help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zou, A.
Right arrow Articles by Allegretto, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zou, A.
Right arrow Articles by Allegretto, E. A.
Molecular Endocrinology 13 (3): 418-430
Copyright © 1999 by The Endocrine Society

Estrogen Receptor ß Activates the Human Retinoic Acid Receptor {alpha}-1 Promoter in Response to Tamoxifen and Other Estrogen Receptor Antagonists, but Not in Response to Estrogen

Aihua Zou, Keith B. Marschke, Katharine E. Arnold, Elaine M. Berger, Patrick Fitzgerald, Dale E. Mais and Elizabeth A. Allegretto

Departments of Retinoid Research (A.Z., P.F., E.A.A.), New Leads Discovery (K.B.M., K.E.A.), and Endocrine Research (E.M.B., D.E.M.) Ligand Pharmaceuticals, Inc. San Diego, California 92121


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Human estrogen receptor-{alpha} (hER{alpha}) or -ß (hERß) transfected into Hep G2 or COS1 cells each responded to estrogen to increase transcription from an estrogen-responsive element (ERE)-driven reporter vector with similar fold induction through a classical mechanism involving direct receptor binding to DNA. ER antagonists inhibited this estrogen induction through both hER{alpha} and hERß, although raloxifene was more potent through ER{alpha} than ERß, and tamoxifen was more potent via ERß than ER{alpha}. We have shown previously that estrogen stimulated the human retinoic acid receptor-{alpha}-1 (hRAR{alpha}-1) promoter through nonclassical EREs by a mechanism that was ER{alpha} dependent, but that did not involve direct receptor binding to DNA. We show here that in contrast to hER{alpha}, hERß did not induce reporter activity driven by the hRAR{alpha}-1 promoter in the presence of estrogen. While hERß did not confer estrogen responsiveness on this promoter, it did elicit transcriptional activation in the presence of 4-hydroxytamoxifen (4-OH-Tam). Additionally, this 4-OH-Tam agonist activity via ERß was completely blocked by estrogen. Like ER{alpha}, transcriptional activation of this promoter by ERß was not mediated by direct receptor binding to DNA. While hER{alpha} was shown to act through two estrogen-responsive sequences within the promoter, hERß acted only at the 3'-region, through two Sp1 sites, in response to 4-OH-Tam. Other ER antagonists including raloxifene, ICI-164,384 and ICI-182,780 also acted as agonists through ERß via the hRAR{alpha}-1 promoter. Through the use of mutant and chimeric receptors, it was shown that the 4-OH-Tam activity via ERß from the hRAR{alpha}-1 promoter in Hep G2 cells required the amino-terminal region of ERß, a region that was not necessary for estrogen-induced ERß activity from an ERE in Hep G2 cells. Additionally, the progesterone receptor (PR) antagonist RU486 acted as a weak (IC50 >1 µM) antagonist via hER{alpha} and as a fairly potent (IC50 ~200 nM) antagonist via hERß from an ERE-driven reporter in cells that do not express PR. Although RU486 bound only weakly to ER{alpha} or ERß in vitro, it did bind to ERß in whole-cell binding assays, and therefore, it is likely metabolized to an ERß-interacting compound in the cell. Interestingly, RU486 acted as an agonist through ERß to stimulate the hRAR{alpha}-1 promoter in Hep G2 cells. These findings may have ramifications in breast cancer treatment regimens utilizing tamoxifen or other ER antagonists and may explain some of the known estrogenic or antiestrogenic biological actions of RU486.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogen has a wide variety of biological effects, including roles in the function and development of reproductive tissues in both males and females and in protection of bone and the cardiovascular system (1, 2, 3, 4). These effects are exerted through binding of estrogen to the estrogen receptor (ER), a nuclear transcription factor of the intracellular receptor superfamily (5, 6). Recently, a second ER has been discovered that has been termed ERß (7, 8) and the previously defined ER is now referred to as ER{alpha}. ERß was initially cloned from rat prostate (7), and the human clone was retrieved from testis (8).

ER{alpha} has been shown to bind to, and activate transcription through, estrogen responsive elements (EREs) within the regulatory regions of target genes. These classically defined EREs are palindromic sequences spaced by 3 bp and have been identified in the regulatory regions of estrogen-induced genes (9, 10). ERß has also been shown to increase the activity of a reporter construct containing an ERE in CHO (7, 8) or COS (11) cell cotransfection-transactivation assays. The classical consensus ERE was originally defined from the Xenopus vitellogenin A2 gene promoter (GGTCANNNTGACC) (9) and is directly bound by ER{alpha}. However, there are several other estrogen-responsive genes that have been discovered that utilize divergent EREs or other transcription factor DNA-binding sites as the target sequences of ER{alpha} action. These genes include those that are regulated by ER{alpha} working through AP-1 or Sp1 bound to their respective DNA-binding sites (12, 13, 14, 17), and others in which ER{alpha} is thought to act through an as yet unidentified protein or proteins (15, 16, 17).

Recently, Paech et al. (18) have shown that while estrogen induced AP-1-driven reporter activity through ER{alpha}, it was inactive through ERß. However, ER antagonists activated ERß to induce transcriptional activity through an AP-1 site, and this stimulation was blocked by estrogen (18). Herein we tested the activity of hERß via a known estrogen target gene whose activation is not mediated by direct receptor binding to DNA, the human retinoic acid receptor-{alpha}-1 (hRAR{alpha}-1) promoter (17). While hER{alpha} efficiently activated transcription from this promoter in Hep G2 cells in response to estrogen, hERß did not. However, 4-hydroxytamoxifen (4-OH-Tam) and other ER antagonists acted as agonists through hERß to drive transcription from the hRAR{alpha}-1 promoter, and this activity was completely antagonized by estrogen. The site of 4-OH-Tam responsiveness through ERß within this promoter was mapped to two Sp1 sites between -79 and -49, a region that has been previously shown to mediate ER{alpha} activity in response to estrogen (17). Full activation of this promoter through ERß by 4-OH-Tam in Hep G2 cells required the amino terminus of ERß, a region that did not seem to play a role in ERß transactivation from an ERE in Hep G2 cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cotransactivation Properties of hER{alpha} and hERß via ERE-{Delta}MTV-LUC
Mammalian expression vectors for hER{alpha} (17, 19) or hERß were cotransfected along with a luciferase reporter vector driven by two copies of a palindromic ERE into Hep G2 cells and treated with estradiol in transactivation assays. Figure 1Go shows that both hER{alpha} (panel A) and hERß (panel B) responded to estradiol in a dose-dependent manner to increase luciferase activity 3- to 4-fold in Hep G2 cells, a cell line that does not endogenously express either ER (Refs. 17, 19 and our data not shown). Antagonist mode assays were performed to test the ability of tamoxifen, 4-OH-Tam, and raloxifene to block the estrogen response via each receptor. In the presence of 10 nM estrogen, a dose-dependent decrease in luciferase activity was observed via hER{alpha} (Fig. 1AGo) with increasing concentrations of raloxifene (IC50 ~3 nM), 4-OH-Tam (IC50 ~21 nM), and tamoxifen (IC50 ~1700 nM). While each compound also antagonized estrogen action via hERß (Fig. 1BGo), the potencies were different (IC50 values: raloxifene, ~55 nM; 4-OH-Tam, ~5 nM; tamoxifen, ~260 nM) than those observed with hER{alpha}. These antagonists did not act as partial agonists on this reporter in Hep G2 cells through hER{alpha} or hERß (data not shown). Interestingly, RU486, a progesterone receptor (PR) antagonist, was shown to have antagonist activity through both hER{alpha} and hERß from this ERE-driven reporter in COS-1 cells (Fig. 2Go), which do not express PR (Ref. 20 and our data not shown). While RU486 was a weak antagonist through ER{alpha} (Fig. 2AGo; IC50 > 1 µM), it was fairly potent through ERß (Fig. 2BGo; IC50 ~200 nM). In contrast, another PR ligand, progesterone, had no effect in this assay (Fig. 2Go), indicating that the inhibition of ER activity by RU486 was not through a PR-mediated mechanism such as has been described previously (21). These effects of RU486 to decrease reporter activity were also not due to cytotoxicity, as ß-galactosidase values did not change with increasing RU486 concentration (data not shown), indicating that cell viability was not affected by the compound.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Estrogen Induces Transactivation from an ERE-Driven Reporter through hER{alpha} or hERß, and ER Antagonists Exhibit Receptor Selectivity in Hep G2 Cell Cotransfection Assays

pRShER{alpha} (A) or pRShERß (B) was cotransfected transiently along with ERE(2 )-{Delta}MTV-LUC into Hep G2 cells, treated with ligands for 30 h, and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). Ligands were added as follows: estradiol from 10-12 to 10-5 M (solid circles) or estradiol held constant at 10 nM in combination with tamoxifen (open squares), 4-OH-Tam (solid triangles), or Raloxifene (open circles) from 10-12 to 10-5 M.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. RU486 Acts as an Antagonist of Estrogen Action from an ERE through ER{alpha} and ERß in Cotransfection Assays

pRShER{alpha} (A) or pRShERß (B) was cotransfected transiently along with ERE(2 )-{Delta}MTV-LUC into COS-1 cells, treated with ligands for 30 h, and then analyzed for luciferase activity that was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). Estradiol was kept constant at 5 nM, and vehicle (solid circles), RU486 (solid squares), progesterone (open squares), or raloxifene (solid triangles) was added from 10-10 to 10-5 M.

 
Ligand-Binding Properties of hERß
Yeast-expressed hER{alpha} and hERß were used in in vitro binding assays to determine their ligand binding characteristics. Saturation binding experiments using tritiated estradiol and subsequent Scatchard analysis for both yeast-expressed receptors yielded equilibrium dissociation constants of estradiol for hER{alpha} and hERß that were essentially identical [dissociation constant (Kd) values, ~0.8–1 nM; data not shown). These values for hERß are in agreement with the values for rat (7, 22) and mouse (11) ERß that have been recently reported. Competition ligand binding assays using tritiated estradiol were employed to determine relative affinities of a variety of compounds for hER{alpha} and hERß. Table 1Go shows the resultant inhibition constant (Ki) values for each receptor with a number of ligands. Of the compounds tested, various ligands showed differential binding between hER{alpha} and hERß. Tamoxifen bound with higher affinity to hERß (Ki = 47 nM) than to hER{alpha} (Ki = 143 nM), while raloxifene displayed a higher affinity for hER{alpha} (Ki = 0.14 nM) than for hERß (Ki = 2.43 nM). These in vitro binding affinities correlate well with the relative potencies of these compounds to antagonize estrogen action via an ERE (Fig. 1Go). RU486, which also showed antagonist activity from an ERE through both ER{alpha} (IC50 > 1 µM, Fig. 2Go) and ERß (IC50 ~200 nM, Fig. 2Go), bound only weakly to either receptor in vitro (Ki > 2000 nM, Table 1Go). One explanation for the observed activity of RU486 through ERß in cell-based assays is that it is metabolized in these cells to a compound that is able to bind to ERß with higher affinity than the parent compound.


View this table:
[in this window]
[in a new window]
 
Table 1. Ki values obtained from competition binding of various compounds with [3H]17ß-estradiol to hER{alpha} and hERß

 
To test this hypothesis, whole-cell binding assays were performed. COS-1 cells were transfected with hER{alpha} or hERß and then incubated with [3H]-17ß-estradiol in the presence and absence of unlabeled raloxifene, RU486, or progesterone. Unlabeled raloxifene competed with [3H]-17ß-estradiol for binding to both ER{alpha} (Fig. 3AGo) and ERß (Fig. 3BGo) to yield IC50 values of 2–10 nM, similar to those achieved in in vitro binding assays utilizing ER{alpha}- and ERß-containing protein extracts. RU486 competed with [3H]-17ß-estradiol for binding to ERß expressed in COS-1 cells (IC50 ~100 nM; Fig. 3BGo) while RU486 binding to ER{alpha} was very weak (IC50 > 3 µM; Fig. 3AGo). Another known ligand for PR, progesterone, did not compete with [3H]-17ß-estradiol for binding to ER{alpha} or ERß in this assay (Fig. 3Go, A and B). Therefore, these data support the hypothesis that RU486 is metabolized in cells into a compound that is able to interact with ERß.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Whole-Cell RU486 Competition Binding Properties of hER{alpha} and hERß

pRShER{alpha} (A) or pRShERß (B) was transfected transiently into COS-1 cells, and then cells were incubated with 2 nM [3H]17ß-estradiol with various concentrations of unlabeled raloxifene (solid triangles), RU486 (solid squares), or progesterone (open squares) for 3 h. Cells were washed and lysed, and bound radioactivity was quantitated.

 
Activation Function Contributions of hER{alpha} and hERß to Stimulate Transcription from an ERE in Hep G2 Cells
hER{alpha} and hERß behaved similarly in cotransactivation assays in Hep G2 cells (Fig. 1Go) and in COS-1 cells (Fig. 2Go and data not shown) with regard to activation by estrogen and antagonism of estrogen action by ER antagonists, with the exception that ligand selectivity differences for the two receptors were noted (Fig. 1Go and Table 1Go). To test whether hER{alpha} and hERß use similar activation functions to stimulate transcription from a consensus ERE, various mutant receptors were constructed (see Fig. 4Go). In addition to the human wild-type (wt) receptors, the previously described hER{alpha}-AF1 and hER{alpha}-AF2 constructs (19) were tested. Also constructed were hERß-AF2, which lacks the amino terminus of hERß, and two chimeric receptors: BAA [ERß amino terminus linked to the DNA-binding domain (DBD) and entire carboxyl-terminal region of ER{alpha}] and ABB (ER{alpha} amino terminus linked to the DBD and entire carboxyl- terminal region of ERß; see Materials and Methods). The mutant hER{alpha} and hERß constructs that were produced to generate the chimeric receptors (see Materials and Methods) were identical to the wt receptors in their response to estrogen and 4-OH-Tam in these cotransfection assays (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. ER Constructs Used in the Study

Dotted regions represent hER{alpha} sequence and hatched regions represent hERß sequence. Numbers below each construct diagram denote amino acid number. Percent sequence identity between wt ER{alpha} and ERß is also shown.

 
In Hep G2 cells, the AF1 function of ER{alpha} is active from an ERE, as evidenced by that fact that hER{alpha}-AF1, the construct that lacks a functional AF2 (see Fig. 4Go) while retaining native ligand-binding affinity (19), conferred approximately 8-fold induction of reporter activity by estrogen while ER{alpha} wt resulted in approximately 10-fold activation (Fig. 5Go). hER{alpha}-AF2 (which lacks the amino-terminal region containing AF1) was also active, but also showed less activity than ER{alpha} wt (~4-fold induction of luciferase activity by estrogen; Fig. 5Go). In contrast, hERß-AF2 exhibited activity comparable to hERß wt, implying that the amino terminus of ERß did not contribute to estrogen induction from an ERE in Hep G2 cells (Fig. 5Go). This lack of participation of the ERß amino terminus was further corroborated by the fact that BAA was no more active than ER{alpha}-AF2 (Fig. 5Go). The ABB construct was also no more active than ERß wt or ERß-AF2, indicating that the amino terminus of ER{alpha}, while active on its own, did not increase the activity of ERß-AF2. This result may imply amino-carboxyl terminal interactions within the ABB protein that prohibit ER{alpha} AF1 factors from binding.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Activation Function Contribution of ER{alpha} and ERß to Stimulate Transcription from an ERE in Response to Estrogen in Hep G2 Cells

pRShER{alpha}, hER{alpha}-AF1, hER{alpha}-AF2, pRShERß, pRShERß-AF2, ABB, or BAA was cotransfected transiently along with ERE(2 )-{Delta}MTV-LUC into Hep G2 cells treated with vehicle or estrogen (dose range from 10-10 to 10-5 M) for 40 h and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). All receptor constructs were expressed at approximately equal levels as determined by ligand binding assays (data not shown). Maximal fold induction (100 nM estrogen vs. vehicle treatment) is shown in the figure for each receptor construct (average of at least five individual experiments per receptor construct).

 
Cotransactivation Properties of hER{alpha} and hERß via the hRAR{alpha} Promoter
While hER{alpha} and hERß showed similar responses to estradiol via an ERE-driven reporter (Fig. 1Go), it was of interest to test their activity from a promoter that did not require direct receptor binding to DNA. The hRAR{alpha} promoter [(-491 to +36)-hRAR{alpha}-pGL2-LUC] has been previously shown to be stimulated by estradiol in the presence of hER{alpha} in Hep G2 cells in a DNA-binding independent fashion (17). Interestingly, estrogen was unable to stimulate transcription from this promoter through ERß in Hep G2 cells (Fig. 6BGo). However, 4-OH-Tam acted as an agonist through ERß from this promoter, and estrogen antagonized the 4-OH-Tam stimulation of reporter activity (Fig. 6BGo). Other ER antagonists tested also were able to stimulate transcription from the hRAR{alpha}-1 promoter through ERß. Raloxifene and the two "pure" ER antagonists, ICI-164,384 and ICI-182,780, elicited 3- to 4-fold induction of reporter activity through ERß from this promoter (Fig. 7AGo). Additionally, RU486, which was an ER antagonist through both ER{alpha} and ERß from an ERE-driven reporter (Fig. 2Go), also acted as an agonist through ERß to stimulate transcription from the hRAR{alpha}-1 promoter (Fig. 7AGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. hER{alpha}, but Not hERß, Drives Transcription from the hRAR{alpha}-1 Promoter in Response to Estrogen

pRShER{alpha} (A) or pRShERß (B) was cotransfected transiently along with (-491 to +36)hRAR{alpha}-1-pGL2-LUC into Hep G2 cells, treated with ligands for 30 h, and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). Ligands were added as follows: estradiol from 10-11 to 10-6 M (solid circles), 4-OH-Tam from 10-11 to 10-6 M (solid squares), estradiol held constant at 5 nM in combination with 4-OH-Tam from 10-11 to 10-6 M (open circles), or 4-OH-Tam held constant at 5 nM with estrogen from 10-11 to 10-6 M (open squares).

 


View larger version (39K):
[in this window]
[in a new window]
 
Figure 7. ER Antagonists Act as Agonists through ERß to Stimulate Transcription from the hRAR{alpha}-1 Promoter at Sp1 Sites

pRShERß (A and B) was transfected transiently along with (-491 to +36)hRAR{alpha}-1-pGL2-LUC (A,B) or RAR{alpha} promoter deletion constructs (B) into Hep G2 cells treated with vehicle (open bars) or 10-9 M (diagonal line-filled bars), 10-8 M (horizontal line-filled bars) or 10-7 M (black bars) of various ligands as indicated for 40 h and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). Sequence of the hRAR{alpha}-1 promoter between -79 and -49 is shown in panel B. Guanidine residues that were mutated to adenines to produce an hRAR{alpha}-1 promoter construct containing mutant Sp1 sites are overlined in panel B.

 
Site of ERß action within the hRAR{alpha}-1 Promoter
To determine the site of ERß activity within the hRAR{alpha} promoter, previously produced hRAR{alpha}-1 promoter deletion constructs (17) were used to test ERß activity in response to 4-OH-Tam in Hep G2 cell cotransfection assays. In contrast to ER{alpha}, which acted through two sites to confer estrogen sensitivity on this promoter (17), ERß action was delineated to just one of these promoter regions. Deletion of the region between -79 and -49 of the hRAR{alpha}-1 promoter eliminated 4-OH-Tam induction of transcriptional activity through ERß (Fig. 7BGo). This region contains two Sp1 sites, which were then mutated to determine whether they were required for the activity of ERß at this promoter. Two point mutations in the distal Sp1 site (-491 to +36 Sp1{Delta}1) or the proximal Sp1 site (-491 to +36 Sp1{Delta}2) of the RAR{alpha} promoter abrogated 4-OH-Tam-stimulated ERß activity, while the double mutant (-491 to +36 Sp1{Delta}1, 2) was unable to confer 4-OH-Tam activity through ERß (Fig. 7BGo). Yeast recombinantly expressed hERß, like hER{alpha} (17), did not bind to the sequence between -79 and -40 in an electrophoretic mobility shift assay and did not form a ternary complex with recombinant Sp1 (Fig. 8AGo) or specifically enhance the binding of suboptimal levels of Sp1 to this sequence (Fig. 8AGo), although both ER{alpha} and ERß were able to bind to a consensus ERE (Fig. 8B).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 8. ERß and ER{alpha} Do Not Form Ternary Complexes with Sp1 on Sp1 Sites within the hRAR{alpha}-1 Promoter

Oligonucleotides from hRAR{alpha}-1 promoter containing sequence between -79 and -40 bp (A) or containing a consensus ERE (B) were radiolabeled and incubated with recombinant Sp1 (Promega) and/or whole-cell protein extracts from insect cells infected without (Sf21-WT) or with hER{alpha} (Sf21-ER{alpha}) or hERß (Sf21-ERß) recombinant virus as denoted in the figure (see Materials and Methods).

 
Activation Function Contributions of ER{alpha} and ERß via the hRAR{alpha} Promoter in Hep G2 Cells
While hER{alpha} and hERß have shown similar activity from an ERE in COS-1 (Ref. 11 , Fig. 2Go, and data not shown) and Hep G2 (Fig. 1Go) cells, the two receptors were much less efficient in activation of the hRAR{alpha}-1 promoter in COS-1 cells than in Hep G2 cells (data not shown). Hep G2 is a cell line that has been shown to be dominant for ER{alpha} AF1 function (19), implying that AF1 function of ER{alpha} is involved in activation of this promoter. We therefore set out to determine which activation function domains of ER{alpha} and ERß were involved in stimulation of transcription from the RAR{alpha} promoter in Hep G2 cells. Surprisingly, in contrast to estrogen activation by ER{alpha} from an ERE, which is mediated both through AF1 and AF2 in Hep G2 cells (Ref. 19 and Fig. 5Go), ER{alpha}-AF1 was inactive in response to estrogen on the RAR{alpha} promoter (Fig. 9AGo). ER{alpha}-AF2 also did not respond to estrogen in this assay (Fig. 9AGo). Both ER{alpha} AF constructs were expressed in these cells at approximately equal levels as ER{alpha} wt, as determined by ligand-binding assays (data not shown). Therefore, both AF1 and AF2 of ER{alpha} are necessary for estrogen induction of transcription from the RAR{alpha} promoter. Like ERß wt, ERß-AF2 did not confer estrogen responsiveness on the RAR{alpha} promoter (Fig. 9BGo). Interestingly, AF1 of ER{alpha} in the context of ERß DBD and ligand-binding domain (LBD) (ABB) resulted in a receptor that responded to estrogen to activate this promoter (Fig. 9BGo). However, the ERß amino terminus did not work in concert with ER{alpha} AF-2 (BAA) in this assay (Fig. 9BGo). Therefore, these results indicate that, for estrogen activation of the hRAR{alpha}-1 promoter in Hep G2 cells, the AF1 of ER{alpha} is necessary, but not sufficient: it must be in the context of the AF2 of either ER{alpha} or ERß to function.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 9. Activation Function Contribution of ER{alpha} and ERß to Stimulate Transcription from the hRAR{alpha}-1 Promoter in Response to Estrogen in Hep G2 Cells

pRShER{alpha} (A), hER{alpha}-AF1 (A), hER{alpha}-AF2 (A), pRShERß (B), pRShERß-AF2 (B), BAA (B), or ABB (B) was cotransfected transiently along with (-491 to +36)hRAR{alpha}-1 -pGL2-LUC into Hep G2 cells treated with vehicle or estrogen (10-10, 10-8, and 10-6 M) for 40 h and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). All receptor constructs were expressed at approximately equal levels as determined by ligand binding assays (data not shown).

 
The involvement of each ER’s AF domains in response to 4-OH-Tam activation was also evaluated via this promoter. ER{alpha} wt is weakly activated by 4-OH-Tam to induce RAR{alpha}-driven reporter activity in Hep G2 cells (Fig. 10AGo). However, ER{alpha}-AF1 and ER{alpha}-AF2 are each inactive on this promoter in response to 4-OH-Tam (Fig. 10AGo). This result is similar to the estrogen activation of ER{alpha} from this promoter (Fig. 9AGo). ERß wt conferred 4-OH-Tam activation on the RAR{alpha} promoter; however, ERß-AF2 was reproducibly and significantly less active than ERß wt (Fig. 10BGo). This result was in contrast to ERß activity from a consensus ERE where ERß-AF2 was just as active as ERß wt (Fig. 5Go). The ABB construct was completely inactive in this assay, indicating that ER{alpha} AF1 was inactive in the context of the AF2 of ERß from this promoter in response to 4-OH-Tam. However, BAA was active in response to 4-OH-Tam (Fig. 10BGo), indicating that the amino terminus of ERß can rescue the inactive ER{alpha}-AF2 (Fig. 10AGo). These data imply that the amino terminus of ERß plays an active role in 4-OH-Tam transcriptional stimulation of the hRAR{alpha}-1 promoter in Hep G2 cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 10. Activation Function Contribution of ER{alpha} and ERß to Stimulate Transcription from the hRAR{alpha}-1 Promoter in Response to 4-OH-Tam in Hep G2 Cells

pRShER{alpha} (A), hER{alpha}-AF1 (A), hER{alpha}-AF2 (A), pRShERß (B), pRShERß-AF2 (B), BAA (B), or ABB (B) was cotransfected transiently along with (-491 to +36)hRAR{alpha}-1-pGL2-LUC into Hep G2 cells treated with vehicle or 4-OH-Tam (10-10, 10-8 and 10-6 M) for 40 h and then analyzed for luciferase activity, which was normalized with an internal ß-galactosidase expression plasmid for transfection efficiency (see Materials and Methods). All receptor constructs were expressed at approximately equal levels as determined by ligand binding assays (data not shown). The average of three individual experiments is shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We describe herein the characterization of human ER{alpha} and ERß activities on two different types of promoters with different ligands in cotransactivation assays. While ER{alpha} and ERß responded in a similar manner to induce reporter activity from an ERE in Hep G2 cell cotransfection-transactivation assays (Figs. 1Go and 2Go), there were a few differences observed with regard to ligand specificities and activation function requirements from this response element. Raloxifene was approximately 20-fold ER{alpha} selective, and tamoxifen was about 3-fold ERß selective in Hep G2 cell ERE cotransactivation assays (Fig. 1Go). These ligands also exhibited similar receptor selectivity profiles as assessed by in vitro competition binding assays, with raloxifene having a higher affinity for hER{alpha} than for hERß and tamoxifen demonstrating a tighter interaction with hERß than with hER{alpha} (Table 1Go). Raloxifene-ERß binding activity has not been previously reported; however, tamoxifen was tested with rat ERß and showed less than a 2-fold separation between rER{alpha} and rERß (22).

Another difference between the two receptors in Hep G2 cell ERE cotransactivation assays was their activation function utilization properties. Both AF1 and AF2 of ER{alpha} contributed to the estrogen response from an ERE, as shown previously (19), although each were less active than ER{alpha} wt (Fig. 5Go). In contrast, ERß-AF2 showed equal efficacy in response to estrogen as did ERß wt from the ERE-driven reporter in Hep G2 cells (Fig. 5Go). Although we have not generated an ERß-AF1 construct, the chimeric receptor BAA was no more active than ER{alpha}-AF2, implying that the amino terminus of ERß did not participate in the transcriptional response induced by estrogen though ERß from an ERE in Hep G2 cells. These findings imply that the cofactor-receptor interactions in Hep G2 cells that occur at an ERE may be different for each ER.

While ligand selectivity and AF preference differences were discerned between the two receptors in transcriptional activation from an ERE, the differences between the two ERs were more pronounced at the hRAR{alpha}-1 promoter. Whereas hER{alpha} and hERß were both efficient activators of transcription from a classical ERE in response to estrogen, this was not the case from the hRAR{alpha}-1 promoter. It has been previously established that estrogen stimulates transcription from the hRAR{alpha}-1 promoter through ER{alpha} (17, 23). Surprisingly, estrogen was unable to stimulation transcription from this promoter in the presence of hERß in Hep G2 cells. However, 4-OH-Tam and other ER antagonists were potent ERß agonists at this promoter. This ‘reverse pharmacology’ has recently also been observed through an isolated AP-1 element (18).

Recent studies have shown that ER{alpha} and ERß can heterodimerize on an ERE as assessed by electrophoretic mobility shift assay, although there were not any obvious observed differences between each receptor alone or combined in ERE transcriptional assays in the presence of estrogen (24, 25). It is not clear what role, if any, heterodimers may play in the activation of the hRAR{alpha}-1 promoter. ERß titration resulted in decreased estrogen-induced transcriptional activity through ER{alpha} from the hRAR{alpha} promoter, as expected (data not shown). These data could be explained by ERß monomer or homodimer replacing ER{alpha} monomer or homodimer at the promoter or by heterodimer activity. Also, in electrophoretic mobility shift assays there was no observed Sp1 ternary complex with either ER alone (Fig. 8Go) or together (data not shown) at the RAR{alpha} promoter sequence containing the Sp1 sites. Dimerization mutant receptors may help elucidate the role of ER heterodimers in signal transduction from classical and nonclassical promoters.

Other ER antagonists (raloxifene, ICI-164,384, and ICI-182,780) also acted as agonists through ERß at this promoter (Fig. 7AGo). In addition to these known ER antagonists, RU486, which was found to be an antagonist of estrogen activity from an ERE through ERß (Fig. 2Go), was also an agonist through ERß to stimulate the RAR{alpha} promoter in cotransfection-transactivation assays (Fig. 7AGo). RU486 has been reported to possess both estrogenic and antiestrogenic activities. It has been shown to inhibit estrogen action in the endometrium of primates (26, 27, 28) and has been shown to stimulate T47D (29) and MCF7 (30) breast cancer cell growth, a known property of estrogen. Breast cancer cell lines and tumors have been shown to express ERß RNA (31). McDonnell et al. have reported that RU486 can act via PR-A to inhibit estrogen activity through ER{alpha} in cotransfection experiments, and this molecular finding may explain some of the antiestrogenic biological actions of RU486 (21). Our data herein indicate that RU486, and/or metabolites thereof, were able to act directly through ERß to exert both antiestrogenic and estrogenic actions on different promoters (with EC50 values of 100–200 nM) and, therefore, may also contribute to the observed effects of RU486 in vivo and in vitro. It has been shown that doses of RU486 (1–5 mg/kg) that caused antiestrogenic effects in primates resulted in circulating levels of up to ~300 nM (26), and in rats a dose of 5 mg/kg resulted in 0.5 to 2 µM RU486 in the serum (our data not shown), concentrations consistent with those that were efficacious in our in vitro assays.

ER{alpha} was previously found to stimulate transcription from two regions within the hRAR{alpha}-1 promoter (17, 23). One region included a sequence similar to an ERE palindrome (17), and the other region contained two Sp1 sites (17, 23). However, there was no direct ER{alpha} binding to either DNA sequence (17). Sp1 did bind to the region containing the Sp1 sites, but it did not form a ternary complex with ER{alpha}. Herein, it was observed that 4-OH-Tam induction of RAR{alpha} promoter-driven reporter activity in the presence of ERß occurred only through the region of the promoter containing the Sp1 sites, and that both of these Sp1 elements were required for full activity (Fig. 7BGo). ERß, like ER{alpha} (17), did not bind directly to this DNA sequence or form a ternary complex with Sp1 on the DNA (Fig. 8Go). Therefore, Sp1 mediation of the ERß stimulation of the RAR{alpha} promoter in response to 4-OH-Tam and the estrogen induction via ER{alpha} may occur through receptor docking with another protein to Sp1 or may involve direct interaction that is not detectable in in vitro electromobility shift assays.

ER{alpha} and ERß also showed very different activator function requirements for stimulation of transcription from the hRAR{alpha}-1 promoter. Both the ER{alpha}-AF1 and ER{alpha}-AF2 constructs were completely inactive in response to estrogen from the hRAR{alpha}-1 promoter-driven reporter vector in Hep G2 cell cotransfection assays (Fig. 9AGo), implying that both activation function regions of ER{alpha} are necessary for transcriptional activity from this promoter. This was not the case from an ERE, in which both ER{alpha} mutant constructs had activity alone (Ref. 19 and Fig. 5Go). ERß-AF2, like ERß wt, was inactive in response to estrogen on the hRAR{alpha}-1 promoter (Fig. 9BGo). However, ABB (amino-terminal region of ER{alpha} fused to the DBD and LBD regions of ERß) was just as active as ER{alpha} in this assay, indicating that ER{alpha} AF1 was necessary for estrogen induction of this promoter in Hep G2 cells, but not sufficient. The AF1 of ER{alpha} must be in the context of the AF2 of either ER{alpha} or ERß to be transcriptionally active at the RAR{alpha} promoter. These data imply that ER{alpha} AF1 and AF2 may interact to attract a cofactor, that multiple cofactors are involved, or that one domain is responsible for contacting the protein(s) touching the DNA while the other domain may interact with cofactor(s) to form a structure conducive to transcriptional activation via this promoter.

The ERß amino terminus seemed to have no contribution to the estrogen induction from an ERE (Fig. 5Go) or from the RAR{alpha} promoter (Fig. 9Go). However, 4-OH-Tam induction of the RAR{alpha} promoter via ERß in Hep G2 cells required ERß amino-terminal region for full activity (Fig. 10Go). ERß-AF2 was consistently less active than ERß wt in transactivation from the hRAR{alpha} promoter in the presence of 4-OH-Tam (Fig. 10BGo). This was true over a range of receptor plasmid concentrations (data not shown) and implied that the ERß amino terminal region was responsible for some of the activity observed with ERß wt from this promoter. Additionally, the construct BAA (amino terminus of ERß joined to the DBD and LBD of ER{alpha}) had equal or greater activity than ERß wt in response to 4-OH-Tam from this promoter while the DBD-LBD of ER{alpha} (ER{alpha}-AF2) was inactive. These data taken together indicate that the amino-terminal region of ERß contributed to its activity via the RAR{alpha} promoter in the presence of 4-OH-Tam. Therefore, the amino-terminal regions of ER{alpha} and ERß, which are quite divergent from each other (~17% sequence identity), show markedly different activities in response to different ligands and on different promoters. These two regions may interact with different transcriptional cofactors leading to the "reverse pharmacology" observed with this promoter in Hep G2 cells.

Endogenous levels of RAR{alpha} RNA (17, 32) and protein (17) have been shown to increase with estrogen treatment of human breast cancer cell lines, MCF7 (17) and T-47D (32), which are known to express ER{alpha}. It will be of interest to determine whether cells that only express ERß, and not ER{alpha}, will show 4-OH-Tam, but not estrogen, induction of RAR{alpha}. Certain breast tumors have been shown to express ERß (31), and the exploration of a possible correlation between tamoxifen agonist activity in certain breast cancers and ER{alpha} and ERß expression patterns may have importance in the design of treatment regimens for breast cancer patients.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ligands
17ß-Estradiol was from Aldrich Chemical Co. (Milwaukee, WI); diethylstilbestrol, progesterone, tamoxifen, and 4-OH-Tam were from Sigma Chemical Co. (St. Louis, MO). Estrone was from Steraloids (Wilton, NH), and estriol was from Wyeth-Ayerst (Philadelphia, PA). Raloxifene, ICI-164,384, ICI-182,780, and RU486 were produced by Ligand Pharmaceuticals, Inc. (San Diego, CA). [3H]-17ß-Estradiol (~141 Ci/mmol) was from Amersham (Arlington Heights, IL).

Cloning and Vector Construction
hERß cDNA was cloned by RT-PCR using 1 µg of human testis total RNA (CLONTECH, Palo Alto, CA) with the following primers: 5'-GGCCCAAGCTTATAGCCCTGCTGTGATGAATT-3' and 5'-CCGCTCGAGTTATCACTGAGACTGTGGGTTCT-3'. The PCR product was subcloned into pCRII (Invitrogen, San Diego, CA) via the HindIII and XhoI sites, and sequencing showed that it was 100% identical to the published sequence (8). Human ERß cDNA was cloned into the yeast expression vector pYEX-BX (CLONTECH), by use of a shuttle vector to generate a SalI site at the 5'-end of the cDNA. The 3'-BamHI site was blunted and ligated into pYEX-BX at the EcoRI site (blunted) and termed pYhERß. hERß was cloned into the mammalian expression vector, pRSpl (pRShERß), at HindIII and BamHI sites by use of a shuttle vector and a polylinker inserted into pRSpl. Human ER{alpha} cDNA was cloned into a yeast vector as previously described, termed here pYhER{alpha} (33), and into pRSpl mammalian expression vector as described previously (19) and referred to herein as pRShER{alpha}.

The human RAR{alpha}-1 promoter (500 bp) (34) was cloned by multiple independent PCRs from human genomic DNA into a promoterless luciferase vector, pGL2-LUC and termed (-491 to +36)-RAR{alpha}-pGL2-LUC, as described previously (17). Deletion constructs of the hRAR{alpha}-1 promoter were constructed into pGL2-LUC (17). Two Sp1 sites in RAR{alpha} promoter (-68 to -62 and -58 to -51) were mutated from GGGCGGG to GGACAGG by use of the following oligonucleotides: -193GATTCCCACGGTCCAGTCTTC-173, -41TGTCCCTCAGGCCCGCCCCTGCCTGTCCACCGACCAATC-79 (for Sp1{Delta}1), -41TGTCCCTCA GGCCTGTCCCTGCCCGCCCACCGACCAATC-79 (for Sp1 {Delta}2),-41TGTCCCTCAGGCCTGTCCCTGCCTGTCCACCGACCAATC-79 (for Sp1 {Delta}1, 2). (-491 to +36)RAR{alpha}-pGL2-LUC was digested with DsaI and XhoI and the resultant 5.8-kb fragment was purified. (-491 to +36)RAR{alpha}-pGL2-LUC was also digested with Bsu36 I and XhoI, and the resultant ~120-bp fragment was purified. Three-way ligation of the 152-bp PCR fragment (DsaI/Bsu36 I digested), 5.8-kb DsaI/XhoI fragment, and ~120-bp Bsu36 I/XhoI fragment yielded (-491 to +36 Sp1{Delta}1)RAR{alpha}-pGL2-LUC, (-491 to +36 Sp1{Delta}2)RAR{alpha}-pGL2-LUC, and (-491to +36 Sp1{Delta}1, 2)RAR{alpha}-pGL2-LUC. All constructs were sequenced to confirm identity.

Chimeric and Mutant Receptor Construction
An NheI site was created 5' of the DNA-binding domains of hER{alpha} and hERß by mutagenesis to generate ER{alpha}/ERß chimeras. For ER{alpha}, a 65-mer oligonucleotide that contained a unique endogenous BglI site and an NheI site created by mutation of bases 509 and 510 of ER{alpha} (5'-450CGACGCCAGGGTGGCAGAGAAAGATTGGCCAGTACCAATGACAAGGGAAGTATGGCTAGCGAATC515-3') and a 22-mer oligonucleotide that contained an endogenous HindIII site (5'-1010ATCGAAGCTTCACTGAAGGGTC988-3') were used for PCR amplification of a ~520-bp portion of ER{alpha}. This 520 bp BglI/HindIII fragment was cloned into pRShER{alpha} to yield pRShER{alpha} (m1) which contained the NheI site mutation, which resulted in a single amino acid change at position 170 from methionine to serine. For ERß, a 68-mer oligonucleotide that contained an endogenous PstI site and an NheI site created by mutation of bases 233, 234, 236, and 237 of ERß (5'-316GTAATCGCTGCAGACAGCGCAGAAGTGAGCATCCCTCTTTGAACCTGGACCGCTAGCAGGGCTGGCGC248-3') and an 18-mer oligonucleotide (5'-GCCTAGCTCGATACAATA-3') from pRS vector sequence upstream of the ERß cloning site were used for PCR amplification of a ~300-bp portion of ERß. The 5'-end of ERß in pRShERß was cut with PstI and HindIII (HindIII site 5' to ERß sequence within the cloning polylinker) and replaced with the PCR product to yield pRShERß (m1), which contained the NheI site mutations and resulted in two amino acid changes (valine 78 to alanine and threonine 79 to serine). To swap the amino termini of hER{alpha} and hERß, pRS-hERß(m1) was digested with SmaI (5' of ERß within the polylinker cloning site) and NheI, and pRS-hER{alpha} (m1) was digested with Asp 718 (5' of ER{alpha} in the pRS vector), blunt-ended with Klenow, and digested again with NheI. Ligation of the hER{alpha} amino-terminal fragment with pRShERß DBD and LBD fragment yielded pRShERABB (ABB), and ligation of the amino-terminal fragment of hERß with pRShER{alpha} DBD and LBD fragment yielded pRShERBAA (BAA). pRShERß-AF2 was constructed by use of a 38-mer oligonucleotide that contained a HindIII site and an ATG 5' to the DNA-binding domain of hERß (5'-GGAAGCTTCCTGCTGTGATG263TCAAAGAGGGATGCTCAC281-3') and a 24-mer oligonucleotide (5'-938TCCAGAACAAGATCTGGAGCAAAG914-3') containing a unique endogenous BglII site to yield a 600-bp PCR fragment. The 960-bp 5'-end of hERß (HindIII/BglII digest) was replaced with this 600-bp fragment, which lacks the amino-terminal region of hERß to yield pRShERß-AF2. Sequencing confirmed the identity of all constructs.

Cotransfection/Cotransactivation Assays
Hep G2 and COS-1 cells were obtained from the ATCC (Manassas, VA) and were grown according to their specifications. Hep G2 or COS-1 cells were transfected with various receptor expression vectors (see above), and reporter constructs including ERE(2)-{Delta}MTV-LUC (two tandem copies of CAAAGTCAGGTCACAGTGACCTGATCAA) (-491 to +36)hRAR{alpha}-1-pGL2-LUC (17), and various other hRAR{alpha}-1-pGL2-LUC deletion (17) and mutant (see above) constructs using the calcium phosphate method (17, 19). Cells were plated in phenol red-free media with charcoal-stripped serum (Hyclone Laboratories, Logan, UT). Reporter- and receptor-containing vectors were transfected along with carrier DNA and ß-galactosidase internal control plasmid as previously described (17, 19). Briefly, transfections were performed in triplicate in gelatin-coated (Hep G2) or noncoated (COS-1) 12-well or 96-well plates with a total of 20 µg DNA (0.1 to 3 µg receptor expression vector, 5 µg reporter plasmid, 5 µg ß-galactosidase plasmid, and pGEM carrier DNA to 20 µg) per ml of calcium phosphate-HEPES transfection solution. Six hours later, ligands were added in fresh media as above and incubation was for 30–40 h. Cells were lysed, and measurement of luciferase and ß-galactosidase activities was as previously described (17, 19). Luciferase values were normalized for transfection efficiencies with ß-galactosidase activities.

Ligand-Binding Assays
For saturation binding experiments, cell extracts from yeast transformed with pYhER{alpha} or pYhERß (10–30 µg total protein per tube) were incubated with increasing concentrations of [3H]estradiol in the absence and presence of a saturating amount of unlabeled estradiol. For competition binding assays, recombinant receptor-containing yeast extracts (10–30 µg total protein per well) were incubated with [3H]estradiol (2 nM) in the presence of increasing amounts of unlabeled test compounds (10 pM to 10 µM). Total and nonspecific binding were determined by incubating receptor extract and tritiated ligand in the absence and presence of a 200-fold molar excess of unlabeled estradiol. Both types of assays were carried out for 16 h at 4 C in binding buffer consisting of 0.3 M KCl, 10 mM Tris, pH 7.5, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid, and 5 mM dithiothreitol. Bound and free ligand were separated by hydroxylapatite resin; the resultant ligand-receptor complex bound to hydroxylapatite resin was washed twice with cold binding buffer without dithiothreitol, and radioactivity was quantitated by scintillation counting. After correcting for nonspecific binding, IC50 (concentration of competing ligand required to decrease specific binding by 50%) values were determined by use of log-logit plots of the data. Ki values were calculated by application of the Cheng-Prussof equation [Ki = IC50/(1 + [L]/Kd)], where [L] is the concentration of labeled ligand and Kd is the dissociation constant of the labeled ligand as determined by saturation binding and Scatchard analysis.

For Hep G2 cell binding assays, cells were transfected with various receptor constructs and reporter DNA in an identical manner as for transactivation assays. After 30–40 h, cells were washed twice in PBS and lysed, and high-salt whole-cell protein extracts were prepared. Ligand binding assays were performed using 0.5 mg of Hep G2 whole-cell extract per assay point in the presence of 5 nM [3H]estradiol with and without a 200-fold molar excess of unlabeled estradiol in binding buffer as described above. Separation of bound and free ligand was as described above and specific binding was determined.

For whole-cell binding assays, COS-1 cells were plated in 96-well tissue culture dishes in phenol red-free media containing charcoal-stripped serum (Hyclone) and then transfected by the calcium phosphate method with pRShER{alpha} or pRShERß. After approximately 40 h (and one media change), cells were incubated with fresh media containing 2 nM [3H]17ß-estradiol in the presence and absence of various concentrations of unlabeled estradiol, RU486, or progesterone for 3 h. Cells were washed twice in cold PBS after which 0.25 ml scintillation fluid was added to each well. Plates were kept at room temperature for 24 h, and then radioactivity was quantitated by use of a Packard microplate scintillation counter.

Electrophoretic Mobility Shift Assays
Oligonucleotides (-79 to -40 bp from the hRAR{alpha}-1 promoter or containing one copy of a consensus ERE) were annealed and end-labeled with [32P]nucleotide triphosphates. Protein extracts were high-salt, whole-cell preparations from Sf21 insect cells infected with and without hER{alpha} or hERß recombinant baculovirus. Sp1 protein was from Promega (Madison, WI). Mouse anti-ER monoclonal antibodies were generated against a peptide containing amino acids 8–22 of hER{alpha}, and rabbit anti-ERß antiserum was generated from a peptide containing amino acids 1–14 of hERß. Protein-DNA binding reactions were carried out in buffer containing 6% glycerol, 10 mM HEPES, pH 7.9, 0.05 M KCl, 1 mM dithiothreitol, 2.5 mM MgCl2, and 2% Ficoll for 15 min at 4 C and 2 min at room temperature. Electrophoresis was carried out via 6% acrylamide, 0.5x Tris-borate-EDTA (TBE) mini gels (Novex, San Diego, CA) in 0.5x TBE buffer at 4 C. Gels were dried and exposed to x-ray film at -80 C.


    ACKNOWLEDGMENTS
 
We thank Rich Heyman, Donald McDonnell, and Kathy Fosnaugh for helpful discussions. We thank Sharon Dana for ERE(2)-{Delta}MTV-LUC and Dave Clemm for baculovirus expression.


    FOOTNOTES
 
Address requests for reprints to: Dr. Elizabeth A. Allegretto, Department of Retinoid Research, Ligand Pharmaceuticals, Inc., 10255 Science Center Drive, San Diego, California 92121. E-mail: ballegretto{at}ligand.com

Received for publication August 31, 1998. Revision received November 13, 1998. Accepted for publication December 2, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Korach KS, Migliaccio S, Davis VL 1995 Estrogens. In: Munson PL (ed) Principles of Pharmacology. Basic Concepts and Clinical Applications. Chapman and Hall, New York, pp 809–825
  2. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166[Abstract/Free Full Text]
  3. Wren BG 1992 The effect of oestrogen on the female cardiovascular system. Med J Aust 157:204–208[Medline]
  4. Notelovitz M 1997 Estrogen therapy and osteoporosis: principles & practice. Am J Med Sci 313:2–12[CrossRef][Medline]
  5. Gronemeyer H, Laudet V 1995 Transcription factors 3: nuclear receptors. Protein Profile 2:1173–1308[Medline]
  6. Ing NH, O’Malley BW 1995 The steroid hormone receptor superfamily: molecular mechanisms of action. In: Weintraub BD (ed) Molecular Endocrinology: Basic Concepts and Clinical Correlations. Raven Press, New York, pp 195–215
  7. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  8. Mosselman S, Polman J, Dijkema R 1996 ER beta: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  9. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU 1986 An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46:1053–1061[CrossRef][Medline]
  10. Inoue S, Orimo A, Hosoi T, Kondo S, Toyoshima H, Kondo T, Ikegami A, Ouchi Y, Orimo H, Muramatsu M 1993 Genomic binding-site cloning reveals an estrogen-responsive gene that encodes a RING finger protein. Proc Natl Acad Sci USA 90:11117–11121[Abstract/Free Full Text]
  11. Tremblay GB, Tremblay A, Copeland NG, Gilbert, DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  12. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract]
  13. Gaub MP, Bellard M, Scheuer Chambon P, Sassone-Corsi P 1990 Activation of the ovalbumin gene by the estrogen receptor involves the fos-jun complex. Cell 63:1267–1276[CrossRef][Medline]
  14. Krishnan V, Wang X, Safe S 1994 Estrogen receptor-Sp1 complexes mediate estrogen-induced cathepsin D gene expression in MCF-7 human breast cancer cells. J Biol Chem 269:15912–15917[Abstract/Free Full Text]
  15. Sukovich DA, Mukherjee R, Benfield PA 1994 A novel, cell-type-specific mechanism for estrogen receptor-mediated gene activation in the absence of an estrogen-responsive element. Mol Cell Biol 14:7134–7143[Abstract/Free Full Text]
  16. Norris J, Fan D, Aleman C, Marks JR, Futreal PA, Wiseman RW, Iglehart JD, Deininger PL, McDonnell DP 1995 Identification of a new subclass of Alu DNA repeats which can function as estrogen receptor-dependent transcriptional enhancers. J Biol Chem 270:22777–22782[Abstract/Free Full Text]
  17. Elgort MG, Zou A, Marschke KB, Allegretto EA 1996 Estrogen and estrogen receptor antagonists stimulate transcription from the human retinoic acid receptor-{alpha}1 promoter via a novel sequence. Mol Endocrinol 10:477–487[Abstract]
  18. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  19. Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract]
  20. Bai W, Tullos S, Weigel NL 1994 Phosphorylation of Ser-530 facilitates hormone-dependent transcriptional activation of the chicken progesterone receptor. Mol Endocrinol 11:1465–73
  21. McDonnell DP, Goldman ME 1994 RU486 exerts antiestrogenic activities through a novel progesterone receptor A-mediated mechanism. J Biol Chem 269:11945–11949[Abstract/Free Full Text]
  22. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA 1997 Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology 138:863–870[Abstract/Free Full Text]
  23. Rishi AK, Shao ZM, Baumann RG, Li XS, Sheikh MS, Kimura S, Bashirelahi N, Fontana JA 1995 Estradiol regulation of the human retinoic acid receptor {alpha} gene in human breast carcinoma cells is mediated via an imperfect half-palindromic estrogen response element and Sp1 motifs. Cancer Res 55:4999–5006[Abstract/Free Full Text]
  24. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA 1997 Mouse estrogen receptor beta forms estrogen response element-binding heterodimers with estrogen receptor-{alpha}. Mol Endocrinol 11:1486–96[Abstract/Free Full Text]
  25. Cowley SM, Hoare S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–62[Abstract/Free Full Text]
  26. Wolf JP, Hsiu JG, Anderson TL, Ulmann A, Baulieu EE, Hodgen GD 1989 Noncompetitive antiestrogenic effect of RU 486 in blocking the estrogen-stimulated luteinizing hormone surge and the proliferative action of estradiol on endometrium in castrate monkeys. Fertil Steril 52:1055–1060[Medline]
  27. Slayden OD, Hirst JJ, Brenner RM 1993 Estrogen action in the reproductive tract of rhesus monkeys during antiprogestin treatment. Endocrinology 132:1845–1856[Abstract]
  28. Brenner RM Slayden OD 1994 Oestrogen action in the endometrium and oviduct of rhesus monkeys during RU486 treatment. Hum Reprod 9:82–97
  29. Bowden RT, Hissom JR, Moore MR 1989 Growth stimulation of T47D human breast cancer cells by the anti-progestin RU486. Endocrinology 124:2642–2644[Abstract]
  30. Jeng MH, Langan-Fahey SM, Jordan VC 1993 Estrogenic actions of RU486 in hormone-responsive MCF-7 human breast cancer cells. Endocrinology 132:2622–2630[Abstract]
  31. Dotzlaw H, Leygue E, Watson PH, Murphy LC 1997 Expression of estrogen receptor-ß in human breast tumors. J Clin Endocrinol Metab 82:2371–2374[Abstract/Free Full Text]
  32. Roman SD, Ormandy CJ, Manning DL, Blamey RW, Nicholson RI, Sutherland RL, Clarke CL 1993 Estradiol induction of retinoic acid receptors in human breast cancer cells. Cancer Res 53:5940–5945[Abstract/Free Full Text]
  33. Pham TA, Hwung YP, Santiso-Mere D, McDonnell DP, O’Malley BW 1992 Ligand-dependent and -independent function of the transactivation regions of the human estrogen receptor in yeast. Mol Endocrinol 6:1043–1050[Abstract]
  34. Brand NJ, Petkovich M, Chambon P 1990 Characterization of a functional promoter for the human retinoic acid receptor-{alpha} (hRAR-{alpha}). Nucleic Acids Res 18:6799–6806[Abstract/Free Full Text]