Molecular Endocrinology 13 (3): 495-504
Copyright © 1999 by The Endocrine Society
Transcriptional and Posttranscriptional Regulation of Insulin-Like Growth Factor Binding Protein-3 by Cyclic Adenosine 3',5'-Monophosphate: Messenger RNA Stabilization Is Accompanied by Decreased Binding of a 42-kDa Protein to a Uridine-Rich Domain in the 3'-Untranslated Region
N. E. Erondu,
J. Nwankwo,
Y. Zhong,
M. Boes,
B. Dake and
R. S. Bar
Diabetes and Endocrinology Research Center Department of
Internal Medicine The University of Iowa and Veterans
Administration Medical Center Iowa City, Iowa 52246
 |
ABSTRACT
|
|---|
The Madin Darby bovine kidney (MDBK) cell line was
used to investigate the mechanisms underlying the cAMP regulation of
insulin-like growth factor binding protein-3 (IGFBP-3) gene expression.
Treatment of confluent monolayers either with forskolin or cAMP
produced a 60- to 75-fold induction of IGFBP-3 mRNA and protein levels.
This effect did not require new protein synthesis as inhibition of
translation by cycloheximide actually caused a 2-fold increase
in the cAMP induction. The rates of IGFBP-3 gene transcription,
assessed by nuclear run-on assays, increased approximately 15-fold in
cells exposed to cAMP. In addition, the half-life of the IGFBP-3 mRNA
transcript was increased
3-fold in the presence of cAMP. Gel
mobility shift and competition experiments revealed the specific
binding of an approximately 42-kDa cytoplasmic protein factor to the
3'-untranslated region (3'-UTR) of the IGFBP-3 mRNA. A 21-nucleotide
uridine-rich segment that contained no AUUUA motif was sufficient for
the specific binding. The binding activity of this protein was reduced
after cAMP treatment but was increased by phosphatase treatment. In
conclusion, the cAMP induction of IGFBP-3 mRNA in MDBK cells occurred
at both the transcriptional and posttranscriptional levels. The IGFBP-3
mRNA stabilization in MDBK cells probably involved the phosphorylation
of a member of the family of U-rich region mRNA-binding proteins and is
the first reported member whose RNA-binding activity is reduced by
cAMP.
 |
INTRODUCTION
|
|---|
Insulin-like growth factors (IGFs) are mitogenic peptides that
regulate metabolic activity and cell growth and differentiation in many
cell types (1). Insulin-like growth factor binding protein-3 (IGFBP-3),
the major IGFBP in the circulation, is synthesized by a wide range of
tissues and cell types. IGFBP-3 has also been shown to modulate IGF
action as well as possess IGF-independent activities such as
antiproliferation, apoptosis, and cell differentiation (2). Levels of
both IGF-I and IGFBP-3 in the circulation and in tissues are altered in
a number of disease states including diabetes mellitus and renal
failure (3). Such decreases in IGFBP levels have been suggested to
contribute to some of the pathological findings attributed to IGF-I by
making more of the growth factor available to its cellular receptor. As
therapies with IGF-I and IGF-I/IGFBP-3 complexes are being tested,
it is essential that we understand the factors and mechanisms that
regulate IGFBP-3 synthesis.
Several physiologically important cytokines and growth factors
that increase intracellular levels of cAMP also regulate IGFBP-3
synthesis (4). It has been reported that the cAMP induction of IGFBP-3
production in MDBK cells, a bovine renal epithelial cell line, was
associated with increased responsiveness to IGF-I as well as
differentiation of the cells (5, 6). In the present study, we examined
the mechanisms underlying the cAMP regulation of IGFBP-3 production in
MDBK cells. Specifically, the effects of cAMP on IGFBP-3 gene
transcription rates and mRNA stability were investigated to determine
whether the cAMP regulation of IGFBP-3 is brought about by
transcriptional and/or posttranscriptional mechanisms. We also report
the identification of candidate cis- and
trans-acting elements/factors involved in such
regulation.
 |
RESULTS
|
|---|
Induction of IGFBP-3 Production by cAMP
Confluent MDBK cells were washed with serum-free DMEM and exposed
to forskolin and to varying concentrations of (Bu)2cAMP for
18 h at 37 C. Steady state IGFBP-3 mRNA was measured by Northern
blot analysis while IGFBP-3 protein secreted into the media was
determined by [125I]IGF-I Western ligand blotting.
Results (Fig. 1
, A and C) confirmed
previous reports (7) that forskolin induced IGFBP-3 mRNA and protein
levels in MDBK cells. In addition, we have shown a dose-dependent
increase in IGFBP-3 mRNA and protein levels by (Bu)2cAMP in
these cells (Fig. 1
, A and C). Reprobing the membrane with a bovine
actin cDNA probe (Fig. 1B
), as well as ethidium bromide staining (data
not shown), verified the equivalent RNA loading in all lanes. It should
be noted that the cAMP-induced increase in IGFBP-4 protein seen in Fig. 1C
has been reported previously (5, 7) and also correlates with changes
in steady state IGFBP-4 mRNA levels (data not shown). Table 1
summarizes the mean data
(±SD) for the effect of forskolin and varying doses of
(Bu)2cAMP on IGFBP-3 mRNA levels in MDBK cells.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 1. Northern Blot Analysis of MDBK Cellular RNA (A and
B) and [125I]IGF-I Western Ligand Blot of Conditioned
Media (C)
MDBK cells were incubated for 18 h at 37 C in serum-free media and
in the presence of the indicated concentrations of
(Bu)2cAMP and forskolin. Total RNA (10 µg/lane) was
electrophoresed, blotted, and probed with 32P-labeled
IGFBP-3 (A). The IGFBP-3 probe was washed off the filter, and it was
reprobed for the housekeeping gene, actin (B). Conditioned media from
the cells were collected, electrophoresed, blotted, and probed with
[125I]IGF-I (C). The double arrowhead in
panel B indicates actin mRNA.
|
|
The time course of the IGFBP-3 mRNA induction by cAMP is shown in Fig. 2
. The increase in the steady state level
of IGFBP-3 mRNA was observed after 2 h of incubation and reached a
maximum after approximately 12 h. Furthermore, the forskolin- and
cAMP-induced increase in IGFBP-3 mRNA was inhibited in the presence of
H89 (a protein kinase A inhibitor) as would be expected for a protein
kinase A-mediated process (Fig. 3
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2. Time Course of the Regulation of IGFBP-3 mRNA by
cAMP
Confluent MDBK cells were incubated in the absence or presence of 10
mM (Bu)2cAMP for varying lengths of time. Total
RNA was isolated and IGFBP-3 mRNA was determined by Northern blot
analysis as previously described.
|
|

View larger version (57K):
[in this window]
[in a new window]
|
Figure 3. Effect of H89 and Cycloheximide (CHX) on
cAMP-Induced Increase in IGFBP-3 mRNA
MDBK cells were treated with H89 (30 µM) or CHX (2
µM) in the presence or absence of 10 mM
(Bu)2cAMP or 30 µM forskolin, followed by
Northern blot analysis using an IGFBP-3 probe.
|
|
Requirement for New Protein Synthesis
The role of new protein synthesis in IGFBP-3 induction by cAMP was
studied by pretreatment of MDBK cells with 2 µM
cycloheximide followed by exposure to either forskolin or cAMP. This
concentration of cycloheximide has been reported to inhibit protein
synthesis in MDBK cells by 75% (8). Our results (Fig. 3
) show that the
cAMP induction of IGFBP-3 was not prevented or reduced by inhibition of
new protein synthesis. In fact, the observed effect was enhanced
2.1 ± 0.3-fold (n = 3, P < 0.05) in the
presence of cycloheximide, perhaps due to the inhibition of synthesis
of labile destabilizing factor(s) or labile transcriptional
repressor(s). Alternatively, translation of IGFBP-3 mRNA leads to the
unmasking of a target site for the binding of a destabilizing
factor.
IGFBP-3 Gene Transcription Rates and mRNA Stability Are Increased
by cAMP
The observed cAMP induction of IGFBP-3 mRNA could occur either at
the level of gene transcription or via mRNA stabilization. To study the
regulation of the IGFBP-3 gene by cAMP, the transcription rates of the
IGFBP-3 gene in MDBK cells were measured by nuclear run-on assays. MDBK
cells, in the absence of cAMP, had a very low basal transcription of
IGFBP-3 (Fig. 4
, Control). In contrast,
the MDBK cells treated with cAMP showed a 15 ± 2-fold increase in
IGFBP-3 gene transcription (Fig. 4
, (Bu)2cAMP; n = 3,
P < 0.05). Bovine actin and pBluescript (Stratagene,
La Jolla, CA) were included on the filters as internal controls. These
nuclear run-on results indicate that the regulation of IGFBP-3 gene in
MDBK cells by cAMP occurs, at least in part, at the transcriptional
level.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 4. Stimulation of IGFBP-3 Gene Transcription by cAMP
Confluent MDBK cells were incubated in the presence or absence of
(Bu)2cAMP (10 mM) for 18 h, followed by
nuclear run-on assays as described in Materials and
Methods. There was a significant increase in IGFBP-3 gene
transcription in the presence of cAMP.
|
|
Since the 15-fold increase in transcription rate could not totally
account for the 75-fold increase in the cAMP induction of IGFBP-3
steady state mRNA, we examined the effect of cAMP on IGFBP-3 mRNA
stability in MDBK cells. The half-life of IGFBP-3 mRNA was
measured in cultures treated with the transcription inhibitor,
dichloro-ß-D-ribofuranosyl benzimidazole (DRB) in the
presence or absence of cAMP. First, as shown in Fig. 5A
, the concentration of DRB used in
these experiments (65 µM) was sufficient to inhibit cAMP
induction of IGFBP-3 mRNA. To generate sufficient IGFBP-3 mRNA for the
stability experiments, MDBK cells were first incubated with 10
mM (Bu)2cAMP overnight. The cells were
subsequently washed with serum-free media, and the incubation was
continued with DRB plus or minus 10 mM
(Bu)2cAMP. Cells were harvested at 0, 4, 12, and 20 h
after addition of DRB, and IGFBP-3 mRNA levels were quantitated by
Northern blot analysis. The amount of IGFBP-3 mRNA at time zero in each
treatment group was assigned a value of 100%, and all other values at
different time points were expressed relative to the time zero value.
As shown in Fig. 5
, B and C, and Table 2
,
the presence of cAMP caused approximately a 3-fold increase in the
half-life of IGFBP-3 mRNA (from 6.3 h to 21 h) implying that
the cAMP-induced increase occurs also at the level of mRNA stability.
Incubation of the cells with cAMP had no significant effect on the
half-life of actin mRNA (Fig. 5C
and Table 2
).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5. Stabilization of IGFBP-3 mRNA by cAMP
A, Total RNA from cells exposed to 65 µM DRB in the
presence or absence of cAMP were analyzed by Northern blot. B, Cells
were treated with cAMP for 18 h before the addition of DRB.
Incubation was continued in the absence (Control) or presence of 10
mM cAMP [(Bu)2cAMP] and at the indicated
times, total RNA was isolated and IGFBP-3 mRNA was analyzed by Northern
blot. Both blots were subsequently washed and reprobed for Actin mRNA.
C, Percentage of IGFBP-3 and actin mRNA remaining as determined by
densitometric scanning was plotted on a semilog scale. The mRNA levels
at time zero were assigned a value of 100%, and mRNA levels at all
other times are expressed as percentages of time zero values. The data
were generated from three independent experiments, and error bars have
been omitted for clarity. The range of the data points is indicated by
the calculated half-life values shown in Table 2 .
|
|
Identification of Specific IGFBP-3 mRNA- Binding Activity
Most studies dealing with mRNA stability determinants have
identified mRNA decay signals in the 3'-untranslated region (3'-UTR)
indicating the importance of this region in influencing the half-lives
of most mRNAs (9). One of these determinants is the AUUUA motif,
which is also present in the 3'-UTR of the full-length bovine, rat, and
human IGFBP-3 cDNAs (10, 11, 12). As shown in Fig. 6A
, the segment of the 3'-UTR containing
this motif (underlined ATTTA) is virtually identical across
the three species. This is quite remarkable for a noncoding region of
the mRNA and raises the possibility that it plays a major role in mRNA
regulation. Therefore, the initial studies were focused on the 3'-UTR
of IGFBP-3 mRNA to identify RNA binding proteins in MDBK cells that
bind to this region and also exhibit differential binding depending on
prior exposure of the cells to cAMP.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 6. 3'-UTR of IGFBP-3 cDNA
A, Nucleotide sequences of a segment of the 3'-UTR of human (top
line), bovine (middle line), and rat
(bottom line) IGFBP-3 cDNA. The sequence is numbered
relative to the first nucleotide of the published IGFBP-3 cDNA clones.
The human and rat sequences that are identical to the bovine sequence
are indicated by an asterisk. The ATTTA motif is
underlined. Gaps have been introduced to maximize the
alignment. The rat cDNA sequence was obtained from Ref. 10, the human
cDNA sequence was from Ref. 11, while the bovine sequence was from Ref.
12. B, Partial restriction enzyme map of the 3'-UTR of bovine IGFBP-3
cDNA. The nucleotide positions of the restriction enzymes relative to
the first nucleotide of the full-length cDNA, BP-3.511, are shown in
parentheses. The 17 A residues at the 3'-end of the cDNA
is indicated by the , while the ATTTA motif is shown as
°|.
Regions corresponding to the RNA probes described in Materials
and Methods are shown below the map.
|
|
To determine whether cellular extracts contain proteins that bind to
the 3'-UTR of IGFBP-3 mRNA, a 32P-labeled 3'-UTR1
transcript (nt 20392430, Fig. 6B
) was incubated with cytoplasmic
extracts from MDBK cells that had been exposed to serum-free media in
the absence or presence of cAMP. After digestion of the free RNA probe
with RNase T1, the RNA-protein complexes were separated on an SDS-PAGE
gel. Figure 7A
shows one major complex
that was reduced to 66 ± 7% of control (n = 8,
P < 0.05) in extracts from cells that were treated
with cAMP. This decrease in binding was abolished when cells were
exposed to media that also contained H89 (106 ± 15%, n =
4), indicating that this is likely to be a protein kinase A-mediated
process. To determine the molecular size of the protein involved in the
complex formation, Northwestern blot analysis of cytoplasmic extract
from control and cAMP-treated cells was performed. As shown in Fig. 7B
, the binding of the 3'-UTR1 probe to a
42-kDa protein in extracts
from cAMP-treated cells was reduced to 63 ± 6% of control(Lane 2
vs. 1; n = 4, P < 0.05). When this
experiment was repeated with a nonspecific probe, no binding to this
protein was detected (Fig. 7C
, lanes 1 and 2). This is the expected
result if this 42-kDa RNA-binding protein is involved in
destabilization/degradation of IGFBP-3 mRNA, in which case cAMP-induced
reduction in its binding will result in stabilization. To confirm that
the observed shifted band was due to an interaction between a protein
and the labeled RNA, the cellular extract was preincubated with
proteinase K before the gel mobility shift assays were done. As shown
in Fig. 8
(lanes A2, A3, B2, and B3), the
complex formation was abolished by pretreatment with proteinase K as
would be expected for an RNA-protein interaction.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 7. cAMP Treatment Inhibits the Binding of a 42-kDa
RNA-Binding Activity to 3'-UTR1
A, Radiolabeled sense RNA probe, 3'-UTR1 was incubated with 10 µg
cytoplasmic extract from control and cAMP-treated MDBK cells plus or
minus H89. After RNase T1 digestion, samples were UV-cross-linked and
separated by 12% SDS-PAGE under reducing conditions. The formation of
a 48-kDa RNA-protein complex in extract from cAMP-treated cells was
reduced relative to control. There was no significant difference
between control and cAMP-treated cells when H89 was included during the
incubation. B, Cytoplasmic extract (60 µg) from control (lane 1) and
cAMP-treated (lane 2) MDBK cells was subjected to 12% SDS-PAGE under
reducing conditions, blotted, renatured, and probed with radiolabeled
3'-UTR1 transcript as described in Materials and
Methods. The arrow depicts a 42-kDa protein
whose binding to the probe in extract from cAMP-treated cells (lane 2)
was reduced relative to control extract (lane 1). C, An identical blot
as the one shown in panel B was probed with a nonspecific probe,
3'-UTR2. The data, which were generated by densitometric scanning of
the blots, are expressed relative to control (assigned a value of
100%).
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Figure 8. Proteinase K Sensitivity of RNA-Protein Complex
Formation
Cytoplasmic extracts from control (A) and cAMP-treated (B) MDBK cells
were preincubated with 0 (lane 1), 0.1 µg (lane 2), and 1 µg (lane
3) of proteinase K for 30 min at 37 C followed by addition of
32P-labeled 3'-UTR1 to initiate the binding reaction. After
RNase T1 digestion and UV cross-linking, the samples were subjected to
electrophoresis on a 6% native gel.
|
|
A Phosphoprotein Is Required for Formation of the RNA-Protein
Complex
The control of cellular events by cAMP is usually mediated
by cAMP activation of protein kinase A, leading to phosphorylation of
protein factors. To test whether phosphorylation is involved in the
control of this RNA-binding activity, cytoplasmic extract from
cAMP-treated cells was incubated first with potato acid phosphatase
before the binding reaction. Figure 9
(lane 2) shows that pretreatment of the extract with acid phosphatase
enhanced the binding activity of the RNA-binding protein 2.6 ±
0.7-fold (n = 3, P < 0.05).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 9. Phosphatase Treatment Enhances the Formation of the
RNA-Protein Complex
Potato acid phosphatase was incubated with cytoplasmic extract
generated from cAMP-treated cells at 37 C for 30 min, before the
addition of radiolabeled 3'-UTR1 (lane 2). Lane 1 represents a control
incubation with extract that was not treated with acid phosphatase,
while lane 3 represents incubation with heat-inactivated acid
phosphatase. After RNase T1 digestion and UV cross- linking, the
samples were subjected to electrophoresis on a 6% native gel. After
exposure to x-ray film, the gel was scanned and the data are expressed
relative to control (lane 1), which was assigned a value of 1.
Treatment of the extract with acid phosphatase (lane 2) caused a
significant increase in the formation of the RNA-protein complex.
|
|
A Uridine-Rich Region Is Necessary for the Formation of the
RNA-Protein Complex
To further localize the region on 3'-UTR1 (Fig. 6B
) to which this
42-kDa protein binds, the RNA mobility gel shift studies were repeated
with 32P-labeled 3'-UTR2 [Fig. 6B
, nucleotides (nt)
20392238] and 3'-UTR3 (Fig. 6B
, nt 22392430) transcripts. The
RNA-protein complex was only generated with 3'-UTR3 transcripts (data
not shown), which was not entirely surprising since 3'-UTR3 contains
the single AUUUA motif and, in addition, was uridine rich, two elements
that have been shown to be involved in the binding of mRNA
stabilization/destabilization factors (9). To demonstrate that the
region encompassed by 3'-UTR3 was responsible for the RNA binding to
3'-UTR1, the binding studies with 3'-UTR1 were repeated in the presence
of 100-fold molar excess of unlabeled 3'-UTR2 and 3'-UTR3. As predicted
(Fig. 10A
), only 3'-UTR3 inhibited the
formation of the RNA-protein complex. To explore the sequence
requirements for this complex formation, various ribohomopolymers were
tested for their ability to compete for binding to the
32P-labeled, 3'-UTR1 probe by gel mobility shift assay. As
shown in Fig. 10A
, poly (G), poly (A), and poly (C) showed no
competition even at 500 ng while poly (U) abolished the formation of
the complex at 10 ng.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 10. Specificity of the RNA-Protein Complex
Formation
A, Specificity of the binding to 3'-UTR1. Before addition of the
MDBK cytoplasmic extract, radiolabeled 3'-UTR1 was mixed with 100-fold
molar excess of 3'-UTR2 (lane 2) or 3'-UTR3 (lane 3) or with varying
amounts of unlabeled ribohomopolymer competitors as indicated. After
RNase T1 digestion and UV cross-linking, the samples were resolved on a
6% native polyacrylamide gel. B, Determination of protein-binding site
in the 3'-UTR of IGFBP-3 mRNA. Radiolabeled 3'-UTR3-A (lane 1),
3'-UTR3-B (lane 2), and 3'-UTR3-C (lane 3) were incubated with
cytoplasmic extract followed by RNase T1 digestion and UV
cross-linking. The samples were subsequently resolved on a 6% native
gel. C, Specificity of the binding to 3'-UTR3-A. The binding reaction
with 32P-labeled 3'-UTR3-A was repeated in the absence
(lane 1) or presence of the following competitors: 100-fold 3'-UTR3,
specific competitor (lane 2); 100-fold 3'-UTR2, nonspecific competitor
(lane 3); 500 ng poly (A) (lane 4); 500 ng poly (G) (lane 5); 500 ng
poly(C) (lane 6); and 10 ng poly (U) (lane 7). The RNA sequences
contained in the above probes that were derived from the 3'-UTR of
IGFBP-3 mRNA are UCCUUUAUUUUUUUAAUUAAGUUUUUGAGA (3'-UTR3-A);
AAAAGUAUUUUUGAAAAGUUUGUCUU (3'-UTR3-B); and
GC-AAUGUAUUUAUAAAUAGUAAAUAAAAUU (3'-UTR3-C). D, Requirement for the
poly uridine stretch in the RNA-protein complex formation. Three
mutants of 3'-UTR3-A lacking the 5 U stretch and containing the
indicated nucleotide substitutions (underlined) in the 7
U stretch were generated as described in Materials and
Methods, radiolabeled, and used in the binding reaction as
described above). Lane 1, Mut 1 (UCCUUUAUUUAUUUAAUUAAG);
lane 2, Mut 2 (UCCUUUAUUUGUUUAAUUAAG); and lane 3, Mut 3
(UCCUUUAUUAUUAUAAUUAAG).
|
|
To further map the protein-binding site(s) within 3'-UTR3 (Fig. 6B
),
three additional RNA probes encompassing three nonoverlapping AU-rich
regions were synthesized. One, designated 3'-UTR3-A (nt 23112340) is
60% U-rich; the second, 3'-UTR3-B (nt 23452370) is 46% U-rich;
while the third, 3'-UTR3-C (nt 23712400), is 37% U-rich and contains
the single AUUUA motif in the IGFBP-3 mRNA. As shown in Fig. 10B
(lane
1), an RNA-protein complex was generated when 3'-UTR3-A was incubated
with MDBK cytoplasmic extract. No band-shifted complex was formed with
either probes 3'-UTR3-B or 3'-UTR3-C (lanes 2 and 3). Competition
experiments (Fig. 10C
) showed that 3'-UTR3 (lane 2) and poly (U) (lane
7), but not 3'-UTR2 poly (A), poly (G), or poly (C) (lanes 36),
abolished complex formation. Thus, this 42-kDa protein is probably not
a poly (A)-binding protein and does not require the presence of an
AUUUA motif for binding. It should also be noted that 3'-UTR3-A
contains two U stretches (7 and 5 nt in length), making it interesting
to determine whether the uridine stretches are critical for RNA-protein
complex formation. The gel shift experiments were repeated with
3'-UTR3-A mutants and, as shown in Fig. 10D
, deletion of the stretch of
five Us plus a single U-to-A mutation in the seven-U stretch did not
abolish complex formation (lane 1). This was not entirely surprising
since this single U-to-A substitution generated the consensus nonameric
motif (UUAUUUAUU) that has been shown to be an instability determinant
as well as a site for the binding of U-rich element-binding protein
factors (13). However, a single U-to-G mutation as well as U-to-A
mutation at two positions in this region abolished complex formation
(lanes 2 and 3), indicating that the polyuridine stretch is critical
for the RNA-protein interaction.
 |
DISCUSSION
|
|---|
Several physiologically important cytokines and growth factors
that increase intracellular cAMP levels also regulate IGFBP-3
synthesis (4). An example is the cAMP induction of IGFBP-3 in MDBK
cells, which is associated with differentiation of the cells as well as
increased responsiveness to IGF-I (5, 6).
In this study, cAMP has been shown to regulate gene expression by both
transcriptional and posttranscriptional mechanisms. Nuclear run-on
assays demonstrated that (Bu)2cAMP significantly increased
the rate of IGFBP-3 gene transcription in MDBK cells. In addition, the
half-life of IGFBP-3 mRNA transcript was increased
3-fold in the
presence of cAMP, the first report of cAMP-mediated regulation of
IGFBP-3 mRNA stability. Although estimates of mRNA half-lives and
stability using transcription inhibitors such as DRB must be viewed
with caution, it is a widely used approach that generally agrees with
results obtained from pulse-chase experiments (9). More importantly,
our present results have revealed specific binding of a 42-kDa
cytoplasmic protein to the 3'-UTR of IGFBP-3 mRNA in a cAMP-dependent
and protein phosphorylation-dependent manner. Mutations within the
polyuridine stretch abolished RNA-protein complex formation, indicating
that this protein probably belongs to the family of U-rich region
mRNA-binding proteins (9, 13) and is the first member whose RNA-binding
activity is reduced by cAMP.
In many genes, an 8-bp palindrome (TGACGTCA) has been identified as the
canonical cAMP response element (CRE) (14). However, not all
cAMP-regulated genes have the canonical CRE sequence as numerous
variations to this consensus sequence have been identified (15).
Furthermore, the AP-2 recognition site (a non-CRE element) mediates
cAMP induction of some mRNAs (16). It is, therefore, interesting to
note that two overlapping putative AP-2-binding sites have been
identified in corresponding positions 5' to both the bovine and rat
IGFBP-3 promoter (4, 12). Future studies will be aimed at determining
if this element is involved in the observed cAMP regulation of IGFBP-3
gene transcription. It will be equally important to identify
trans-acting factors as well as any other
cis-acting elements involved.
The demonstration that the IGFBP-3 mRNA stabilization by cAMP is
accompanied by decreased binding of a protein factor to a U-rich domain
of the 3'-UTR of the IGFBP-3 mRNA is interesting since the U-rich
elements found within the 3'-UTRs of many immediate early mRNAs such as
c-fos and c-myc play an important regulatory role
in the turnover of these mRNAs (9, 17). In fact, several U-rich
element-binding proteins have been identified, and there is evidence
that they are involved in mediating selective mRNA stabilization and/or
destabilization (13, 18). Furthermore, the mRNA-binding activity of
some of these proteins is modulated by reversible
phosphorylation/dephosphorylation (13). Examples include SG-URBP, a
48-kDa cytoplasmic protein that binds to the 3'-UTR of the
Na+/glucose transporter in the pig kidney cell line
(LLC-PK1), as well as AUBF, a 44-kDa
adenosine-uridine-binding factor that binds to AUUUA motifs of several
cytokine and oncogene mRNAs (19). The IGFBP-3 mRNA-binding protein
described in this report differs from other known binding proteins in
that its binding activity is decreased by cAMP. It is, therefore,
likely to be a new member of the family of U-rich region mRNA-binding
proteins.
The functional significance of the RNA-protein interaction
described in this study still needs to be directly demonstrated. A
reasonable hypothesis to explain our findings is that this 42-kDa
protein is involved in IGFBP-3 mRNA degradation and that the decrease
in its binding affinity resulting from phosphorylation leads to mRNA
stabilization. Other interesting questions include the requirement for
other protein factors and whether this protein can bind to mRNAs other
than IGFBP-3 mRNA to increase their stability in response to cAMP.
Further studies of this model system are likely to provide unique and
novel insights into the regulation of IGFBP-3 synthesis as well as
enhance our understanding of the cAMP second messenger pathway as it
relates to mRNA stabilization/destabilization.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
Stock cultures of MDBK cells were obtained from ATCC (Manassas,
VA) and maintained in media supplemented with 10% FCS as recommended
by the supplier. Confluent cells were washed with serum-free media
before exposure to the various conditions. Forskolin,
(Bu)2cAMP, H89, cycloheximide, and ribohomopolymers were
purchased from Sigma Chemical Co. (St. Louis, MO).
RNA Isolation and Northern Blot Analysis
Total RNA was isolated from MDBK cells using the QIAGEN
(Chatsworth, CA) RNeasy Total RNA kit and quantitated by measurement of
absorbance at 260 nm. After the RNA was separated by
agarose-formaldehyde gel electrophoresis, it was transferred to a nylon
membrane (GeneScreen, New England Nuclear, Boston, MA) and probed with
radiolabeled IGFBP-3 PCR product as previously described (20).
Membranes were stripped according to the manufacturers instructions
and reprobed with a radiolabeled bovine actin PCR product to assess the
relative sample loading efficiency. The PCR products used for the above
experiments were generated using oligonucleotides based on the
published sequences of bovine IGFBP-3 and actin cDNAs (21, 22).
Ligand Blotting
Conditioned media were concentrated and subjected to SDS-PAGE
under nonreducing conditions. After electrotransfer, the membranes were
probed with [125I]IGF-I according to the method of
Hossenlopp et al. with minor modifications as previously
described (20).
Isolation of Nuclei and Transcription Assay
We used the method of Tetradis et al. (23) with minor
modifications. Confluent MDBK cells were incubated in serum-free media
plus or minus cAMP for 18 h before isolation of nuclei. Cells were
rinsed once with ice-cold PBS without calcium and magnesium, collected
by scraping into PBS, and harvested by centrifugation at 1500 rpm for 2
min. The cell pellet from each T75 flask was resuspended in 1 ml of
hypotonic buffer on ice [10 mM KCl, 10 mM
Tris-HCl (pH 7.5), 1.5 mM MgCl2, 0.3
M sucrose, 0.25% NP-40, 1 mM dithiothreitol
(DTT), and 0.5 mM phenylmethylsulfonylfluoride] and gently
disrupted in a Dounce homogenizer with pestle B. Lysed cells were
centrifuged for 15 min at 1500 rpm, and the nuclear pellet was
immediately resuspended in 200 µl of transcription reaction buffer
[50 mM Tris-HCl (pH 7.5), 0.1 M ammonium
sulfate, 1.8 mM DTT, 1.8 mM MnCl2,
2 µl Rnasin, 300 µM each of ATP, CTP, and GTP, and 100
µCi of [32P]UTP]. Transcription was carried out for 20
min at room temperature and terminated by the addition of 5 µl
ribonuclease (RNase)-free deoxyribonuclease (DNAse) and 2 µl of tRNA
(20 mg/ml). After 15 min at room temperature, 20 µl 10% SDS and 2
µl proteinase K (0.1 mg/ml) were added, and the incubation was
continued for 45 min at 37 C. RNA was subsequently extracted by the
method of Chomczynski and Sacchi (24). Five micrograms of linearized
pBS, bovine actin, and IGFBP-3 cDNAs (all cloned in pBS) were slot
blotted onto nitrocellulose paper and stored at 4 C until use. Filters
were prehybridized for 1 h at 52 C in 3 ml of a solution
containing 49.3% formamide, 4.93 x saline sodium citrate
(SSC), 0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl (pH
7.5), 4 x Denhardts, 0.34 mg/ml yeast RNA, and 0.34 mg/ml
sheared salmon sperm DNA. An equal amount of radioactive RNA
(107 cpm) was added to each vial, and the filters were
hybridized at 52 C for 72 h in a solution containing 58%
formamide, 5.8 x SSC, 0.12% SDS, 1.2 mM EDTA, 12
mM Tris-HCl (pH 7.5), 4.7 x Denhardts, 0.4 mg/ml
yeast tRNA, and 0.4 mg/ml sheared salmon sperm DNA. Filters were washed
twice at 65 C for 1 h in 25 ml of 2 x SSC. The filters were
digested with RNase A for 30 min at 37 C, followed by a final wash in
25 ml of 2 x SSC at 37 C for 1 h. Filters were air dried and
exposed to x-ray film at -80 C.
mRNA Stability Analysis
MDBK cells were incubated with 10 mM
(Bu)2cAMP for 18 h before the addition of 65
µM DRB to arrest new RNA synthesis. Incubation was
continued in the presence of DRB plus or minus cAMP. Cells were
harvested 0, 4, 12, and 20 h after the addition of DRB for RNA
extraction and Northern blot analysis as described above.
Construction of Plasmids
As stated above, we have isolated and sequenced a full-length
IGFBP-3 cDNA (2.4 kb) cloned into EcoRI- and
XhoI-predigested pBluescript (Stratagene). The cDNA clone
(BP-3.511) has a SacI site 4 bp downstream of the stop
codon. A 1010-bp SacI fragment containing the 5'-UTR, the
entire coding region, and 4 bp of 3'-UTR was excised from BP-3.511 and
religated. The resulting plasmid, referred to as
BP-3.511
Sac, contained the entire 1420 bp of 3'-UTR of
bovine IGFBP-3 cDNA except for 4 bp upstream of the SacI
site. BP-3.511
Sac was double digested with
SacI and AccI, filled in with Klenow enzyme, and
religated to generate BP-3.511
Acc, which contained 392
bp of 3'-UTR (nt 20392430). A 2237-bp BamHI fragment was
excised from BP-3.511 and religated to generate
BP-3.511
Bam, which contained 192 bp of 3'-UTR
(nucleotides 22382430). The following oligonucleotide pairs
corresponding to the indicated segments of the 3'-UTR of the IGFBP-3
cDNA were synthesized. A (nt 23112340): 5'-TCC TTT ATT TTT TTA ATT
AAG TTT TTG AGA-3' and 5'-TCT CAA AAA CTT AAT TAA AAA AAT AAA GGA-3'; B
(nt 23452370): 5'-AAA AGT ATT TTT GAA AAG TTT GTC TT-3' and 5'-AAG
ACA AAC TTT TCA AAA ATA CTT TT-3'; C (nt 23712400): 5'-GCA ATG TAT
TTA TAA ATA GTA AAT AAA ATT-3' and 5'-AAT TTT ATT TAC TAT TTA TAA ATA
CAT TGC-3'; A mut 1 (nt 2311 to 2331): 5'-TCC TTT ATT TAT
TTA ATT AAG-3' and 5'-CTT AAT TAA ATA AAT AAA GGA-3'; A mut
2 (nt 23112331): 5'-TCC TTT ATT TGT TTA ATT AAG-3' and
5'-CTT AAT TAA ACA AAT AAA GGA-3'; A mut 3 (nt 23112331):
5'-TCC TTT ATT ATT ATA ATT AAG-3' and 5'-CTT
AAT TAT AAT AAT AAA GGA-3' (the mutated
nucleotides are underlined). Each oligo pair was annealed
and cloned into the SmaI site of pBS to generate plasmids
pBS:3'-UTR3-A, pBS:3'-UTR3-B, pBS:3'-UTR3-C, pBS:3'-UTR3-A mut 1,
pBS:3'UTR3-A mut 2, and pBS:3'-UTR3-A mut 3, respectively. Before their
use in RNA synthesis, purified plasmids were sequenced for
verification. A partial restriction enzyme map of the 3'-UTR of IGFBP-3
cDNA is depicted in Fig. 6B
.
Preparation of RNA Transcripts
The following sense RNA probes were prepared by
linearizing the above plasmids with appropriate restriction enzymes:
3'-UTR1, a 402-nt transcript synthesized from XhoI
linearized BP-3.511
Acc; 3'-UTR2, a 210-nt transcript
synthesized from BamHI linearized BP-3.511
Acc;
3'-UTR3, a 237-nt transcript synthesized from XhoI
linearized BP-3.511
Bam; 3'-UTR3-A, a 132-nt transcript
synthesized from XhoI linearized pBS:3'UTR3-A; 3'UTR3-B, a
128-nt transcript synthesized from XhoI linearized
pBS:3'-UTR3-A; 3'-UTR3-C, a 132 nt transcript synthesized from
XhoI linearized pBS:3'UTR3-C; 3'-UTR3-A mut 1, a 100-nt
transcript synthesized from BamHI linearized pBS:3'-UTR3-A
mut 1; 3'-UTR3-A mut 2, a 100-nt transcript synthesized from
BamHI linearized pBS:3'-UTR3-A; and 3'-UTR3-A mut 3, a
123-nt transcript synthesized from XhoI linearized
pBS:3'-UTR3-A mut 3. Approximately 100 nt of the 3'-UTR3-A, -B, and -C
and 3'-UTR3-A mut 3 and
80 nt of 3'UTR3-A mut 1 and mut 2 were
derived from the vector, pBS. In vitro transcription
reactions were performed according to Promega (Madison, WI)
instructions using T3 RNA polymerase except for 3'-UTR3-A mut 1 and 2
where T7 RNA polymerase was used. Labeled transcripts were synthesized
by inclusion of [
-32P]UTP (800 Ci/mmol) in the
reaction, and the resulting transcripts had a specific activity of
approximately 13 x 108 cpm/µg. To generate
unlabeled transcripts for competition experiments, transcription
reactions were scaled up to 100 µl as recommended by Promega, and
[32P]UTP was replaced by nonradioactive UTP.
Preparation of Cell Lysates
MDBK cells incubated for 18 h in serum-free media plus or
minus 10 mM cAMP were washed twice with ice-cold PBS before
lysis in a buffer containing 10 mM HEPES, pH 7.4, 3
mM MgCl2, 40 mM KCl, 2
mM DTT, 5% glycerol, 0.5% NP-40, 8 ng/ml aprotinin, and
100 ng/ml phenylmethysulfonyl fluoride. Nuclei and cell debris were
removed by centrifugation at 10,000 x g for 5 min at 4
C, and the cytoplasmic lysates were stored at -80 C until use.
Analysis of RNA-Protein Interactions
MDBK cytoplasmic lysate (10 µg protein) was
incubated at room temperature for 15 min with 32P-labeled
RNA (14 ng) in a buffer containing 10 mM HEPES (pH 7.4),
3 mM MgCl2, 40 mM KCl, 2
mM DTT, 10% glycerol, and 0.5% NP-40. Heparin (final
concentration of 10 mg/ml) and yeast tRNA (200 µg/ml, final
concentration) were added to reduce nonspecific binding. Subsequently,
unbound RNA was digested with 10 U RNase T1 for 3060 min at room
temperature. The reaction mixtures were cross-linked with 254 nm UV
radiation for 5 min using Stratalinker 1800 (Stratagene). The
RNA-protein complexes were resolved either on a 6% nondenaturing
polyacrylamide gel or a 12% SDS gel under reducing conditions. Gels
were dried and exposed to film at room temperature or at -80 C.
Northwestern Blot Analysis
After SDS-PAGE of cytoplasmic extract (60 µg/lane) under
reducing conditions, the proteins were wet transferred to
nitrocellulose sheets as previously described. To renature the
proteins, the filter was incubated at 4 C for 1 h with one change
in renaturation buffer (10 mM Tris-HCl, pH 7.5, 1
mM EDTA, 50 mM NaCl, 0.1% Triton X-100, 1x
Denhardts, 100 µg/ml tRNA). Subsequently, the blotted proteins were
probed with either radiolabeled 3'-UTR1 or 3'-UTR2 riboprobe
(105-106 cpm/ml) for 1 h at room
temperature in renaturation buffer except that heparin was added to a
final concentration of 10 mg/ml and the concentration of tRNA was 200
µg/ml. Unbound RNA was removed by three cycles of washing in the
above buffer at room temperature (2 min per wash), and the membrane was
subsequently exposed to x-ray film.
Statistics
All comparisons were paired t tests, and the
significance was set at P < 0.05. Each figure
represents an individual experiment and means ± SD of
at least three independent experiments are presented.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Ngozi E. Erondu, M.B.B.S., Ph.D., The University of Iowa, Department of Internal Medicine, ENDO 3E17 Veterans Administration Medical Center, Iowa City, Iowa 52246. E-mail: ngozi-erondu{at}uiowa.edu
This work was supported by the Office of Research and Development,
Medical Research Service, Department of Veterans Affairs, NIH Grant
DK-5227701 (to N. E.E.) and NIH Grant DK-29295 to the Diabetes
and Endocrinology Research Center.
Received for publication April 2, 1998.
Revision received November 17, 1998.
Accepted for publication December 2, 1998.
 |
REFERENCES
|
|---|
-
Jones JI, Clemmons DR 1995 Insulin-like growth factors
and their binding proteins: biological actions. Endocr Rev 16:334[CrossRef][Medline]
-
Bach LA, Rechler MM 1995 Insulin-like growth factor binding
proteins. Diabetes Rev 3:3861
-
Hirschberg R 1993 IGF-1 and the kidney. J Lab Clin Med 122:636638[Medline]
-
Albiston AL, Saffery R, Herington AC 1995 Cloning and
characterization of the promoter for the rat insulin-like growth
factor-binding protein-3 gene. Endocrinology 136:696704[Abstract]
-
Cohick WS, Clemmons DR 1993 Regulation of IGF BP secretion
and modulation of cell growth in MDBK cells. Growth Regul 3:1821
-
Cohick WS, Clemmons DR 1994 Enhanced expression of
dihydrofolate reductase by bovine kidney epithelial cells results in
altered cell morphology, IGF-1 responsiveness and IGF binding protein-3
expression. J Cell Physiol 161:178186[CrossRef][Medline]
-
Cohick WS, Clemmons DR 1991 Regulation of insulin-like
growth factor binding protein synthesis and secretion in a bovine
epithelial cell line. Endocrinology 129:13471354[Abstract]
-
Gagnon AM, Simboli-Campbell M, Welsh J 1994 Induction of
calbindin D-28K in Madin-Darby bovine kidney cells by
(OH)2D3. Kidney Int 45:95102[Medline]
-
Ross J 1995 mRNA stability in mammalian cells. Microbiol Rev 59:423450[Abstract/Free Full Text]
-
Shimasaki S, Koba A, Mercado M, Shimonaka M, Ling N 1989 Complementary DNA structure of the high molecular weight rat
insulin-like growth factor binding protein (IGF-BP3) and tissue
distribution of its mRNA. Biochem Biophys Res Commun 165:907912[CrossRef][Medline]
-
Thweatt R, Fleischmann R, Goldstein S 1993 Analysis of the
primary structure of insulin-like growth factor binding protein-3 cDNA
from Werner syndrome fibroblasts. DNA Seq 4:4346[Medline]
-
Erondu NE, Toland B, Boes M, Dake BL, Moser DR, Bar RS 1997 Bovine insulin-like growth factor binding protein-3: organization
of the chromosomal gene and functional analysis of its promoter.
Endocrinology 138:28562862[Abstract/Free Full Text]
-
Jarzembrowski JA, Malter JS 1997 Cytoplasmic fate of
eukaryotic mRNA: identification and characterization of AU-binding
proteins. Prog Mol Subcell Biol 18:141172[Medline]
-
Lalli E, Sassone-Corsi P 1994 Signal transduction and gene
regulation: the nuclear response to cAMP. J Biol Chem 269:1735917362[Free Full Text]
-
Delmas V, Molina C, Lalli E, DeGroot R, Foulkes NS, Masquilier
D, Sassone-Corsi P 1994 Complexity and versatility of the
transcriptional response to cAMP. Rev Physiol Biochem Pharmacol 124:128[Medline]
-
Duan C, Clemmons R 1995 Transcription factor AP-2 regulates
human insulin-like growth factor binding protein-5 gene expression.
J Biol Chem 42:2484424851
-
Chen C-Y, Shyu A-B 1995 AU-rich elements: characterization and
importance in mRNA degradation. Trends Biochem Sci 20:465470[CrossRef][Medline]
-
You Y, Chen C-Y, Shyu A-B 1992 U-rich sequence binding
proteins (URBPs) interacting with a 20-nucleotide U-rich sequence in
the 3' untranslated region of c-fos mRNA may be involved in
the first step of c-fos mRNA degradation. Mol Cell Biol 12:29312940[Abstract/Free Full Text]
-
Peng H, Lever J 1995 Regulation of
Na+-coupled glucose transport in LLC- PK1
cells: message stabilization induced by cyclic AMP elevation is
accompanied by binding of a Mr = 48,000 protein to a uridine-rich
domain in the 3'-untranslated region. J Biol Chem 270:2399624003[Abstract/Free Full Text]
-
Erondu NE, Dake BL, Moser DR, Lin M, Boes M, Bar RS 1996 Regulation of endothelial IGF BP-3 synthesis and secretion by IGF-1 and
TGFß. Growth Regul 6:19[Medline]
-
Degen J, Neubauer M, Friezner-Degen S, Seyfried C, Morris D 1983 Regulation of protein synthesis in mitogen-activated bovine
lymphocytes: analysis of actin-specific and total mRNA accumulation and
utilization. J Biol Chem 258:1215312162[Abstract/Free Full Text]
-
Spratt SK, Tatsuno GP, Sommer A 1991 Cloning and
characterization of bovine insulin-like growth factor binding protein
(bIGF BP3). Biochem Biophys Res Commun 177:10251032[CrossRef][Medline]
-
Tetradis S, Pilbeam C, Liu Y, Herschman H, Kream B 1997 Parathyroid hormone increases prostaglandin G/H synthase-2
transcription by a cyclic AMP- mediated pathway in murine osteoblastic
MC3T3E1 cells. Endocrinology 138:35943600[Abstract/Free Full Text]
-
Ausubel FM, Brent R, Kingston RE, Moore DD, Smith JA, Seidman
JG, Struhl K 1998 Current Protocols in Molecular Biology. Greene/Wiley
Interscience, New York
This article has been cited by other articles:

|
 |

|
 |
 
J. Deschenes-Furry, K. Mousavi, F. Bolognani, R. L. Neve, R. J. Parks, N. I. Perrone-Bizzozero, and B. J. Jasmin
The RNA-Binding Protein HuD Binds Acetylcholinesterase mRNA in Neurons and Regulates its Expression after Axotomy
J. Neurosci.,
January 17, 2007;
27(3):
665 - 675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Ongeri, M. F. Verderame, and J. M. Hammond
Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways
Mol. Endocrinol.,
July 1, 2005;
19(7):
1837 - 1848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Ongeri, Q. Zhu, M. F. Verderame, and J. M. Hammond
Insulin-Like Growth Factor-Binding Protein-3 in Porcine Ovarian Granulosa Cells: Gene Cloning, Promoter Mapping, and Follicle-Stimulating Hormone Regulation
Endocrinology,
April 1, 2004;
145(4):
1776 - 1785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. O. Nwankwo, A. A. Spector, and F. E. Domann
A nucleotide insertion in the transcriptional regulatory region of FADS2 gives rise to human fatty acid delta-6-desaturase deficiency
J. Lipid Res.,
December 1, 2003;
44(12):
2311 - 2319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ruggiero, M. Olivero, A. Follenzi, L. Naldini, R. Calogero, and M. F. Di Renzo
Deletion in a (T)8 microsatellite abrogates expression regulation by 3'-UTR
Nucleic Acids Res.,
November 15, 2003;
31(22):
6561 - 6569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol.,
April 1, 2003;
17(4):
562 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deschenes-Furry, G. Belanger, N. Perrone-Bizzozero, and B. J. Jasmin
Post-transcriptional Regulation of Acetylcholinesterase mRNAs in Nerve Growth Factor-treated PC12 Cells by the RNA-binding Protein HuD
J. Biol. Chem.,
February 14, 2003;
278(8):
5710 - 5717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. A. Price, B. M. Moats-Staats, and A. D. Stiles
Pro- and Anti-inflammatory Cytokines Regulate Insulin-like Growth Factor Binding Protein Production by Fetal Rat Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol.,
March 1, 2002;
26(3):
283 - 289.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang, X. Ma, L.-C. C. Yeh, and M. L. Adamo
Differential Regulation of IGF-Binding Protein Gene Expression by cAMP in Rat C6 Glioma Cells
Endocrinology,
September 1, 2001;
142(9):
3917 - 3925.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. S. Cohick, B. Wang, P. Verma, and Y. R. Boisclair
Insulin-Like Growth Factor I (IGF-I) and Cyclic Adenosine 3',5'-Monophosphate Regulate IGF-Binding Protein-3 Gene Expression by Transcriptional and Posttranscriptional Mechanisms in Mammary Epithelial Cells
Endocrinology,
December 1, 2000;
141(12):
4583 - 4591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Lee and S. G. Laychock
Regulation of Inositol Trisphosphate Receptor Isoform Expression in Glucose-Desensitized Rat Pancreatic Islets: Role of Cyclic Adenosine 3',5'-Monophosphate and Calcium
Endocrinology,
April 1, 2000;
141(4):
1394 - 1402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Rodriguez-Pascual, M. Hausding, I. Ihrig-Biedert, H. Furneaux, A. P. Levy, U. Forstermann, and H. Kleinert
Complex Contribution of the 3'-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene. INVOLVEMENT OF THE RNA-BINDING PROTEIN HuR
J. Biol. Chem.,
August 18, 2000;
275(34):
26040 - 26049.
[Abstract]
[Full Text]
[PDF]
|
 |
|