| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Agonist Actions on aP2 Gene Expression Detected Using Branched DNA Messenger RNA Quantitation
Endocrine Therapeutics Department of Drug Discovery The R.W. Johnson Pharmaceutical Research Institute Raritan, New Jersey 08869
| ABSTRACT |
|---|
|
|
|---|
(PPAR
), a member of the nuclear hormone receptor
superfamily, plays an essential role in the mediation of the actions of
antidiabetic drugs known as thiazolidinediones (TZDs). PPAR
activates many target genes involved in lipid anabolism including the
adipocyte fatty acid binding protein (aP2). In this study, induction of
aP2 gene expression by PPAR
agonists was examined in both cultured
cells and diabetic mice using branched DNA (bDNA)-mediated mRNA
quantitation. bDNA technology allows for the direct measurement of a
particular mRNA directly within cellular lysate using a 96-well plate
format in a time frame comparable to a reporter gene assay. In cultured
human subcutaneous preadipocytes, the TZDs, troglitazone and BRL-49653,
both rapidly induced aP2 mRNA as detected with the bDNA method. In
these cells, the effect of BRL-49653 on aP2 mRNA levels was detectable
as early as 30 min after treatment (47% increase) and was maximal
after 24 h of treatment (12-fold increase). The effects of
troglitazone on aP2 mRNA induction were similar to those of BRL-49653
except that the maximal level of induction was consistently lower
(e.g. 24 h treatment = 4-fold increase).
Dose-response relationships for both of the TZDs were also determined
using the 24-h treatment time point. EC50s for
both BRL-49653 and troglitazone were estimated to be 80
nM and 690 nM,
respectively. A natural PPAR
ligand,
15-deoxy-
12,14-PGJ2,
was also active in this assay with a maximal induction of aP2 mRNA of
approximately 5-fold when tested at 1 µM.
Since the PPAR
:retinoid X receptor (RXR) heterodimer has been
characterized as a permissive heterodimer with respect to RXR ligands,
the ability of 9-cis-retinoic acid (9-cis-RA)
to induce aP2 mRNA was examined. Although 9-cis-RA had very
low efficacy (2-fold induction), the maximal effect was reached at 100
nM. No synergism or additivity in aP2 mRNA
induction was detected when 9-cis-RA was included with
either of the TZDs used in this study. Significant induction of aP2
mRNA in bone marrow of db/db mice treated with either
troglitazone or BRL-49653 was also detected, indicating that the bDNA
assay may be a simple method to monitor nuclear receptor target gene
induction in vivo. | INTRODUCTION |
|---|
|
|
|---|
(PPAR
) is a
member of the nuclear hormone receptor superfamily that has been
demonstrated to play an essential role in the mediation of the actions
of antidiabetic drugs known as thiazolidinediones (TZDs) (1, 2, 3). TZDs
have been demonstrated to bind directly to PPAR
with high affinity,
causing activation of target genes (1, 2, 3). These compounds were first
demonstrated to be specific PPAR
ligands by Lehmann et
al. with affinities [dissociation constants (Kds)]
ranging from the relatively weak ciglitazone (>1 µM) to
the potent BRL-49653 (40 nM) (4). It was later shown that
there was a direct correlation between the affinity of the various TZDs
for PPAR
and their relative antihyperglycemic effect in
vivo (5).
Endogenous PPAR
ligands have also been identified such as
15-deoxy-
12,14-PGJ2 (15d-PGJ2)
(6, 7) and 9- and 13-hydroxyoctadecadienoic acid (HODE) (8). Although
the physiological role of 15d-PGJ2 as a PPAR
agonist is
unclear, 15d-PGJ2 has been characterized as efficacious in
both transcriptional reporter and adipocyte differentiation assays,
although the potency is relatively low (Kd > 1
µM) (6, 7). 9- and 13-HODE are also relatively low
potency ligands for PPAR
(Kd > 1 µM) and
are active in reporter assays (8). It has been suggested that 9- and
13-HODE, components of oxidized low-density lipoprotein, may
play a role in the PPAR
-mediated differentiation of macrophages to
foam cells (8, 9).
Activation of PPAR
leads to increased expression of many target
genes involved in lipid anabolism and energy balance such as the
adipocyte fatty acid binding protein (aP2), acyl-CoA oxidase,
lipoprotein lipase, and acyl-CoA synthase (1, 2, 3, 10). Recently, with
the description of a role of PPAR
in the monocyte, a new class of
responsive genes has been identified, e.g. CD14, CD36, and
SR-A, which function in the differentiation of these cells to foam
cells (8, 9) and inducible nitric oxide synthase, gelatinase B,
and tumor necrosis factor-
, which function in the regulation of the
inflammatory response (11, 12).
Analysis of the response of various target genes, such as those
described above, in response to ligands for nuclear receptors has been
limited by the techniques with which the induction of the gene of
interest is detected. Typically, Northern analysis, RT-PCR, or
ribonuclease (RNAse) protection is used to detect changes in expression
of nuclear receptor target genes. However, if the effects of multiple
ligands and doses of these ligands are to be analyzed, these classic
molecular biology methods are cumbersome. The transcriptional reporter
assay has solved the problem concerning the level of throughput
required for these types of studies, but in many cases it may be
advantageous or more appropriate to examine the expression of an
authentic target gene with its entire natural regulatory sequences
instead of a reporter in a heterologous system. To address this, we
have developed a method to quantitate a nuclear receptor target in a
96-well format. This method utilizes branched DNA (bDNA) amplification
technology that was originally developed for clinical detection of
viral DNA and RNA (13, 14, 15, 16). The method is as simple to perform as a
transcriptional reporter assay and is completed in the same time frame.
In this study, we used the bDNA assay to monitor the level of induction
of the PPAR
target gene, aP2, after treatment of various cell types
with a variety of agonists. We also demonstrate that this assay
provides a simple method for detecting the actions of nuclear receptor
ligands on target genes in vivo.
| RESULTS |
|---|
|
|
|---|
|
target gene aP2.
ProbeDesigner (Chiron Diagnostics, Emeryville, CA) software was
used to design the probe set for detection of the human aP2 mRNA.
Figure 2
|
Agonists Measured with bDNA
Technology
|
agonists (data
not shown).
|
12,14-PGJ2 (15d-PGJ2)
was quite active with efficacy similar to the thiazolidinediones (Fig. 5
agonists on aP2 gene expression in human omental
preadipocytes were also examined. As shown in Fig. 6
|
|
|
|
Action in Vivo with the bDNA
Assay
agonist actions (21), was selected as the tissue to examine
because of the low basal levels of aP2 expression and the ease of
sample collection. Relative levels of aP2 expression were normalized to
the expression of GAPDH to control for variability during the
preparation of the tissue. As shown in Fig. 7
|
| DISCUSSION |
|---|
|
|
|---|
and aP2 as a model nuclear receptor and target gene,
respectively, we demonstrated that the bDNA assay can be effectively
used to monitor nuclear receptor-mediated alterations in gene
expression. The bDNA assay is simple to perform and is completed along
the same time frame as a transcriptional reporter assay. The assay is
easily adapted to different cell types including tissue directly from
an animal source. With the availability of software to aid in the
design of the oligonucleotide probes, the assay is also adaptable to
virtually any gene of interest.
The results of the bDNA-mediated aP2 induction assay were consistent
with other assays that examine the activity of PPAR
. BRL-49653 and
troglitazone had EC50s for induction of aP2 that correlated
well with published values for their affinities for PPAR
and
EC50s in the transcriptional reporter assay (4, 6, 7). The
time frame of induction of aP2 was also similar to previous values
obtained by Northern analysis (21, 22). Our studies with the RAR/RXR
agonist, 9-cis-retinoic acid, confirm that the PPAR
/RXR
heterodimer is permissive (23); however, our data indicate that, at
least in terms of aP2 gene induction, activation of RXR does not yield
the same degree of efficacy as activation of PPAR
, and the RXR
ligand does not function additively or synergistically with a PPAR
ligand. Previously, it was demonstrated that RXR ligands may act
additively (24) or synergistically (25) with PPAR
ligands, although
this does not appear to be the case for induction of aP2 expression in
preadipocytes. Mukherjee et al. (25) found that the RXR
ligand, LGD 100268, is as efficacious in the activation of the
PPAR
/RXR heterodimer as a PPAR
ligand in reporter assays. These
investigators also showed that PPAR
and RXR ligands synergistically
activated reporter gene transcription. Similar results were obtained in
diabetic rodent models using plasma glucose and glucose tolerance tests
as endpoints (25). The reason for this discrepancy is not clear, but
may arise from the fact that we are monitoring the expression of a
single PPAR
target gene under the regulation of its natural
promoter; thus, complex regulation within the aP2 promoter may preclude
RXR ligands from functioning, as previously described at the DR1
element (25). The fact that RXR ligands have a much greater effect on
insulin sensitivity in vivo than on aP2 gene expression
in vitro may be ascribed to the notion that activation of
many PPAR
target genes is required to increase insulin sensitivity
by RXR ligands, and aP2 is not one of these. Alternatively, the
differences in the ligands used (9-cis-retinoic acid
vs. LG 100268) in these studies may account for the
discrepancies.
In this study, using the bDNA assay, we also examined the ability of the TZDs to induce aP2 gene expression in vivo. Previously, it was demonstrated that TZDs induce adipocyte differentiation in bone marrow (21). Since bone marrow is a relatively accessible source of tissue and has low basal levels of aP2 expression, we examined the effects of troglitazone and BRL-49653 on the expression of aP2 in this tissue. We found that treatment of db/db mice with either of these TZDs induced significant (3.2- to 3.8-fold induction) aP2 expression. This assay is extremely efficient at detecting induction of genes in vivo, as we could evaluate the results of the assay within 16 h after harvesting tissue with no RNA purification required.
In summary, we have adapted a novel assay, originally developed for detection of viral nucleic acids, for use to detect activation of nuclear receptor target genes. This method is advantageous in that one can quickly and simply assay the relative effects of a ligand on target genes within target tissues. We believe this assay will complement the transcriptional reporter assay. Whereas the reporter assay has its strengths in the area of investigation of the mechanistics and specificity of nuclear receptor function, the bDNA assay focuses on the physiological relevance of receptor activation in both cell culture and animals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
agonists on the day the cells were received from
Zen-Bio. DMEM/F-12 medium containing the agonists was added to the
cells after removal of the preadipocyte media. The media remained on
the cells for various amounts of time (0.5 h48 h) depending on the
experiment. At the termination of the challenge, medium was removed and
100 µl of lysis buffer were added as described below.
Quantitative RT-PCR
Human subcutaneous preadipocytes were induced with
differentiation medium (see Cell Culture), and the cells
were harvested for RNA purification after 3 and 24 h. Total RNA
was prepared using the protocol of guanidinium/acid-phenol extraction
(17). The method for RT and QPCR has been described previously
(17, 18, 19). Briefly, total RNA was mixed with nuclease-free water to a
final volume of 7 µl, heated at 65 C for 5 min, and chilled on ice.
Aliquoted RT mixture was added into individual tubes bringing the final
volume to 20 µl. Each RT reaction contained 1.5 µM
oligodT12-18, 0.5 mM deoxynucleoside
triphosphate), 1 U of RNase inhibitor, 10 µM
dithiothreitol, 1 x RT buffer (GIBCO BRL, Gaithersburg, MD) and
100 U of M-MLV (GIBCO BRL). The reaction was incubated at 37 C for
1 h, heated at 85 C for 4 min, and chilled on ice. For QPCR, a 1:3
dilution of internal control for aP2 was added into a series of PCR
reaction tubes containing equal volumes of RT reaction mixture (1
µl/50 ng total RNA). The PCR reaction contained 0.4 µM
of corresponding primers specific for aP2 cDNA (5'-TGAAA GAAGT AGGAG
TGGGC, 5'-CTTCA GTCCA GGTCA ACGTC), 50 µM deoxynucleoside
triphosphate, 1 x PCR buffer and 2.5 U of Taq
polymerase (Perkin-Elmer, Norwalk, CT) in a final volume of 50 µl.
The amplification conditions for PCR were detailed previously (23). The
internal standard of aP2 was the corresponding aP2 cDNA fragment with
90-bp deletion (from 134213 bp of the coding sequence) engineered by
PCR method. The authenticity of the internal control DNA was confirmed
by DNA sequencing. Fifteen microliters of PCR product were loaded onto
a 6% Tris-borate-EDTA acrylamide gel and subjected to
electrophoresis. After staining with ethidium bromide, the gel was
photographed, and the intensity of the DNA bands was quantified by a
computerized camera and computer analysis system (Bio-Rad Gel Docu
1000; Bio-Rad Laboratories, Richmond, CA). The ratio of the integrated
DNA bands was plotted out on a log-log scale against the amount of
internal standard present in the PCR reactions. The amount of aP2 cDNA
before the PCR was determined from the plot (17).
bDNA Assay
The bDNA assay was performed according to the manufacturers
protocol (Chiron Diagnostics; Emeryville, CA). Briefly, after the
challenge of the preadipocytes, cells were lysed with lysis buffer
(provided by Chiron Diagnostics) containing the aP2 oligonucleotides
(described below). After a 15-min incubation, 80 µl of the lysis
buffer from each well were added to a corresponding capture well
(preincubated with 100 µl of blocking buffer (provided by Chiron
Diagnostics). The capture plate was incubated overnight at 53 C in a
plate incubator (Chiron Diagnostics). After this incubation, the bDNA
and label probes were annealed as directed by the manufacturer. After a
30-min incubation with the luminescent alkaline phosphatase substrate,
dioxitane, the luminescence was quantitated in a Dynex MLX microtiter
plate luminometer. A summary of the procedure is provided in Fig. 1
aP2 Probe Design
Oligonucleotide probes were designed to anneal to the aP2 mRNA
and function in the bDNA mRNA detection system were designed with
ProbeDesigner software (Chiron Diagnostics). This software package
analyzes a target sequence of interest with a series of algorithms to
determine which regions of the sequence can perform as locations for
capture, label, or spacer probe annealing. The sequence of the
oligonucleotides is summarized below:
ap2001.CE CATTTTGTGAGTTTTCTAGGATTATTCTTT-TCTCTTGGAAAGAAAGT
ap2002.CE ATGTTAGGTTTGGCCATGCCTTTCTCTTGGAAAGAAAGT
ap2003.CE CCTCTCGTTTTCTCTTTATGGTTTTCTCTTGGAAAGAAAGT
ap2004.CE GCTTATGCTCTCTCATAAACTCTCGTGGT-TTCTCTTGGAAAGAAAGT
ap2005.LE CCAGGTACCTACAAAAGCATCACATTTAGG-CATAGGACCCGTGTCT
ap2006.LE GCCCACTCCTACTTCTTTCATATAATCATT-TAGGCATAGGACCCGTGTCT
ap2007.LE AGCCACTTTCCTGGTGGCAAATTTAGGCAT-AGGACCCGTGTCT
ap2008.LE CATCCCCATTCACACTGATGATCTTTAGGC-ATAGGACCCGTGTCT
ap2009.LE GTACCAGGACACCCCCATCTAAGGTTTTTA-GGCATAGGACCCGTGTCT
ap2010.LE GGTTGATTTTCCATCCCATTTCTGCACATT-TTAGGCATAGGACCCGTGTCT
ap2011.LE GCATTCCACCACCAGTTTATCATTTTAGGC-ATAGGACCCGTGTCT
ap2012.LE GCGAACTTCAGTCCAGGTCAACGTCCCT-TGTTTAGGCATAGGACCCGTGTCT
ap2013.LE TCCCACAGAATGTTGTAGAGTTCAATTTTA-GGCATAGGACCCGTGTCT
ap2014.LE AAAACAACAATATCTTTTTGAACAATATATT-TAGGCATAGGACCCGTGTCT
ap2015.BL TCAAAGTTTTCACTGGAGACAAGTTT
ap2016.BL AAAGGTACTTTCAGATTTAATGGTGATCA
ap2017.BL CTGGCCCAGTATGAAGGAAATCTCAGTATTTTT
ap2018.BL TCTGCAGTGACTTCGTCAAATTC
ap2019.BL ATGGTGCTCTTGACTTTCCTGTCA
ap2020.BL AAGTGACGCCTTTCATGAC
A schematic illustrating the design of the aP2 oligonucleotide probes
is shown in Fig. 2
. The GAPDH probes designed and validated by Chiron
Diagnositics are shown below:
H.GAPDH.118.26.L AATTTGCCATGGGTGGAATCATATT-GQTTTQAGGCATAGGACCCGTGTCT
H.GAPDH.144.20.L CAGCCTTGACGGTGCCATGGQTT-TQAGGCATAGGACCCGTGTCT
H.GAPDH.164.22.L TTGATGACAAGCTTCCCGTTCTQTT-TQAGGCATAGGACCCGTGTCT
H.GAPDH.186.21.L AAGATGGTGATGGGTTTACCAQTT-TQAGGCATAGGACCCGTGTCT
H.GAPDH.229.20.L CCAGCATCGCCCCACTTGATQTT-TQAGGCATAGGACCCGTGTCT
H.GAPDH.249.25.L AGTGGACTCCACGACGTACTCAG-CGQTTTQAGGCATAGGACCCGTGTCT
RH.GAPDH.274.22.L TCTCCATGGTGGTGAAGACGC-CQTTTQAGGCATAGGACCCGTGTCT
H.GAPDH.375.23.C CATACTTCTCATGGTTCACACCC-QTTTQCTCTTGGAAAGAAAGT
H.GAPDH.398.26.C ATTGCTGATGATCTTGAGGCTGTT-GTQTTTQCTCTTGGAAAGAAAGT
H.GAPDH.71.21.C CAATGAAGGGGTCATTGATGGQTT-TQCTCTTGGAAAGAAAGT
H.GAPDH.92.26.C GAACATGTAAACCATGTAGTTGAG-GTQTTTQCTCTTGGAAAGAAAGT
H.GAPDH.207.22.B TTTGGAGGGATCTCGCTCCTGG
Treatment of db/db Mice
For determination of aP2 expression in bone marrow,
db/db mice (8- to 10-week-old females; C57Bl/KFJ; Jackson
Laboratories, Bar Harbor ME) were dosed by oral gavage once a day for
five consecutive days with either vehicle (0.5%
carboxymethylcellulose) or 30 mg/kg BRL-49653. The bone marrow was
aspirated from the femur and tibia of one leg of each mouse and
collected in RPMI 1640 media. The cells were diluted to 0.4 ml with
media and evenly distributed into 4 wells of a 96-well plate. After
allowing the cells to adhere for 2 h, the wells were washed twice
with medium, and adherent cells were lysed as described above. aP2 was
assessed using the bDNA assay using GAPDH levels to control for
variance in tissue preparation.
| FOOTNOTES |
|---|
Received for publication September 1, 1998. Revision received October 28, 1998. Accepted for publication November 19, 1998.
| REFERENCES |
|---|
|
|
|---|
: Adipogenic regulator and
thiazolidinedione receptor. Diabetes 47:507514[Abstract]
.
J Biol Chem 270:1295312956
agonism and the antihyperglycemic
activity of thiazolidinediones. J Med Chem 39:665668[CrossRef][Medline]
12,14-prostaglandin J2 is a ligand for
the adipocyte determination factor PPAR gamma. Cell 83:803812[CrossRef][Medline]
and promotes adipocyte
differentiation. Cell 83:813819[CrossRef][Medline]
. Cell 93:229240[CrossRef][Medline]
promotes monocyte/macrophage differentiation and uptake of
oxidized LDL. Cell 93:241252[CrossRef][Medline]
agonists inhibit
production of monocyte inflammatory cytokines. Nature 391:8286[CrossRef][Medline]
is a negative regulator
of macrophage activation. Nature 391:7982[CrossRef][Medline]
have
depot-specific effects on human preadipocyte differentiation. J
Clin Invest 100:31493153[Medline]
activation by thiazolidinediones induces adipogenesis in
bone marrow stromal cells. Mol Pharmacol 50:10871094[Abstract]
2, a lipid-activated
transcription factor. Cell 79:11471156[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. P. Burris, C. Montrose, K. A. Houck, H. E. Osborne, W. P. Bocchinfuso, B. C. Yaden, C. C. Cheng, R. W. Zink, R. J. Barr, C. D. Hepler, et al. The Hypolipidemic Natural Product Guggulsterone Is a Promiscuous Steroid Receptor Ligand Mol. Pharmacol., March 1, 2005; 67(3): 948 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. D. Tchoukalova, M. G. Sarr, and M. D. Jensen Measuring committed preadipocytes in human adipose tissue from severely obese patients by using adipocyte fatty acid binding protein Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1132 - R1140. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. He, T. Jiang, Z. Wang, M. Levi, and J. Li Modulation of carbohydrate response element-binding protein gene expression in 3T3-L1 adipocytes and rat adipose tissue Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E424 - E430. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cao, Y. Liang, C. L. Broderick, B. A. Oldham, T. P. Beyer, R. J. Schmidt, Y. Zhang, K. R. Stayrook, C. Suen, K. A. Otto, et al. Antidiabetic Action of a Liver X Receptor Agonist Mediated By Inhibition of Hepatic Gluconeogenesis J. Biol. Chem., January 3, 2003; 278(2): 1131 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Player, L.-P. Shen, D. Kenny, V. P. Antao, and J. A. Kolberg Single-copy Gene Detection Using Branched DNA (bDNA) In Situ Hybridization J. Histochem. Cytochem., May 1, 2001; 49(5): 603 - 612. [Abstract] [Full Text] |
||||
![]() |
M. Gurnell, J. M. Wentworth, M. Agostini, M. Adams, T. N. Collingwood, C. Provenzano, P. O. Browne, O. Rajanayagam, T. P. Burris, J. W. Schwabe, et al. A Dominant-negative Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) Mutant Is a Constitutive Repressor and Inhibits PPARgamma -mediated Adipogenesis J. Biol. Chem., February 25, 2000; 275(8): 5754 - 5759. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |