| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-1 Promoter in Response to Tamoxifen and Other Estrogen Receptor Antagonists, but Not in Response to Estrogen
Departments of Retinoid Research (A.Z., P.F., E.A.A.), New Leads Discovery (K.B.M., K.E.A.), and Endocrine Research (E.M.B., D.E.M.) Ligand Pharmaceuticals, Inc. San Diego, California 92121
| ABSTRACT |
|---|
|
|
|---|
(hER
) or -ß
(hERß) transfected into Hep G2 or COS1 cells each responded to
estrogen to increase transcription from an estrogen-responsive element
(ERE)-driven reporter vector with similar fold induction through a
classical mechanism involving direct receptor binding to DNA. ER
antagonists inhibited this estrogen induction through both hER
and
hERß, although raloxifene was more potent through ER
than ERß,
and tamoxifen was more potent via ERß than ER
. We have shown
previously that estrogen stimulated the human retinoic acid
receptor-
-1 (hRAR
-1) promoter through nonclassical EREs by a
mechanism that was ER
dependent, but that did not involve direct
receptor binding to DNA. We show here that in contrast to hER
,
hERß did not induce reporter activity driven by the hRAR
-1
promoter in the presence of estrogen. While hERß did not confer
estrogen responsiveness on this promoter, it did elicit transcriptional
activation in the presence of 4-hydroxytamoxifen (4-OH-Tam).
Additionally, this 4-OH-Tam agonist activity via ERß was completely
blocked by estrogen. Like ER
, transcriptional activation of this
promoter by ERß was not mediated by direct receptor binding to DNA.
While hER
was shown to act through two estrogen-responsive sequences
within the promoter, hERß acted only at the 3'-region, through two
Sp1 sites, in response to 4-OH-Tam. Other ER antagonists including
raloxifene, ICI-164,384 and ICI-182,780 also acted as agonists through
ERß via the hRAR
-1 promoter. Through the use of mutant and
chimeric receptors, it was shown that the 4-OH-Tam activity via ERß
from the hRAR
-1 promoter in Hep G2 cells required the amino-terminal
region of ERß, a region that was not necessary for estrogen-induced
ERß activity from an ERE in Hep G2 cells. Additionally, the
progesterone receptor (PR) antagonist RU486 acted as a weak
(IC50 >1 µM)
antagonist via hER
and as a fairly potent
(IC50
200 nM)
antagonist via hERß from an ERE-driven reporter in cells that do not
express PR. Although RU486 bound only weakly to ER
or ERß in
vitro, it did bind to ERß in whole-cell binding assays, and
therefore, it is likely metabolized to an ERß-interacting compound in
the cell. Interestingly, RU486 acted as an agonist through ERß to
stimulate the hRAR
-1 promoter in Hep G2 cells. These findings may
have ramifications in breast cancer treatment regimens utilizing
tamoxifen or other ER antagonists and may explain some of the known
estrogenic or antiestrogenic biological actions of RU486. | INTRODUCTION |
|---|
|
|
|---|
. ERß was initially cloned from
rat prostate (7), and the human clone was retrieved from testis
(8).
ER
has been shown to bind to, and activate transcription through,
estrogen responsive elements (EREs) within the regulatory regions of
target genes. These classically defined EREs are palindromic sequences
spaced by 3 bp and have been identified in the regulatory regions of
estrogen-induced genes (9, 10). ERß has also been shown to increase
the activity of a reporter construct containing an ERE in CHO (7, 8) or
COS (11) cell cotransfection-transactivation assays. The classical
consensus ERE was originally defined from the Xenopus
vitellogenin A2 gene promoter (GGTCANNNTGACC)
(9) and is directly bound by ER
. However, there are several other
estrogen-responsive genes that have been discovered that utilize
divergent EREs or other transcription factor DNA-binding sites as the
target sequences of ER
action. These genes include those that are
regulated by ER
working through AP-1 or Sp1 bound to their
respective DNA-binding sites (12, 13, 14, 17), and others in which ER
is
thought to act through an as yet unidentified protein or proteins
(15, 16, 17).
Recently, Paech et al. (18) have shown that while estrogen
induced AP-1-driven reporter activity through ER
, it was inactive
through ERß. However, ER antagonists activated ERß to induce
transcriptional activity through an AP-1 site, and this stimulation was
blocked by estrogen (18). Herein we tested the activity of hERß via a
known estrogen target gene whose activation is not mediated by direct
receptor binding to DNA, the human retinoic acid receptor-
-1
(hRAR
-1) promoter (17). While hER
efficiently activated
transcription from this promoter in Hep G2 cells in response to
estrogen, hERß did not. However, 4-hydroxytamoxifen (4-OH-Tam) and
other ER antagonists acted as agonists through hERß to drive
transcription from the hRAR
-1 promoter, and this activity was
completely antagonized by estrogen. The site of 4-OH-Tam responsiveness
through ERß within this promoter was mapped to two Sp1 sites between
-79 and -49, a region that has been previously shown to mediate ER
activity in response to estrogen (17). Full activation of this promoter
through ERß by 4-OH-Tam in Hep G2 cells required the amino terminus
of ERß, a region that did not seem to play a role in ERß
transactivation from an ERE in Hep G2 cells.
| RESULTS |
|---|
|
|
|---|
and hERß via
ERE-
MTV-LUC
(17, 19) or hERß were
cotransfected along with a luciferase reporter vector driven by two
copies of a palindromic ERE into Hep G2 cells and treated with
estradiol in transactivation assays. Figure 1
(panel A) and
hERß (panel B) responded to estradiol in a dose-dependent manner
to increase luciferase activity 3- to 4-fold in Hep G2 cells, a cell
line that does not endogenously express either ER (Refs. 17, 19 and our
data not shown). Antagonist mode assays were performed to test the
ability of tamoxifen, 4-OH-Tam, and raloxifene to block the estrogen
response via each receptor. In the presence of 10 nM
estrogen, a dose-dependent decrease in luciferase activity was observed
via hER
(Fig. 1A
3 nM), 4-OH-Tam (IC50
21 nM), and tamoxifen (IC50
1700
nM). While each compound also antagonized estrogen action
via hERß (Fig. 1B
55 nM; 4-OH-Tam,
5
nM; tamoxifen,
260 nM) than those observed
with hER
. These antagonists did not act as partial agonists on this
reporter in Hep G2 cells through hER
or hERß (data not shown).
Interestingly, RU486, a progesterone receptor (PR) antagonist, was
shown to have antagonist activity through both hER
and hERß from
this ERE-driven reporter in COS-1 cells (Fig. 2
(Fig. 2A
200 nM). In
contrast, another PR ligand, progesterone, had no effect in this assay
(Fig. 2
|
|
and hERß were used in in vitro
binding assays to determine their ligand binding characteristics.
Saturation binding experiments using tritiated estradiol and subsequent
Scatchard analysis for both yeast-expressed receptors yielded
equilibrium dissociation constants of estradiol for hER
and hERß
that were essentially identical [dissociation constant
(Kd) values,
0.81 nM; data not shown).
These values for hERß are in agreement with the values for rat (7, 22) and mouse (11) ERß that have been recently reported. Competition
ligand binding assays using tritiated estradiol were employed to
determine relative affinities of a variety of compounds for hER
and
hERß. Table 1
and hERß. Tamoxifen bound with
higher affinity to hERß (Ki = 47 nM) than to
hER
(Ki = 143 nM), while raloxifene
displayed a higher affinity for hER
(Ki = 0.14
nM) than for hERß (Ki = 2.43 nM).
These in vitro binding affinities correlate well with the
relative potencies of these compounds to antagonize estrogen action via
an ERE (Fig. 1
(IC50 > 1 µM, Fig. 2
200 nM, Fig. 2
|
or hERß and then incubated
with [3H]-17ß-estradiol in the presence and absence of
unlabeled raloxifene, RU486, or progesterone. Unlabeled raloxifene
competed with [3H]-17ß-estradiol for binding to both
ER
(Fig. 3A
- and
ERß-containing protein extracts. RU486 competed with
[3H]-17ß-estradiol for binding to ERß expressed in
COS-1 cells (IC50
100 nM; Fig. 3B
was very weak (IC50 > 3
µM; Fig. 3A
or ERß in this assay (Fig. 3
|
and hERß to Stimulate
Transcription from an ERE in Hep G2 Cells
and hERß behaved similarly in cotransactivation assays in
Hep G2 cells (Fig. 1
and hERß use similar activation functions to
stimulate transcription from a consensus ERE, various mutant receptors
were constructed (see Fig. 4
-AF1 and hER
-AF2 constructs (19) were tested. Also
constructed were hERß-AF2, which lacks the amino terminus of hERß,
and two chimeric receptors: BAA [ERß amino terminus linked to the
DNA-binding domain (DBD) and entire carboxyl-terminal region of ER
]
and ABB (ER
amino terminus linked to the DBD and entire carboxyl-
terminal region of ERß; see Materials and Methods). The
mutant hER
and hERß constructs that were produced to generate the
chimeric receptors (see Materials and Methods) were
identical to the wt receptors in their response to estrogen and
4-OH-Tam in these cotransfection assays (data not shown).
|
is active from an ERE, as
evidenced by that fact that hER
-AF1, the construct that lacks a
functional AF2 (see Fig. 4
wt resulted in approximately 10-fold
activation (Fig. 5
-AF2 (which
lacks the amino-terminal region containing AF1) was also active, but
also showed less activity than ER
wt (
4-fold induction of
luciferase activity by estrogen; Fig. 5
-AF2 (Fig. 5
, while active on its own, did not increase the activity of
ERß-AF2. This result may imply amino-carboxyl terminal interactions
within the ABB protein that prohibit ER
AF1 factors from
binding.
|
and hERß via the hRAR
Promoter
and hERß showed similar responses to estradiol via
an ERE-driven reporter (Fig. 1
promoter [(-491 to +36)-hRAR
-pGL2-LUC] has
been previously shown to be stimulated by estradiol in the presence of
hER
in Hep G2 cells in a DNA-binding independent fashion (17).
Interestingly, estrogen was unable to stimulate transcription from this
promoter through ERß in Hep G2 cells (Fig. 6B
-1 promoter through ERß. Raloxifene and the two "pure" ER
antagonists, ICI-164,384 and ICI-182,780, elicited 3- to 4-fold
induction of reporter activity through ERß from this promoter (Fig. 7A
and ERß from an ERE-driven reporter
(Fig. 2
-1 promoter (Fig. 7A
|
|
-1 Promoter
promoter, previously produced hRAR
-1 promoter deletion constructs
(17) were used to test ERß activity in response to 4-OH-Tam in Hep G2
cell cotransfection assays. In contrast to ER
, which acted through
two sites to confer estrogen sensitivity on this promoter (17), ERß
action was delineated to just one of these promoter regions. Deletion
of the region between -79 and -49 of the hRAR
-1 promoter
eliminated 4-OH-Tam induction of transcriptional activity through ERß
(Fig. 7B
1) or the proximal Sp1 site (-491 to +36 Sp1
2) of the RAR
promoter abrogated 4-OH-Tam-stimulated ERß activity, while the double
mutant (-491 to +36 Sp1
1, 2) was unable to confer 4-OH-Tam activity
through ERß (Fig. 7B
(17), did not bind to the sequence between -79 and -40 in an
electrophoretic mobility shift assay and did not form a ternary complex
with recombinant Sp1 (Fig. 8A
and ERß were able to bind to
a consensus ERE (Fig. 8B).
|
and ERß via the
hRAR
Promoter in Hep G2 Cells
and hERß have shown similar activity from an ERE in
COS-1 (Ref. 11 , Fig. 2
-1 promoter in COS-1 cells than in Hep G2 cells (data not
shown). Hep G2 is a cell line that has been shown to be dominant for
ER
AF1 function (19), implying that AF1 function of ER
is
involved in activation of this promoter. We therefore set out to
determine which activation function domains of ER
and ERß were
involved in stimulation of transcription from the RAR
promoter in
Hep G2 cells. Surprisingly, in contrast to estrogen activation by ER
from an ERE, which is mediated both through AF1 and AF2 in Hep G2 cells
(Ref. 19 and Fig. 5
-AF1 was inactive in response to estrogen on
the RAR
promoter (Fig. 9A
-AF2
also did not respond to estrogen in this assay (Fig. 9A
AF
constructs were expressed in these cells at approximately equal levels
as ER
wt, as determined by ligand-binding assays (data not shown).
Therefore, both AF1 and AF2 of ER
are necessary for estrogen
induction of transcription from the RAR
promoter. Like ERß wt,
ERß-AF2 did not confer estrogen responsiveness on the RAR
promoter
(Fig. 9B
in the context of ERß DBD and
ligand-binding domain (LBD) (ABB) resulted in a receptor that responded
to estrogen to activate this promoter (Fig. 9B
AF-2 (BAA) in this
assay (Fig. 9B
-1 promoter in Hep G2 cells, the AF1 of ER
is necessary, but not sufficient: it must be in the context of
the AF2 of either ER
or ERß to function.
|
wt is weakly
activated by 4-OH-Tam to induce RAR
-driven reporter activity in Hep
G2 cells (Fig. 10A
-AF1
and ER
-AF2 are each inactive on this promoter in response to
4-OH-Tam (Fig. 10A
from this promoter (Fig. 9A
promoter; however, ERß-AF2 was reproducibly
and significantly less active than ERß wt (Fig. 10B
AF1 was inactive in the
context of the AF2 of ERß from this promoter in response to 4-OH-Tam.
However, BAA was active in response to 4-OH-Tam (Fig. 10B
-AF2
(Fig. 10A
-1
promoter in Hep G2 cells.
|
| DISCUSSION |
|---|
|
|
|---|
and ERß
activities on two different types of promoters with different ligands
in cotransactivation assays. While ER
and ERß responded in a
similar manner to induce reporter activity from an ERE in Hep G2 cell
cotransfection-transactivation assays (Figs. 1
selective, and tamoxifen was about 3-fold
ERß selective in Hep G2 cell ERE cotransactivation assays (Fig. 1
than for hERß and
tamoxifen demonstrating a tighter interaction with hERß than with
hER
(Table 1
and rERß
(22).
Another difference between the two receptors in Hep G2 cell ERE
cotransactivation assays was their activation function utilization
properties. Both AF1 and AF2 of ER
contributed to the estrogen
response from an ERE, as shown previously (19), although each were less
active than ER
wt (Fig. 5
). In contrast, ERß-AF2 showed equal
efficacy in response to estrogen as did ERß wt from the ERE-driven
reporter in Hep G2 cells (Fig. 5
). Although we have not generated an
ERß-AF1 construct, the chimeric receptor BAA was no more active than
ER
-AF2, implying that the amino terminus of ERß did not
participate in the transcriptional response induced by estrogen though
ERß from an ERE in Hep G2 cells. These findings imply that the
cofactor-receptor interactions in Hep G2 cells that occur at an ERE may
be different for each ER.
While ligand selectivity and AF preference differences were discerned
between the two receptors in transcriptional activation from an ERE,
the differences between the two ERs were more pronounced at the
hRAR
-1 promoter. Whereas hER
and hERß were both efficient
activators of transcription from a classical ERE in response to
estrogen, this was not the case from the hRAR
-1 promoter. It has
been previously established that estrogen stimulates transcription from
the hRAR
-1 promoter through ER
(17, 23). Surprisingly, estrogen
was unable to stimulation transcription from this promoter in the
presence of hERß in Hep G2 cells. However, 4-OH-Tam and other ER
antagonists were potent ERß agonists at this promoter. This reverse
pharmacology has recently also been observed through an isolated AP-1
element (18).
Recent studies have shown that ER
and ERß can heterodimerize on an
ERE as assessed by electrophoretic mobility shift assay, although there
were not any obvious observed differences between each receptor alone
or combined in ERE transcriptional assays in the presence of
estrogen (24, 25). It is not clear what role, if any, heterodimers may
play in the activation of the hRAR
-1 promoter. ERß titration
resulted in decreased estrogen-induced transcriptional activity through
ER
from the hRAR
promoter, as expected (data not shown). These
data could be explained by ERß monomer or homodimer replacing ER
monomer or homodimer at the promoter or by heterodimer activity. Also,
in electrophoretic mobility shift assays there was no observed Sp1
ternary complex with either ER alone (Fig. 8
) or together (data not
shown) at the RAR
promoter sequence containing the Sp1 sites.
Dimerization mutant receptors may help elucidate the role of ER
heterodimers in signal transduction from classical and nonclassical
promoters.
Other ER antagonists (raloxifene, ICI-164,384, and ICI-182,780) also
acted as agonists through ERß at this promoter (Fig. 7A
). In addition
to these known ER antagonists, RU486, which was found to be an
antagonist of estrogen activity from an ERE through ERß (Fig. 2
), was
also an agonist through ERß to stimulate the RAR
promoter in
cotransfection-transactivation assays (Fig. 7A
). RU486 has been
reported to possess both estrogenic and antiestrogenic activities. It
has been shown to inhibit estrogen action in the endometrium of
primates (26, 27, 28) and has been shown to stimulate T47D (29) and MCF7
(30) breast cancer cell growth, a known property of estrogen. Breast
cancer cell lines and tumors have been shown to express ERß RNA (31).
McDonnell et al. have reported that RU486 can act via PR-A
to inhibit estrogen activity through ER
in cotransfection
experiments, and this molecular finding may explain some of the
antiestrogenic biological actions of RU486 (21). Our data herein
indicate that RU486, and/or metabolites thereof, were able to act
directly through ERß to exert both antiestrogenic and estrogenic
actions on different promoters (with EC50 values of
100200 nM) and, therefore, may also contribute to the
observed effects of RU486 in vivo and in vitro.
It has been shown that doses of RU486 (15 mg/kg) that caused
antiestrogenic effects in primates resulted in circulating levels of up
to
300 nM (26), and in rats a dose of 5 mg/kg resulted
in 0.5 to 2 µM RU486 in the serum (our data not shown),
concentrations consistent with those that were efficacious in our
in vitro assays.
ER
was previously found to stimulate transcription from two regions
within the hRAR
-1 promoter (17, 23). One region included a sequence
similar to an ERE palindrome (17), and the other region contained two
Sp1 sites (17, 23). However, there was no direct ER
binding to
either DNA sequence (17). Sp1 did bind to the region containing the Sp1
sites, but it did not form a ternary complex with ER
. Herein, it was
observed that 4-OH-Tam induction of RAR
promoter-driven reporter
activity in the presence of ERß occurred only through the region of
the promoter containing the Sp1 sites, and that both of these Sp1
elements were required for full activity (Fig. 7B
). ERß, like ER
(17), did not bind directly to this DNA sequence or form a ternary
complex with Sp1 on the DNA (Fig. 8
). Therefore, Sp1 mediation of the
ERß stimulation of the RAR
promoter in response to 4-OH-Tam and
the estrogen induction via ER
may occur through receptor docking
with another protein to Sp1 or may involve direct interaction that is
not detectable in in vitro electromobility shift assays.
ER
and ERß also showed very different activator function
requirements for stimulation of transcription from the hRAR
-1
promoter. Both the ER
-AF1 and ER
-AF2 constructs were completely
inactive in response to estrogen from the hRAR
-1 promoter-driven
reporter vector in Hep G2 cell cotransfection assays (Fig. 9A
),
implying that both activation function regions of ER
are necessary
for transcriptional activity from this promoter. This was not the case
from an ERE, in which both ER
mutant constructs had activity alone
(Ref. 19 and Fig. 5
). ERß-AF2, like ERß wt, was inactive in
response to estrogen on the hRAR
-1 promoter (Fig. 9B
). However, ABB
(amino-terminal region of ER
fused to the DBD and LBD regions of
ERß) was just as active as ER
in this assay, indicating that ER
AF1 was necessary for estrogen induction of this promoter in Hep G2
cells, but not sufficient. The AF1 of ER
must be in the context of
the AF2 of either ER
or ERß to be transcriptionally active at the
RAR
promoter. These data imply that ER
AF1 and AF2 may interact
to attract a cofactor, that multiple cofactors are involved, or that
one domain is responsible for contacting the protein(s) touching the
DNA while the other domain may interact with cofactor(s) to form a
structure conducive to transcriptional activation via this
promoter.
The ERß amino terminus seemed to have no contribution to the estrogen
induction from an ERE (Fig. 5
) or from the RAR
promoter (Fig. 9
).
However, 4-OH-Tam induction of the RAR
promoter via ERß in Hep G2
cells required ERß amino-terminal region for full activity (Fig. 10
).
ERß-AF2 was consistently less active than ERß wt in transactivation
from the hRAR
promoter in the presence of 4-OH-Tam (Fig. 10B
). This
was true over a range of receptor plasmid concentrations (data not
shown) and implied that the ERß amino terminal region was responsible
for some of the activity observed with ERß wt from this promoter.
Additionally, the construct BAA (amino terminus of ERß joined to the
DBD and LBD of ER
) had equal or greater activity than ERß wt in
response to 4-OH-Tam from this promoter while the DBD-LBD of ER
(ER
-AF2) was inactive. These data taken together indicate that the
amino-terminal region of ERß contributed to its activity via the
RAR
promoter in the presence of 4-OH-Tam. Therefore, the
amino-terminal regions of ER
and ERß, which are quite divergent
from each other (
17% sequence identity), show markedly different
activities in response to different ligands and on different promoters.
These two regions may interact with different transcriptional cofactors
leading to the "reverse pharmacology" observed with this promoter
in Hep G2 cells.
Endogenous levels of RAR
RNA (17, 32) and protein (17) have been
shown to increase with estrogen treatment of human breast cancer cell
lines, MCF7 (17) and T-47D (32), which are known to express ER
. It
will be of interest to determine whether cells that only express ERß,
and not ER
, will show 4-OH-Tam, but not estrogen, induction of
RAR
. Certain breast tumors have been shown to express ERß (31),
and the exploration of a possible correlation between tamoxifen agonist
activity in certain breast cancers and ER
and ERß expression
patterns may have importance in the design of treatment regimens for
breast cancer patients.
| MATERIALS AND METHODS |
|---|
|
|
|---|
141 Ci/mmol) was from Amersham
(Arlington Heights, IL).
Cloning and Vector Construction
hERß cDNA was cloned by RT-PCR using 1 µg of human testis
total RNA (CLONTECH, Palo Alto, CA) with the following primers:
5'-GGCCCAAGCTTATAGCCCTGCTGTGATGAATT-3' and
5'-CCGCTCGAGTTATCACTGAGACTGTGGGTTCT-3'. The PCR product was subcloned
into pCRII (Invitrogen, San Diego, CA) via the HindIII and
XhoI sites, and sequencing showed that it was 100%
identical to the published sequence (8). Human ERß cDNA was cloned
into the yeast expression vector pYEX-BX (CLONTECH), by use of a
shuttle vector to generate a SalI site at the 5'-end of the
cDNA. The 3'-BamHI site was blunted and ligated into pYEX-BX
at the EcoRI site (blunted) and termed pYhERß. hERß was
cloned into the mammalian expression vector, pRSpl (pRShERß), at
HindIII and BamHI sites by use of a shuttle
vector and a polylinker inserted into pRSpl. Human ER
cDNA was
cloned into a yeast vector as previously described, termed here
pYhER
(33), and into pRSpl mammalian expression vector as described
previously (19) and referred to herein as pRShER
.
The human RAR
-1 promoter (500 bp) (34) was cloned by multiple
independent PCRs from human genomic DNA into a promoterless luciferase
vector, pGL2-LUC and termed (-491 to +36)-RAR
-pGL2-LUC, as
described previously (17). Deletion constructs of the hRAR
-1
promoter were constructed into pGL2-LUC (17). Two Sp1 sites in RAR
promoter (-68 to -62 and -58 to -51) were mutated from GGGCGGG to
GGACAGG by use of the following oligonucleotides:
-193GATTCCCACGGTCCAGTCTTC-173,
-41TGTCCCTCAGGCCCGCCCCTGCCTGTCCACCGACCAATC-79
(for Sp1
1), -41TGTCCCTCA
GGCCTGTCCCTGCCCGCCCACCGACCAATC-79
(for Sp1
2),-41TGTCCCTCAGGCCTGTCCCTGCCTGTCCACCGACCAATC-79
(for Sp1
1, 2). (-491 to +36)RAR
-pGL2-LUC was digested with
DsaI and XhoI and the resultant 5.8-kb fragment
was purified. (-491 to +36)RAR
-pGL2-LUC was also digested with
Bsu36 I and XhoI, and the resultant
120-bp fragment was
purified. Three-way ligation of the 152-bp PCR fragment
(DsaI/Bsu36 I digested), 5.8-kb
DsaI/XhoI fragment, and
120-bp Bsu36
I/XhoI fragment yielded (-491 to +36
Sp1
1)RAR
-pGL2-LUC, (-491 to +36 Sp1
2)RAR
-pGL2-LUC, and
(-491to +36 Sp1
1, 2)RAR
-pGL2-LUC. All constructs were sequenced
to confirm identity.
Chimeric and Mutant Receptor Construction
An NheI site was created 5' of the DNA-binding
domains of hER
and hERß by mutagenesis to generate ER
/ERß
chimeras. For ER
, a 65-mer oligonucleotide that contained a unique
endogenous BglI site and an NheI site created by
mutation of bases 509 and 510 of ER
(5'-450CGACGCCAGGGTGGCAGAGAAAGATTGGCCAGTACCAATGACAAGGGAAGTATGGCTAGCGAATC515-3')
and a 22-mer oligonucleotide that contained an endogenous
HindIII site
(5'-1010ATCGAAGCTTCACTGAAGGGTC988-3')
were used for PCR amplification of a
520-bp portion of ER
. This
520 bp BglI/HindIII fragment was cloned into
pRShER
to yield pRShER
(m1) which contained the NheI
site mutation, which resulted in a single amino acid change at position
170 from methionine to serine. For ERß, a 68-mer oligonucleotide that
contained an endogenous PstI site and an NheI
site created by mutation of bases 233, 234, 236, and 237 of ERß
(5'-316GTAATCGCTGCAGACAGCGCAGAAGTGAGCATCCCTCTTTGAACCTGGACCGCTAGCAGGGCTGGCGC248-3')
and an 18-mer oligonucleotide (5'-GCCTAGCTCGATACAATA-3') from pRS
vector sequence upstream of the ERß cloning site were used for PCR
amplification of a
300-bp portion of ERß. The 5'-end of ERß in
pRShERß was cut with PstI and HindIII
(HindIII site 5' to ERß sequence within the cloning
polylinker) and replaced with the PCR product to yield pRShERß (m1),
which contained the NheI site mutations and resulted in two
amino acid changes (valine 78 to alanine and threonine 79 to serine).
To swap the amino termini of hER
and hERß, pRS-hERß(m1) was
digested with SmaI (5' of ERß within the polylinker
cloning site) and NheI, and pRS-hER
(m1) was digested
with Asp 718 (5' of ER
in the pRS vector), blunt-ended with Klenow,
and digested again with NheI. Ligation of the hER
amino-terminal fragment with pRShERß DBD and LBD fragment yielded
pRShERABB (ABB), and ligation of the amino-terminal fragment of hERß
with pRShER
DBD and LBD fragment yielded pRShERBAA (BAA).
pRShERß-AF2 was constructed by use of a 38-mer oligonucleotide that
contained a HindIII site and an ATG 5' to the DNA-binding
domain of hERß
(5'-GGAAGCTTCCTGCTGTGATG263TCAAAGAGGGATGCTCAC281-3')
and a 24-mer oligonucleotide
(5'-938TCCAGAACAAGATCTGGAGCAAAG914-3')
containing a unique endogenous BglII site to yield a 600-bp
PCR fragment. The 960-bp 5'-end of hERß
(HindIII/BglII digest) was replaced with this
600-bp fragment, which lacks the amino-terminal region of hERß to
yield pRShERß-AF2. Sequencing confirmed the identity of all
constructs.
Cotransfection/Cotransactivation Assays
Hep G2 and COS-1 cells were obtained from the ATCC (Manassas,
VA) and were grown according to their specifications. Hep G2 or COS-1
cells were transfected with various receptor expression vectors (see
above), and reporter constructs including ERE(2)-
MTV-LUC (two
tandem copies of
CAAAGTCAGGTCACAGTGACCTGATCAA) (-491 to
+36)hRAR
-1-pGL2-LUC (17), and various other hRAR
-1-pGL2-LUC
deletion (17) and mutant (see above) constructs using the calcium
phosphate method (17, 19). Cells were plated in phenol red-free media
with charcoal-stripped serum (Hyclone Laboratories, Logan, UT).
Reporter- and receptor-containing vectors were transfected along with
carrier DNA and ß-galactosidase internal control plasmid as
previously described (17, 19). Briefly, transfections were performed in
triplicate in gelatin-coated (Hep G2) or noncoated (COS-1) 12-well or
96-well plates with a total of 20 µg DNA (0.1 to 3 µg receptor
expression vector, 5 µg reporter plasmid, 5 µg ß-galactosidase
plasmid, and pGEM carrier DNA to 20 µg) per ml of calcium
phosphate-HEPES transfection solution. Six hours later, ligands were
added in fresh media as above and incubation was for 3040 h. Cells
were lysed, and measurement of luciferase and ß-galactosidase
activities was as previously described (17, 19). Luciferase values were
normalized for transfection efficiencies with ß-galactosidase
activities.
Ligand-Binding Assays
For saturation binding experiments, cell extracts from yeast
transformed with pYhER
or pYhERß (1030 µg total protein per
tube) were incubated with increasing concentrations of
[3H]estradiol in the absence and presence of a saturating
amount of unlabeled estradiol. For competition binding assays,
recombinant receptor-containing yeast extracts (1030 µg total
protein per well) were incubated with [3H]estradiol (2
nM) in the presence of increasing amounts of unlabeled test
compounds (10 pM to 10 µM). Total and
nonspecific binding were determined by incubating receptor extract and
tritiated ligand in the absence and presence of a 200-fold molar excess
of unlabeled estradiol. Both types of assays were carried out for
16 h at 4 C in binding buffer consisting of 0.3
M KCl, 10 mM Tris, pH 7.5, 0.5%
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid,
and 5 mM dithiothreitol. Bound and free ligand were
separated by hydroxylapatite resin; the resultant ligand-receptor
complex bound to hydroxylapatite resin was washed twice with cold
binding buffer without dithiothreitol, and radioactivity was
quantitated by scintillation counting. After correcting for nonspecific
binding, IC50 (concentration of competing ligand required
to decrease specific binding by 50%) values were determined by use of
log-logit plots of the data. Ki values were calculated by
application of the Cheng-Prussof equation [Ki =
IC50/(1 + [L]/Kd)], where [L] is the
concentration of labeled ligand and Kd is the dissociation
constant of the labeled ligand as determined by saturation binding and
Scatchard analysis.
For Hep G2 cell binding assays, cells were transfected with various receptor constructs and reporter DNA in an identical manner as for transactivation assays. After 3040 h, cells were washed twice in PBS and lysed, and high-salt whole-cell protein extracts were prepared. Ligand binding assays were performed using 0.5 mg of Hep G2 whole-cell extract per assay point in the presence of 5 nM [3H]estradiol with and without a 200-fold molar excess of unlabeled estradiol in binding buffer as described above. Separation of bound and free ligand was as described above and specific binding was determined.
For whole-cell binding assays, COS-1 cells were plated in 96-well
tissue culture dishes in phenol red-free media containing
charcoal-stripped serum (Hyclone) and then transfected by the calcium
phosphate method with pRShER
or pRShERß. After approximately
40 h (and one media change), cells were incubated with fresh media
containing 2 nM [3H]17ß-estradiol in the
presence and absence of various concentrations of unlabeled estradiol,
RU486, or progesterone for 3 h. Cells were washed twice in cold
PBS after which 0.25 ml scintillation fluid was added to each well.
Plates were kept at room temperature for 24 h, and then
radioactivity was quantitated by use of a Packard microplate
scintillation counter.
Electrophoretic Mobility Shift Assays
Oligonucleotides (-79 to -40 bp from the hRAR
-1 promoter or
containing one copy of a consensus ERE) were annealed and end-labeled
with [32P]nucleotide triphosphates. Protein extracts were
high-salt, whole-cell preparations from Sf21 insect cells infected with
and without hER
or hERß recombinant baculovirus. Sp1 protein was
from Promega (Madison, WI). Mouse anti-ER monoclonal antibodies were
generated against a peptide containing amino acids 822 of hER
, and
rabbit anti-ERß antiserum was generated from a peptide containing
amino acids 114 of hERß. Protein-DNA binding reactions were carried
out in buffer containing 6% glycerol, 10 mM HEPES, pH 7.9,
0.05 M KCl, 1 mM dithiothreitol, 2.5
mM MgCl2, and 2% Ficoll for 15 min at 4 C and
2 min at room temperature. Electrophoresis was carried out via 6%
acrylamide, 0.5x Tris-borate-EDTA (TBE) mini gels (Novex, San
Diego, CA) in 0.5x TBE buffer at 4 C. Gels were dried and exposed to
x-ray film at -80 C.
| ACKNOWLEDGMENTS |
|---|
MTV-LUC and Dave Clemm for baculovirus
expression. | FOOTNOTES |
|---|
Received for publication August 31, 1998. Revision received November 13, 1998. Accepted for publication December 2, 1998.
| REFERENCES |
|---|
|
|
|---|
1 promoter via a novel sequence. Mol
Endocrinol 10:477487
and ERß at AP1 sites. Science 277:15081510
and ß. Endocrinology 138:863870
gene in human breast carcinoma cells is
mediated via an imperfect half-palindromic estrogen response element
and Sp1 motifs. Cancer Res 55:49995006
. Mol Endocrinol 11:148696
and ß form heterodimers on DNA. J Biol Chem 272:1985862
(hRAR-
). Nucleic Acids Res 18:67996806This article has been cited by other articles:
![]() |
T. J. Nakamura, M. T. Sellix, M. Menaker, and G. D. Block Estrogen directly modulates circadian rhythms of PER2 expression in the uterus Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1025 - E1031. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Damdimopoulos, G. Spyrou, and J.-A. Gustafsson Ligands Differentially Modify the Nuclear Mobility of Estrogen Receptors {alpha} and Endocrinology, January 1, 2008; 149(1): 339 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartman, M. Tujague, A. Strom, E. Treuter, M. Warner, et al. Estrogen Receptors: How Do They Signal and What Are Their Targets Physiol Rev, July 1, 2007; 87(3): 905 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Levy, X. Zhao, H. Tang, R. B. Jaffe, T. P. Speed, and D. C. Leitman Multiple Transcription Factor Elements Collaborate with Estrogen Receptor {alpha} to Activate an Inducible Estrogen Response Element in the NKG2E Gene Endocrinology, July 1, 2007; 148(7): 3449 - 3458. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maor, D. Mayer, R. I Yarden, A. V Lee, R. Sarfstein, H. Werner, and M. Z Papa Estrogen receptor regulates insulin-like growth factor-I receptor gene expression in breast tumor cells: involvement of transcription factor Sp1 J. Endocrinol., December 1, 2006; 191(3): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Larson, D. L. Osburn, K. Schmitz, L. Giampa, S.-M. Mong, K. Marschke, H. M. Seidel, J. Rosen, and A. Negro-Vilar Peptide Binding Identifies an ER{alpha} Conformation That Generates Selective Activity in Multiple In Vitro Assays J Biomol Screen, September 1, 2005; 10(6): 590 - 598. [Abstract] [PDF] |
||||
![]() |
J. Laganiere, G. Deblois, and V. Giguere Functional Genomics Identifies a Mechanism for Estrogen Activation of the Retinoic Acid Receptor {alpha}1 Gene in Breast Cancer Cells Mol. Endocrinol., June 1, 2005; 19(6): 1584 - 1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Chabbert-Buffet, G. Meduri, P. Bouchard, and I. M. Spitz Selective progesterone receptor modulators and progesterone antagonists: mechanisms of action and clinical applications Hum. Reprod. Update, May 1, 2005; 11(3): 293 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bjornstrom and M. Sjoberg Mechanisms of Estrogen Receptor Signaling: Convergence of Genomic and Nongenomic Actions on Target Genes Mol. Endocrinol., April 1, 2005; 19(4): 833 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Varshochi, F. Halim, A. Sunters, J. P. Alao, P. A. Madureira, S. M. Hart, S. Ali, D. M. Vigushin, R. C. Coombes, and E. W.-F. Lam ICI182,780 Induces p21Waf1 Gene Transcription through Releasing Histone Deacetylase 1 and Estrogen Receptor {alpha} from Sp1 Sites to Induce Cell Cycle Arrest in MCF-7 Breast Cancer Cell Line J. Biol. Chem., February 4, 2005; 280(5): 3185 - 3196. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gold, F. Kalush, J. Bergeron, K. Scott, N. Mitra, K. Wilson, N. Ellis, H. Huang, M. Chen, R. Lippert, et al. Estrogen Receptor Genotypes and Haplotypes Associated with Breast Cancer Risk Cancer Res., December 15, 2004; 64(24): 8891 - 8900. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Hopp, H. L. Weiss, I. S. Parra, Y. Cui, C. K. Osborne, and S. A. W. Fuqua Low Levels of Estrogen Receptor {beta} Protein Predict Resistance to Tamoxifen Therapy in Breast Cancer Clin. Cancer Res., November 15, 2004; 10(22): 7490 - 7499. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. R. Ee, S. Kamalakaran, D. Tonetti, X. He, D. D. Ross, and W. T. Beck Identification of a Novel Estrogen Response Element in the Breast Cancer Resistance Protein (ABCG2) Gene Cancer Res., February 15, 2004; 64(4): 1247 - 1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. McDonnell Mining the Complexities of the Estrogen Signaling Pathways for Novel Therapeutics Endocrinology, October 1, 2003; 144(10): 4237 - 4240. [Full Text] [PDF] |
||||
![]() |
T. Fujita, Y. Kobayashi, O. Wada, Y. Tateishi, L. Kitada, Y. Yamamoto, H. Takashima, A. Murayama, T. Yano, T. Baba, et al. Full Activation of Estrogen Receptor {alpha} Activation Function-1 Induces Proliferation of Breast Cancer Cells J. Biol. Chem., July 11, 2003; 278(29): 26704 - 26714. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. M. Kelley, B. G. Rowan, and M. Ratnam Modulation of the Folate Receptor {alpha} Gene by the Estrogen Receptor: Mechanism and Implications in Tumor Targeting Cancer Res., June 1, 2003; 63(11): 2820 - 2828. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tan-Chiu, J. Wang, J. P. Costantino, S. Paik, C. Butch, D. L. Wickerham, B. Fisher, and N. Wolmark Effects of Tamoxifen on Benign Breast Disease in Women at High Risk for Breast Cancer J Natl Cancer Inst, February 19, 2003; 95(4): 302 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vasudevan, S. Ogawa, and D. Pfaff Estrogen and Thyroid Hormone Receptor Interactions: Physiological Flexibility by Molecular Specificity Physiol Rev, October 1, 2002; 82(4): 923 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sathya, M. S. Jansen, S. C. Nagel, C. E. Cook, and D. P. MCDonnell Identification and Characterization of Novel Estrogen Receptor-{beta}-Sparing Antiprogestins Endocrinology, August 1, 2002; 143(8): 3071 - 3082. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Greco, E. A. Allegretto, M. J. Tetel, and J. D. Blaustein Coexpression of ER{beta} with ER{alpha} and Progestin Receptor Proteins in the Female Rat Forebrain: Effects of Estradiol Treatment Endocrinology, December 1, 2001; 142(12): 5172 - 5181. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Fitts, R. M. Klein, and C. A. Powers Estrogen and Tamoxifen Interplay with T3 in Male Rats: Pharmacologically Distinct Classes of Estrogen Responses Affecting Growth, Bone, and Lipid Metabolism, and Their Relation to Serum GH and IGF-I Endocrinology, October 1, 2001; 142(10): 4223 - 4235. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Clarke, F. Leonessa, J. N. Welch, and T. C. Skaar Cellular and Molecular Pharmacology of Antiestrogen Action and Resistance Pharmacol. Rev., March 1, 2001; 53(1): 25 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Davidge, Y. Zhang, and K. G. Stewart A comparison of ovariectomy models for estrogen studies Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2001; 280(3): R904 - R907. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hall, C.-y. Chang, and D. P. McDonnell Development of Peptide Antagonists That Target Estrogen Receptor {beta}-Coactivator Interactions Mol. Endocrinol., December 1, 2000; 14(12): 2010 - 2023. [Abstract] [Full Text] |
||||
![]() |
K.-M. Lau, M. LaSpina, J. Long, and S.-M. Ho Expression of Estrogen Receptor (ER)-{{alpha}} and ER-{beta} in Normal and Malignant Prostatic Epithelial Cells: Regulation by Methylation and Involvement in Growth Regulation Cancer Res., June 1, 2000; 60(12): 3175 - 3182. [Abstract] [Full Text] |
||||
![]() |
D. L. Stenoien, M. G. Mancini, K. Patel, E. A. Allegretto*, C. L. Smith, and M. A. Mancini Subnuclear Trafficking of Estrogen Receptor-{alpha} and Steroid Receptor Coactivator-1 Mol. Endocrinol., April 1, 2000; 14(4): 518 - 534. [Abstract] [Full Text] |
||||
![]() |
B. Saville, M. Wormke, F. Wang, T. Nguyen, E. Enmark, G. Kuiper, J.-A. Gustafsson, and S. Safe Ligand-, Cell-, and Estrogen Receptor Subtype (alpha /beta )-dependent Activation at GC-rich (Sp1) Promoter Elements J. Biol. Chem., February 25, 2000; 275(8): 5379 - 5387. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman and P. H. Brown Tamoxifen Prevention of Breast Cancer: an Instance of the Fingerpost J Natl Cancer Inst, November 3, 1999; 91(21): 1809 - 1819. [Full Text] [PDF] |
||||
![]() |
P. Webb, P. Nguyen, C. Valentine, G. N. Lopez, G. R. Kwok, E. McInerney, B. S. Katzenellenbogen, E. Enmark, J.-A. Gustafsson, S. Nilsson, et al. The Estrogen Receptor Enhances AP-1 Activity by Two Distinct Mechanisms with Different Requirements for Receptor Transactivation Functions Mol. Endocrinol., October 1, 1999; 13(10): 1672 - 1685. [Abstract] [Full Text] |
||||
![]() |
M. L. O'Brien, K. Park, Y. In, and O.-K. Park-Sarge Characterization of Estrogen Receptor-{beta} (ER{beta}) Messenger Ribonucleic Acid and Protein Expression in Rat Granulosa Cells Endocrinology, October 1, 1999; 140(10): 4530 - 4541. [Abstract] [Full Text] |
||||
![]() |
R. V. Weatherman and T. S. Scanlan Unique Protein Determinants of the Subtype-selective Ligand Responses of the Estrogen Receptors (ERalpha and ERbeta ) at AP-1 Sites J. Biol. Chem., February 2, 2001; 276(6): 3827 - 3832. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |