help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koszewski, N. J.
Right arrow Articles by Russell, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koszewski, N. J.
Right arrow Articles by Russell, J.
Molecular Endocrinology 13 (3): 455-465
Copyright © 1999 by The Endocrine Society

Turning a Negative into a Positive: Vitamin D Receptor Interactions with the Avian Parathyroid Hormone Response Element

Nicholas J. Koszewski, Sheila Ashok and John Russell

Department of Internal Medicine (N.J.K.) Division of Nephrology, Bone and Mineral Metabolism University of Kentucky Medical Center Lexington, Kentucky 40536-0084
Department of Medicine (S.A., J.R.) Albert Einstein College of Medicine Bronx, New York 10021


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] negatively regulates expression of the avian PTH (aPTH) gene transcript, and a vitamin D response element (VDRE) near the promoter of the aPTH gene had previously been identified. The present report assessed whether the negative activity imparted by the aPTH VDRE could be converted to a positive transcriptional response through selective mutations introduced into the element. The tested sequences were derived from individual and combined mutations to 2 bp in the 3'-half of the direct repeat element, GGGTCAggaGGGTGT. Cold competition experiments using mutant and wild-type oligonucleotides in the mobility shift assay revealed minor differences in the ability of any of these sequences to compete for binding to a heterodimer complex comprised of recombinant proteins. Ethylation interference footprint analysis for each of the mutants produced unique patterns over the 3'-half-sites that were distinct from the weak, wild-type footprint. Transcriptional outcomes evaluated from a chloramphenicol acetyltransferase reporter construct utilizing the aPTH promoter found that the individual T->A mutant produced an attenuated negative transcriptional response while the G->C mutant resulted in a reproducibly weak positive transcriptional outcome. The double mutant, however, yielded a 4-fold increase in transcription, similar to the 7-fold increase observed from an analogous construct using the human osteocalcin VDRE. UV light cross-linking to gapped oligonucleotides assessed the polarity of heterodimer binding to the wild-type and double mutant sequences and was consistent with the vitamin D receptor preferentially binding to the 5'-half of both elements. Finally, DNA affinity chromatography was used to immobilize heterodimer complexes bound to the wild-type and double mutant sequences as bait to identify proteins that may preferentially interact with these DNA-bound heterodimers. This analysis revealed the presence of a p160 protein that specifically interacted with the heterodimer bound to the wild-type VDRE, but was absent from complexes bound to response elements associated with positive transcriptional activity. Thus, the sequence of the individual VDRE appears to play an active role in dictating transcriptional responses that may be mediated by altering the ability of a vitamin D receptor heterodimer to interact with accessory factor proteins.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The hormonal form of vitamin D, 1,25-dihyroxyvitamin D3 [1,25-(OH)2D3], binds to its receptor to regulate the transcriptional activity of numerous genes (for review see Ref. 1). A number of DNA response elements to which the hormone-receptor complex binds with high affinity have been identified (2, 3, 4, 5, 6, 7, 8). The majority of known vitamin D response elements (VDREs) follow a direct repeat with 3-bp spacing (DR+3) format (7) and are associated with positive or increased transcription of the target gene message. With few exceptions (9, 10, 11, 12), high-affinity DNA-binding interactions by the vitamin D receptor (VDR) require heterodimerization with an accessory nuclear factor (13, 14, 15, 16), currently thought to consist of members of the retinoid X receptor (RXR) family of proteins (17, 18, 19). However, binding by a heterodimer to a DR+3 element implies an inherent polarity regarding the positioning of the individual proteins over each of the half-sites of the element. Recent results would suggest that the preferred orientation on the osteopontin and osteocalcin VDREs, sequences associated with positive gene-regulatory activity by the vitamin, place the VDR over the 3'-half-site with RXR occupying the 5' half-site (20, 21, 22).

The hormone, however, also negatively regulates expression of several gene products (23, 24, 25, 26, 27), including direct transcriptional effects on PTH gene expression (28, 29, 30, 31, 32). Response elements were identified that were in close proximity to the promoters of the avian and human PTH genes (28, 29). The avian PTH (aPTH) VDRE followed the classical DR+3 format while the hPTH VDRE appeared to function as a single half-site and may involve RXR-independent binding (33). In vitro DNA binding to the aPTH VDRE was shown to require heterodimerization of recombinant VDR with RXR-containing extracts, although interference footprinting results revealed only weak interactions over the two half-sites (29). As part of the same study, transient transfection experiments utilizing the aPTH VDRE demonstrated the element’s ability to down-regulate gene expression in response to hormone, either within the context of its natural position in the aPTH promoter or when linked to a heterologous promoter.

Negative gene regulation by other members of the steroid hormone receptor superfamily has also been described. Negative regulation of the bovine PRL gene by glucocorticoids was shown to occur by direct interaction of the glucocorticoid receptor with a negative glucocorticoid response element (GRE) that bore only a modest resemblance to a consensus GRE derived from positive regulatory elements (34, 35). Interestingly, when two mutations were introduced into this negative element, the transcriptional activity was transformed from negative to positive in response to hormone administration. That data, combined with additional evidence that GREs may act as allosteric regulators of glucocorticoid-mediated gene transcription (36, 37), give credence to the notion that individual DNA sequences may play an active role in dictating transcriptional responses.

As part of continuing studies on the aPTH gene, we noted that replacement of the wild-type negative VDRE in the aPTH promoter with the positively responding human osteocalcin (hOC) VDRE resulted in a strong positive transcriptional response to 1,25-(OH)2D3 administration in transient transfection studies (see Table 1Go). This indicated that the aPTH promoter could support both negative or positive transcriptional outcomes and suggested that the DNA sequence of the VDRE may actively participate in dictating the observed response. Given these preliminary observations, we systematically investigated the capacity to alter the negative transcriptional potential of the aPTH VDRE by directed mutagenesis of the wild-type element within the context of its natural promoter.


View this table:
[in this window]
[in a new window]
 
Table 1. Transcriptional Response of Wild-Type and Mutant aPTH Response Elements in OK Cells

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sequence comparisons with DR+3 VDREs known to elicit positive transcriptional responses (2, 3, 4, 5, 6, 7, 8), as well as comprehensive footprint data on positive VDREs (11), indicated the presence of highly conserved nucleotides throughout these motifs. Analysis of the aPTH VDRE revealed that it bore striking similarity to these sequences, save for the latter two positions in the 3'-half of the element (+6 and +7, Fig. 1Go). These positions are largely restricted to cytosine (+6) and adenine (+7) residues in the majority of positive VDREs, but are relegated to guanine and thymidine residues in the wild-type aPTH element. Thus, in the present study, mutations were introduced into these positions comprised of single conversions of G->C at +6 (cPTH) and T->A at the +7 position (mPTH) because of the aforementioned high conservation of those nucleotides in positive DR+3 VDREs. A double mutant (dmPTH) was also created by changing the GT at positions +6/+7 to CA to generate a perfect direct repeat of the GGGTCA hexanucleotide half-site, similar to a sequence previously shown to be an enhancer of vitamin D actions (7). Notably, this represents a conversion from a purine/pyrimidine to a pyrimidine/purine dinucleotide ending.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Sequences and Numbering Scheme of DR+3 Sequences Used in the Study

Sequence of the aPTH VDRE is highlighted with the numbering scheme of the various nucleotide positions listed above. Shown below are the sequences of the mutants and the positive control hOC VDRE. Abbreviations are defined in the text.

 
Specific binding to the aPTH sequence was evaluated in the gel shift assay using recombinant human VDR (rhVDR) and RXR{alpha} (rhRXR{alpha}) extracts (Fig. 2Go). No binding was observed by either extract alone (lanes 1 and 2), and while binding was observed in the absence of hormone, addition of 1,25-(OH)2D3 resulted in a 2-fold stimulation of binding under these conditions (lanes 3 and 4). The anti-VDR antibody, 9A7{gamma}, was able to block the appearance of the bound band while generating a minor supershifted complex, and inclusion of an anti-RXR{alpha} antibody was able to supershift the complex indicating that both proteins were part of the bound complex (lanes 5 and 11). Competition with an excess of unlabeled aPTH or hOC double-stranded oligonucleotides prevented observation of the bound radiolabeled complex, while the perfect estrogen response element from the chicken vitellogenin II (cvitERE) gene had no effect on the complex (lanes 7–9). Analogous results were obtained using radiolabeled probes for each of the other mutant aPTH VDRE sequences (data not shown), indicating that the mixture of rhVDR/rhRXR{alpha} was required and bound to the these sequences in a specific manner.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 2. EMSA Analysis of rhVDR/rhRXR{alpha} Binding to the aPTH VDRE

The gel shift assay showing binding by rhVDR cytosol (lane 1); rhRXR{alpha} cytosol (lane 2), mixture of rhVDR/rhRXR{alpha} cytosols in the absence (lane 3) and presence (lane 4) of hormone; 9A7{gamma} anti-VDR monoclonal antibody (lane 5); control rat serum (lane 6); 200-fold excess of cold aPTH VDRE oligonucleotide (lane 7); 200-fold excess of cvitERE (lane 8); 200-fold excess of hOC VDRE (lane 9); control binding of rhVDR/rhRXR{alpha} binding to aPTH in the presence of normal rabbit serum (lane 10); addition of anti-RXR{alpha} polyclonal antibody (lane 11); addition of anti-RXRß polyclonal antibody (lane 12).

 
Relative competitive binding curves were generated for the heterodimer complex using a fixed amount of radiolabeled aPTH VDRE and varying concentrations of the cold wild-type and mutant oligonucleotides (Fig. 3Go). Based on an analysis of the half-maximal competition curves, the data indicate that the dmPTH oligonucleotide was approximately 3 to 4 times more effective at competing for heterodimer binding to the aPTH probe than either the wild-type sequence or the cPTH mutant oligonucleotide. The mPTH sequence was the least effective competitor of these four oligonucleotides in this analysis. Furthermore, additional mutant oligonucleotides were evaluated that replaced highly conserved guanine dinucleotide positions in the 5'-half of the wild-type element (5'Mut, positions -5 and -6, GG->CC) or in the 3'-half of the element (3'Mut, positions +3 and +4, GG->CC). Neither of these latter mutants was effective at competing for binding by the heterodimer, although the 3'Mut, which retained the intact GGGTCA 5'-half-site, produced a modest reduction in the bound band at the highest tested concentration. This indicates the importance of both half-sites in binding by the heterodimeric complex.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Competition of Wild-Type and Mutant Oligonucleotides for Binding to the Wild-Type Element

Variable amounts of aPTH (open squares), mPTH (solid squares), cPTH (solid triangles), dmPTH (solid diamonds), 5'Mut (cross-marks), and 3'Mut (open diamonds) oligonucleotides were mixed with a fixed amount of radiolabeled aPTH VDRE in gel shift experiments using a constant concentration of rhVDR/rhRXR{alpha} heterodimer. After separation of bound and free probe, the samples were analyzed for the amount of bound complex and normalized against a control binding reaction of the heterodimer with no cold competitor added. Shown are the average values and SEs from two (5'- and 3'Mut) or three (all others) independent experiments.

 
Earlier interference footprint studies examining the interactions of partially purified canine intestinal VDR with the aPTH VDRE revealed a group of weak, major groove contact points in the DR+3 element (29). In an effort to discern potential differences in DNA-binding interactions, ethylation interference footprints were generated for the recombinant proteins bound to the wild-type and mutant sequences. Ethylation of the wild-type probe and its use in the interference assay with the recombinant proteins revealed a footprint analogous to that produced by the canine VDR and consistent with dimer binding (Fig. 4aGo). Weak interference was observed over the modified guanines at positions -7 to -5 and +2 to +4. On the opposite strand (data not shown), weak interference was again seen over the TGA sequence at -2' to -4', with even less pronounced interactions over the ACA at +5' to +7'.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 4. Ethylation Interference Analysis of Binding to the aPTH and Mutant Sequences

Ethylation interference was used to examine binding by the rhVDR/rhRXR{alpha} heterodimer to the aPTH (a), mPTH (b), cPTH (c), and dmPTH (d) modified probes. Sequences are indicated, and the corresponding guanine triplet areas are bracketed. B, Bound fraction from mobility shift separation; F, free probe from mobility shift separation; C, a portion of each ethylated probe was withheld from the footprint analysis and treated in an analogous fashion to the B and F samples to generate a control cleavage pattern. It was noted that significantly less F sample was evident in the mobility shift separation using the dmPTH-modified probe; thus, the decreased intensity of noninterfering bands was observed in the subsequent cleavage and sequencing gel analysis. (e) Overlays of the footprints from the 3'-halves of each of the sequences in panels a–d is shown (solid lines). For comparative purposes, an overlay of the control cleavage (C) of the ethylated aPTH sequence (dashed line) is included as a point of reference in each case.

 
The interference footprint of the top strand of the mPTH mutant exhibited a modest departure from the wild-type sequence (Fig. 4bGo). Notably, interactions were again evident at the +2 to +4 guanine positions, but they now displayed a measurable increase in the degree of interference, with the strongest occurring at the +2 and +3 positions. The opposite strand exhibited a slight gain in interference over the +5' to +7' positions (data not shown). The strands of the other single mutant, cPTH, produced a unique footprint pattern that was now significantly altered from the previous observations (Fig. 4cGo). Interference over the guanine triplet at +2 to +4 was again evident; however, very strong interference was now observed over the modified guanine at +3, with a more modest gain in interference evident at the +4 guanine. Significant increases in interference were also observed over the -7 to -5 guanine triplet in the 5'-half of the element as well as additional degrees of contact over the corresponding AGA at +5' to +7' on the opposite strand (data not shown).

The interference footprint of the double mutant deviated significantly from the previously examined wild-type and single-mutant sequences (Fig. 4dGo). Strong, nearly complete interference was observed over the guanine residues at +2/+3, and as noted for the cPTH mutant, there was significant interference over the guanines at -5/-6. In addition, interference in the opposite strand was now strongly evident over the pair of TGA sequences at +5' to +7' and -2' to -4' (data not shown). The overall pattern of interference for the dmPTH was similar in nature to the strong interference seen for the osteopontin (11) and osteocalcin VDREs (N. J. Koszewski, unpublished observations), both of which are known to be strong positive regulators of vitamin D-stimulated gene transcription (2, 3, 5). A densitometric analysis is presented in Fig. 4eGo to depict the changes that occurred in the footprint patterns over the 3'-halves of each of the sequences. These range from a very modest degree of interference observed as a result of the heterodimer complex binding to the wild-type aPTH VDRE to the very strong, almost complete, interference observed with the dmPTH sequence. As an initial point of reference, a control cleavage pattern generated from a portion of the chemically modified aPTH VDRE probe not used in the separation analysis is also included in each graph (dashed line).

Ribonuclease protection assays were next used to assess the transcriptional response to administration of 1,25-(OH)2D3 to OK cells transfected with reporter constructs containing wild-type or mutant VDREs upstream from the aPTH promoter linked to the chloramphenicol acetyl transferase (CAT) gene (Table 1Go). In transfection studies using plasmid constructs containing the wild-type aPTH VDRE, treatment with 1,25-(OH)2D3 inhibited CAT mRNA transcripts by 54%, similar to earlier observations using CAT enzyme activity itself to assess gene expression (29). Substitution of the wild-type sequence with the mPTH VDRE resulted in approximately 50% attenuation of the inhibitory effect of 1,25-(OH)2D3 (-54% vs. -28%). More interestingly, the single mutation of G->C at position +6 (cPTH) now resulted in a modest, but highly reproducible, increase (+21%) of CAT gene transcripts in response to hormone. Finally, transfection with the plasmid construct containing the dmPTH sequence resulted in a dramatic increase (~4-fold) in CAT gene transcription, similar to the 7-fold increase observed with the prototypical positive hOC VDRE used as a positive control in these experiments.

Selected mutations within the wild-type aPTH response element were able to alter the points of DNA contact as delineated by the interference assay in conjunction with a graded response from negative to positive in hormone-stimulated transcriptional activity. However, heterodimeric interactions by the RXR/VDR complex with a direct repeat response element implies an order or polarity of the individual proteins with respect to DNA binding. Previous studies demonstrated that RXR occupies the 5'-half and VDR the 3'- half of VDREs isolated from genes that are up-regulated by the vitamin (20, 21, 22, 38). In light of the negative regulation imparted by the wild-type aPTH sequence, and the clearly positive response obtained with the dmPTH element, we sought to ascertain whether this might not be the result of an altered polarity of the proteins binding to these elements. Using a strategy of gapped oligonucleotides and UV light cross-linking (39), proteins in contact with the 5'- and 3'-halves of both of these VDREs were analyzed.

As noted in Fig. 5Go, cross-linking to either half of both the aPTH and dmPTH sequences gave similar results. Control cross-linking to either 5' sequence yielded two prominent bands at approximately 59 and 82 kDa, which was consistent with linked oligonucleotides to rhVDR and rhRXRß, respectively. Specific competition with an excess amount of hOC VDRE resulted in the disappearance of both bands; however, competition with an excess of the nonspecific cvitERE had a dramatic effect on either eliminating or strongly reducing the intensity of the 82-kDa band, while a more modest effect on the 59-kDa band was observed. This suggests that the 82-kDa band is not specific and these results would be consistent with a polarity of binding that places rhVDR in the 5'-position. Using the same type of analysis, cross-linking to the 3'-halves of both elements resulted in the most prominent, specific band at 82 kDa, indicative of hRXRß linked to the respective 3'-oligonucleotides. Thus, while the polarity appears reversed for the wild-type negative element from other known positive VDREs, this alignment is maintained in the dmPTH mutant sequence that elicits a positive transcriptional response. Therefore, an altered polarity by itself cannot account for the negative to positive transcriptional response observed with these two sequences.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 5. UV Cross-Linking of Gapped, Radiolabeled 5'- and 3'-Oligonucleotides Corresponding to the aPTH or dmPTH Sequences

Recombinant hVDR and hRXRß cytosols were mixed with the appropriately labeled gapped oligonucleotides and irradiated at 254 nm, and the products were separated by SDS-PAGE. C, Control binding conditions; hOC, a 200-fold excess of unlabeled osteocalcin probe was added to the binding reaction before cross-linking; ERE, a 200-fold excess of unlabeled cvitERE was added to the binding reaction before cross-linking. Recombinant hRXRß was used in this experiment as it offered a clearer separation of denatured proteins (recombinant hVDR = 49–50 kDa; hRXRß = 68–70 kDa).

 
The polarity of binding by the heterodimer appeared the same for these two elements, yet there were distinct changes in the footprint patterns that suggested a difference in the manner in which the heterodimer bound to one sequence vs. the other. Given this possibility, we assessed whether there might be differences in proteins that may interact with the heterodimer bound to these two sequences. To test this scenario, oligonucleotide matrices were generated for either the wild-type or double-mutant sequences. These were prebound with saturating concentrations of recombinant extracts of rhVDR/rhRXR{alpha} in the presence of 1,25-(OH)2D3 and washed with a moderately high-salt (200 mM KCl) buffer to limit binding by nonspecific proteins. These matrices were then equilibrated in a low-salt buffer and incubated with extracts prepared from MG-63 cells, a human osteoblastic cell line, that permitted having human recombinant receptors interacting with human-derived cofactors. After this, the matrices were washed extensively with low-salt buffer, and all of the proteins were recovered in a high-salt wash and analyzed by SDS-PAGE and silver staining. As a further set of controls, the hOC VDRE and a DR+1 known to bind RXR homodimers (40, 41) were similarly prepared. In the latter case, the column was prebound with rhRXR{alpha} extracts alone in the presence of 9-cis-retinoic acid.

As expected, rhVDR and rhRXR{alpha} were readily evident in the elutions from the matrices in comparable amounts (Fig. 6Go). Several proteins, including a cluster in the range of 45–47 kDa and a 240-kDa band, appeared in all four eluted samples, although the 45-kDa band was more prominently observed in the hOC elution with little of the 47-kDa band evident. In addition, a protein at 50 kDa appeared more intensely in the elutions from the columns bound with VDR/RXR{alpha} heterodimer complexes than in the rhRXR{alpha} homodimer experiment. A pair of intense bands at approximately 60 and 54 kDa from the MG-63 cell extract, above and below the position of rhRXR{alpha}, appeared to specifically associate with the heterodimer complex bound to the hOC VDRE and were not evident in the other elutions. A 98-kDa protein appeared in elutions from both the hOC and aPTH VDRE affinity columns, but did not appear in the other columns. Interestingly, the profile from the aPTH column yielded one unique band at approximately 160 kDa that was not observed in any of the other elutions. Analogous profiles from the four columns were obtained from complexes formed in the absence of ligands in the binding mixtures (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Protein-Protein Contacts Made to Complexes Bound to Different Response Elements

Binding of rhVDR/rhRXR{alpha} to the aPTH, dmPTH, or hOC-linked columns, or rhRXR{alpha} to a DR+1-linked columns was followed by washing of the matrices and incubation with MG-63 cell extracts. After washing in low-salt buffer, the proteins were eluted and analyzed by SDS-PAGE and silver staining.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
These results demonstrate a link between the sequence of the individual nucleotides comprising a steroid response element and the subsequent activity of a hormone-receptor complex. As determined by the mobility shift assay, both wild-type and mutant sequences fulfilled the criteria of specific binding. Interestingly, the 9A7{gamma} antibody directed against the hinge region of the VDR generated a minor, but significant, supershifted band in the mobility shift assay (Fig. 2Go). Previous work with this antibody under identical conditions using positively responding VDREs demonstrated that binding of the VDR was blocked, and no bound or supershifted products were observed (11, 29). Collectively, these data would be consistent with an altered conformational change in the VDR and/or an altered polarity of binding by the heterodimer to these different types of VDREs.

Interference footprinting is predicated on the concept that limited chemical modifications to singular positions in a DNA binding site may preclude the ability of a protein to bind to that site, either through steric, structural, or electrostatic perturbations to the DNA, and thus be excluded from the bound fraction during the separation procedure. Interactions of the heterodimer with the wild-type and mutant sequences appeared highly specific using recombinant sources of receptor proteins, and there were only minor differences between these sequences in their ability to compete for binding in the relative competitive binding electrophoretic mobility shift assay (EMSA). Yet distinct footprints were evident for each DR+3, suggesting different modes of interaction by the heterodimeric partners. This implies that the heterodimer complex may be making additional contacts within the various sequences with individual nucleotides not examined in this study or that the bound complex is able to somehow accommodate these uniquely modified positions. In the case of the aPTH VDRE then, this latter possibility suggests that any single modification by itself may not be sufficient to entirely block the complex from still binding to that sequence.

Surprisingly, the mPTH sequence that placed an adenine residue at position +7, which is highly conserved in the majority of positive DR+3 VDREs (1), caused only a minor shift in the footprint analysis and demonstrated only a moderate attenuation of the negative response in the transcription assay. Conversely, the significant increase in the degree of interference observed by the G->C swap at position +6 in the cPTH mutant, together with the observed weak, yet clearly positive transcriptional response, revealed the relative importance this position may exert in acting as a ‘switch’ to distinguish negative and positive activity. Finally, the dmPTH sequence that exhibited the strongest interference footprint pattern also displayed the strongest, positive transcriptional response. This sequence is a perfect direct repeat of the GGGTCA half-site, highly similar to DNA elements associated with positive transcriptional responses (1, 7). In addition, binding site selection analyses indicated that the preferred DNA-binding sequence of the heterodimer ended in the CA dinucleotide (positions -3/-2 and +6/+7) for both half-sites (12, 42). However, other than the dmPTH sequence, there was no strong association between the order of competition in the EMSA, dmPTH -> aPTH ~ cPTH -> mPTH, and the rank order of transcriptional outcomes from strongly positive to strongly negative: dmPTH -> cPTH -> mPTH -> aPTH. This suggests that factors other than binding avidity may be playing a role in determining transcriptional activity.

In contrast to previous reports on other VDREs (20, 21, 22, 43), the cross-link data place RXR preferentially over the 3'-half of both the aPTH and dmPTH elements. Preliminary results would indicate that this arrangement may also hold for a VDRE recently identified in the rat PTH gene that exhibits striking sequence similarity to the avian element (J. Russell, S. Ashok, and N. J. Koszewski, manuscript submitted). Previous data demonstrated that the VDR can bind as a homodimer to a DR+3 element (9, 11, 12), indicating that the VDR is capable of occupying the 5' half-site of a VDRE. The retinoid receptors have also been reported to display an altered polarity in binding to selected response elements that resulted in enhanced or repressed transcriptional activity (44). However, an altered polarity by itself did not restrict the VDR heterodimer complex to a unique transcriptional outcome in the present study, as exhibited by the wild-type aPTH and dmPTH sequences that maintained the same polarity, but with opposing transcriptional responses.

The VDR, like other members of the nuclear receptor gene family, has also been shown to interact with a variety of accessory proteins (45, 46, 47, 48, 49, 50). In the studies with the transcriptionally negative aPTH element, binding to that sequence by the heterodimer generated a weak interference footprint and promoted unique interaction with a p160 protein. In contrast, heterodimer binding to the positive hOC and dmPTH sequences, the latter that differed by only two nucleotides from the aPTH element, failed to exhibit an interaction with this protein. The elution from the hOC affinity column also revealed the significant presence of additional proteins at approximately 60 and 54 kDa that appeared specific for this sequence. This may reflect proteins from human osteoblast-like cells associating with the recombinant human heterodimer complex bound to a regulatory sequence from a gene that is naturally expressed in these cells (51). Additional studies are ongoing, but the relative presence or absence of these proteins may be involved in the observed negative or positive transcriptional responses from these specific response elements.

It was noted that essentially identical elution profiles from the affinity chromatography columns have been obtained from complexes bound in the presence or absence of added vitamin D hormone. A similar lack of hormone dependence was also observed in analogous experiments using HeLa cell nuclear extracts (data not shown). There may be several reasons to account for this observation, the first of which may be an inherent lack of sensitivity in this experimental system. Either in the presence or absence of hormone, a relatively large amount of affinity-purified hVDR/hRXR complex was immobilized on these VDRE columns relative to the interacting factors present in the diluted cell extracts. Also, the binding conditions and washes for the affinity columns were performed under low-salt conditions. Thus, if the effect of hormone is to alter the affinity for an interacting protein, then having such an excess amount of complex in either a hormone-bound or unbound state under low-salt conditions may simply transcend those affinity differences and result in an inability to visualize hormone-dependent interactions. Alternatively, this experiment may be revealing only those basal, hormone-independent interactions that occurred in an element-specific fashion. That is, these factors may associate with the VDR complex as it binds to these VDREs to assist in achieving the proscribed regulatory response, while the function of the hormone is to recruit yet additional factors not revealed by this analysis.

A general working model has appeared in the literature that incorporates many of the current concepts in explaining activation of gene expression by the thyroid/retinoid subfamily of nuclear receptors, to which the VDR belongs (52). The chromatin remodeling scheme proposes that the unliganded receptor binds to its response element as part of a multiprotein complex that also includes corepressor or silencer molecules and histone deacetylases. In this state, transcription of the target gene is repressed or silenced. Hormone binding is proposed to alter the conformation of the receptor complex, and transcriptional coactivators are recruited to the scene along with histone acetylases, and gene transcription is turned on. While accounting for enhancement of gene transcription, a question arises as to what factors are involved that would explain hormone-dependent repression and activation in the same cell. The present data suggest that an additional detail to consider is the specific sequence of the DNA-binding site. That is, beyond the potential role in binding affinity, the subtle and not-so-subtle differences in DNA sequences capable of binding the VDR specifically may be acting as allosteric effectors of receptor function (36, 37, 53, 54). Binding of the VDR to different types of response elements, therefore, is proposed to elicit conformational changes in the receptor complex and/or the exposure of different regions of the molecule to the external environment, similar in concept to agonist or antagonist binding to the ligand-binding domains of hormone receptors. Collectively, this suggests that plasticity exists in the VDR/RXR heterodimer arrangement and corresponding transcriptional response that is inextricably associated with the exact DNA sequence (55, 56). These changes in the VDR complex invoked by binding to distinct DNA response elements may then facilitate the interaction of available cell type-specific coactivators or corepressors to bring about the desired transcriptional response.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
General
All enzymes were purchased from New England Biolabs (Beverly, MA). {gamma}32P-ATP (6000 Ci/mmol) and {alpha}32P-dATP (3000 Ci/mmol) were purchased from Dupont NEN Research Products (Wilmington, DE). Oligonucleotides were synthesized at the University of Kentucky Molecular Structure Analysis Facility with BamHI- and XbaI-compatible ends and cloned into pGEM11zf (Promega Corp, Madison, WI). Sequences were confirmed by dideoxysequencing. Sequences of the top strands are as follows: aPTH, 5'-CTAGAATGAGGGTCAGGAGGGTGTGCTGG; mPTH, CTAGAATGA-GGGTCAGGAGGGTGAGCTGG; cPTH, CTAGAGAGGGTCAGGAGGGTCTGCG; dmPTH, CTAGAGAGGGTCAGGA-GGGTCAGCG; hOC, CTAGATTGGTGACTCACCGGGTGAACGGGGGCATTGCG. The aPTH promoter sequence was synthesized by PCR and ligated into a commercially available pCAT expression vector using the SalI and XbaI restriction sites present in the multiple cloning site. Synthetic oligonucleotides containing the sequences for wild-type aPTH, the various aPTH mutants, and wild-type hOC VDREs were excised from pGEM11zf with the combination of SalI and HindIII and placed immediately upstream from the aPTH promoter/pCAT construct. The 9A7{gamma} antibody was generously provided by Dr. J. Wesley Pike (University of Cincinnati), while the anti-RXR{alpha} and anti-RXRß antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

Mobility Shift Assays
Recombinant hVDR- and hRXR{alpha}-containing extracts were prepared from baculovirus-infected Sf9 insect cells as described previously (11). The cell pellets were homogenized in 6 volumes of buffer [20 mM Tris (pH 7.5), 1 mM EDTA, 2 mM dithiothreitol (DTT), 350 mM KCl, 10 mM NaF, 100 µM Na3VO4, 0.1 mM leupeptin, and 10% glycerol] on ice. The cytosols were clarified by centrifugation at 30,000 x g for 60 min at 4 C, snap-frozen, and stored at -70 C before use. For radiolabeling, DNA fragments were excised from the pGEM11zf-based plasmids using the combination of EcoRI and HindIII restriction enzymes. Radioactive probes were generated by fill-in labeling reactions using Klenow fragment and {alpha}-32P-dATP. Cytosols of recombinant hVDR and hRXR{alpha} were diluted 1:25 in ice-cold KTEDG buffer [400 mM KCl, 20 mM Tris (pH 7.5), 1 mM EDTA, 2 mM DTT, and 10% glycerol] before use. Samples were kept cold, and 1 µl each of diluted extracts was used in a 20 µl final volume in a buffer that included 100 mM KCl, 20 mM Tris (pH 7.5), 1.5 mM EDTA, 2 mM DTT, 5% glycerol, 0.5% 3-(3-cholamidopropyl)dimethylammonio-1-propanesulfonate (CHAPS), 10 mM NaF, 100 µM Na3VO4, 1.0 µg dIdC, and 100 nM 1,25-(OH)2D3. After incubation on ice, the radiolabeled probes were added and incubation continued for 1 h. The samples were then applied to cooled, prerun 5% polyacrylamide gels (29:1) in 0.5x Tris-borate-EDTA buffer, and electrophoresis was initiated at 14 V/cm for 3 h. Gels were transferred and dried followed by autoradiography.

Antibodies (1 µl each of undiluted sample) were allowed to incubate with the gel shift samples for 1 h at 4 C before the addition of the radiolabeled probes. Cold competition binding reactions were carried out using the cvitERE (5'-GATCCCTGGTCAGCGTGACCGGAG) and hOC VDRE (5'-CTAGATTGGTGACTCACCGGGTGAACGGGGGCATTGCG). For the relative competitive binding experiments, recombinant cytosols were diluted 1:50, and unlabeled competitor oligonucleotide samples were mixed with radiolabeled wild-type aPTH probe and this combination was added to the binding reactions.

Interference Assay
The ethylation interference footprints were obtained as previously described (11). The DNA probes were generated from the pGEM11z-based plasmids containing the inserted oligonucleotides by end-labeling linearized, CIP-treated plasmids with polynucleotide kinase and {gamma}-32P-ATP using the combination of EcoRI and HindIII restriction enzymes. Briefly, 32P-end-labeled DNA probes in 50 mM sodium cacodylate buffer (pH 8.0) were treated with ethylnitrosourea-saturated ethanol for 20 min at 55 C. After precipitation with sodium acetate/ethanol and reprecipitation (three times), the pellets were washed with 70% ethanol, dried, and resuspended in water. Ethylated probes were then used in the gel mobility shift assay as above, except the amounts of probe were increased to 10–15 fmol. Acrylamide sections corresponding to bound and free DNA were excised, and the DNA was recovered by electrochemical elution and precipitation. Cleavage of the modified DNA was accomplished by treating with 100 mM NaOH/0.1 mM EDTA in 10 mM phosphate buffer at 95 C for 30 min followed by neutralization with 3 M sodium acetate (pH 5.2) and precipitation with ethanol. Samples were separated by 8% sequencing gels and dried, and autoradiography was performed followed by densitometric analysis.

Transfection Studies
OK cells were cotransfected by lipofectin as previously described with the appropriate VDRE-CAT construct (2.5 µg, Fig. 1Go) and cytomegalovirus (CMV)-ß-galactosidase (2.5 µg) plasmids (29). Analysis of CAT gene transcripts after treatment with 1,25-(OH)2D3 for 24 h was quantified by ribonuclease protection assay within the same assay. Total RNA from OK cells transfected with the various PTH-CAT and CMV-ß-galactosidase plasmid constructs was prepared by extraction with phenol-guanidinium thiocyanate. The RNA extracts were incubated with DNase I for 5 min at room temperature and ethanol precipitated. The RNA pellets were incubated with radiolabeled RNA probes (158 bases for CAT and 370 bases for ß-galactosidase) in 20 µl of buffer containing 80% formamide, 100 mM sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA, overnight at 43 C. The hybridization mixtures were digested with a combination of ribonuclease A and ribonuclease T1 at 37 C for 30 min. The protected RNA hybrids were precipitated with propanol-guanidinium thiocyanate and separated on 6% nondenaturing polyacrylamide gels. The gels were dried and exposed to x-ray film for 6 h at -80 C. The resulting autoradiograms were quantified by densitometric scanning, and values for the CAT gene transcripts were normalized with respect to the values for cotransfected ß-galactosidase gene transcripts.

UV Cross-Linking
The 5'- or 3'-oligonucleotides (5': GCATCTAGAATGAGGGBrUCAGG; 3': AGGGBrUGBrUGCTGGATCCCTCGA) of the aPTH were end-labeled with {gamma}-32P-ATP and T4 polynucleotide kinase. The labeled oligonucleotides were mixed with an excess of the other unlabeled oligonucleotide and annealed to the complementary sequence. After hybridization, the double-stranded oligonucleotides were purified by 8% PAGE and recovered by electroelution. The hybridized DNA fragments were then included in incubations as described above for the mobility shift assay except the amount of recombinant cytosols was increased 2.5-fold, and 100,000 cpm of gapped, radiolabeled probes were added. The sample tubes were maintained on ice and irradiated for 45 min at a wavelength of 254 nm. After irradiation, the binding reactions were mixed with 2x SDS-PAGE loading buffer and denatured at 95 C for 5 min, and the proteins were separated by 10% SDS-PAGE. After electrophoresis the gels were fixed and dried, and autoradiography was performed. Cross-linking probes for the dmPTH (5': CCGCATCTAGAGAGGGBrUCAGG; 3': AGGGBrUCAGCGGATCCCTCGAG) were prepared and treated in an analogous fashion.

Affinity Chromatography Studies
Oligonucleotide probes biotinlyated at the 5'-end for aPTH and dmPTH were synthesized as above, annealed to their complementary strand, and bound to streptavidin-agarose beads. In addition, a DR+1 matrix was similarly prepared (5'-GATCCGGGTAGGGGTCAGAGGTCACTCGT). Binding reactions of a mixture of rhVDR and rhRXR{alpha} in the presence of 1,25-(OH)2D3 or rhRXR{alpha} alone in the presence of 9-cis-retinoic acid (10 µM) were prepared as outlined above, but in amounts to completely saturate binding to the response elements present in each column. After incubation of the recombinant proteins with the agarose matrices for 60 min at 4 C, the matrices were washed with approximately 50 volumes of KTEDG-200 buffer. After this, the columns were reequilibrated in 10 volumes of KTEDG-60 buffer. Whole-cell extracts were prepared from human osteosarcoma MG-63 cells as outlined above and diluted to 60 mM KCl concentration. The MG-63 extracts were then mixed with the agarose matrices at 4 C for 60 min and then washed with approximately 50 volumes of KTEDG-60 buffer. The bound proteins were subsequently eluted by incubation with KTEDG-400 buffer, denatured, separated by 10% SDS-PAGE, and silver stained.


    ACKNOWLEDGMENTS
 
The authors would like to Ms. Holli Gravatte for her excellent technical assistance and Dr. M. C. Langub for his critical review of this manuscript.


    FOOTNOTES
 
Address requests for reprints to: Dr. Nicholas J. Koszewski, University of Kentucky Medical Center, Department of Internal Medicine, Division of Nephrology, Bone and Mineral Metabolism, 800 Rose Street, Lexington, Kentucky 40536-0084. E-mail: njhosz0{at}pop.uky.edu

This work was supported by NIH Grants DK-47883 (N.J.K.), DK-38422 (J.R.), and Dialysis Clinic Incorporated (N.J.K.).

Received for publication May 14, 1998. Revision received November 20, 1998. Accepted for publication November 30, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Haussler MR, Whitfield GK, Haussler CA, Hsieh J-C, Thompson PD, Selznick SH, Dominguez CE, Jurutka PW 1998 The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13:325–349[CrossRef][Medline]
  2. Kerner SA, Scott RA, Pike JW 1989 Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci USA 86:4455–4459[Abstract/Free Full Text]
  3. Noda M, Vogel RL, Craig AM, Prahl J, DeLuca HF, Denhardt DT 1990 Identification of a DNA sequence responsible for binding of the 1,25- dihydroxyvitamin D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (SPP-1 or osteopontin) gene expression. Proc Natl Acad Sci USA 87:9995–9999[Abstract/Free Full Text]
  4. Ohyama Y, Ozono K, Uchida M, Shinki T, Kato S, Suda T, Yamamoto O, Noshiro M, Kato Y 1994 Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 269:10545–10550[Abstract/Free Full Text]
  5. Ozono K, Liao J, Kerner SA, Scott RA, Pike JW 1990 The vitamin D-responsive element in the human osteocalcin gene. Association with a nuclear proto-oncogene enhancer. J Biol Chem 265:21881–21888[Abstract/Free Full Text]
  6. Terpening CM, Haussler CA, Jurutka PW, Galligan MA, Komm BS, Haussler MR 1991 The vitamin D-responsive element in the rat bone Gla protein gene is an imperfect direct repeat that cooperates with other cis-elements in 1,25- dihydroxyvitamin D3-mediated transcriptional activation. Mol Endocrinol 5:373–385[Abstract/Free Full Text]
  7. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  8. Zierold C, Darwish HM, DeLuca HF 1995 Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. J Biol Chem 270:1675–1678[Abstract/Free Full Text]
  9. Cheskis B, Freedman LP 1994 Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR) homodimers into VDR-retinoid x receptor heterodimers. Mol Cell Biol 14:3329–3338[Abstract/Free Full Text]
  10. Freedman LP, Arce V, Perez Fernandez R 1994 DNA sequences that act as high affinity targets for the vitamin D3 receptor in the absence of the retinoid X receptor. Mol Endocrinol 8:265–273[Abstract/Free Full Text]
  11. Koszewski NJ, Reinhardt TA, Horst RL 1996 Vitamin D receptor interactions with the murine osteopontin response element. J Steroid Biochem Mol Biol 59:377–388[CrossRef][Medline]
  12. Nishikawa J, Kitaura M, Matsumoto M, Imagawa M, Nishihara T 1994 Difference and similarity of DNA sequence recognized by VDR homodimer and VDR/RXR heterodimer. Nucleic Acids Res 22:2902–2907[Abstract/Free Full Text]
  13. Liao J, Ozono K, Sone T, McDonnell DP, Pike JW 1990 Vitamin D receptor interaction with specific DNA requires a nuclear protein and 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 87:9751–9755[Abstract/Free Full Text]
  14. Sone T, Kerner S, Pike JW 1991 Vitamin D receptor interaction with specific DNA. Association as a 1,25-dihydroxyvitamin D3-modulated heterodimer. J Biol Chem 266:23296–23305[Abstract/Free Full Text]
  15. Sone T, Ozono K, Pike JW 1991 A 55-kilodalton accessory factor facilitates vitamin D receptor DNA binding. Mol Endocrinol 5:1578–1586[Abstract/Free Full Text]
  16. Ross TK, Moss VE, Prahl JM, DeLuca HF 1992 A nuclear protein essential for binding of rat 1,25-dihydroxyvitamin D3 receptor to its response elements. Proc Natl Acad Sci USA 89:256–260[Abstract/Free Full Text]
  17. MacDonald PN, Dowd DR, Nakajima S, Galligan MA, Reeder MC, Haussler CA, Ozato K, Haussler MR 1993 Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1,25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene. Mol Cell Biol 13:5907–5917[Abstract/Free Full Text]
  18. Munder M, Herzberg IM, Zierold C, Moss VE, Hanson K, Clagett-Dame M, DeLuca HF 1995 Identification of the porcine intestinal accessory factor that enables DNA sequence recognition by vitamin D receptor. Proc Natl Acad Sci USA 92:2795–2799[Abstract/Free Full Text]
  19. Yu VC, Delsert C, Andersen B, Holloway JM, Devary OV, Naar AM, Kim SY, Boutin JM, Glass CK, Rosenfeld MG 1991 RXR beta: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67:1251–1266[CrossRef][Medline]
  20. Jin CH, Pike JW 1996 Human vitamin D receptor-dependent transactivation in Saccharomyces cerevisiae requires retinoid X receptor. Mol Endocrinol 10:196–205[Abstract/Free Full Text]
  21. Lemon BD, Freedman LP 1996 Selective effects of ligands on vitamin D3 receptor- and retinoid X receptor-mediated gene activation in vivo. Mol Cell Biol 16:1006–1016[Abstract]
  22. Staal A, van WAJ, Birkenhager JC, Pols HA, Prahl J, DeLuca H, Gaub MP, Lian JB, Stein GS, van LJP, Stein JL 1996 Distinct conformations of vitamin D receptor/retinoid X receptor-{alpha} heterodimers are specified by dinucleotide differences in the vitamin D-responsive elements of the osteocalcin and osteopontin genes. Mol Endocrinol 10:1444–1456[Abstract/Free Full Text]
  23. Alroy I, Towers TL, Freedman LP 1995 Transcriptional repression of the interleukin-2 gene by vitamin D3: direct inhibition of NFATp/AP-1 complex formation by a nuclear hormone receptor. Mol Cell Biol 15:5789–5799[Abstract]
  24. Falzon M 1996 DNA sequences in the rat parathyroid hormone-related peptide gene responsible for 1,25-dihydroxyvitamin D3-mediated transcriptional repression. Mol Endocrinol 10:672–681[Abstract/Free Full Text]
  25. Kremer R, Sebag M, Champigny C, Meerovitch K, Hendy GN, White J, Goltzman D 1996 Identification and characterization of 1,25-dihydroxyvitamin D3-responsive repressor sequences in the rat parathyroid hormone-related peptide gene. J Biol Chem 271:16310–16316[Abstract/Free Full Text]
  26. Li Q, Gardner DG 1994 Negative regulation of the human atrial natriuretic peptide gene by 1,25-dihydroxyvitamin D3. J Biol Chem 269:4934–4939[Abstract/Free Full Text]
  27. Peleg S, Abruzzese RV, Cooper CW, Gagel RF 1993 Down-regulation of calcitonin gene transcription by vitamin D requires two widely separated enhancer sequences. Mol Endocrinol 7:999–1008[Abstract/Free Full Text]
  28. Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM 1992 Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 89:8097–8101[Abstract/Free Full Text]
  29. Liu SM, Koszewski N, Lupez M, Malluche HH, Olivera A, Russell J 1996 Characterization of a response element in the 5'-flanking region of the avian (chicken) PTH gene that mediates negative regulation of gene transcription by 1,25-dihydroxyvitamin D3 and binds the vitamin D3 receptor. Mol Endocrinol 10:206–215[Abstract/Free Full Text]
  30. Okazaki T, Igarashi T, Kronenberg HM 1988 5'-flanking region of the parathyroid hormone gene mediates negative regulation by 1,25-(OH)2 vitamin D3. J Biol Chem 263:2203–2208[Abstract/Free Full Text]
  31. Okazaki T, Zajac JD, Igarashi T, Ogata E, Kronenberg HM 1991 Negative regulatory elements in the human parathyroid hormone gene. J Biol Chem 266:21903–21910[Abstract/Free Full Text]
  32. Hawa NS, O’Riordan JL, Farrow SM 1996 Functional analysis of vitamin D response elements in the parathyroid hormone gene and a comparison with the osteocalcin gene. Biochem Biophys Res Commun 228:352–357[CrossRef][Medline]
  33. Mackey SL, Heymont JL, Kronenberg HM, Demay MB 1996 Vitamin D receptor binding to the negative human parathyroid hormone vitamin D response element does not require the retinoid X receptor. Mol Endocrinol 10:298–305[Abstract/Free Full Text]
  34. Diamond MI, Miner JN, Yoshinaga SK, Yamamoto KR 1990 Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249:1266–1272[Abstract/Free Full Text]
  35. Sakai DD, Helms S, Carlstedt-Duke J, Gustafsson JA, Rottman FM, Yamamoto KR 1988 Hormone-mediated repression: a negative glucocorticoid response element from the bovine prolactin gene. Genes Dev 2:1144–1154[Abstract/Free Full Text]
  36. Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular receptors use a common mechanism to interpret signaling information at response elements. Genes Dev 10:1271–1283[Abstract/Free Full Text]
  37. Lefstin JA, Thomas JR, Yamamoto KR 1994 Influence of a steroid receptor DNA-binding domain on transcriptional regulatory functions. Genes Dev 8:2842–2856[Abstract/Free Full Text]
  38. Schrader M, Muller KM, Nayeri S, Kahlen JP, Carlberg C 1994 Vitamin D3-thyroid hormone receptor heterodimer polarity directs ligand sensitivity of transactivation. Nature 370:382–386[CrossRef][Medline]
  39. Zechel C, Shen XQ, Chen JY, Chen ZP, Chambon P, Gronemeyer H 1994 The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors to direct repeats. EMBO J 13:1425–1433[Medline]
  40. Heery DM, Pierrat B, Gronemeyer H, Chambon P, Losson R 1994 Homo- and heterodimers of the retinoid X receptor (RXR) activated transcription in yeast. Nucleic Acids Res 22:726–731[Abstract/Free Full Text]
  41. Mader S, Chen JY, Chen Z, White J, Chambon P, Gronemeyer H 1993 The patterns of binding of RAR, RXR and TR homo- and heterodimers to direct repeats are dictated by the binding specificites of the DNA binding domains. EMBO J 12:5029–5041[Medline]
  42. Colnot S, Lambert M, Blin C, Thomasset M, Perret C 1995 Identification of DNA sequences that bind retinoid X receptor-1,25(OH)2D3-receptor heterodimers with high affinity. Mol Cell Endocrinol 113:89–98[CrossRef][Medline]
  43. Kurokawa R, Yu VC, Naar A, Kyakumoto S, Han Z, Silverman S, Rosenfeld MG, Glass CK 1993 Differential orientations of the DNA-binding domain and carboxy-terminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7:1423–1435[Abstract/Free Full Text]
  44. Kurokawa R, DiRenzo J, Boehm M, Sugarman J, Gloss B, Rosenfeld MG, Heyman RA, Glass CK 1994 Regulation of retinoid signalling by receptor polarity and allosteric control of ligand binding. Nature 371:528–531[CrossRef][Medline]
  45. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  46. Blanco JC, Wang IM, Tsai SY, Tsai MJ, O’Malley BW, Jurutka PW, Haussler MR, Ozato K 1995 Transcription factor TFIIB and the vitamin D receptor cooperatively activate ligand-dependent transcription. Proc Natl Acad Sci USA 92:1535–1539[Abstract/Free Full Text]
  47. Lee JW, Ryan F, Swaffield JC, Johnston SA, Moore DD 1995 Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature 374:91–94[CrossRef][Medline]
  48. MacDonald PN, Sherman DR, Dowd DR, Jefcoat SC, Jr, DeLisle RK 1995 The vitamin D receptor interacts with general transcription factor IIB. J Biol Chem 270:4748–4752[Abstract/Free Full Text]
  49. vom Baur E, Zechel C, Heery D, Heine MJ, Garnier JM, Vivat V, Le Douarin B, Gronemeyer H, Chambon P, Losson R 1996 Differential ligand-dependent interactions between the AF-2 activating domain of nuclear receptors and the putative transcriptional intermediary factors mSUG1 and TIF1. EMBO J 15:110–124[Medline]
  50. Baudino TA, Kraichely DM, Jefcoat SC, Jr, Winchester SK, Partridge NC, MacDonald PN 1998 Isolation and characterization of a novel coactivator protein, NCoA-62, involved in vitamin D-mediated transcription. J Biol Chem 273:16434–16441[Abstract/Free Full Text]
  51. Clover J, Gowen M 1994 Are MG-63 and HOS TE85 human osteosarcoma cell lines representative models of the osteoblastic phenotype? Bone 15:585–591[Medline]
  52. Perlmann T, Evans RM 1997 Nuclear receptors in Sicily: all in the famiglia. Cell 90:391–397[CrossRef][Medline]
  53. Rajaram N, Kerppola TK 1997 DNA bending by Fos-Jun and the orientation of heterodimer binding depend on the sequence of the AP-1 site. EMBO J 16:2917–2925[CrossRef][Medline]
  54. Huang J, Blackwell TK, Kedes L, Weintraub H 1996 Differences between MyoD DNA binding and activation site requirements revealed by functional random sequence selection. Mol Cell Biol 16:3893–3900[Abstract]
  55. Kurokawa R, Soderstrom M, Horlein A, Halachmi S, Brown M, Rosenfeld MG, Glass CK 1995 Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature 377:451–454[CrossRef][Medline]
  56. Misra V, Walter S, Yang P, Hayes S, POH 1996 Conformational alteration of Oct-1 upon DNA binding dictates selectivity in differential interactions with related transcriptional coactivators. Mol Cell Biol 16:4404–4413[Abstract]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
H. Du, G. S. Daftary, S. I. Lalwani, and H. S. Taylor
Direct Regulation of HOXA10 by 1,25-(OH)2D3 in Human Myelomonocytic Cells and Human Endometrial Stromal Cells
Mol. Endocrinol., September 1, 2005; 19(9): 2222 - 2233.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. R McGaffin and S. A Chrysogelos
Identification and characterization of a response element in the EGFR promoter that mediates transcriptional repression by 1,25-dihydroxyvitamin D3 in breast cancer cells
J. Mol. Endocrinol., August 1, 2005; 35(1): 117 - 133.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-N. Bastie, N. Balitrand, F. Guidez, I. Guillemot, J. Larghero, C. Calabresse, C. Chomienne, and L. Delva
1{alpha},25-Dihydroxyvitamin D3 Transrepresses Retinoic Acid Transcriptional Activity via Vitamin D Receptor in Myeloid Cells
Mol. Endocrinol., November 1, 2004; 18(11): 2685 - 2699.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Alimov, M. C. Langub, H. H. Malluche, and N. J. Koszewski
Sp3/Sp1 in the Parathyroid Gland: Identification of an Sp1 Deoxyribonucleic Acid Element in the Parathyroid Hormone Promoter
Endocrinology, July 1, 2003; 144(7): 3138 - 3147.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G.-J. C. M. van den Bemd, M. Jhamai, A. Staal, A. J. van Wijnen, J. B. Lian, G. S. Stein, H. A. P. Pols, and J. P. T. M. van Leeuwen
A Central Dinucleotide within Vitamin D Response Elements Modulates DNA Binding and Transactivation by the Vitamin D Receptor in Cellular Response to Natural and Synthetic Ligands
J. Biol. Chem., April 19, 2002; 277(17): 14539 - 14546.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. POLLY, M. HERDICK, U. MOEHREN, A. BANIAHMAD, T. HEINZEL, and C. CARLBERG
VDR-Alien: a novel, DNA-selective vitamin D3 receptor-corepressor partnership
FASEB J, July 1, 2000; 14(10): 1455 - 1463.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koszewski, N. J.
Right arrow Articles by Russell, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koszewski, N. J.
Right arrow Articles by Russell, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals