help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erondu, N. E.
Right arrow Articles by Bar, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Erondu, N. E.
Right arrow Articles by Bar, R. S.
Molecular Endocrinology 13 (3): 495-504
Copyright © 1999 by The Endocrine Society

Transcriptional and Posttranscriptional Regulation of Insulin-Like Growth Factor Binding Protein-3 by Cyclic Adenosine 3',5'-Monophosphate: Messenger RNA Stabilization Is Accompanied by Decreased Binding of a 42-kDa Protein to a Uridine-Rich Domain in the 3'-Untranslated Region

N. E. Erondu, J. Nwankwo, Y. Zhong, M. Boes, B. Dake and R. S. Bar

Diabetes and Endocrinology Research Center Department of Internal Medicine The University of Iowa and Veterans Administration Medical Center Iowa City, Iowa 52246


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Madin Darby bovine kidney (MDBK) cell line was used to investigate the mechanisms underlying the cAMP regulation of insulin-like growth factor binding protein-3 (IGFBP-3) gene expression. Treatment of confluent monolayers either with forskolin or cAMP produced a 60- to 75-fold induction of IGFBP-3 mRNA and protein levels. This effect did not require new protein synthesis as inhibition of translation by cycloheximide actually caused a 2-fold increase in the cAMP induction. The rates of IGFBP-3 gene transcription, assessed by nuclear run-on assays, increased approximately 15-fold in cells exposed to cAMP. In addition, the half-life of the IGFBP-3 mRNA transcript was increased ~3-fold in the presence of cAMP. Gel mobility shift and competition experiments revealed the specific binding of an approximately 42-kDa cytoplasmic protein factor to the 3'-untranslated region (3'-UTR) of the IGFBP-3 mRNA. A 21-nucleotide uridine-rich segment that contained no AUUUA motif was sufficient for the specific binding. The binding activity of this protein was reduced after cAMP treatment but was increased by phosphatase treatment. In conclusion, the cAMP induction of IGFBP-3 mRNA in MDBK cells occurred at both the transcriptional and posttranscriptional levels. The IGFBP-3 mRNA stabilization in MDBK cells probably involved the phosphorylation of a member of the family of U-rich region mRNA-binding proteins and is the first reported member whose RNA-binding activity is reduced by cAMP.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factors (IGFs) are mitogenic peptides that regulate metabolic activity and cell growth and differentiation in many cell types (1). Insulin-like growth factor binding protein-3 (IGFBP-3), the major IGFBP in the circulation, is synthesized by a wide range of tissues and cell types. IGFBP-3 has also been shown to modulate IGF action as well as possess IGF-independent activities such as antiproliferation, apoptosis, and cell differentiation (2). Levels of both IGF-I and IGFBP-3 in the circulation and in tissues are altered in a number of disease states including diabetes mellitus and renal failure (3). Such decreases in IGFBP levels have been suggested to contribute to some of the pathological findings attributed to IGF-I by making more of the growth factor available to its cellular receptor. As therapies with IGF-I and IGF-I/IGFBP-3 complexes are being tested, it is essential that we understand the factors and mechanisms that regulate IGFBP-3 synthesis.

Several physiologically important cytokines and growth factors that increase intracellular levels of cAMP also regulate IGFBP-3 synthesis (4). It has been reported that the cAMP induction of IGFBP-3 production in MDBK cells, a bovine renal epithelial cell line, was associated with increased responsiveness to IGF-I as well as differentiation of the cells (5, 6). In the present study, we examined the mechanisms underlying the cAMP regulation of IGFBP-3 production in MDBK cells. Specifically, the effects of cAMP on IGFBP-3 gene transcription rates and mRNA stability were investigated to determine whether the cAMP regulation of IGFBP-3 is brought about by transcriptional and/or posttranscriptional mechanisms. We also report the identification of candidate cis- and trans-acting elements/factors involved in such regulation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Induction of IGFBP-3 Production by cAMP
Confluent MDBK cells were washed with serum-free DMEM and exposed to forskolin and to varying concentrations of (Bu)2cAMP for 18 h at 37 C. Steady state IGFBP-3 mRNA was measured by Northern blot analysis while IGFBP-3 protein secreted into the media was determined by [125I]IGF-I Western ligand blotting. Results (Fig. 1Go, A and C) confirmed previous reports (7) that forskolin induced IGFBP-3 mRNA and protein levels in MDBK cells. In addition, we have shown a dose-dependent increase in IGFBP-3 mRNA and protein levels by (Bu)2cAMP in these cells (Fig. 1Go, A and C). Reprobing the membrane with a bovine actin cDNA probe (Fig. 1BGo), as well as ethidium bromide staining (data not shown), verified the equivalent RNA loading in all lanes. It should be noted that the cAMP-induced increase in IGFBP-4 protein seen in Fig. 1CGo has been reported previously (5, 7) and also correlates with changes in steady state IGFBP-4 mRNA levels (data not shown). Table 1Go summarizes the mean data (±SD) for the effect of forskolin and varying doses of (Bu)2cAMP on IGFBP-3 mRNA levels in MDBK cells.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. Northern Blot Analysis of MDBK Cellular RNA (A and B) and [125I]IGF-I Western Ligand Blot of Conditioned Media (C)

MDBK cells were incubated for 18 h at 37 C in serum-free media and in the presence of the indicated concentrations of (Bu)2cAMP and forskolin. Total RNA (10 µg/lane) was electrophoresed, blotted, and probed with 32P-labeled IGFBP-3 (A). The IGFBP-3 probe was washed off the filter, and it was reprobed for the housekeeping gene, actin (B). Conditioned media from the cells were collected, electrophoresed, blotted, and probed with [125I]IGF-I (C). The double arrowhead in panel B indicates actin mRNA.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Effect of Forskolin and (Bu)2cAMP on IGFBP-3 mRNA Levels

 
The time course of the IGFBP-3 mRNA induction by cAMP is shown in Fig. 2Go. The increase in the steady state level of IGFBP-3 mRNA was observed after 2 h of incubation and reached a maximum after approximately 12 h. Furthermore, the forskolin- and cAMP-induced increase in IGFBP-3 mRNA was inhibited in the presence of H89 (a protein kinase A inhibitor) as would be expected for a protein kinase A-mediated process (Fig. 3Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Time Course of the Regulation of IGFBP-3 mRNA by cAMP

Confluent MDBK cells were incubated in the absence or presence of 10 mM (Bu)2cAMP for varying lengths of time. Total RNA was isolated and IGFBP-3 mRNA was determined by Northern blot analysis as previously described.

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. Effect of H89 and Cycloheximide (CHX) on cAMP-Induced Increase in IGFBP-3 mRNA

MDBK cells were treated with H89 (30 µM) or CHX (2 µM) in the presence or absence of 10 mM (Bu)2cAMP or 30 µM forskolin, followed by Northern blot analysis using an IGFBP-3 probe.

 
Requirement for New Protein Synthesis
The role of new protein synthesis in IGFBP-3 induction by cAMP was studied by pretreatment of MDBK cells with 2 µM cycloheximide followed by exposure to either forskolin or cAMP. This concentration of cycloheximide has been reported to inhibit protein synthesis in MDBK cells by 75% (8). Our results (Fig. 3Go) show that the cAMP induction of IGFBP-3 was not prevented or reduced by inhibition of new protein synthesis. In fact, the observed effect was enhanced 2.1 ± 0.3-fold (n = 3, P < 0.05) in the presence of cycloheximide, perhaps due to the inhibition of synthesis of labile destabilizing factor(s) or labile transcriptional repressor(s). Alternatively, translation of IGFBP-3 mRNA leads to the unmasking of a target site for the binding of a destabilizing factor.

IGFBP-3 Gene Transcription Rates and mRNA Stability Are Increased by cAMP
The observed cAMP induction of IGFBP-3 mRNA could occur either at the level of gene transcription or via mRNA stabilization. To study the regulation of the IGFBP-3 gene by cAMP, the transcription rates of the IGFBP-3 gene in MDBK cells were measured by nuclear run-on assays. MDBK cells, in the absence of cAMP, had a very low basal transcription of IGFBP-3 (Fig. 4Go, Control). In contrast, the MDBK cells treated with cAMP showed a 15 ± 2-fold increase in IGFBP-3 gene transcription (Fig. 4Go, (Bu)2cAMP; n = 3, P < 0.05). Bovine actin and pBluescript (Stratagene, La Jolla, CA) were included on the filters as internal controls. These nuclear run-on results indicate that the regulation of IGFBP-3 gene in MDBK cells by cAMP occurs, at least in part, at the transcriptional level.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 4. Stimulation of IGFBP-3 Gene Transcription by cAMP

Confluent MDBK cells were incubated in the presence or absence of (Bu)2cAMP (10 mM) for 18 h, followed by nuclear run-on assays as described in Materials and Methods. There was a significant increase in IGFBP-3 gene transcription in the presence of cAMP.

 
Since the 15-fold increase in transcription rate could not totally account for the 75-fold increase in the cAMP induction of IGFBP-3 steady state mRNA, we examined the effect of cAMP on IGFBP-3 mRNA stability in MDBK cells. The half-life of IGFBP-3 mRNA was measured in cultures treated with the transcription inhibitor, dichloro-ß-D-ribofuranosyl benzimidazole (DRB) in the presence or absence of cAMP. First, as shown in Fig. 5AGo, the concentration of DRB used in these experiments (65 µM) was sufficient to inhibit cAMP induction of IGFBP-3 mRNA. To generate sufficient IGFBP-3 mRNA for the stability experiments, MDBK cells were first incubated with 10 mM (Bu)2cAMP overnight. The cells were subsequently washed with serum-free media, and the incubation was continued with DRB plus or minus 10 mM (Bu)2cAMP. Cells were harvested at 0, 4, 12, and 20 h after addition of DRB, and IGFBP-3 mRNA levels were quantitated by Northern blot analysis. The amount of IGFBP-3 mRNA at time zero in each treatment group was assigned a value of 100%, and all other values at different time points were expressed relative to the time zero value. As shown in Fig. 5Go, B and C, and Table 2Go, the presence of cAMP caused approximately a 3-fold increase in the half-life of IGFBP-3 mRNA (from 6.3 h to 21 h) implying that the cAMP-induced increase occurs also at the level of mRNA stability. Incubation of the cells with cAMP had no significant effect on the half-life of actin mRNA (Fig. 5CGo and Table 2Go).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Stabilization of IGFBP-3 mRNA by cAMP

A, Total RNA from cells exposed to 65 µM DRB in the presence or absence of cAMP were analyzed by Northern blot. B, Cells were treated with cAMP for 18 h before the addition of DRB. Incubation was continued in the absence (Control) or presence of 10 mM cAMP [(Bu)2cAMP] and at the indicated times, total RNA was isolated and IGFBP-3 mRNA was analyzed by Northern blot. Both blots were subsequently washed and reprobed for Actin mRNA. C, Percentage of IGFBP-3 and actin mRNA remaining as determined by densitometric scanning was plotted on a semilog scale. The mRNA levels at time zero were assigned a value of 100%, and mRNA levels at all other times are expressed as percentages of time zero values. The data were generated from three independent experiments, and error bars have been omitted for clarity. The range of the data points is indicated by the calculated half-life values shown in Table 2Go.

 

View this table:
[in this window]
[in a new window]
 
Table 2. mRNA Half-Lives

 
Identification of Specific IGFBP-3 mRNA- Binding Activity
Most studies dealing with mRNA stability determinants have identified mRNA decay signals in the 3'-untranslated region (3'-UTR) indicating the importance of this region in influencing the half-lives of most mRNAs (9). One of these determinants is the AUUUA motif, which is also present in the 3'-UTR of the full-length bovine, rat, and human IGFBP-3 cDNAs (10, 11, 12). As shown in Fig. 6AGo, the segment of the 3'-UTR containing this motif (underlined ATTTA) is virtually identical across the three species. This is quite remarkable for a noncoding region of the mRNA and raises the possibility that it plays a major role in mRNA regulation. Therefore, the initial studies were focused on the 3'-UTR of IGFBP-3 mRNA to identify RNA binding proteins in MDBK cells that bind to this region and also exhibit differential binding depending on prior exposure of the cells to cAMP.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 6. 3'-UTR of IGFBP-3 cDNA

A, Nucleotide sequences of a segment of the 3'-UTR of human (top line), bovine (middle line), and rat (bottom line) IGFBP-3 cDNA. The sequence is numbered relative to the first nucleotide of the published IGFBP-3 cDNA clones. The human and rat sequences that are identical to the bovine sequence are indicated by an asterisk. The ATTTA motif is underlined. Gaps have been introduced to maximize the alignment. The rat cDNA sequence was obtained from Ref. 10, the human cDNA sequence was from Ref. 11, while the bovine sequence was from Ref. 12. B, Partial restriction enzyme map of the 3'-UTR of bovine IGFBP-3 cDNA. The nucleotide positions of the restriction enzymes relative to the first nucleotide of the full-length cDNA, BP-3.511, are shown in parentheses. The 17 A residues at the 3'-end of the cDNA is indicated by the {Delta}, while the ATTTA motif is shown as °|. Regions corresponding to the RNA probes described in Materials and Methods are shown below the map.

 
To determine whether cellular extracts contain proteins that bind to the 3'-UTR of IGFBP-3 mRNA, a 32P-labeled 3'-UTR1 transcript (nt 2039–2430, Fig. 6BGo) was incubated with cytoplasmic extracts from MDBK cells that had been exposed to serum-free media in the absence or presence of cAMP. After digestion of the free RNA probe with RNase T1, the RNA-protein complexes were separated on an SDS-PAGE gel. Figure 7AGo shows one major complex that was reduced to 66 ± 7% of control (n = 8, P < 0.05) in extracts from cells that were treated with cAMP. This decrease in binding was abolished when cells were exposed to media that also contained H89 (106 ± 15%, n = 4), indicating that this is likely to be a protein kinase A-mediated process. To determine the molecular size of the protein involved in the complex formation, Northwestern blot analysis of cytoplasmic extract from control and cAMP-treated cells was performed. As shown in Fig. 7BGo, the binding of the 3'-UTR1 probe to a ~42-kDa protein in extracts from cAMP-treated cells was reduced to 63 ± 6% of control(Lane 2 vs. 1; n = 4, P < 0.05). When this experiment was repeated with a nonspecific probe, no binding to this protein was detected (Fig. 7CGo, lanes 1 and 2). This is the expected result if this 42-kDa RNA-binding protein is involved in destabilization/degradation of IGFBP-3 mRNA, in which case cAMP-induced reduction in its binding will result in stabilization. To confirm that the observed shifted band was due to an interaction between a protein and the labeled RNA, the cellular extract was preincubated with proteinase K before the gel mobility shift assays were done. As shown in Fig. 8Go (lanes A2, A3, B2, and B3), the complex formation was abolished by pretreatment with proteinase K as would be expected for an RNA-protein interaction.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 7. cAMP Treatment Inhibits the Binding of a ~42-kDa RNA-Binding Activity to 3'-UTR1

A, Radiolabeled sense RNA probe, 3'-UTR1 was incubated with 10 µg cytoplasmic extract from control and cAMP-treated MDBK cells plus or minus H89. After RNase T1 digestion, samples were UV-cross-linked and separated by 12% SDS-PAGE under reducing conditions. The formation of a ~48-kDa RNA-protein complex in extract from cAMP-treated cells was reduced relative to control. There was no significant difference between control and cAMP-treated cells when H89 was included during the incubation. B, Cytoplasmic extract (60 µg) from control (lane 1) and cAMP-treated (lane 2) MDBK cells was subjected to 12% SDS-PAGE under reducing conditions, blotted, renatured, and probed with radiolabeled 3'-UTR1 transcript as described in Materials and Methods. The arrow depicts a ~42-kDa protein whose binding to the probe in extract from cAMP-treated cells (lane 2) was reduced relative to control extract (lane 1). C, An identical blot as the one shown in panel B was probed with a nonspecific probe, 3'-UTR2. The data, which were generated by densitometric scanning of the blots, are expressed relative to control (assigned a value of 100%).

 


View larger version (59K):
[in this window]
[in a new window]
 
Figure 8. Proteinase K Sensitivity of RNA-Protein Complex Formation

Cytoplasmic extracts from control (A) and cAMP-treated (B) MDBK cells were preincubated with 0 (lane 1), 0.1 µg (lane 2), and 1 µg (lane 3) of proteinase K for 30 min at 37 C followed by addition of 32P-labeled 3'-UTR1 to initiate the binding reaction. After RNase T1 digestion and UV cross-linking, the samples were subjected to electrophoresis on a 6% native gel.

 
A Phosphoprotein Is Required for Formation of the RNA-Protein Complex
The control of cellular events by cAMP is usually mediated by cAMP activation of protein kinase A, leading to phosphorylation of protein factors. To test whether phosphorylation is involved in the control of this RNA-binding activity, cytoplasmic extract from cAMP-treated cells was incubated first with potato acid phosphatase before the binding reaction. Figure 9Go (lane 2) shows that pretreatment of the extract with acid phosphatase enhanced the binding activity of the RNA-binding protein 2.6 ± 0.7-fold (n = 3, P < 0.05).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 9. Phosphatase Treatment Enhances the Formation of the RNA-Protein Complex

Potato acid phosphatase was incubated with cytoplasmic extract generated from cAMP-treated cells at 37 C for 30 min, before the addition of radiolabeled 3'-UTR1 (lane 2). Lane 1 represents a control incubation with extract that was not treated with acid phosphatase, while lane 3 represents incubation with heat-inactivated acid phosphatase. After RNase T1 digestion and UV cross- linking, the samples were subjected to electrophoresis on a 6% native gel. After exposure to x-ray film, the gel was scanned and the data are expressed relative to control (lane 1), which was assigned a value of 1. Treatment of the extract with acid phosphatase (lane 2) caused a significant increase in the formation of the RNA-protein complex.

 
A Uridine-Rich Region Is Necessary for the Formation of the RNA-Protein Complex
To further localize the region on 3'-UTR1 (Fig. 6BGo) to which this 42-kDa protein binds, the RNA mobility gel shift studies were repeated with 32P-labeled 3'-UTR2 [Fig. 6BGo, nucleotides (nt) 2039–2238] and 3'-UTR3 (Fig. 6BGo, nt 2239–2430) transcripts. The RNA-protein complex was only generated with 3'-UTR3 transcripts (data not shown), which was not entirely surprising since 3'-UTR3 contains the single AUUUA motif and, in addition, was uridine rich, two elements that have been shown to be involved in the binding of mRNA stabilization/destabilization factors (9). To demonstrate that the region encompassed by 3'-UTR3 was responsible for the RNA binding to 3'-UTR1, the binding studies with 3'-UTR1 were repeated in the presence of 100-fold molar excess of unlabeled 3'-UTR2 and 3'-UTR3. As predicted (Fig. 10AGo), only 3'-UTR3 inhibited the formation of the RNA-protein complex. To explore the sequence requirements for this complex formation, various ribohomopolymers were tested for their ability to compete for binding to the 32P-labeled, 3'-UTR1 probe by gel mobility shift assay. As shown in Fig. 10AGo, poly (G), poly (A), and poly (C) showed no competition even at 500 ng while poly (U) abolished the formation of the complex at 10 ng.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 10. Specificity of the RNA-Protein Complex Formation

A, Specificity of the binding to 3'-UTR1. Before addition of the MDBK cytoplasmic extract, radiolabeled 3'-UTR1 was mixed with 100-fold molar excess of 3'-UTR2 (lane 2) or 3'-UTR3 (lane 3) or with varying amounts of unlabeled ribohomopolymer competitors as indicated. After RNase T1 digestion and UV cross-linking, the samples were resolved on a 6% native polyacrylamide gel. B, Determination of protein-binding site in the 3'-UTR of IGFBP-3 mRNA. Radiolabeled 3'-UTR3-A (lane 1), 3'-UTR3-B (lane 2), and 3'-UTR3-C (lane 3) were incubated with cytoplasmic extract followed by RNase T1 digestion and UV cross-linking. The samples were subsequently resolved on a 6% native gel. C, Specificity of the binding to 3'-UTR3-A. The binding reaction with 32P-labeled 3'-UTR3-A was repeated in the absence (lane 1) or presence of the following competitors: 100-fold 3'-UTR3, specific competitor (lane 2); 100-fold 3'-UTR2, nonspecific competitor (lane 3); 500 ng poly (A) (lane 4); 500 ng poly (G) (lane 5); 500 ng poly(C) (lane 6); and 10 ng poly (U) (lane 7). The RNA sequences contained in the above probes that were derived from the 3'-UTR of IGFBP-3 mRNA are UCCUUUAUUUUUUUAAUUAAGUUUUUGAGA (3'-UTR3-A); AAAAGUAUUUUUGAAAAGUUUGUCUU (3'-UTR3-B); and GC-AAUGUAUUUAUAAAUAGUAAAUAAAAUU (3'-UTR3-C). D, Requirement for the poly uridine stretch in the RNA-protein complex formation. Three mutants of 3'-UTR3-A lacking the 5 U stretch and containing the indicated nucleotide substitutions (underlined) in the 7 U stretch were generated as described in Materials and Methods, radiolabeled, and used in the binding reaction as described above). Lane 1, Mut 1 (UCCUUUAUUUAUUUAAUUAAG); lane 2, Mut 2 (UCCUUUAUUUGUUUAAUUAAG); and lane 3, Mut 3 (UCCUUUAUUAUUAUAAUUAAG).

 
To further map the protein-binding site(s) within 3'-UTR3 (Fig. 6BGo), three additional RNA probes encompassing three nonoverlapping AU-rich regions were synthesized. One, designated 3'-UTR3-A (nt 2311–2340) is 60% U-rich; the second, 3'-UTR3-B (nt 2345–2370) is 46% U-rich; while the third, 3'-UTR3-C (nt 2371–2400), is 37% U-rich and contains the single AUUUA motif in the IGFBP-3 mRNA. As shown in Fig. 10BGo (lane 1), an RNA-protein complex was generated when 3'-UTR3-A was incubated with MDBK cytoplasmic extract. No band-shifted complex was formed with either probes 3'-UTR3-B or 3'-UTR3-C (lanes 2 and 3). Competition experiments (Fig. 10CGo) showed that 3'-UTR3 (lane 2) and poly (U) (lane 7), but not 3'-UTR2 poly (A), poly (G), or poly (C) (lanes 3–6), abolished complex formation. Thus, this 42-kDa protein is probably not a poly (A)-binding protein and does not require the presence of an AUUUA motif for binding. It should also be noted that 3'-UTR3-A contains two U stretches (7 and 5 nt in length), making it interesting to determine whether the uridine stretches are critical for RNA-protein complex formation. The gel shift experiments were repeated with 3'-UTR3-A mutants and, as shown in Fig. 10DGo, deletion of the stretch of five Us plus a single U-to-A mutation in the seven-U stretch did not abolish complex formation (lane 1). This was not entirely surprising since this single U-to-A substitution generated the consensus nonameric motif (UUAUUUAUU) that has been shown to be an instability determinant as well as a site for the binding of U-rich element-binding protein factors (13). However, a single U-to-G mutation as well as U-to-A mutation at two positions in this region abolished complex formation (lanes 2 and 3), indicating that the polyuridine stretch is critical for the RNA-protein interaction.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Several physiologically important cytokines and growth factors that increase intracellular cAMP levels also regulate IGFBP-3 synthesis (4). An example is the cAMP induction of IGFBP-3 in MDBK cells, which is associated with differentiation of the cells as well as increased responsiveness to IGF-I (5, 6).

In this study, cAMP has been shown to regulate gene expression by both transcriptional and posttranscriptional mechanisms. Nuclear run-on assays demonstrated that (Bu)2cAMP significantly increased the rate of IGFBP-3 gene transcription in MDBK cells. In addition, the half-life of IGFBP-3 mRNA transcript was increased ~3-fold in the presence of cAMP, the first report of cAMP-mediated regulation of IGFBP-3 mRNA stability. Although estimates of mRNA half-lives and stability using transcription inhibitors such as DRB must be viewed with caution, it is a widely used approach that generally agrees with results obtained from pulse-chase experiments (9). More importantly, our present results have revealed specific binding of a 42-kDa cytoplasmic protein to the 3'-UTR of IGFBP-3 mRNA in a cAMP-dependent and protein phosphorylation-dependent manner. Mutations within the polyuridine stretch abolished RNA-protein complex formation, indicating that this protein probably belongs to the family of U-rich region mRNA-binding proteins (9, 13) and is the first member whose RNA-binding activity is reduced by cAMP.

In many genes, an 8-bp palindrome (TGACGTCA) has been identified as the canonical cAMP response element (CRE) (14). However, not all cAMP-regulated genes have the canonical CRE sequence as numerous variations to this consensus sequence have been identified (15). Furthermore, the AP-2 recognition site (a non-CRE element) mediates cAMP induction of some mRNAs (16). It is, therefore, interesting to note that two overlapping putative AP-2-binding sites have been identified in corresponding positions 5' to both the bovine and rat IGFBP-3 promoter (4, 12). Future studies will be aimed at determining if this element is involved in the observed cAMP regulation of IGFBP-3 gene transcription. It will be equally important to identify trans-acting factors as well as any other cis-acting elements involved.

The demonstration that the IGFBP-3 mRNA stabilization by cAMP is accompanied by decreased binding of a protein factor to a U-rich domain of the 3'-UTR of the IGFBP-3 mRNA is interesting since the U-rich elements found within the 3'-UTRs of many immediate early mRNAs such as c-fos and c-myc play an important regulatory role in the turnover of these mRNAs (9, 17). In fact, several U-rich element-binding proteins have been identified, and there is evidence that they are involved in mediating selective mRNA stabilization and/or destabilization (13, 18). Furthermore, the mRNA-binding activity of some of these proteins is modulated by reversible phosphorylation/dephosphorylation (13). Examples include SG-URBP, a 48-kDa cytoplasmic protein that binds to the 3'-UTR of the Na+/glucose transporter in the pig kidney cell line (LLC-PK1), as well as AUBF, a 44-kDa adenosine-uridine-binding factor that binds to AUUUA motifs of several cytokine and oncogene mRNAs (19). The IGFBP-3 mRNA-binding protein described in this report differs from other known binding proteins in that its binding activity is decreased by cAMP. It is, therefore, likely to be a new member of the family of U-rich region mRNA-binding proteins.

The functional significance of the RNA-protein interaction described in this study still needs to be directly demonstrated. A reasonable hypothesis to explain our findings is that this 42-kDa protein is involved in IGFBP-3 mRNA degradation and that the decrease in its binding affinity resulting from phosphorylation leads to mRNA stabilization. Other interesting questions include the requirement for other protein factors and whether this protein can bind to mRNAs other than IGFBP-3 mRNA to increase their stability in response to cAMP. Further studies of this model system are likely to provide unique and novel insights into the regulation of IGFBP-3 synthesis as well as enhance our understanding of the cAMP second messenger pathway as it relates to mRNA stabilization/destabilization.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
Stock cultures of MDBK cells were obtained from ATCC (Manassas, VA) and maintained in media supplemented with 10% FCS as recommended by the supplier. Confluent cells were washed with serum-free media before exposure to the various conditions. Forskolin, (Bu)2cAMP, H89, cycloheximide, and ribohomopolymers were purchased from Sigma Chemical Co. (St. Louis, MO).

RNA Isolation and Northern Blot Analysis
Total RNA was isolated from MDBK cells using the QIAGEN (Chatsworth, CA) RNeasy Total RNA kit and quantitated by measurement of absorbance at 260 nm. After the RNA was separated by agarose-formaldehyde gel electrophoresis, it was transferred to a nylon membrane (GeneScreen, New England Nuclear, Boston, MA) and probed with radiolabeled IGFBP-3 PCR product as previously described (20). Membranes were stripped according to the manufacturer’s instructions and reprobed with a radiolabeled bovine actin PCR product to assess the relative sample loading efficiency. The PCR products used for the above experiments were generated using oligonucleotides based on the published sequences of bovine IGFBP-3 and actin cDNAs (21, 22).

Ligand Blotting
Conditioned media were concentrated and subjected to SDS-PAGE under nonreducing conditions. After electrotransfer, the membranes were probed with [125I]IGF-I according to the method of Hossenlopp et al. with minor modifications as previously described (20).

Isolation of Nuclei and Transcription Assay
We used the method of Tetradis et al. (23) with minor modifications. Confluent MDBK cells were incubated in serum-free media plus or minus cAMP for 18 h before isolation of nuclei. Cells were rinsed once with ice-cold PBS without calcium and magnesium, collected by scraping into PBS, and harvested by centrifugation at 1500 rpm for 2 min. The cell pellet from each T75 flask was resuspended in 1 ml of hypotonic buffer on ice [10 mM KCl, 10 mM Tris-HCl (pH 7.5), 1.5 mM MgCl2, 0.3 M sucrose, 0.25% NP-40, 1 mM dithiothreitol (DTT), and 0.5 mM phenylmethylsulfonylfluoride] and gently disrupted in a Dounce homogenizer with pestle B. Lysed cells were centrifuged for 15 min at 1500 rpm, and the nuclear pellet was immediately resuspended in 200 µl of transcription reaction buffer [50 mM Tris-HCl (pH 7.5), 0.1 M ammonium sulfate, 1.8 mM DTT, 1.8 mM MnCl2, 2 µl Rnasin, 300 µM each of ATP, CTP, and GTP, and 100 µCi of [32P]UTP]. Transcription was carried out for 20 min at room temperature and terminated by the addition of 5 µl ribonuclease (RNase)-free deoxyribonuclease (DNAse) and 2 µl of tRNA (20 mg/ml). After 15 min at room temperature, 20 µl 10% SDS and 2 µl proteinase K (0.1 mg/ml) were added, and the incubation was continued for 45 min at 37 C. RNA was subsequently extracted by the method of Chomczynski and Sacchi (24). Five micrograms of linearized pBS, bovine actin, and IGFBP-3 cDNAs (all cloned in pBS) were slot blotted onto nitrocellulose paper and stored at 4 C until use. Filters were prehybridized for 1 h at 52 C in 3 ml of a solution containing 49.3% formamide, 4.93 x saline sodium citrate (SSC), 0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl (pH 7.5), 4 x Denhardt’s, 0.34 mg/ml yeast RNA, and 0.34 mg/ml sheared salmon sperm DNA. An equal amount of radioactive RNA (107 cpm) was added to each vial, and the filters were hybridized at 52 C for 72 h in a solution containing 58% formamide, 5.8 x SSC, 0.12% SDS, 1.2 mM EDTA, 12 mM Tris-HCl (pH 7.5), 4.7 x Denhardt’s, 0.4 mg/ml yeast tRNA, and 0.4 mg/ml sheared salmon sperm DNA. Filters were washed twice at 65 C for 1 h in 25 ml of 2 x SSC. The filters were digested with RNase A for 30 min at 37 C, followed by a final wash in 25 ml of 2 x SSC at 37 C for 1 h. Filters were air dried and exposed to x-ray film at -80 C.

mRNA Stability Analysis
MDBK cells were incubated with 10 mM (Bu)2cAMP for 18 h before the addition of 65 µM DRB to arrest new RNA synthesis. Incubation was continued in the presence of DRB plus or minus cAMP. Cells were harvested 0, 4, 12, and 20 h after the addition of DRB for RNA extraction and Northern blot analysis as described above.

Construction of Plasmids
As stated above, we have isolated and sequenced a full-length IGFBP-3 cDNA (2.4 kb) cloned into EcoRI- and XhoI-predigested pBluescript (Stratagene). The cDNA clone (BP-3.511) has a SacI site 4 bp downstream of the stop codon. A 1010-bp SacI fragment containing the 5'-UTR, the entire coding region, and 4 bp of 3'-UTR was excised from BP-3.511 and religated. The resulting plasmid, referred to as BP-3.511{Delta}Sac, contained the entire 1420 bp of 3'-UTR of bovine IGFBP-3 cDNA except for 4 bp upstream of the SacI site. BP-3.511{Delta}Sac was double digested with SacI and AccI, filled in with Klenow enzyme, and religated to generate BP-3.511{Delta} Acc, which contained 392 bp of 3'-UTR (nt 2039–2430). A 2237-bp BamHI fragment was excised from BP-3.511 and religated to generate BP-3.511{Delta}Bam, which contained 192 bp of 3'-UTR (nucleotides 2238–2430). The following oligonucleotide pairs corresponding to the indicated segments of the 3'-UTR of the IGFBP-3 cDNA were synthesized. A (nt 2311–2340): 5'-TCC TTT ATT TTT TTA ATT AAG TTT TTG AGA-3' and 5'-TCT CAA AAA CTT AAT TAA AAA AAT AAA GGA-3'; B (nt 2345–2370): 5'-AAA AGT ATT TTT GAA AAG TTT GTC TT-3' and 5'-AAG ACA AAC TTT TCA AAA ATA CTT TT-3'; C (nt 2371–2400): 5'-GCA ATG TAT TTA TAA ATA GTA AAT AAA ATT-3' and 5'-AAT TTT ATT TAC TAT TTA TAA ATA CAT TGC-3'; A mut 1 (nt 2311 to 2331): 5'-TCC TTT ATT TAT TTA ATT AAG-3' and 5'-CTT AAT TAA ATA AAT AAA GGA-3'; A mut 2 (nt 2311–2331): 5'-TCC TTT ATT TGT TTA ATT AAG-3' and 5'-CTT AAT TAA ACA AAT AAA GGA-3'; A mut 3 (nt 2311–2331): 5'-TCC TTT ATT ATT ATA ATT AAG-3' and 5'-CTT AAT TAT AAT AAT AAA GGA-3' (the mutated nucleotides are underlined). Each oligo pair was annealed and cloned into the SmaI site of pBS to generate plasmids pBS:3'-UTR3-A, pBS:3'-UTR3-B, pBS:3'-UTR3-C, pBS:3'-UTR3-A mut 1, pBS:3'UTR3-A mut 2, and pBS:3'-UTR3-A mut 3, respectively. Before their use in RNA synthesis, purified plasmids were sequenced for verification. A partial restriction enzyme map of the 3'-UTR of IGFBP-3 cDNA is depicted in Fig. 6BGo.

Preparation of RNA Transcripts
The following sense RNA probes were prepared by linearizing the above plasmids with appropriate restriction enzymes: 3'-UTR1, a 402-nt transcript synthesized from XhoI linearized BP-3.511{Delta}Acc; 3'-UTR2, a 210-nt transcript synthesized from BamHI linearized BP-3.511{Delta}Acc; 3'-UTR3, a 237-nt transcript synthesized from XhoI linearized BP-3.511{Delta} Bam; 3'-UTR3-A, a 132-nt transcript synthesized from XhoI linearized pBS:3'UTR3-A; 3'UTR3-B, a 128-nt transcript synthesized from XhoI linearized pBS:3'-UTR3-A; 3'-UTR3-C, a 132 nt transcript synthesized from XhoI linearized pBS:3'UTR3-C; 3'-UTR3-A mut 1, a 100-nt transcript synthesized from BamHI linearized pBS:3'-UTR3-A mut 1; 3'-UTR3-A mut 2, a 100-nt transcript synthesized from BamHI linearized pBS:3'-UTR3-A; and 3'-UTR3-A mut 3, a 123-nt transcript synthesized from XhoI linearized pBS:3'-UTR3-A mut 3. Approximately 100 nt of the 3'-UTR3-A, -B, and -C and 3'-UTR3-A mut 3 and ~80 nt of 3'UTR3-A mut 1 and mut 2 were derived from the vector, pBS. In vitro transcription reactions were performed according to Promega (Madison, WI) instructions using T3 RNA polymerase except for 3'-UTR3-A mut 1 and 2 where T7 RNA polymerase was used. Labeled transcripts were synthesized by inclusion of [{alpha}-32P]UTP (800 Ci/mmol) in the reaction, and the resulting transcripts had a specific activity of approximately 1–3 x 108 cpm/µg. To generate unlabeled transcripts for competition experiments, transcription reactions were scaled up to 100 µl as recommended by Promega, and [32P]UTP was replaced by nonradioactive UTP.

Preparation of Cell Lysates
MDBK cells incubated for 18 h in serum-free media plus or minus 10 mM cAMP were washed twice with ice-cold PBS before lysis in a buffer containing 10 mM HEPES, pH 7.4, 3 mM MgCl2, 40 mM KCl, 2 mM DTT, 5% glycerol, 0.5% NP-40, 8 ng/ml aprotinin, and 100 ng/ml phenylmethysulfonyl fluoride. Nuclei and cell debris were removed by centrifugation at 10,000 x g for 5 min at 4 C, and the cytoplasmic lysates were stored at -80 C until use.

Analysis of RNA-Protein Interactions
MDBK cytoplasmic lysate (10 µg protein) was incubated at room temperature for 15 min with 32P-labeled RNA (1–4 ng) in a buffer containing 10 mM HEPES (pH 7.4), 3 mM MgCl2, 40 mM KCl, 2 mM DTT, 10% glycerol, and 0.5% NP-40. Heparin (final concentration of 10 mg/ml) and yeast tRNA (200 µg/ml, final concentration) were added to reduce nonspecific binding. Subsequently, unbound RNA was digested with 10 U RNase T1 for 30–60 min at room temperature. The reaction mixtures were cross-linked with 254 nm UV radiation for 5 min using Stratalinker 1800 (Stratagene). The RNA-protein complexes were resolved either on a 6% nondenaturing polyacrylamide gel or a 12% SDS gel under reducing conditions. Gels were dried and exposed to film at room temperature or at -80 C.

Northwestern Blot Analysis
After SDS-PAGE of cytoplasmic extract (60 µg/lane) under reducing conditions, the proteins were wet transferred to nitrocellulose sheets as previously described. To renature the proteins, the filter was incubated at 4 C for 1 h with one change in renaturation buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 50 mM NaCl, 0.1% Triton X-100, 1x Denhardt’s, 100 µg/ml tRNA). Subsequently, the blotted proteins were probed with either radiolabeled 3'-UTR1 or 3'-UTR2 riboprobe (105-106 cpm/ml) for 1 h at room temperature in renaturation buffer except that heparin was added to a final concentration of 10 mg/ml and the concentration of tRNA was 200 µg/ml. Unbound RNA was removed by three cycles of washing in the above buffer at room temperature (2 min per wash), and the membrane was subsequently exposed to x-ray film.

Statistics
All comparisons were paired t tests, and the significance was set at P < 0.05. Each figure represents an individual experiment and means ± SD of at least three independent experiments are presented.


    FOOTNOTES
 
Address requests for reprints to: Ngozi E. Erondu, M.B.B.S., Ph.D., The University of Iowa, Department of Internal Medicine, ENDO 3E17 Veterans Administration Medical Center, Iowa City, Iowa 52246. E-mail: ngozi-erondu{at}uiowa.edu

This work was supported by the Office of Research and Development, Medical Research Service, Department of Veterans Affairs, NIH Grant DK-52277–01 (to N. E.E.) and NIH Grant DK-29295 to the Diabetes and Endocrinology Research Center.

Received for publication April 2, 1998. Revision received November 17, 1998. Accepted for publication December 2, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[CrossRef][Medline]
  2. Bach LA, Rechler MM 1995 Insulin-like growth factor binding proteins. Diabetes Rev 3:38–61
  3. Hirschberg R 1993 IGF-1 and the kidney. J Lab Clin Med 122:636–638[Medline]
  4. Albiston AL, Saffery R, Herington AC 1995 Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene. Endocrinology 136:696–704[Abstract]
  5. Cohick WS, Clemmons DR 1993 Regulation of IGF BP secretion and modulation of cell growth in MDBK cells. Growth Regul 3:18–21
  6. Cohick WS, Clemmons DR 1994 Enhanced expression of dihydrofolate reductase by bovine kidney epithelial cells results in altered cell morphology, IGF-1 responsiveness and IGF binding protein-3 expression. J Cell Physiol 161:178–186[CrossRef][Medline]
  7. Cohick WS, Clemmons DR 1991 Regulation of insulin-like growth factor binding protein synthesis and secretion in a bovine epithelial cell line. Endocrinology 129:1347–1354[Abstract]
  8. Gagnon AM, Simboli-Campbell M, Welsh J 1994 Induction of calbindin D-28K in Madin-Darby bovine kidney cells by (OH)2D3. Kidney Int 45:95–102[Medline]
  9. Ross J 1995 mRNA stability in mammalian cells. Microbiol Rev 59:423–450[Abstract/Free Full Text]
  10. Shimasaki S, Koba A, Mercado M, Shimonaka M, Ling N 1989 Complementary DNA structure of the high molecular weight rat insulin-like growth factor binding protein (IGF-BP3) and tissue distribution of its mRNA. Biochem Biophys Res Commun 165:907–912[CrossRef][Medline]
  11. Thweatt R, Fleischmann R, Goldstein S 1993 Analysis of the primary structure of insulin-like growth factor binding protein-3 cDNA from Werner syndrome fibroblasts. DNA Seq 4:43–46[Medline]
  12. Erondu NE, Toland B, Boes M, Dake BL, Moser DR, Bar RS 1997 Bovine insulin-like growth factor binding protein-3: organization of the chromosomal gene and functional analysis of its promoter. Endocrinology 138:2856–2862[Abstract/Free Full Text]
  13. Jarzembrowski JA, Malter JS 1997 Cytoplasmic fate of eukaryotic mRNA: identification and characterization of AU-binding proteins. Prog Mol Subcell Biol 18:141–172[Medline]
  14. Lalli E, Sassone-Corsi P 1994 Signal transduction and gene regulation: the nuclear response to cAMP. J Biol Chem 269:17359–17362[Free Full Text]
  15. Delmas V, Molina C, Lalli E, DeGroot R, Foulkes NS, Masquilier D, Sassone-Corsi P 1994 Complexity and versatility of the transcriptional response to cAMP. Rev Physiol Biochem Pharmacol 124:1–28[Medline]
  16. Duan C, Clemmons R 1995 Transcription factor AP-2 regulates human insulin-like growth factor binding protein-5 gene expression. J Biol Chem 42:24844–24851
  17. Chen C-Y, Shyu A-B 1995 AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20:465–470[CrossRef][Medline]
  18. You Y, Chen C-Y, Shyu A-B 1992 U-rich sequence binding proteins (URBPs) interacting with a 20-nucleotide U-rich sequence in the 3' untranslated region of c-fos mRNA may be involved in the first step of c-fos mRNA degradation. Mol Cell Biol 12:2931–2940[Abstract/Free Full Text]
  19. Peng H, Lever J 1995 Regulation of Na+-coupled glucose transport in LLC- PK1 cells: message stabilization induced by cyclic AMP elevation is accompanied by binding of a Mr = 48,000 protein to a uridine-rich domain in the 3'-untranslated region. J Biol Chem 270:23996–24003[Abstract/Free Full Text]
  20. Erondu NE, Dake BL, Moser DR, Lin M, Boes M, Bar RS 1996 Regulation of endothelial IGF BP-3 synthesis and secretion by IGF-1 and TGFß. Growth Regul 6:1–9[Medline]
  21. Degen J, Neubauer M, Friezner-Degen S, Seyfried C, Morris D 1983 Regulation of protein synthesis in mitogen-activated bovine lymphocytes: analysis of actin-specific and total mRNA accumulation and utilization. J Biol Chem 258:12153–12162[Abstract/Free Full Text]
  22. Spratt SK, Tatsuno GP, Sommer A 1991 Cloning and characterization of bovine insulin-like growth factor binding protein (bIGF BP3). Biochem Biophys Res Commun 177:1025–1032[CrossRef][Medline]
  23. Tetradis S, Pilbeam C, Liu Y, Herschman H, Kream B 1997 Parathyroid hormone increases prostaglandin G/H synthase-2 transcription by a cyclic AMP- mediated pathway in murine osteoblastic MC3T3–E1 cells. Endocrinology 138:3594–3600[Abstract/Free Full Text]
  24. Ausubel FM, Brent R, Kingston RE, Moore DD, Smith JA, Seidman JG, Struhl K 1998 Current Protocols in Molecular Biology. Greene/Wiley Interscience, New York



This article has been cited by other articles:


Home page
J. Neurosci.Home page
J. Deschenes-Furry, K. Mousavi, F. Bolognani, R. L. Neve, R. J. Parks, N. I. Perrone-Bizzozero, and B. J. Jasmin
The RNA-Binding Protein HuD Binds Acetylcholinesterase mRNA in Neurons and Regulates its Expression after Axotomy
J. Neurosci., January 17, 2007; 27(3): 665 - 675.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. M. Ongeri, M. F. Verderame, and J. M. Hammond
Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways
Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. M. Ongeri, Q. Zhu, M. F. Verderame, and J. M. Hammond
Insulin-Like Growth Factor-Binding Protein-3 in Porcine Ovarian Granulosa Cells: Gene Cloning, Promoter Mapping, and Follicle-Stimulating Hormone Regulation
Endocrinology, April 1, 2004; 145(4): 1776 - 1785.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. O. Nwankwo, A. A. Spector, and F. E. Domann
A nucleotide insertion in the transcriptional regulatory region of FADS2 gives rise to human fatty acid delta-6-desaturase deficiency
J. Lipid Res., December 1, 2003; 44(12): 2311 - 2319.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Ruggiero, M. Olivero, A. Follenzi, L. Naldini, R. Calogero, and M. F. Di Renzo
Deletion in a (T)8 microsatellite abrogates expression regulation by 3'-UTR
Nucleic Acids Res., November 15, 2003; 31(22): 6561 - 6569.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol., April 1, 2003; 17(4): 562 - 574.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Deschenes-Furry, G. Belanger, N. Perrone-Bizzozero, and B. J. Jasmin
Post-transcriptional Regulation of Acetylcholinesterase mRNAs in Nerve Growth Factor-treated PC12 Cells by the RNA-binding Protein HuD
J. Biol. Chem., February 14, 2003; 278(8): 5710 - 5717.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
W. A. Price, B. M. Moats-Staats, and A. D. Stiles
Pro- and Anti-inflammatory Cytokines Regulate Insulin-like Growth Factor Binding Protein Production by Fetal Rat Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., March 1, 2002; 26(3): 283 - 289.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Wang, X. Ma, L.-C. C. Yeh, and M. L. Adamo
Differential Regulation of IGF-Binding Protein Gene Expression by cAMP in Rat C6 Glioma Cells
Endocrinology, September 1, 2001; 142(9): 3917 - 3925.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. S. Cohick, B. Wang, P. Verma, and Y. R. Boisclair
Insulin-Like Growth Factor I (IGF-I) and Cyclic Adenosine 3',5'-Monophosphate Regulate IGF-Binding Protein-3 Gene Expression by Transcriptional and Posttranscriptional Mechanisms in Mammary Epithelial Cells
Endocrinology, December 1, 2000; 141(12): 4583 - 4591.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Lee and S. G. Laychock
Regulation of Inositol Trisphosphate Receptor Isoform Expression in Glucose-Desensitized Rat Pancreatic Islets: Role of Cyclic Adenosine 3',5'-Monophosphate and Calcium
Endocrinology, April 1, 2000; 141(4): 1394 - 1402.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Rodriguez-Pascual, M. Hausding, I. Ihrig-Biedert, H. Furneaux, A. P. Levy, U. Forstermann, and H. Kleinert
Complex Contribution of the 3'-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene. INVOLVEMENT OF THE RNA-BINDING PROTEIN HuR
J. Biol. Chem., August 18, 2000; 275(34): 26040 - 26049.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Erondu, N. E.
Right arrow Articles by Bar, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation