developing rat placenta and Rcho cells (data not shown) we tested these in vitro translated proteins for the ability to bind the 65-bp F9 fragment in gel mobility shift studies. Neither recombinant Ets2 or Ets1 protein binds the F9 fragment; they both shift a consensus Ets2-binding site (48). This consensus Ets2-binding site does not compete any of the complexes formed between placental nuclear extract and the F9 fragment. There is, however, a specific placental complex that is competed by the native sequence but is not competed by an oligonucleotide containing a mutation of the GGA core of the Ets-binding site. These results strongly suggest that Ets2 is not the family member that binds the rPLII enhancer GGA sequence directly in vivo, and the identity of that family member remains to be determined. We cannot rule out, however, that Ets2 could still have a role through protein-protein interactions with another Ets proteins. Such interactions have been previously reported for the human stromelysin gene (43).

The physiological importance of the AP-1 and Ets-binding sites in rPLII placental expression is supported by the effect of mutations of each core sequence on the enhancing activity of the active fragment. Mutation of the Ets site alone reduces activity to approximately 30% of that of the native -1880 to -1729 F7 fragment, while mutation of the AP-1 site reduces luciferase activity to approximately 60% of the nonmutagenized fragment. The double Ets/AP-1 mutant eliminates the enhancing activity of the fragment indicating that both the Ets and AP-1 sites are important in this activity. The fact that neither mutation alone causes complete loss of enhancing activity again suggests that the binding of each protein at these adjacent sites may be independent. Cotransfection of c-Fos/c-Jun or Ets2 expression clones with the F9/luciferase construct in Rcho cells results in an increase in reporter gene expression in both cases. When c-Fos, c-Jun, and Ets2 are co-transfected together, there is a further increase in reporter gene expression that appears to be additive. Given that our gel shift data do not demonstrate binding of Ets2 to the F9 fragment, it appears that its overexpression may be acting indirectly. In this regard, it has been reported that Ets2 binds to and activates the jun-B and c-Fos promoters (49, 50).

Unlike the PLI gene, and some other placental genes, members of the GATA family of transcription factors do not have a role in the enhancing activity of this rPLII fragment. There is no protection by the placental nuclear extracts of two putative GATA sites found in this active fragment that are adjacent and occur within the context of a direct repeat (AGATATGTAGATATGT) at -1799 to -1785. Mutation of both core GATA sequences has a slight but not significant effect (P > 0.05) on luciferase activity, supporting our conclusion from the DNAse I protection data.

Very recently, work on the 5'-flanking portion of the mouse PLII gene has also identified a region containing activating DNA sequences (51). This region from -1471 to -1340 has a marked similarity to the segment of the rPLII gene immediately 3' of our reported sequence and overlaps our F9 fragment by 27 bp at its 5'-end. A comparison of the rat and mouse PLII sequences is shown in Fig. 9Go. It is intriguing that although the most 5'-region of the mPLII gene, designated region m1 and shown by mutagenesis studies to contain an enhancing sequence, is highly related to our FP1 region, it does not contain an Ets-binding site. Gel mobility shift studies with Rcho extracts showed the formation of specific complexes on the m1 sequence, but this sequence does not represent a binding site for a known transcription factor. The more 5' AP-1-binding site we identified in the rat sequence is not represented in the activating mouse PLII sequence. The region of the mPLII gene designated m7, which was also shown to contain enhancing sequences, is less highly conserved between the rat and mouse, while the activating m8 and m9 regions are strongly conserved, including the consensus GATA site, which was found not to bind a GATA factor. It therefore appears that, in spite of the overall high degree of relatedness between the PLII genes in these species, somewhat different regulatory mechanisms have evolved in the rat and mouse, and it will be interesting to determine the precise identity of the factors responsible for enhancing the transcription of these two genes.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 9. A Comparison of rPLII and mPLII 5'-Enhancing Sequences

The mPLII sequence is from Lin and Linzer (51 ). The mPLII fragment overlaps at its 5'-end with the most 3'-end of the rPLII F9 fragment as indicated in the different type. Gaps have been added to the sequences to increase homology; mismatches in the mPLII sequence are shown in lowercase letters. The brackets indicate the regions of the mPLII gene that were systematically mutated. The mPLII fragment has been reported to contain positive regulatory elements in the regions designated m1 and m7–m9. The m1 region corresponds to the region of a consensus Ets-binding site in the rPLII gene that is underlined. When the m1 region of the mouse sequence is mutated, there is a loss in enhancing activity. A consensus GATA site that was found not to bind a GATA factor is underlined in both sequences.

 
The DNAse I protection patterns and gel mobility shift complexes formed between GC nuclear extracts and the 65-bp fragment are distinct from those seen with the placental extracts and indicate the binding of markedly different protein complexes in these two tissues. The factors involved in the GC complexes are unclear. An AP-1 consensus binding site does not compete any F9/GC complex, and a oligonucleotide containing mutant AP-1- and Ets-binding sites competes similarly to the native sequence. Combined with our previous study in transgenic mice (30), our new data strongly suggest that the enhancing region we have identified has an important role in the placental cell-specific expression of the rPLII gene. The complete developmental expression of the rPLII gene, however, may be dependent on the presence of further regulatory sequences. Our initial deletion experiments of the 3-kb 5'-flanking fragment identified other potentially important but as yet uncharacterized regions. Sequences between -1435 to -765 are essential for expression in Rcho cells, although at a low level; other sequences appear to have negative effects on reporter gene transcription as demonstrated by a marked decrease in activity when included in the absence of the enhancing region (-3031 to -2838) or by a marked increase in expression when deleted (-1729 to -1435).

A comparison of DNA sequences and transcription factors that have been reported to be important in placental-specific gene expression, now including the rPLII enhancer, suggests that there may not be a single combination of factors that marks a gene for placental expression. The sequence we have described does not contain an AP2 (TSE) site, a functional GATA site, or a basic helix-loop-helix binding site, all of which have been previously associated with placental gene expression. In particular, the rPLII enhancer is different from the sequences that were identified as important for the expression of the mPLI and the mPLII genes, suggesting that even the same placental cell type may use different combinations of transcription factors for the regulation of expression of different genes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Some restriction enzymes, Klenow DNA polymerase, and T4 DNA ligase were from Pharmacia (Baie d’Urfé, Québec, Canada.); FBS, RPMI 1640 medium, DMEM, sodium pyruvate, HEPES buffer, penicillin/streptomycin, trypsin/EDTA, NUNC culture dishes and flasks, agarose, some restriction enzymes, NACS columns, and custom-synthesized oligonucleotides were from Life Technologies (Burlington, Ontario, Canada); NCTC 135 medium was from Sigma-Aldrich (Oakville, Ontario, Canada); random prime DNA labeling kits and Sequenase kits were from Amersham (Oakville, Ontario, Canada); luciferase assays kits, reporter lysis buffer, PCR sequencing, and in vitro transcription/translation kits and DNAse I (RQ) were from Promega (Madison, WI); AP-1 consensus oligo, AP-1, and Ets2 antisera were from Santa Cruz Biotechnology (Santa Cruz, CA); Nitroplus membrane, guanidine isothiocyanate, and general laboratory chemicals were from Fisher Scientific (Nepean, Ontario, Canada); [32P]dCTP, [35S]dATP, and [32P{gamma}]ATP were from Mandel Scientific (Guelph, Ontario, Canada); Bio-Rad protein assay reagent was from Bio-Rad Laboratories (Mississauga, Ontario, Canada); Qiagen DNA plasmid columns were from Qiagen Inc. (Mississauga, Ontario, Canada); Kodak XAR film was from Intersciences Inc. (Markham, Ontario, Canada).

Cell Lines
The rat choriocarcinoma Rcho cell line (32) was kindly provided by Drs. A. Verstuyf and M. Vandeputte (Rega Institute for Medical Research, Catholic University of Louvain, Louvain, Belgium). The rat pituitary GC cell line was a gift from Dr. P. A. Cattini (Department of Physiology, University of Manitoba, Winnipeg, Canada).

Clones and Vectors
The rPLII genomic clone, GC I, and some subclones are described by Shah et al. (30). Other vectors and clones were generously provided as follows: luciferase vector pXP2 (37), a cytomegalovirus promoter/luciferase construct (CMVp.luc), and an herpes simplex thymidine kinase promoter/luciferase vector, pT81luc (37), Dr. R. J. Matusik, Department of Urological Surgery, Vanderbilt University, Nashville, TN; a cytomegalovirus promoter/chloramphenicol transacetylase construct (pcDNA3.cat), Dr. R. P. C. Shiu, Department of Physiology, University of Manitoba, Winnipeg, Canada; hEts1 and hEts2 cDNA clones (52), Dr. P. A. Cattini; rat c-Fos and rat c-Jun (45), Dr. T. Curran, St Jude Children’s Research Hospital, Memphis, TN.

rPLII 5'-Flanking Plasmid Clones
5'-Flanking plasmid subclones were constructed from an rPLII {lambda}-genomic clone, GC I (30). We have shown that a -3031 5'-flanking fragment proximal to the transcription start site is sufficient to direct reporter gene expression in the rat trophoblast Rcho cell line and the placenta of transient transgenic mice. All plasmid DNAs were prepared from overnight bacterial cultures using Qiagen DNA plasmid columns according to the supplier’s protocol. DNA sequencing of the clones was carried out by the dideoxy method (53) using Sequenase or a PCR sequencing kit and [35S]dATP. All restriction enzyme fragments were purified by agarose gel electrophoresis followed by electroelution and ethanol precipitation.

Chimeric rPLII 5'-flanking/luciferase clones containing the native rPLII promoter were constructed in the vector pXP2. Clones are named according to the 5'-end of the fragment; the 3'-end of these clones originates at position +64. The clones -765rPLIIp.luc and -3031rPLIIp.luc have been previously described (30). Further rPLII native promoter luciferase clones were constructed as follows: a 4.5-kb 5'-rPLII fragment cloned into the HindIII/BamHI sites in pBspSK (Stratagene, La Jolla, CA) was digested with EcoRI/BamHI, and the isolated fragment was recloned into EcoRI/BamHI cut pBspSK to remove sequences between -3031 to -1729 and conserve a 5'-HindIII cloning site; a HindIII/BamHI fragment of this clone was isolated and ligated into HindIII/BglII-digested pXP2 to form -1729rPLIIp.luc. -1729rPLIIp.luc was digested with BamHI/BglII and religated to form -1435rPLIIp.luc. A pBspSK clone containing the PvuII fragment from -765 to +64 was digested with EcoRV/BamHI and cloned into the SmaI/BglII site of pXP2 to form -118-rPLIIp.luc. To produce the clone, {Delta}ErPLIIp.luc, deleted for -2838 to -1729, the -4.5-kb 5'flanking pBspSK clone, was digested with EcoRI and religated; this deletion clone was further digested with SacI/BamHI and cloned into SacI/BglII-cut pXP2.

The analysis of the -2838 to -1729 EcoRI fragment for placental-specific enhancing activity in the context of a heterologous promoter was carried out in the luciferase reporter vector pT81luc, which contains a minimal (-81 to +52) herpes simplex thymidine kinase promoter. Clones were constructed as follows: the EcoRI fragment was cloned into EcoRI-digested pBspSK to produce E/EpBspSK in both 5'->3' and 3'->5' directions as determined by sequencing; this fragment was removed from the 5'->3' (E/EF) clone by HindIII/SmaI digestion and cloned into HindIII/SmaI-digested pT81luc to produce E/EFTKpluc (5'->3'); the fragment from the 3'->5'pBspSK (E/ER) clone was digested with BamHI/EcoRV and ligated into BamHI/SmaI-cut pT81luc to give E/ERTKpluc. Subfragments of the EcoRI fragment were ligated into the luciferase reporter vector, pT81luc, as follows, moving from the 5'- to 3'-end of the fragment: E/EFpBspSK was digested with HindIII/DraI, and the 5'-HindIII/DraI fragment (F1) was isolated and ligated to HindIII/SmaI cut vector; an internal DraI/DraI fragment (F2) was isolated and ligated to SmaI cut vector. E/EFpBspSK was also digested with DraI/SacI, and the 3'-DraI/SacI fragment (F3) was isolated and ligated to SmaI/SacI cut vector. A HindIII/SacI fragment isolated from the F3 clone was further digested with BsaBI. The 5'-HindIII/BsaBI fragment (F4) was cloned into HindIII/SmaI cut vector; the 3'-BsaBI/SacI fragment (F5) was cloned into SmaI/SacI cut vector. The F5 clone was digested with HindIII and StuI, and the 5' HindIII/StuI fragment (F6) was isolated and ligated into HindIII/SmaI cut vector; the F5 clone was also digested with StuI/SacI, and the 3'-StuI/SacI fragment (F7) was isolated and ligated into SmaI/SacI cut vector. A BamHI fragment from F7TKpluc (polylinker sites) was digested with HphI and blunt-ended with Klenow polymerase. This fragment was further digested with HindIII and SacI; the 5'-HindIII/HphI fragment (F8) was cloned into HindIII/SmaI cut vector; the 3'-HphI/SacI fragment (F9) was cloned into SmaI/SacI cut vector.

All constructs were sequenced across the newly created boundaries to determine correct ligations.

Cell Culture and Transient Transfection Assays
The rat choriocarcinoma Rcho cell line was grown routinely on RPMI 1640 medium containing HEPES buffer, supplemented with heat-inactivated 20% FBS, 1 mM sodium pyruvate, 50 µM ß-mercaptoethanol, 50 U/ml streptomycin, and 50 µg/ml penicillin. Medium was changed every other day, and cells were split before confluency, every 3 days, using trypsin/EDTA. When grown for transfections and nuclear extract preparations, cells were changed after 4 days to NCTC 135 medium with 10% FCS and supplements that stimulate giant cell differentiation (31). The rat anterior pituitary GC cell line was grown in DMEM as described by Cattini and Eberhardt (54).

The Rcho cells were transfected using the calcium phosphate method essentially as described by Vuille et al. (55) at the times indicated. Transfections were routinely carried out in 10-cm dishes using 10 µg of test plasmids and 1 µg of CMVp.cat for determining transfection efficiency. The rat anterior pituitary GC cells were grown to 40–50% confluency and transfected as described by Nickel et al. (56).

Cell extracts were prepared as previously described (30) except that reporter lysis buffer (Promega, Madison, WI) was used. Luciferase assays were carried out immediately after lysate preparation using a Promega Luciferase Assay kit according to supplier’s instructions. Activity was measured in relative light units using a TROPIX luminometer (Bio/Can Scientific, Mississauga, Ontario, Canada). The chloramphenicol acetyltransferase activity was measured by the two-phase fluor diffusion assay as described by Nickel et al. (56). To standardize for variations in plasmid uptake, all luciferase activities were normalized to the CAT assay data for the same sample. Protein determinations were carried out using a Bio-Rad protein assay reagent according to the supplier’s protocol.

Nuclear Extract Preparation
Nuclear extracts were prepared from Rcho and GC cell lines, and rat placental labyrinth regions collected and dissected at days 14 to 16, according to published protocols (57) with the following modifications. Rcho cultures were grown for 6 days as described; remaining small undifferentiated cells were first removed by a short 0.25% trypsin pretreatment before giant cells were collected for nuclei (15). Frozen placentas were ground to a fine powder in a mortar and pestle placed on dry ice; placental nuclear extracts were prepared as for the cell culture extracts with the initial volume being taken as the volume of powdered tissue. All procedures involving animals were carried out according to protocols approved by the University of Manitoba Animal Care Committee.

DNAse I Protection Assays
DNAse I protection assays of the 329-bp rPLII 5'-flanking BsaBI/EcoRI fragment (F5) described above were carried out according to standard protocols (58). The F7TKpluc clone was digested at an XhoI site in the pT81luc polylinker and treated with calf intestinal phosphatase, and the antisense strand was end-labeled with T4 polynucleotide kinase and [32P{gamma}]ATP. The fragment was released by a HindIII digestion and purified by agarose gel electrophoresis, followed by electroelution and ethanol precipitation. Binding reactions were carried out in a final volume of 20 µl containing approximately 20,000 cpm (5–10 fmol) of fragment and 0.5 µg dI:dC. Increasing amounts of placental labyrinth and Rcho nuclear extracts (10–80 µg) or GC nuclear extracts (20 and 40 µg) were incubated with the probe on ice for 15 min followed by digestion with 0.05 U of DNAse I for 90 sec at 26 C. After phenol/chloroform extraction and precipitation, the digested products were fractionated on a denaturing 6% polyacrylamide/urea gel and exposed to Kodak XAR film for autoradiography.

Electrophoretic Mobility Shift Assays
The 65-bp F9 fragment that had been cloned into the SmaI/EcoRI sites of pBspSK was cut out with EcoRI, electroeluted from an agarose gel, and end-labeled with Klenow fragment and {alpha}-dATP. Recombinant c-Fos, c-Jun, Ets1, and Ets2 proteins were synthesized using an in vitro transcription/translation kit according to the supplier’s protocol. Nuclear extracts were made as described. Four microliters each of one or more of the in vitro translated mixtures, 20 µg of rat placental nuclear extract, or 5 µg of GC extract were used in a binding reaction. Reactions were carried out in 40 µl of binding buffer containing 20 mM HEPES buffer, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 5 mM MgCl2, 1 mM phenylmethylsulfonylfluoride, 0.5 µg dI:dC. Specific or nonspecific competitors were added for 15 min before the labeled probe; Jun or Ets2 antisera were added 45 min before the probe; 10 to 20 fmoles of labeled probe (1–2 x 104 dpm) were incubated for a further 30 min. All binding reactions were at room temperature. Complexes were separated by electrophoresis on 4% nondenaturing polyacrylamide gels. Gels were dried and exposed for autoradiography.

Coding strands of specific competitor oligonucleotides used:

AP-1 consensus: CGCTTGATGACTCAGCCGGAA

Ets2 consensus (48): CTAGGACCGGAAGTGGGAGT

mAP-1/mEts: CCAGGGTTATTTctagAAGGGTAAACAttcAGTAGGGCTTG

Site-Directed Mutagenesis
A PCR strategy was used to mutate transcription factor-binding sites that had been identified by DNAse I protection studies and sequence analysis. These sites included a consensus Ets-binding site, a putative AP-1-binding site, and a pair of putative GATA-binding sites found within a direct repeat sequence. The StuI/EcoRI fragment that had been shown to retain activity in transfection assays was cloned into the SmaI/SacI sites of pBspKS. Three mutagenic primers were synthesized as follows:

mEts: GCGCGAGCTCGAATTCAAGCCCTACTgaaTGTTTACCCTTGAGCA

mAP-1: GCGCGAGCTCGAATTCAAGCCCTACTTCCTGTTTACCCTTctagAAATAACCCTGGAAATG

mGATA: GCGCGAGCTCGAATTCAAGCCCTACTTCCTGTTTACCCTTGAGCAAATAACCCTGGAAATGCGTAAAACACATcggTACATAcgTTACTCACC

Sequences are shown 5'->3'; mEts mutates a putative Ets-binding site, mAP-1 mutates a putative AP-1 site; and mGATA mutates two putative GATA sites all shown in lower case. In addition to the mutated sequences, each primer included a SacI site and a 4-bp GCGC extension at the 3'-end of the primers (underlined) to facilitate directional cloning. The M13 reverse primer was used with the mutagenic primers in PCR reactions. PCR fragments were isolated by agarose gel electrophoresis and electroelution, digested with HindIII/SacI, and cloned into these sites in pBspKS for sequencing to confirm that only the expected mutations had been introduced. The mutated HindIII/SacI fragments were cloned into HindIII/SacI-digested pT81luc for testing in transfection assays. The double Ets/AP-1 mutant was generated by PCR as described using the mAP-1 primer with the mEts pBsp clone. PCR product was cloned into pBspKS as described above for the single mutants to facilitate sequencing, followed by cloning of the correct fragment into pT81luc.


    ACKNOWLEDGMENTS
 
We wish to thank Agnes Fresnoza for her excellent technical assistance. We thank Dr. Peter Cattini for his helpful and stimulating discussions and for the generous use of his luminometer. We also thank the members of the Cattini laboratory for their advice on nuclear extract preparation and setting up DNAse I protection and gel electrophoretic mobility shift assays.


    FOOTNOTES
 
Address requests for reprints to: Dr. Mary Lynn Duckworth, Department of Physiology, University of Manitoba, Room 421 Basic Medical Sciences Building, 730 William Avenue, Winnipeg, Manitoba, R3E 3J7 Canada. E-mail: mdckwth{at}cc.umanitoba.ca

This work was supported by grants from the Medical Research Council of Canada, the Manitoba Medical Services Foundation, and the Manitoba Health Research Council.

Received for publication March 3, 1998. Revision received October 2, 1998. Accepted for publication November 11, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Johnson W, Albanese C, Handwerger S, Williams T, Pestell RG, Jameson JL 1997 Regulation of the human chorionic gonadotropin {alpha}- and ß-subunit promoters by AP-2. J Biol Chem 272:15405–15412[Abstract/Free Full Text]
  2. Steger D, LiCalsi C, Mellon PL Trophoblast-specific element binding protein is closely related to transcription factor activator protein 2. Program of The 77th Annual Meeting of The Endocrine Society, Washington, DC, 1995 p 426 (Abstract)
  3. Steger DJ, Büscher M, Hecht JH, Mellon PL 1993 Coordinate control of the {alpha}- and ß-subunit genes of human chorionic gonadotropin by trophoblast-specific element-binding protein. Mol Endocrinol 7:1579–1588[Abstract]
  4. Budworth PR, Quinn PG, Nilson JH 1997 Multiple characteristics of a pentameric regulatory array endow the human {alpha}-subunit glycoprotein hormone promoter with trophoblast specificity and maximal activity. Mol Endocrinol 11:1669–1680[Abstract/Free Full Text]
  5. Yamada D, Harada N, Honda S, Takagi Y 1995 Regulation of placenta-specific expression of the aromatase cytochrome P-450 gene: involvement of the trophoblast-specific element binding protein. J Biol Chem 270:25064–25069[Abstract/Free Full Text]
  6. Shi D, Winston JH, Blackburn MR, Datta SK, Hanten G, Kellems RE 1997 Diverse genetic regulatory motifs required for murine adenosine deaminase gene expression in placenta. J Biol Chem 272:2334–2341[Abstract/Free Full Text]
  7. Ng Y-K, George KM, Engel JD, Linzer DIH 1994 GATA factor activity is required for the trophoblast-specific transcriptional regulation of the mouse placental lactogen-1 gene. Development 120:3257–3266[Abstract]
  8. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the human gonadotropin {alpha}-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:5592–5602[Abstract/Free Full Text]
  9. Shida MM, Ng Y-K, Soares MJ, Linzer, DIH 1993 Trophoblast-specific transcription from the mouse placental lactogen-1 gene promoter. Mol Endocrinol 7:181–188[Abstract]
  10. Jacquemin P, Martial JA, Davidson I 1997 Human TEF-5 is preferentially expressed in placenta and binds multiple functional elements of the human chorionic somatommotropin-B gene enhancer. J Biol Chem 272:12928–12937[Abstract/Free Full Text]
  11. Jiang S-W, Trujillo MA, Eberhardt NL 1997 Human chorionic somatomammotropin enhancer function is mediated by cooperative binding of TEF-1 and SCEF-1 to multiple, low-affinity binding sites. Mol Endocrinol 11:1223–1232[Abstract/Free Full Text]
  12. Guillemot F, Nagy A, Auerbach A, Rossant J, Joyner A 1994 Essential role of Mash-2 in extraembryonic development. Nature 371:333–336[CrossRef][Medline]
  13. Firulli AB, McFadden DG, Lin Q, Srivastava D, Olsen EN 1998 Heart and extra-embryonic mesodermal defects in mouse embryos lacking the bHLH transcription factor Hand1. Nat Genet 18:266–270[CrossRef][Medline]
  14. Riley P, Anson-Cartwright L, Cross JC 1998 The Hand1 bHLH transcription factor is essential for placentation and cardiac morphogenesis. Nat Genet 18:271–275[CrossRef][Medline]
  15. Cross JC, Flannery ML, Blanar MA, Steingrimsson E, Jenkins NA, Copeland NG, Rutter WJ, Werb Z 1995 Hxt encodes a basic helix-loop-helix transcription factor that regulates trophoblast cell development. Development 121:2513–2523[Abstract]
  16. Srivastava D, Cserjesi P, Olson EN 1995 A subclass of b HLH proteins required for cardiac morphogenesis. Science 270:1955–1999[Abstract/Free Full Text]
  17. Hollenberg SM,Sternglanz R, Cheng PF, Weintraub H 1995 Identification of a new family of tissue specific basic helix-loop-helix proteins with the two hybrid system. Mol Cell Biol 15:3813–3822[Abstract]
  18. Soares MJ, Faria TN, Roby KF, Deb S 1991 Pregnancy and the prolactin family of hormones: coordination of anterior pituitary, uterine, and placental expression. Endocr Rev 12:402–423[Medline]
  19. Soares MJ, Müller H, Orwig KE, Peters TJ, Dai G 1998 The uteroplacental prolactin family and pregnancy. Biol Reprod 58:273–284[Free Full Text]
  20. Southard JN, Talamantes F 1991 Placental prolactin-like proteins in rodents: variations on a structural theme. Mol Cell Endocrinol 79:C133–C140
  21. Kelly PA, Shiu RPC, Robertson MC, Friesen HG 1975 Characterization of rat chorionic mammotropin. Endocrinology 96:1187–1195[Abstract]
  22. Robertson MC, Friesen HG 1981 Two forms of rat placental lactogen revealed by radioimmunoassay. Endocrinology 108:2388–2390[Abstract]
  23. Ogren L, Southard JN, Colosi P, Linzer DIH, Talamantes F 1989 Mouse placental lactogen-1: RIA and gestational profile in maternal serum. Endocrinology 125:2253–2257[Abstract]
  24. Soares MJ, Colosi P, Talamantes F 1982 The development and characterization of a homologous radioimmunoassay for mouse placental lactogen. Endocrinology 110:668–670[Abstract]
  25. Duckworth ML, Robertson MC, Schroedter IC, Szpirer C, Friesen HG 1993 Molecular genetics and biology of the rat placental prolactin family. In: Soares MJ, Handwerger S, Talamantes F (eds) Trophoblast Cells: Pathways for Maternal-Embryonic Communication. Serono Symposia, USA, Springer-Verlag, New York, pp 169–190
  26. Faria TN, Deb S, Kwok SCM, Talamantes F, Soares MJ 1990 Ontogeny of placental lactogen-I and placental lactogen-II in the developing rat placenta. Dev Biol 141:279–291[CrossRef][Medline]
  27. Duckworth ML, Schroedter IC, Friesen HG 1990 Cellular Localization of rat placental lactogen II and rat prolactin-like protein A and B by in situ hybridization. Placenta 11:143–155[CrossRef][Medline]
  28. Nieder GL, Jennes L 1990 Production of mouse placental lactogen-I by trophoblast giant cells in utero and in vitro. Endocrinology 126:2809–2814[Abstract]
  29. Faria TN, Ogren L, Talamantes F, Linzer DI, Soares MJ 1991 Localization of placental lactogen-I in trophoblast giant cells of mouse placenta. Biol Reprod 44:327–333[Abstract]
  30. Shah P, Sun Y, Szpirer C, Duckworth ML 1998 Rat placental lactogen II gene: characterization of gene structure and placental-specific expression. Endocrinology 139:967–973[Abstract/Free Full Text]
  31. Faria TN, Soares MJ 1991 Trophoblast cell differentiation: establishment, characterization, and modulation of a rat trophoblast cell line expressing members of the placental prolactin family. Endocrinology 129:2895–2906[Abstract]
  32. Verstuyf A, Sobis H, Goebels J, Fonteyn E, Cassiman JJ, Vandeputte M 1990 Establishment and characterization of a continuous in vitro line from a rat choriocarcinoma. Int J Cancer 45:752–756[Medline]
  33. Ma GT, Roth ME, Groskopf JC, Tsai FY, Orkin SH, Grosveld F, Engel JD, Linzer DIH 1997 GATA-2 and GATA-3 regulate trophoblast-specific gene expression in vivo. Development 124:907–914[Abstract]
  34. Sun Y, Robertson MC, Duckworth ML 1998 The effects of epidermal growth factor/transforming growth factor {alpha} on the expression of placental lactogens I and II mRNAs in a rat choriocarcinoma cell line. Endocrine J 45:297–306
  35. Tsai F-Y, Keller G, Kuo FC, Weiss MN, Chen JH, Rosenblatt M, Alt FW, Orkin SH 1994 An early haematopoietic defect in mice lacking the transcriptional factor GATA-2. Nature 371:221–226[CrossRef][Medline]
  36. Pandolfi PP, Roth ME, Karis A, Leonard MW, Dzierzak E, Grosveld FG, Engel JD, Lindenbaum MH 1995 Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat Genet 11:40–44[CrossRef][Medline]
  37. Nordeen SK 1988 Luciferase reporter vectors for analysis of promoters and enhancers. Biotechniques 6:454–457[Medline]
  38. Wasylyk B, Hahn SL, Giovane A 1993 The Ets family of transcription factors. Eur J Biochem 211:7–18[Medline]
  39. Angel P, Imagawa M, Chiu R, Stein B, Imbra RJ, Rahmsdorf HJ, Jonat C, Herrlich P, Karin M 1987 Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729–739[CrossRef][Medline]
  40. Lee W, Mitchell P, Tjian R 1987 Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741–752[CrossRef][Medline]
  41. Wasylyk C, Gutman A, Nicholson R, Wasylyk B 1991 The c-Ets oncoprotein activates the stromelysin promoter through the same elements as several non-nuclear oncoproteins. EMBO J 10:1127–1134[Medline]
  42. Yamamoto H, Flannery ML, Kupriyanov S, Pearce J, McKercher SR, Henkel GW, Maki RA, Werb Z, Oshima RG 1998 Defective trophoblast function in mice with a targeted mutation of Ets2. Genes Dev 12:1315–1326[Abstract/Free Full Text]
  43. Basuyaux JP, Ferreira E, Stéhelin D, Butticè G 1997 The Ets transcription factors interact with each other and with the c-Fos/c-Jun complex via distinct protein domains in a DNA-dependent and -independent manner. J Biol Chem 272:26188–26195[Abstract/Free Full Text]
  44. Wasylyk B, Wasylyk C, Flores P, Begue A, Leprince D, Stehelin D 1990 The c-ets proto-oncogenes encode transcription factors that cooperate with c-Fos and c-Jun for transcriptional activation. Nature 346:191–193[CrossRef][Medline]
  45. Rauscher III FJ, Voulalas PJ, Franza Jr BR, Curran T 1988 Fos and Jun bind cooperatively to the AP-1 site: reconstitution in vitro. Genes Dev 2:1687–1699[Abstract/Free Full Text]
  46. Oettgen P, Akbarali Y, Boltax J, Best J, Kunsch C, Libermann T 1996 Characterization of NERF, a novel transcription factor related to the Ets factor ELF-1. Mol Cell Biol 16:5091–5106[Abstract]
  47. Choi S-G, Yi Y, Kim Y-S, Kato M, Chang J, Chung H-W, Hahm K-B, Yang H-K, Rhee HH, Bang Y-J, Kim S-J 1998 a novel ets-related transcription factor, ERT/ESX/ESE-1, regulates expression of the transforming growth factor-ß type II receptor. J Biol Chem 273:110–117[Abstract/Free Full Text]
  48. Stacey KJ, Fowles LF, Colman MS, Ostrowski MC, Hume DA 1995 Regulation of urokinase-type plasminogen activator gene transcription by macrophage colony-stimulating factor. Mol Cell Biol 15:3430–3441[Abstract]
  49. Aperlo C, Pognonec P, Stanley ER, Boulukos KE 1996 Constitutive c-ets2 expression in M1D+ myeloblast leukemic cells induces their differentiation to macrophages. Mol Cell Biol 16:6851–6858[Abstract]
  50. Coffer P, de Jonge M, Mettouchi A, Binetruy B, Ghysdael J, Kruijer W 1994 JunB promoter regulation: Ras mediated transactivation by c-Ets1 and c-Ets2. Oncogene 9:911–921[Medline]
  51. Lin J, Linzer DIH 1998 Identification of trophoblast-specific regulatory elements in the mouse placental lactogen II gene. Mol Endocrinol 12:418–427[Abstract/Free Full Text]
  52. Watson DK, McWilliams MJ, Lapis P, Lautenberger JA, Schweinfest CW, Papas TS 1988 Mammalian Ets1 and Ets2 genes encode highly conserved proteins. Proc Natl Acad Sci USA 85:7862–7866[Abstract/Free Full Text]
  53. Sanger F, Nicklen S, Coulsen AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  54. Cattini PA, Eberhardt NL 1987 Regulated expression of chimaeric genes containing the 5' flanking regions of human growth hormone-related genes in transiently transfected rat anterior pituitary tumour cells. Nucleic Acids Res 15:1297–1309[Abstract/Free Full Text]
  55. Vuille J-C, Cattini PA, Bock ME, Verstuyf A, Schroedter IC, Duckworth ML, Friesen HG 1993 Rat prolactin-like A protein partial gene and promoter structure: promoter activit