help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burris, T. P.
Right arrow Articles by Demarest, K. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burris, T. P.
Right arrow Articles by Demarest, K. T.
Molecular Endocrinology 13 (3): 410-417
Copyright © 1999 by The Endocrine Society

A Novel Method for Analysis of Nuclear Receptor Function at Natural Promoters: Peroxisome Proliferator-Activated Receptor {gamma} Agonist Actions on aP2 Gene Expression Detected Using Branched DNA Messenger RNA Quantitation

Thomas P. Burris, Patricia D. Pelton, Lubing Zhou, Melville C. Osborne, Ellen Cryan and Keith T. Demarest

Endocrine Therapeutics Department of Drug Discovery The R.W. Johnson Pharmaceutical Research Institute Raritan, New Jersey 08869


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}), a member of the nuclear hormone receptor superfamily, plays an essential role in the mediation of the actions of antidiabetic drugs known as thiazolidinediones (TZDs). PPAR{gamma} activates many target genes involved in lipid anabolism including the adipocyte fatty acid binding protein (aP2). In this study, induction of aP2 gene expression by PPAR{gamma} agonists was examined in both cultured cells and diabetic mice using branched DNA (bDNA)-mediated mRNA quantitation. bDNA technology allows for the direct measurement of a particular mRNA directly within cellular lysate using a 96-well plate format in a time frame comparable to a reporter gene assay. In cultured human subcutaneous preadipocytes, the TZDs, troglitazone and BRL-49653, both rapidly induced aP2 mRNA as detected with the bDNA method. In these cells, the effect of BRL-49653 on aP2 mRNA levels was detectable as early as 30 min after treatment (47% increase) and was maximal after 24 h of treatment (12-fold increase). The effects of troglitazone on aP2 mRNA induction were similar to those of BRL-49653 except that the maximal level of induction was consistently lower (e.g. 24 h treatment = 4-fold increase). Dose-response relationships for both of the TZDs were also determined using the 24-h treatment time point. EC50s for both BRL-49653 and troglitazone were estimated to be 80 nM and 690 nM, respectively. A natural PPAR{gamma} ligand, 15-deoxy-{Delta}12,14-PGJ2, was also active in this assay with a maximal induction of aP2 mRNA of approximately 5-fold when tested at 1 µM. Since the PPAR{gamma}:retinoid X receptor (RXR) heterodimer has been characterized as a permissive heterodimer with respect to RXR ligands, the ability of 9-cis-retinoic acid (9-cis-RA) to induce aP2 mRNA was examined. Although 9-cis-RA had very low efficacy (2-fold induction), the maximal effect was reached at 100 nM. No synergism or additivity in aP2 mRNA induction was detected when 9-cis-RA was included with either of the TZDs used in this study. Significant induction of aP2 mRNA in bone marrow of db/db mice treated with either troglitazone or BRL-49653 was also detected, indicating that the bDNA assay may be a simple method to monitor nuclear receptor target gene induction in vivo.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Peroxisome-proliferator activated receptor-{gamma} (PPAR{gamma}) is a member of the nuclear hormone receptor superfamily that has been demonstrated to play an essential role in the mediation of the actions of antidiabetic drugs known as thiazolidinediones (TZDs) (1, 2, 3). TZDs have been demonstrated to bind directly to PPAR{gamma} with high affinity, causing activation of target genes (1, 2, 3). These compounds were first demonstrated to be specific PPAR{gamma} ligands by Lehmann et al. with affinities [dissociation constants (Kds)] ranging from the relatively weak ciglitazone (>1 µM) to the potent BRL-49653 (40 nM) (4). It was later shown that there was a direct correlation between the affinity of the various TZDs for PPAR{gamma} and their relative antihyperglycemic effect in vivo (5).

Endogenous PPAR{gamma} ligands have also been identified such as 15-deoxy-{Delta}12,14-PGJ2 (15d-PGJ2) (6, 7) and 9- and 13-hydroxyoctadecadienoic acid (HODE) (8). Although the physiological role of 15d-PGJ2 as a PPAR{gamma} agonist is unclear, 15d-PGJ2 has been characterized as efficacious in both transcriptional reporter and adipocyte differentiation assays, although the potency is relatively low (Kd > 1 µM) (6, 7). 9- and 13-HODE are also relatively low potency ligands for PPAR{gamma} (Kd > 1 µM) and are active in reporter assays (8). It has been suggested that 9- and 13-HODE, components of oxidized low-density lipoprotein, may play a role in the PPAR{gamma}-mediated differentiation of macrophages to foam cells (8, 9).

Activation of PPAR{gamma} leads to increased expression of many target genes involved in lipid anabolism and energy balance such as the adipocyte fatty acid binding protein (aP2), acyl-CoA oxidase, lipoprotein lipase, and acyl-CoA synthase (1, 2, 3, 10). Recently, with the description of a role of PPAR{gamma} in the monocyte, a new class of responsive genes has been identified, e.g. CD14, CD36, and SR-A, which function in the differentiation of these cells to foam cells (8, 9) and inducible nitric oxide synthase, gelatinase B, and tumor necrosis factor-{alpha}, which function in the regulation of the inflammatory response (11, 12).

Analysis of the response of various target genes, such as those described above, in response to ligands for nuclear receptors has been limited by the techniques with which the induction of the gene of interest is detected. Typically, Northern analysis, RT-PCR, or ribonuclease (RNAse) protection is used to detect changes in expression of nuclear receptor target genes. However, if the effects of multiple ligands and doses of these ligands are to be analyzed, these classic molecular biology methods are cumbersome. The transcriptional reporter assay has solved the problem concerning the level of throughput required for these types of studies, but in many cases it may be advantageous or more appropriate to examine the expression of an authentic target gene with its entire natural regulatory sequences instead of a reporter in a heterologous system. To address this, we have developed a method to quantitate a nuclear receptor target in a 96-well format. This method utilizes branched DNA (bDNA) amplification technology that was originally developed for clinical detection of viral DNA and RNA (13, 14, 15, 16). The method is as simple to perform as a transcriptional reporter assay and is completed in the same time frame. In this study, we used the bDNA assay to monitor the level of induction of the PPAR{gamma} target gene, aP2, after treatment of various cell types with a variety of agonists. We also demonstrate that this assay provides a simple method for detecting the actions of nuclear receptor ligands on target genes in vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
bDNA mRNA Detection Methodology and aP2 Probe Design
An overview of the bDNA mRNA detection methodology is illustrated in Fig. 1Go. After treatment of hormone-sensitive cells, cultured in a 96-well plate, with ligand for various amounts of time, the cells are lysed in the presence of target oligonucleotides (probes). Multiple short probes are used during the hybridization to span the mRNA of interest. Three types of hybrid target probes are used and include capture probes, target probes, and spacer probes. Capture probes are designed so that a portion hybridizes with an oligonucleotide that is fixed to the well surface of a 96-well plate and another portion that hybridizes to the mRNA of interest. Label probes are designed so that a portion hybridizes to the mRNA of interest and the other portion hybridizes to a branched DNA molecule that is essential for the amplification of the hybridization signal. The probes are designed to completely span the mRNA of interest; the stability of the hybrid is increased by leaving no gaps that would increase the susceptibility of the hybrid to single-stranded nucleases. An aliquot of the lysate from each well is transferred to a capture plate that consists of wells coated with an oligonucleotide complementary to a portion of the capture probe. Hybridization is carried out overnight at 53 C. A solution of bDNA is then added followed by a short hybridization step (30 min at 53 C). The bDNA hybridizes to a portion of the label probe that has previously complexed with the mRNA of interest. A covalently modified oligonucleotide (coupled to alkaline phosphatase) complementary to the branches of the bDNA is added followed by another short hybridization step (15 min at 53 C). A luminescent alkaline phosphatase substrate is then added, followed by quantitation in a luminometer.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Summary of the Assay Procedure and Mechanism of the bDNA-Mediated mRNA Detection Assay

Cells are treated with ligands for various amounts of time followed by cell lysis in the presence of oligonucleotides. Multiple oligonucleotides are used during the hybridization to span the mRNA of interest. Three types of hybrid target probes are used and include capture probes, target probes, and spacer probes. Capture probes are designed so that a portion hybridizes with an oligonucleotide that is fixed to the well surface of a 96-well plate and another portion that hybridizes to the mRNA of interest. Label probes are designed so that a portion hybridizes to the mRNA of interest and the other portion hybridizes to a branched DNA molecule that is essential for the amplification of the hybridization signal. The probes are designed to completely span the mRNA of interest; the stability of the hybrid is increased by leaving no gaps so as to decrease the susceptibility of the hybrid to single stranded nucleases. An aliquot of the lysate from each well is transferred to a capture plate that consists of wells coated with an oligonucleotide complementary to a portion of the capture probe. Hybridization is carried out overnight at 53°C. A solution of bDNA is then added followed by a short hybridization step (30 min at 53°C). The bDNA hybridizes to a portion of the label probe that has previously complexed with the mRNA of interest. A covalently modified oligonucleotide (coupled to alkaline phosphatase) complementary to the branches of the bDNA is added followed by another short hybridization step (15 min at 53 C). A luminescent alkaline phosphatase substrate is then added followed by quantitation in a luminometer.

 
To validate this method for quantitation of nuclear receptor target gene induction, we selected the PPAR{gamma} target gene aP2. ProbeDesigner (Chiron Diagnostics, Emeryville, CA) software was used to design the probe set for detection of the human aP2 mRNA. Figure 2Go is a schematic illustrating the location of the capture, label, and spacer probes within the aP2 mRNA seqeunce. A total of 18 oligonucletides were required to span the aP2 mRNA sequence.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. Schematic Illustrating the Localization of Oligonucleotides Annealing to the aP2 mRNA and Also Functioning in the bDNA mRNA Detection System

 
aP2 mRNA Induction by PPAR{gamma} Agonists Measured with bDNA Technology
To validate the bDNA method for measurement of aP2 in human subcutaneous preadipocytes, we treated the cells with 1 µM BRL-49653 for 3 and 24 h and compared the level of expression of aP2 mRNA as detected by both quantitative PCR (QPCR) and the bDNA method (17, 18, 19). At both the 3- and 24-h timepoints, the two methods are in agreement with respect to the level of induction of aP2 mRNA. After 3 h of treatment, QPCR detected a 3.0-fold increase in aP2 mRNA expression while the bDNA method detected a 3.1 ± 0.30-fold increase (Table 1Go). After 24 h of treatment with BRL-49653, QPCR detected a 12.7-fold increase in expression, whereas the bDNA method detected a 9.9 ± 0.74-fold increase (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Induction of aP2 mRNA Expression Induced by 1 µM BRL-49653 as Detected by QPCR and bDNA Methods

 
To assess the kinetics of induction of aP2 mRNA by BRL-49653, human subcutaneous preadipocytes were cultured in 96-well culture plates and challenged with 1 µM BRL-49653, for various amounts of time ranging from 0.5 h to 5 h followed by assessment of aP2 gene expression using the bDNA assay. As shown in Fig. 3AGo, aP2 expression increased approximately 50% 0.5 h after treatment with BRL-49653 and continued to increase to a level 3-fold higher than controls after 5 h of treatment. Figure 3BGo illustrates a longer time course experiment in which the cells were treated with either BRL-49654 or troglitazone (1 µM) for times ranging from 2–48 h. BRL-49653-treated cells reached a maximal 12-fold increase in the level of aP2 gene induction after 24 h treatment. Interestingly, troglitazone did not induce this great an increase in aP2 gene expression, with a maximal level of only approximately 6-fold over control levels (48 h). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels were monitored in parallel wells, and no significant changes were noted upon addition of PPAR{gamma} agonists (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. The Effect of the PPAR{gamma} Agonists, Troglitazone and BRL 49653, on aP2 mRNA Levels in Preadipocytes after Various Incubation Times

aP2 mRNA levels were assessed with the bDNA assay. A, BRL 49653 (1 µM) increases aP2 mRNA after very short incubation times. An approximate 50% increase in aP2 mRNA levels is detectable in as little as 30 min after addition of the drug. B, The effects of BRL49653 (1 µM and troglitazone (1 µM) on aP2 mRNA levels peak after approximately 24 h. BRL 49653 has a larger effect on the induction of aP2 mRNA than troglitazone. Values are expressed as a mean of the values from three individual wells ± SEM.

 
As detected by the bDNA assay, both troglitazone and BRL-49653 dose dependently increased aP2 expression as shown on Fig. 4Go. Troglitazone was approximately 10-fold less potent than BRL-49653 in this assay (EC50 690 nM vs. 80 nM). 15-deoxy-{Delta}12,14-PGJ2 (15d-PGJ2) was quite active with efficacy similar to the thiazolidinediones (Fig. 5Go). The retinoic acid receptor (RAR)/retinoid X receptor (RXR) agonist, 9-cis-retinoic acid, showed minimal efficacy, increasing aP2 expression only 2-fold (Fig. 5Go). The effects of 9-cis-retinoic acid treatment are attributable to its actions at RXR since a selective RAR agonist, TTNPB, was not active in this assay (data not shown). We also examined the effect of 9-cis-retinoic acid treatment concurrent with either troglitazone or BRL-49653. No additive or synergistic effects were noted (Table 2Go). The effects of the various PPAR{gamma} agonists on aP2 gene expression in human omental preadipocytes were also examined. As shown in Fig. 6Go, consistent with previous findings (20), no effect of these compounds were noted.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. The PPAR{gamma} Agonists, Troglitazone and BRL 49653, Increase aP2 mRNA Levels in a Dose-Dependent Manner

Various concentrations of the agonists were incubated with the preadipocytes, and the experiment was terminated after 24 h. aP2 mRNA levels were assessed with the bDNA assay. BRL 49653 was significantly more potent (EC50 estimated at 80 nM) than troglitazone (EC50 estimated at 690 nM). Values are expressed as a mean of the values from three individual wells ± SEM.

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. 9-cis-Retinoic Acid and PGJ2 Increase aP2 mRNA Levels in a Dose-Dependent Manner

Various concentrations of the compounds were incubated with the preadipocytes, and the experiment was terminated after 24 h. aP2 mRNA levels were assessed with the bDNA assay. 9-cis-Retinoic acid had only limited efficacy with a maximal induction of aP2 mRNA levels of approximately 2-fold. 15d-PGJ2 had efficacy comparable to troglitazone. Values are expressed as a mean of the values from three individual wells ± SEM.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Lack of Additivity or Synergy of 9-cis-Retinoic Acid with Thiazolidinediones

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 6. PPAR{gamma} Ligands Have no Effect on aP2 mRNA Expression in Omental Preadipocytes

BRL-49653, troglitazone, and 15d-PGJ2 were applied to the cells at a concentration of 1 µM for 2, 5, 24, and 48 h. aP2 mRNA levels were assessed with the bDNA assay. Values are expressed as a mean of the values from three individual wells ± SEM.

 
Detection of PPAR{gamma} Action in Vivo with the bDNA Assay
Since the bDNA assay measures the induction of an actual nuclear receptor target gene, we believed that this method may be useful to monitor the actions of nuclear receptor ligands in vivo. To examine this, we treated diabetic mice (db/db) with 30 mg/kg of either BRL-49653 or troglitazone by oral gavage once a day for five consecutive days. After this treatment, the relative expression of aP2 was examined in bone marrow collected from the femurs of the animals. Bone marrow, which has been previously characterized as a target tissue for PPAR{gamma} agonist actions (21), was selected as the tissue to examine because of the low basal levels of aP2 expression and the ease of sample collection. Relative levels of aP2 expression were normalized to the expression of GAPDH to control for variability during the preparation of the tissue. As shown in Fig. 7Go, BRL-49653 and troglitazone significantly increased aP2 gene expression in bone marrow 3.8- and 3.2-fold, respectively.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 7. Thiazolidinediones, BRL-49653 and Troglitazone, Increase aP2 Expression in Vivo as Detected by the bDNA Assay

Female db/db mice, 8–10 weeks of age, were dosed once per day for five consecutive days with 30 mg/kg of either BRL-49653, troglitazone, or vehicle. On the fifth day, bone marrow collected from the femur and tibia was collected and assayed for aP2 mRNA using the bDNA assay. Animals treated with either of the two TZDs showed significant (P < 0.01) increases in aP2 expression.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Using PPAR{gamma} and aP2 as a model nuclear receptor and target gene, respectively, we demonstrated that the bDNA assay can be effectively used to monitor nuclear receptor-mediated alterations in gene expression. The bDNA assay is simple to perform and is completed along the same time frame as a transcriptional reporter assay. The assay is easily adapted to different cell types including tissue directly from an animal source. With the availability of software to aid in the design of the oligonucleotide probes, the assay is also adaptable to virtually any gene of interest.

The results of the bDNA-mediated aP2 induction assay were consistent with other assays that examine the activity of PPAR{gamma}. BRL-49653 and troglitazone had EC50s for induction of aP2 that correlated well with published values for their affinities for PPAR{gamma} and EC50s in the transcriptional reporter assay (4, 6, 7). The time frame of induction of aP2 was also similar to previous values obtained by Northern analysis (21, 22). Our studies with the RAR/RXR agonist, 9-cis-retinoic acid, confirm that the PPAR{gamma}/RXR heterodimer is permissive (23); however, our data indicate that, at least in terms of aP2 gene induction, activation of RXR does not yield the same degree of efficacy as activation of PPAR{gamma}, and the RXR ligand does not function additively or synergistically with a PPAR{gamma} ligand. Previously, it was demonstrated that RXR ligands may act additively (24) or synergistically (25) with PPAR{gamma} ligands, although this does not appear to be the case for induction of aP2 expression in preadipocytes. Mukherjee et al. (25) found that the RXR ligand, LGD 100268, is as efficacious in the activation of the PPAR{gamma}/RXR heterodimer as a PPAR{gamma} ligand in reporter assays. These investigators also showed that PPAR{gamma} and RXR ligands synergistically activated reporter gene transcription. Similar results were obtained in diabetic rodent models using plasma glucose and glucose tolerance tests as endpoints (25). The reason for this discrepancy is not clear, but may arise from the fact that we are monitoring the expression of a single PPAR{gamma} target gene under the regulation of its natural promoter; thus, complex regulation within the aP2 promoter may preclude RXR ligands from functioning, as previously described at the DR1 element (25). The fact that RXR ligands have a much greater effect on insulin sensitivity in vivo than on aP2 gene expression in vitro may be ascribed to the notion that activation of many PPAR{gamma} target genes is required to increase insulin sensitivity by RXR ligands, and aP2 is not one of these. Alternatively, the differences in the ligands used (9-cis-retinoic acid vs. LG 100268) in these studies may account for the discrepancies.

In this study, using the bDNA assay, we also examined the ability of the TZDs to induce aP2 gene expression in vivo. Previously, it was demonstrated that TZDs induce adipocyte differentiation in bone marrow (21). Since bone marrow is a relatively accessible source of tissue and has low basal levels of aP2 expression, we examined the effects of troglitazone and BRL-49653 on the expression of aP2 in this tissue. We found that treatment of db/db mice with either of these TZDs induced significant (3.2- to 3.8-fold induction) aP2 expression. This assay is extremely efficient at detecting induction of genes in vivo, as we could evaluate the results of the assay within 16 h after harvesting tissue with no RNA purification required.

In summary, we have adapted a novel assay, originally developed for detection of viral nucleic acids, for use to detect activation of nuclear receptor target genes. This method is advantageous in that one can quickly and simply assay the relative effects of a ligand on target genes within target tissues. We believe this assay will complement the transcriptional reporter assay. Whereas the reporter assay has its strengths in the area of investigation of the mechanistics and specificity of nuclear receptor function, the bDNA assay focuses on the physiological relevance of receptor activation in both cell culture and animals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
Human preadipocytes obtained from cosmetic liposuction procedures were purchased from Zen-Bio (Research Triangle Park, NC). Confluent cells were shipped in 96-well plates and used on the day of receipt. Cells were plated in preadipocyte medium [DMEM/Ham’s F-10 nutrient broth (1:1) supplemented with HEPES (pH 7.4, 15 mM), biotin (33 µM), pantothenate (17 µM), insulin (100 nM), dexamethasone (1 µM), FBS (10%), and antibiotics (streptomycin, penicillin, and fungizone). Cells were maintained at 37 C and 5% CO2 throughout the study. Cells were challenged with various PPAR{gamma} agonists on the day the cells were received from Zen-Bio. DMEM/F-12 medium containing the agonists was added to the cells after removal of the preadipocyte media. The media remained on the cells for various amounts of time (0.5 h–48 h) depending on the experiment. At the termination of the challenge, medium was removed and 100 µl of lysis buffer were added as described below.

Quantitative RT-PCR
Human subcutaneous preadipocytes were induced with differentiation medium (see Cell Culture), and the cells were harvested for RNA purification after 3 and 24 h. Total RNA was prepared using the protocol of guanidinium/acid-phenol extraction (17). The method for RT and QPCR has been described previously (17, 18, 19). Briefly, total RNA was mixed with nuclease-free water to a final volume of 7 µl, heated at 65 C for 5 min, and chilled on ice. Aliquoted RT mixture was added into individual tubes bringing the final volume to 20 µl. Each RT reaction contained 1.5 µM oligodT12-18, 0.5 mM deoxynucleoside triphosphate), 1 U of RNase inhibitor, 10 µM dithiothreitol, 1 x RT buffer (GIBCO BRL, Gaithersburg, MD) and 100 U of M-MLV (GIBCO BRL). The reaction was incubated at 37 C for 1 h, heated at 85 C for 4 min, and chilled on ice. For QPCR, a 1:3 dilution of internal control for aP2 was added into a series of PCR reaction tubes containing equal volumes of RT reaction mixture (1 µl/50 ng total RNA). The PCR reaction contained 0.4 µM of corresponding primers specific for aP2 cDNA (5'-TGAAA GAAGT AGGAG TGGGC, 5'-CTTCA GTCCA GGTCA ACGTC), 50 µM deoxynucleoside triphosphate, 1 x PCR buffer and 2.5 U of Taq polymerase (Perkin-Elmer, Norwalk, CT) in a final volume of 50 µl. The amplification conditions for PCR were detailed previously (23). The internal standard of aP2 was the corresponding aP2 cDNA fragment with 90-bp deletion (from 134–213 bp of the coding sequence) engineered by PCR method. The authenticity of the internal control DNA was confirmed by DNA sequencing. Fifteen microliters of PCR product were loaded onto a 6% Tris-borate-EDTA acrylamide gel and subjected to electrophoresis. After staining with ethidium bromide, the gel was photographed, and the intensity of the DNA bands was quantified by a computerized camera and computer analysis system (Bio-Rad Gel Docu 1000; Bio-Rad Laboratories, Richmond, CA). The ratio of the integrated DNA bands was plotted out on a log-log scale against the amount of internal standard present in the PCR reactions. The amount of aP2 cDNA before the PCR was determined from the plot (17).

bDNA Assay
The bDNA assay was performed according to the manufacturers protocol (Chiron Diagnostics; Emeryville, CA). Briefly, after the challenge of the preadipocytes, cells were lysed with lysis buffer (provided by Chiron Diagnostics) containing the aP2 oligonucleotides (described below). After a 15-min incubation, 80 µl of the lysis buffer from each well were added to a corresponding capture well (preincubated with 100 µl of blocking buffer (provided by Chiron Diagnostics). The capture plate was incubated overnight at 53 C in a plate incubator (Chiron Diagnostics). After this incubation, the bDNA and label probes were annealed as directed by the manufacturer. After a 30-min incubation with the luminescent alkaline phosphatase substrate, dioxitane, the luminescence was quantitated in a Dynex MLX microtiter plate luminometer. A summary of the procedure is provided in Fig. 1Go

aP2 Probe Design
Oligonucleotide probes were designed to anneal to the aP2 mRNA and function in the bDNA mRNA detection system were designed with ProbeDesigner software (Chiron Diagnostics). This software package analyzes a target sequence of interest with a series of algorithms to determine which regions of the sequence can perform as locations for capture, label, or spacer probe annealing. The sequence of the oligonucleotides is summarized below:

ap2001.CE CATTTTGTGAGTTTTCTAGGATTATTCTTT-TCTCTTGGAAAGAAAGT

ap2002.CE ATGTTAGGTTTGGCCATGCCTTTCTCTTGGAAAGAAAGT

ap2003.CE CCTCTCGTTTTCTCTTTATGGTTTTCTCTTGGAAAGAAAGT

ap2004.CE GCTTATGCTCTCTCATAAACTCTCGTGGT-TTCTCTTGGAAAGAAAGT

ap2005.LE CCAGGTACCTACAAAAGCATCACATTTAGG-CATAGGACCCGTGTCT

ap2006.LE GCCCACTCCTACTTCTTTCATATAATCATT-TAGGCATAGGACCCGTGTCT

ap2007.LE AGCCACTTTCCTGGTGGCAAATTTAGGCAT-AGGACCCGTGTCT

ap2008.LE CATCCCCATTCACACTGATGATCTTTAGGC-ATAGGACCCGTGTCT

ap2009.LE GTACCAGGACACCCCCATCTAAGGTTTTTA-GGCATAGGACCCGTGTCT

ap2010.LE GGTTGATTTTCCATCCCATTTCTGCACATT-TTAGGCATAGGACCCGTGTCT

ap2011.LE GCATTCCACCACCAGTTTATCATTTTAGGC-ATAGGACCCGTGTCT

ap2012.LE GCGAACTTCAGTCCAGGTCAACGTCCCT-TGTTTAGGCATAGGACCCGTGTCT

ap2013.LE TCCCACAGAATGTTGTAGAGTTCAATTTTA-GGCATAGGACCCGTGTCT

ap2014.LE AAAACAACAATATCTTTTTGAACAATATATT-TAGGCATAGGACCCGTGTCT

ap2015.BL TCAAAGTTTTCACTGGAGACAAGTTT

ap2016.BL AAAGGTACTTTCAGATTTAATGGTGATCA

ap2017.BL CTGGCCCAGTATGAAGGAAATCTCAGTATTTTT

ap2018.BL TCTGCAGTGACTTCGTCAAATTC

ap2019.BL ATGGTGCTCTTGACTTTCCTGTCA

ap2020.BL AAGTGACGCCTTTCATGAC

A schematic illustrating the design of the aP2 oligonucleotide probes is shown in Fig. 2Go. The GAPDH probes designed and validated by Chiron Diagnositics are shown below:

H.GAPDH.118.26.L AATTTGCCATGGGTGGAATCATATT-GQTTTQAGGCATAGGACCCGTGTCT

H.GAPDH.144.20.L CAGCCTTGACGGTGCCATGGQTT-TQAGGCATAGGACCCGTGTCT

H.GAPDH.164.22.L TTGATGACAAGCTTCCCGTTCTQTT-TQAGGCATAGGACCCGTGTCT

H.GAPDH.186.21.L AAGATGGTGATGGGTTTACCAQTT-TQAGGCATAGGACCCGTGTCT

H.GAPDH.229.20.L CCAGCATCGCCCCACTTGATQTT-TQAGGCATAGGACCCGTGTCT

H.GAPDH.249.25.L AGTGGACTCCACGACGTACTCAG-CGQTTTQAGGCATAGGACCCGTGTCT

RH.GAPDH.274.22.L TCTCCATGGTGGTGAAGACGC-CQTTTQAGGCATAGGACCCGTGTCT

H.GAPDH.375.23.C CATACTTCTCATGGTTCACACCC-QTTTQCTCTTGGAAAGAAAGT

H.GAPDH.398.26.C ATTGCTGATGATCTTGAGGCTGTT-GTQTTTQCTCTTGGAAAGAAAGT

H.GAPDH.71.21.C CAATGAAGGGGTCATTGATGGQTT-TQCTCTTGGAAAGAAAGT

H.GAPDH.92.26.C GAACATGTAAACCATGTAGTTGAG-GTQTTTQCTCTTGGAAAGAAAGT

H.GAPDH.207.22.B TTTGGAGGGATCTCGCTCCTGG

Treatment of db/db Mice
For determination of aP2 expression in bone marrow, db/db mice (8- to 10-week-old females; C57Bl/KFJ; Jackson Laboratories, Bar Harbor ME) were dosed by oral gavage once a day for five consecutive days with either vehicle (0.5% carboxymethylcellulose) or 30 mg/kg BRL-49653. The bone marrow was aspirated from the femur and tibia of one leg of each mouse and collected in RPMI 1640 media. The cells were diluted to 0.4 ml with media and evenly distributed into 4 wells of a 96-well plate. After allowing the cells to adhere for 2 h, the wells were washed twice with medium, and adherent cells were lysed as described above. aP2 was assessed using the bDNA assay using GAPDH levels to control for variance in tissue preparation.


    FOOTNOTES
 
Address requests for reprints to: Dr. Thomas P. Burris, Drug Discovery, RWJPRI, 1000 Route 202 South, Raritan, New Jersey 08869. E-mail: tburris{at}prius.jnj.com

Received for publication September 1, 1998. Revision received October 28, 1998. Accepted for publication November 19, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Schoonjans K, Martin G, Staels B, Auwerx J 1997 Peroxisome proliferator-activated receptors, orphans with ligands and functions. Curr Opin Lipidol 8:159–166[Medline]
  2. Spiegelman BM 1998 PPAR{gamma}: Adipogenic regulator and thiazolidinedione receptor. Diabetes 47:507–514[Abstract]
  3. Brun RP, Kim JB, Hu E, Spiegelman BM 1997 Peroxisome proliferator-activated receptor gamma and the control of adipogenesis. Curr Opin Lipidol 8:212–218[Medline]
  4. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma}. J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  5. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM 1996 The structure-activity relationship between peroxisome proliferator-activated receptor {gamma} agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665–668[CrossRef][Medline]
  6. Forman BM, Tontonoz P, Chen J, Brun RP, Speigelman BM, Evans RM 1995 15-deoxy-{Delta}12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 83:803–812[CrossRef][Medline]
  7. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM 1995 A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor {gamma} and promotes adipocyte differentiation. Cell 83:813–819[CrossRef][Medline]
  8. Nagy L, Tontonoz P, Alvarez JGA, Chen H, Evans RM 1998 Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR{gamma}. Cell 93:229–240[CrossRef][Medline]
  9. Tontonoz P, Nagy L, Alvarez JGA, Thomazy VA, Evans RM 1998 PPAR{gamma} promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
  10. Staels B, Auwerx J 1997 Role of PPAR in the pharmacological regulation of lipoprotein metabolism by fibrates and thiazolidinediones. Curr Pharm Res 3:1–14
  11. Jiang C, Ting AT, Seed B 1998 PPAR{gamma} agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82–86[CrossRef][Medline]
  12. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK 1998 The peroxisome proliferator-activated receptor {gamma} is a negative regulator of macrophage activation. Nature 391:79–82[CrossRef][Medline]
  13. Davis GL, Lau JY, Urdea MS, Neuwald PD, Wilber JC, Lindsay K, Perrillo RP, Albrecht J 1994 Quantitative detection of hepatitis C virus RNA with a solid-phase signal amplification method: definition of optimal conditions for specimen collection and clinical application in interferon-treated patients. Hepatology 19:1337–1341[CrossRef][Medline]
  14. Detmer J, Lagier R, Flynn J, Zayati C, Kolberg J, Collins M, Urdea M, Sanchez-Pescador R 1996 Accurate quantification of HCV RNA from all HCV genotypes using branched DNA (bDNA) technology. J Clin Microbiol 34:901–907[Abstract]
  15. Hendricks DA, Stowe BS, Hoo BS, Kolberg J, Irvine BS, Neuwald PD, Urdea MS, Perillo RP 1995 Quantitation of HBV DNA in human serum using a branched DNA (bDNA) signal amplification assay. Am J Clin Pathol 104:537–546[Medline]
  16. Pachl C, Todd JA, Kern DG, Sheridan PJ, Fong S-F, Stempien M, Hoo B, Besemer D, Yeghiazarian T, Irvine B, Kolberg J, Kokka R, Neuwald P, Urdea MS 1995 Rapid and precise quantification of HIV-1 RNA in plasma using branched DNA (bDNA) signal amplification assay. J Acquir Immune Defic Syndr Hum Retrovirol 8:446–454[Medline]
  17. Zhou L, Otulakowski G, Lau YC 1997 Use of quantitative PCR as a sensitive method to study retinoid binding protein expression in human skin. Methods Enzymol 282:64–76[Medline]
  18. Zhou L, Ritchie D, Wang EY, Barbone AG, Argentieri D, Lau C 1994 Tepoxalin: a novel immunosuppressive agent with a different mechanism of action from cyclosporin A. J Immunol 151:6166–6174[Abstract]
  19. Kazmi SM, Plane RK, Visconti V, Taylor GR, Zhou L, Lau CY 1995 Suppression of NFkB activation and NfkB-dependent gene expression by Tepoxalin, a dual inhibitor of cylooxygenase and 5-lipoxygenase. J Cell Biochem 57:299–310[CrossRef][Medline]
  20. Adams M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, Digby JE, Sewter CP, Lazar MA, Chatterjee VKK, O’rahilly S 1997 Activators of peroxisome proliferator-activated receptor {gamma} have depot-specific effects on human preadipocyte differentiation. J Clin Invest 100:3149–3153[Medline]
  21. Gimble JM, Robinson CE, Wu X, Kelly KA, Rodriguez BR, Kliewer SA, Lehmann JM, Morris DC 1996 Peroxisome proliferator-activated receptor {gamma} activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:1087–1094[Abstract]
  22. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  23. Kliewer, Umensono K, Noonan DJ, Heyman RA, Evans RA 1992 Convergence of 9-cis retinoic acid and peroxisome proliferator signaling pathways through heterodimer formation of their receptors. Nature 358:771–774[CrossRef][Medline]
  24. Tontonoz P, Singer S, Forman BM, Sarrag P, Fletcher JA, Fletcher CD, Brun RP, Mueller E, Alotiok S, Oppenheim H, Evans RM, Spiegelman BM 1997 Terminal differenation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor g and the retinoid X receptor. Proc Natl Acad Sci USA 94:237–241[Abstract/Free Full Text]
  25. Mukherjee R, Davies PJA, Cromble DL, Bischoff ED, Cesario RM, Jow L, Hamann LG, Boehm MF, Mondon CE, Nadzan AM, Paterniti JR, Heyman RA 1997 Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature 386:407–410[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
T. P. Burris, C. Montrose, K. A. Houck, H. E. Osborne, W. P. Bocchinfuso, B. C. Yaden, C. C. Cheng, R. W. Zink, R. J. Barr, C. D. Hepler, et al.
The Hypolipidemic Natural Product Guggulsterone Is a Promiscuous Steroid Receptor Ligand
Mol. Pharmacol., March 1, 2005; 67(3): 948 - 954.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. D. Tchoukalova, M. G. Sarr, and M. D. Jensen
Measuring committed preadipocytes in human adipose tissue from severely obese patients by using adipocyte fatty acid binding protein
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1132 - R1140.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Z. He, T. Jiang, Z. Wang, M. Levi, and J. Li
Modulation of carbohydrate response element-binding protein gene expression in 3T3-L1 adipocytes and rat adipose tissue
Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E424 - E430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Cao, Y. Liang, C. L. Broderick, B. A. Oldham, T. P. Beyer, R. J. Schmidt, Y. Zhang, K. R. Stayrook, C. Suen, K. A. Otto, et al.
Antidiabetic Action of a Liver X Receptor Agonist Mediated By Inhibition of Hepatic Gluconeogenesis
J. Biol. Chem., January 3, 2003; 278(2): 1131 - 1136.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
A. N. Player, L.-P. Shen, D. Kenny, V. P. Antao, and J. A. Kolberg
Single-copy Gene Detection Using Branched DNA (bDNA) In Situ Hybridization
J. Histochem. Cytochem., May 1, 2001; 49(5): 603 - 612.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Gurnell, J. M. Wentworth, M. Agostini, M. Adams, T. N. Collingwood, C. Provenzano, P. O. Browne, O. Rajanayagam, T. P. Burris, J. W. Schwabe, et al.
A Dominant-negative Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) Mutant Is a Constitutive Repressor and Inhibits PPARgamma -mediated Adipogenesis
J. Biol. Chem., February 25, 2000; 275(8): 5754 - 5759.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burris, T. P.
Right arrow Articles by Demarest, K. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burris, T. P.
Right arrow Articles by Demarest, K. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals