help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richardson, J.
Right arrow Articles by Bodwell, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richardson, J.
Right arrow Articles by Bodwell, J.
Molecular Endocrinology 13 (4): 546-554
Copyright © 1999 by The Endocrine Society

Cyclic Adenosine-3',5'-Monophosphate-Mediated Activation of a Glutamine Synthetase Composite Glucocorticoid Response Element

Jan Richardson, Charles Vinson and Jack Bodwell

Department of Physiology (J.R., J.B.) Dartmouth Medical School Lebanon, New Hampshire 03756
Laboratory of Biochemistry (C.V.) National Cancer Institute National Institutes of Health Bethesda, Maryland 20892


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The glutamate synthetase gene (GS) contains a composite glucocorticoid response element (cGRE) comprised of a GRE and an adjacent element with features of both a cAMP-response element (CRE) and a 12-O-tetradecanoylphorbol 13-acetate (TPA) response element (TRE). The CRE/TRE element of the cGRE contributed to two modes of transcriptional activation: 1) enhancement of the response to cortisol and 2) a synergistic response to cortisol and increased cAMP. COS-7 cells transfected with a cGRE-luciferase construct show minimal expression under basal conditions or forskolin treatment. After cortisol treatment, luciferase activity from the cGRE is enhanced 4- to 8-fold greater than the GRE portion of the cGRE or a GRE from the tyrosine aminotransferase gene. Treatment with both forskolin and cortisol produced a 2- to 4-fold synergistic response over cortisol alone. Synergy is also seen with 8-bromo-cAMP, is specific for the cGRE, and occurs in a number of established cell lines. Elimination of the GRE or CRE/TRE reduces the synergy by 70–100%. Altering the CRE/TRE to GRE spacing changed both enhancement and synergy. Moving the elements 3 bp closer or extending 15 bp reduced enhancement. Synergy was markedly reduced when elements were one half of a helical turn out of phase. Western blots verified that CREB (cAMP-responsive binding protein) and ATF-1 (activating transcription factor-1) binds to the cGRE sequence. A specific dominant negative inhibitor of the CREB family, A-CREB, reduced synergy by 50%. These results suggest that the GS cGRE can potentially integrate signaling from both the cAMP and glucocorticoid receptor transduction pathways and that CREB/ATF-1 may play an important role in this process.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Glutamine synthetase (GS) catalyzes the formation of glutamine from glutamic acid and ammonia in an ATP-dependent reaction (1). Physiologically, GS is a critical enzyme in neurotransmitter, energy, and nitrogen metabolism. GS is also a well characterized enzyme marker of Müller glial cells in the chick retina (2) and is developmentally regulated in these cells by glucocorticoids (3, 4, 5). Glucocorticoid regulation of GS in Muller glial cells does not begin until day 7.5 of development, despite the presence of glucocorticoid receptors before that time (6). The glucocorticoid response element in the GS gene, characterized by deoxyribonuclease I footprinting assays, is located at -2107 to -2079 upstream of the transcriptional start site (7, 8). Nine base pairs 5' of the glucocorticoid response element (GRE) (-2113 to -2120) is a site that has features of both a cAMP response element (CRE) and a TPA response element [TRE, see Fig. 1Go for sequence (4, 5)]. Together, the GRE and the CRE/TRE response elements will be referred to in the text as a composite GRE (cGRE).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Structure of GS cGRE and Mutant cGRE Promoters

The cGRE from the chicken GS gene contains a CRE/TRE site adjacent to a GRE. The sequence of the cGRE is shown above the diagrams of the promoters. The CRE/TRE and the GRE are underlined and in boldface type. Labeled boxes in the schematic of mutant cGRE promoter-reporter constructs represent the CRE/TRE, GRE, TATA region, or luciferase-coding regions. Deletions and substitution of element mutants are shown in panel A, and CRE/TRE-GRE spacing mutants are shown in panel B.

 
Characterization of proteins that bind to the CRE/TRE sequence from the cGRE showed that a variety of proteins from the CREB (cAMP-responsive binding protein)/ATF (activating transcription factor) and AP-1 families of transcription factors can bind to the response element. Electrophoretic mobility shift assays using only the CRE/TRE portion of the cGRE sequence showed that c-Jun/ATF-3 heterodimers bind to this response element (7). In addition, when nuclear extracts from retinal cells were used in mobility shift assays, ATF-1 bound to the CRE/TRE, as demonstrated by supershift assays with anti-ATF-1 antibody (7). cAMP activation of protein kinase A, one of the primary kinases responsible for phosphorylation and subsequent activation of CREB and ATF-1 (9), greatly enhances glucocorticoid-induced expression of GS in retina cells (7). Taken together, these results suggest that members of the CREB ATF-1 family of transcription factors may interact with the glucocorticoid receptor (GR) to modulate glucocorticoid effects on the GS cGRE promoter. For convenience we will use the term CREB to refer to the CREB family of transcription factors.

The mechanism whereby cAMP and glucocorticoids induce enhancement and synergistic activation from the GS promoter is not well understood. In this paper, the necessity of the CRE/TRE and the GRE elements and the importance of their relative spacing and alignment in these processes are examined. In vitro and in vivo evidence identifying the importance of CREB in this system is also presented.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Synergistic Response on GS cGRE Is Evident in Multiple Cell Lines
Figure 1AGo depicts the cGRE (-2120 to -2079) from the chicken GS gene, which contains a CRE/TRE site adjacent to a single GRE. The cGRE or modified sequences were cloned into a PXP2-based luciferase reporter vector (10) to create the cGRE luciferase reporters used in these studies (see Fig. 1Go, A and B, for altered constructs; see Materials and Methods for sequences). Initial experiments were conducted to examine the effects of glucocorticoids and cAMP on COS-7 cells, which have no endogenous GR activity. COS-7 cells were transfected with the cGRE-luciferase reporter (Fig. 1AGo) and mouse glucocorticoid receptor DNA. Thirty hours after transfection, cells were treated for 15 h with cortisol (5 x 10-8 M), which activates the GR, with forskolin (10-5), which increases cAMP levels in the cell through activation of the adenylate cyclase pathway, with both cortisol and forskolin or with vehicle alone. The results, shown in Fig. 2Go, demonstrate that cortisol enhanced luciferase activity significantly above basal levels (150 mV/sec/mg protein vs. 2200 mV/sec/mg protein) whereas forskolin alone had no effect. The level of cortisol-induced luciferase expression represents an enhancement of 4- to 8-fold over that seen with only the GRE element from the cGRE (Fig. 7Go) or of the GRE from the tyrosine amino tranfersase gene (data not shown). A significant synergistic response was seen by treating cells with both cortisol and forskolin, resulting in at least a 2.2-fold increase in luciferase activity compared with cortisol alone (Fig. 2Go). In other experiments, synergy (2- to 4-fold increase above cortisol alone) occurred with cortisol concentrations ranging from 1 x 10-9 M to 1 x 10-6 M as well as with dexamethasone and triamcinolone acetonide. The synergy ratio also increased with increasing forskolin concentrations up to the highest level tested (10-5 M; results not shown). The cGRE-luciferase reporter was tested in three other cell lines: two Chinese hamster ovary (CHO) cell lines (epithelial in origin), DG44 and WCL2, and 29+ cells [a mouse L cell line variant deficient in GR (11)]. WCL2 cells are a stably transfected cell line that express ~5 x 105 mouse GRs/cell, whereas DG44 and 29+ cells were transiently transfected with GR in these experiments. Each of these three cell lines was transfected with the cGRE-luciferase reporter followed by treatment with cortisol and/or forskolin as described for COS-7 cells (Fig. 2Go). Forskolin and cortisol treatment resulted in a 6.5-fold increase in luciferase activity compared with cortisol alone in DG44 cells, a 3.6-fold increase in 29+ cells, and an 8.9-fold increase in WCL2 cells. These results demonstrate that the synergistic response occurs in cell lines from different species and cell types as well as with either stably or transiently transfected GR.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Synergistic Activation of the GS cGRE with Cortisol and Forskolin Treatment in COS-7, WCL2, 29+, and DG44 Cells

Luciferase activity was measured in cell extracts from cells transiently transfected with the GR and the GS cGRE-luciferase reporter. WCL2 cells were transfected with only the reporter gene since they have stably integrated GR DNA. Transfected cells were treated with vehicle alone, cortisol (5 x 10-8 M), forskolin (10-5 M), or cortisol and forskolin for 14–16 h, beginning 24–30 h after transfection. In the cell types tested, cortisol/forskolin treatment resulted in 3- to 8.9-fold induction of luciferase activity compared with cortisol treatment alone [fold induction values (synergy ratios) are shown above the cortisol/forskolin bars on the figure]. Data are average of duplicate samples. Error bars are one-half of the range. Results are representative of three separate experiments.

 


View larger version (25K):
[in this window]
[in a new window]
 
Figure 7. Deletion/Substitutions of cGRE Elements Demonstrate Significant Sequence Requirements for Synergy and Enhancement

Luciferase activity was measured in COS-7 cells transfected with mutated cGRE-reporter constructs shown in Fig. 1AGo and GR DNA (see Materials and Methods for sequences). Cells were cultured for 24 h and then treated for 14–16 h with media alone or media containing cortisol (5 x 10-8 M), forskolin (10-5 M), or both cortisol and forskolin. The inset shows the synergy ratio for each construct. Data are average of duplicate samples. Error bars are one half of the range. Results are representative of four separate experiments.

 
cAMP Activation of the GS cGRE
Direct manipulation of cAMP levels with the cell-permeable cAMP analog, 8-bromo-cAMP, was used to confirm the forskolin results with the cGRE reporter gene. COS-7 cells were transfected with the cGRE-luciferase reporter and mouse GR DNA. Cells were treated with 8-bromo-cAMP alone and in combination with cortisol. As shown in Fig. 3Go, 8Go-bromo-cAMP, like forskolin alone, did not increase luciferase activity from the cGRE-luciferase reporter. Cortisol (5 x 10-8) and 8-bromo-cAMP (10 µM) together resulted in a 2.1-fold increase in luciferase activity from the GRE-luciferase reporter compared with cortisol alone. Increasing 8-bromo-cAMP concentration to 100 µM together with cortisol resulted in a 3-fold increase in luciferase activity compared with cortisol alone (Fig. 3Go). In other experiments, COS-7 cells transfected with the cGRE-luciferase reporter and mouse GR were treated with dideoxyforskolin, an inactive analog of forskolin, in the presence and absence of cortisol (Fig. 3Go). Dideoxyforskolin did not promote synergy with cortisol treatment, indicating a requirement for biological activity. These results support the hypothesis that cortisol/forskolin synergy utilizes the cAMP pathway.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Synergistic Effect on GS cGRE Is Mediated through cAMP Activation

COS-7 cells were transfected with GR and the GS cGRE-luciferase reporter DNA. Twenty four hours after transfection, cells were treated with forskolin, dideoxy (dd) forskolin, or 8-bromo-cAMP alone and with cortisol. Fold induction values (synergy ratios) for cortisol/cAMP treatments (over cortisol alone) are shown above the appropriate bar on the figure). Data are average of duplicate samples. Error bars are one-half of the range. Results are representative of three separate experiments.

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 8. Response Element Spacing Mutations Demonstrate Significant Sequence Requirements for the GS cGRE

Experiments were performed as in Fig. 7Go except that mutant cGREs that alter the spacing between the CRE/TRE and GRE elements were used (Fig. 1BGo). The inset shows the synergy ratio for each construct. Data are average of duplicate samples. Error bars are one half of the range. Results are representative of four separate experiments.

 
Cortisol and Forskolin Do Not Induce Strong Synergistic Effects on Reporter Genes Containing other GREs
To directly compare the cortisol/forskolin effects seen with the GS cGRE with other GREs, four luciferase reporters containing either a single GRE, two GREs, a GRE and an inverted GRE, or the mouse mammary tumor virus (MMTV) promoter (two GREs and four half-sites), were tested. COS-7 cells were transiently transfected with the mouse GR and each of the GRE-containing reporters, followed by treatment with cortisol, forskolin, and both cortisol and forskolin. The ratio of luciferase activity from cells treated with cortisol and forskolin to cortisol alone (synergy ratio) is shown in Fig. 4Go. The GS cGRE-containing promoter gave the strongest response (2-fold higher than cortisol alone) while the synergy ratio for the other promoters ranged from 0.8- to 1.2-fold. These results show that the synergistic response to cortisol and forskolin on the GS cGRE is both specific and more robust than the response of the other GREs tested.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. Synergistic Effect of cAMP and Cortisol Is Specific for cGRE Promoter

Luciferase reporter constructs containing a single (GRE) or two GREs (GRE2), a single GRE and an inverted GRE (GiG), or a MMTV promoter (2 GREs and 4 half-site GREs) were cotransfected into COS-7 cells with GR DNA. Cells were treated with cortisol (5 x 10-8 M), forskolin (10-5 M), and both cortisol and forskolin, as described previously. The synergy ratio is the luciferase activity from cortisol and forskolin treatment relative to cortisol alone. Data are average of duplicate samples. Error bars are one-half of the range. Results are representative of three separate experiments.

 
In Vitro Binding of CREB and GR to a cGRE-Containing Oligo
These results suggested that the cAMP-activated binding protein (CREB) or members of the CREB family such as ATF-1 or CRE modulator (CREM) might be important in the synergistic activation on the cGRE. It was important to establish that the GR and CREB, or its family members, would bind to a cGRE containing oligo in vitro. CREB exists predominately in a nuclear bound form, presumably bound to its CRE (9). To mimic protein binding that might be occurring in vivo, we incubated a double-stranded biotinylated oligo containing the cGRE sequence or a control oligo with nuclear extracts (CREB enriched) from WCL2 cells. After collection and washing on neutravidin beads, cytosolic extract (GR enriched) was added. Bound proteins were eluted from neutravidin beads (see Materials and Methods) and analyzed by SDS-PAGE and Western blot using antibodies that recognized members of the CREB family (including ATF-1 and CREM) or GR. As seen in Fig. 5Go, 12 times as much CREB and 3 times as much GR were detected on the cGRE oligo (lane 1) compared with the control oligo (lane 2), and minimal levels were detected on neutravidin beads alone (lane 3). Low levels of ATF-1 were also specifically bound to the cGRE sequence (lane 1). These results confirm that the cAMP-activated proteins from the CREB/ATF family, as well as the GR, can specifically interact with the cGRE sequence and are potential partners for mediating expression from the cGRE.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 5. Western Blot Analysis of CREB and GR Binding to cGRE Containing Oligo Duplex

Biotinylated 46-mer double-stranded oligos containing the cGRE sequence, control oligo without cGRE sequences, or no oligo was incubated with WCL2 extracts. After purification of the oligo on neutravidin beads, proteins were eluted and analyzed by SDS-PAGE and Western blot analysis using anti-CREB/ATF-1 and GR antibodies. See Materials and Methods for details. Specific binding of proteins to the cGRE sequence is reflected by the difference in binding between the cGRE oligo (lane 1) and the control oligo (lane 2).

 
A Dominant-Negative Inhibitor of CREB Reduces Synergy but Not Enhancement from the cGRE
A-CREB (12) is a modified CREB that was engineered to act as a specific dominant-negative inhibitor of CREB and ATF-1. A-CREB was created by substituting an acidic extension for the basic DNA-binding region of CREB. A-CREB forms a heterodimer with CREB that is 3300 times more stable than the CREB homodimer. In the A-CREB:CREB heterodimer, the acidic region of A-CREB is paired with the basic region of CREB such that DNA binding cannot occur and transcription activity is specifically inhibited. The effect of A-CREB on expression from the cGRE was studied by transfecting COS-7 cells with A-CREB, A-C/EBP, or vector DNA in conjunction with the cGRE luciferase reporter and GR DNA. A-C/EBP is a positive control that is an engineered dominant-negative inhibitor for CCAAT/enhancer-binding protein (C/EBP), a transcription factor that binds to the CAAT box sequence (13). Cells were treated with cortisol, forskolin, both, or neither as described previously. Luciferase activity was measured in cell lysates 16 h later. As shown in Fig. 6Go, A-CREB inhibited the synergistic activation by forskolin and cortisol (synergy ratio 1.0), whereas the vector alone and A-C/EBP had ratios of 1.7 and 2 (Fig. 6Go). A-CREB does not affect transcriptional enhancement by cortisol (compare results of cortisol treatment between vector and A-CREB), suggesting that enhancement from the CRE/TRE in the absence of cAMP may be due to a mechanism distinct from the synergy seen with cortisol and forskolin.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. A-CREB Inhibits Synergism of Cortisol and Forskolin on the GS cGRE

COS-7 cells were transfected with the PXP2 cGRE reporter construct GR DNA and either A-CREB, A-C/EBP, or pRc/CMV500, the base vector of the A-constructs. Twenty eight hours post transfection, cells were treated with medium (O) or medium containing cortisol (C, 5 x 10-8 M), forskolin (F, 10-5 M), and both cortisol and forskolin (CF), as described previously. The number above the CF bar is the synergy ratio (luciferase activity from cortisol and forskolin treatment compared with cortisol alone). Data are average of duplicate samples. Error bars are one half of the range. Results are representative of four separate experiments.

 
Spatial and Sequence Requirements of the GS cGRE Response Element
A series of mutant cGREs (see Materials and Methods for sequences) were constructed to determine the sequence and spatial requirements for enhancement and synergy. COS-7 cells were transfected with DNAs for the mutant promoters and mouse GR. Cells were treated with cortisol and/or forskolin as previously described. Deletion of either the CRE/TRE or the GRE from the cGRE (Figs. 1Go and 7Go) reduced enhancement by cortisol treatment alone by 70% and 99%, respectively. Likewise, the synergy ratio was reduced from 3.9 to 2.20 and 1.76, respectively (Fig. 7Go, inset). Clearly, both the CRE/TRE and the GRE elements are needed for both enhancement and synergy.

Deletion of the TATA region (Fig. 7Go) greatly reduced expression from the cGRE and completely eliminated synergy (Fig. 7Go, inset). It is likely that synergy is somehow associated with one or more of the many basic transcription factors assembled at the TATA region or with factors that need to associate with them.

To investigate the spatial relationships between the CRE and the GRE, a number of constructs were made that altered the distance between the two elements (Fig. 1BGo). Altering the inter element spacing had different effects on enhancement vs. synergy. The normal spacing between the CRE and the GRE is 9 bp, but by shortening it by 3 bp (Fig. 8Go, cortisol only treatment) there was an 80% reduction in enhancement with a minimal effect on synergy (Fig. 8Go, inset). Extending the distance between the two elements by 5 bp or one half of a turn of the DNA helix has no effect on enhancement but drops the synergy ratio from 3.4 to 2, which is near the no-cGRE control ratio of 1.5. Extending the distance by another 5 bp reestablishes the original alignment of the elements but with an additional 10 bp between the elements. This restored the synergy ratio to original levels (3.4), and there was no effect on enhancement. Extending the elements 15 bp or 1.5 turns of the helix again put the elements out of their original alignment. Synergy was reduced to 2.0, and the enhancement was reduced by one third. Clearly, synergy is dependent on the alignment of the two elements, while enhancement appears to be more of a function of the distance between the elements.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cooperation or antagonism between transcription factors on composite response elements provides an additional level of modulation for transcriptional regulation of gene expression. The CRE/TRE and GRE response elements of the cGRE, analyzed in these studies, allow the examination of functional associations between the GR- and cAMP-activated transcription factors. Our results extend previous studies (7) that demonstrate the CRE/TRE site in the cGRE enhances transcription from the GRE sequence with cortisol treatment as well as with cortisol in combination with cAMP. On the cGRE, there is a marked synergistic effect with glucocorticoids and treatments that increased cAMP, resulting in 2.2- to 8.6-fold greater responses than with cortisol treatments alone. The GS cGRE response to glucocorticoids and increased cAMP levels occurs in cell lines from different species and tissues, suggesting that the synergism is not cell type specific. Glucocorticoid/cAMP synergy on the cGRE is distinct from the general potentiation of glucocorticoid-mediated transcription seen with increased cAMP levels (14). Zhang and Danielsen (14) showed that a MMTV CAT (chloramphenicol acetyltransferase) reporter gene was stimulated approximately 1.7-fold with 8-bromo-cAMP in COS-7 cells but did not use a reporter gene containing the cGRE. This value is much higher than we see for MMTV-luciferase, but their induction period was 40 h instead of the~ 16 h used in this study. We find that the actual ratios for the different GREs is somewhat variable from experiment to experiment but the relative relationship to the cGRE remains the same.

Our data strongly suggest that cAMP-responsive proteins cannot act alone on the cGRE but require activated GR because, in the absence of cortisol, there is no reporter response to forskolin (Fig. 2Go, forskolin treatment alone). Additionally, in the absence of the GRE, there is also no reporter response to forskolin (Fig. 7Go). The mutant cGRE reporter construct, made without the GRE, also showed very little transcriptional activation with cortisol or cortisol and forskolin treatment. This demonstrates that the CRE/TRE is an ineffective promoter in the absence of the GRE. Conversely, in the intact cGRE, the CRE/TRE site plays an important role in the enhancement of cortisol-induced transcriptional activation (Fig. 7Go; compare "no CRE promoter plus cortisol" to the "cGRE plus cortisol"). The CRE/TRE element also plays an important role in the synergistic response to both cortisol and forskolin (Fig. 7Go, inset, compare cGRE to no CRE). Thus, both the CRE/TRE and the GRE response elements are necessary for enhancement and synergy.

Mutant cGREs with altered spacing between the GRE and the CRE/TRE provide additional evidence for two distinct modes of transcriptional activation on the cGRE. There is transcriptional enhancement by cortisol on the cGRE that depends on the presence of the CRE/TRE. Enhancement is not affected by alignment on the helix, as the 5- and 10-bp inserts (Fig. 8Go) had analogous expression levels with cortisol. Enhancement was sensitive to the length of insertion/deletion, as moving the CRE/TRE closer by 3 bp or extending by more than 15 bp from the GRE reduced luciferase expression. Second, the synergistic response with cAMP and cortisol is greatly reduced when the CRE/TRE element is rotated so that it is on the opposite side of the DNA helix relative to its normal relationship to the GRE, as it is in the mutants with 5- and 15-bp inserts (Fig. 8Go, inset). These results suggest that the interactions necessary for enhanced transcriptional activation and synergy on the cGRE require close physical association between factors bound to the CRE/TRE and the GRE. On the 25-bp cGRE from the proliferin gene (plfG, Ref. 15), recent studies have used spacing between its AP-1 and GR response elements to examine transcriptional control at this site. On the wild-type p1fG cGRE, whether hormonal activation or repression of transcription occurs depends on the composition of the AP-1 complex (16). cJun homodimers specify activation and cJun/Fos heterodimers result in repression. Modifications of the nucleotide spacing between the AP-1 site and the simple GRE determine whether synergy occurs. When elements were spaced more than 25 bp apart, GR synergized with both cJun and cJun/Fos whereas reporters with separations of 14–18 bp between the GRE and AP-1 site responded like the p1fG (17). Our results with the GS cGRE show that nucleotide spacing is also critical, but the distance between elements appears to be critical for enhancement while helical phasing is more important for synergy.

We provide in vitro and in vivo evidence that CREB is important for cortisol/cAMP synergy on the cGRE. Specific binding of CREB and GR to the cGRE oligo in vitro provides biochemical evidence for the physical interaction of CREB and the GR with the cGRE sequence. We also used a dominant-negative inhibitor of CREB (A-CREB) that functions by heterodimerizing with endogenous CREB and prevents CREB from binding to its response element (12). A-CREB has been shown to selectively inhibit CREB and its family members ATF-1 and CREM (12). In studies reported here, cAMP/cortisol synergy was alleviated in cells cotransfected with A-CREB. The transcriptional response to cortisol alone remained strong in the presence of A-CREB and was comparable to controls transfected with a control vector A-C/EBP or vector alone (see Fig. 6Go). CREB and GR can also be coimmunoprecipitated from cell extracts, suggesting that direct interactions between the proteins on a promoter may also be possible (Ref. 18 , and J. Bodwell and J. Richardson, unpublished results). These findings suggest that CREB or family members are involved in the synergistic activity generated by treating cells with cortisol and cAMP. Strikingly, although the strong response to cortisol alone (enhancement) requires the CRE/TRE, A-CREB does not inhibit the response, suggesting that a factor or factors other than CREB may be involved in the cortisol response. The C/EBP provides another control for the PXP2 vector used as the base of the reporter vector in these studies. The PXP2 reporter contains a CAATA box (19) that can be activated through C/EBP. Since the A-C/EBP had no negative effect on transcription in this system, it suggests that the CAATA box is not used.

Because of the composition of the CRE/TRE, which appears able to bind members of the cAMP-responsive family of transcription factors, integration of transcriptional control from different signal transduction pathways could occur on the GS cGRE. We have shown that activation by cAMP and glucocorticoids leads to synergistic activation on the cGRE. The actual mechanisms involved remain to be elucidated but at least three scenarios can be envisioned to account for synergy. Synergy could be due to activated cAMP- responsive proteins (i.e. CREB and ATF) bound to the CRE which 1) recruit additional factors used by the GR for enhanced transcriptional activation; 2) physically stabilize the GR on the GRE, permitting increased transcriptional activity; and/or 3) the combined surface area created by the proteins bound to the CRE/TRE and the GRE together facilitates recruitment of transcription factors/coactivators to enhance transcription. Recruitment of coactivators, such as CREB-binding protein (CBP), is an appealing idea, as the coactivators could act as a bridge between proteins on the two response elements and the basic transcription machinery. Interestingly, CBP has been shown to be essential in GR- and CREB-mediated responses (20, 21). Future studies will examine the role of protein-protein interactions on the integration of signaling from the cAMP and glucocorticoid pathways on the GS cGRE.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents and Buffers
Cortisol (Steraloids, Newport, RI) was solubilized in ethanol as a 1 mM stock and stored at -20 C. Forskolin (Sigma Chemical Co., St. Louis, MO) was dissolved in dimethylsulfoxide (DMSO) as a 0.1 M stock and stored at 4 C. 8-bromo-cAMP (Sigma) was dissolved in water and stored as a 0.1 M stock at -20 C. Dideoxyforskolin (Sigma) was dissolved in DMSO as a 0.1 M stock and stored at -20 C. Iron-supplemented calf serum was purchased from Sigma. Methotrexate was purchased from Calbiochem (La Jolla, CA). DMEM was purchased from GIBCO/BRL (Gaithersburg, MD). Charcoal-stripped serum was prepared as previously described (22). D-Luciferin potassium salt was from Analytical Luminescence Laboratory (Ann Arbor, MI).

Cell Lines and Vectors
Two CHO epithelial cell lines, WCL2 (23) and DG44 (23), were generous gifts of Dr. Margaret Hirst and Dr. Larry Chasin. WCL2 stably expresses 0.5–1 x 106 mouse GRs per cell. DG44 expresses endogenous GR (~1 x 104 receptors per cell). COS-7 cells, an African green monkey kidney fibroblast line acquired from the American Type Culture Collection (Manassas, VA), contain ~1 x 10 4 GRs/cell but are not transcriptionally active. 29+ cells are derived from a mouse L cell line variant that contain no detectable GRs (11). They were a gift from Dr. Anna Riegel and Dr. Mark Danielsen (Georgetown, MD). PXP2, a luciferase reporter vector without a promoter, served as the basis for the GS-cGRE vectors (10) (Fig. 1Go). The ± strands of the 42-bp sequence, -2120 to -2079 from the GS gene (7), were synthesized commercially, annealed, and cloned into the SalI and BamHI sites of the PXP2 vector. This sequence consists of a CRE/TRE site adjacent to a GRE which, in conjunction with the TATA box from the collagenase gene, provides a promoter activity for luciferase expression. A similar strategy was used for the modified GS promoter reporters described in Fig. 1Go. Sequences cloned into the PXP2 vector are: A, cGRE: AGCTCAGCGTCACTCAGC[CCCGGATCAAAACG-TTCCGTCCTGCGGG]; B, No CRE: CAAGCTCTCAGATCCAAGCTC[CCCGGATCAAAACGTTCCGTCCTGCGGG]; C, No GRE: AGCTCAGCGTCACTCAGCGCCCTCCTGGCTTT-GAAAAGCCAACCCG; D, C - 3 G GAGCTCAGCGTCACTC[CCCGGATCAAAACGTTCCGTCCTGCGGG]; E. C + 5 G: A-GCTCAGCGTCACTCAAGCTTGA[CCCGGATCAAAACGTT-CCGTCCTGCGGG]; F, C + 10 G:AGCTCAGCGTCACTCA-AGCTGGCTTTGA[CCCGGATCAAAACGTTCCGT-CCTGCGGG]. G, C + 15 G AGCTCAGCGTCACTCAAGCT-AGCGGCCGCTAGCTTGA[CCCGGATCAAAACGTTCC- GTCCTGCGGG]; H, consensus GRE AGCTCAGCGTCACTCAGC[CCCGGTACAAAATGTTCCGTCCTGCGGG]; I, consensus CRE: AGCTTGACGTCACTCAGC[CCCGGATCAAAACGTTCCGTCCTGCGGG]. The sequences correspond with diagrams in Fig. 1Go. The GS cGRE sequence and modified sequences were scanned with the TFMatrix transcription factor-binding site profile database to confirm that new transcription factor-binding sites were not introduced [E. Wingender, R. Knueppel, P. Dietze, H. Karas (GBF, Braunschweig, Germany) and Version 1.3 TFSearch (Ytaka Akiyama, Kyoto University, Kyoto, Japan; http://pdap1.trc.rwcp.or.jp/misc/db/TFSEARCH.html.). The pSV2 WT2Rec (24) that encodes the mouse GR was used in transfections of DG44, COS-7, and 29+ cells. Four other PXP2 GRE reporters were used. Three contained multiples of a GRE from the tyrosine aminotransferase (TAT) gene (25) (a single GRE, two GREs, or a GRE and an inverted GRE). The other promoter contained the MMTV long terminal repeat (26) (includes two GREs and four half-sites). The selected GRE sequence from the TAT gene has been shown to be active by itself (25). TAT GRE: TGTACAGGATGTTCT.

Cell Culture
COS-7 cells were grown in DMEM (4.5 g glucose/liter, GIBCO/BRL) containing 10% iron fortified calf serum (Sigma) supplemented with 39.5 mg proline/liter and 100 µg/ml gentamicin. DG44 cells were grown in {alpha}-modification MEM ({alpha}-MEM, Sigma) supplemented with 39.5 mg proline/liter, 2.2 g sodium bicarbonate/liter, and 10% iron fortified calf serum. WCL2 cells were grown in DMEM, as described for COS-7 cells, with the addition of 3 µM methotrexate and 10% charcoal-stripped iron-fortified serum. Cells were trypsinized 1 day before transfection and plated out to achieve log phase growth (60–75% confluence) on the day of transfection.

Transient Transfections
Transient transfections were performed by electroporation using a BTX ECM 600 electroporation system (BTX, a division of Genetronics Inc., San Diego, CA). Conditions were optimized to 170 V–200 V with time constants of 135–145 msec (27). Between 1–3 x 107 cells were used for each treatment group. Briefly, cells were harvested by trypsinization, washed in 30 ml HEPES-buffered saline (20 mM HEPES, 14 mM NaCl, 0.5 mM KCL, 0.067 mM Na 2 HPO 4, 0.6 mM glucose, pH 7.05), centrifuged 3 min at 700 x g, and resuspended at 1–3 x 107cells/300 µl of HEPES-buffered saline and cooled on ice. Four micrograms of mouse GR (clone WT2X) and 10 µg of the particular PXP2-luciferase reporter DNA were added to the cells in a 50-µl volume for a total volume of 350 µl. Cells were electroporated in 4-mm gap cuvettes (Bio-Rad, Richmond, CA, or BTX) and then resuspended in fresh medium containing 10% 2x charcoal-stripped serum. Cells were plated into 100-mm cell culture dishes (Corning, Inc., Corning, NY) and incubated overnight at 37 C. Twenty four to 30 h post transfection, the culture medium was replaced with 15 ml DMEM containing 1% or 10% 2x stripped serum with the indicated concentrations of cortisol (usually 5 x 10- M). Forskolin (usually 1 x 10-5 M)or other reagents (see Results). Equivalent volumes of vehicle (ethanol or DMSO) were added to cells used for controls. Cells were incubated 14–16 h and then harvested, and cell lysates were assayed as described below.

Luciferase, GR, and Protein Assays
Transfected cells in cell culture dishes were rinsed with 2 x 10 ml PBS with glucose (PBS-G) briefly at room temperature. Plates containing cells were chilled on ice for 5–10 min, and then cells were scraped from plates in 1.5 ml PBS-G. After pelleting (3 min, 700 x g), cells were lysed in 250 µl freeze-thaw buffer (FT; 0.025 M TES, 0.02 M NaMO 4, 0.05 M NaF, 10% glycero l, 0.002 M EDTA, 0.002 M EGTA) containing 5 mM CHAPS (3-([(3-chloamidopropyl)dimethyammonio]-1-propanesulfonate, Sigma) for 5 min at 4 C. Cell lysates were centrifuged for 10 min at 12,000 x g. Two hundred microliters of the cell lysate were transferred to a new tube, and samples were assayed for luciferase activity as described below on either a Wallac luminometer (model 1251, Wallac, Gaithersburg, MD) or a EG&G Berthold (Wildbad, Germany) microplate luminometer (model LB96V). Cell lysate (20–40 µl) was added to either 300 or 150 µl (Wallac and Berthold instruments, respectively) luciferase buffer (30 mM HEPES, pH 7.8, 30 mM MgSO4, 5 mM ATP, pH 7.0, 2 µM pyrophosphate). D-Luciferin potassium salt (1 mm in water) was injected (100 µl/Wallac and 50 µl/Berthold) into the cell lysate-buffer mixture and light [millivolts per sec (Wallac) or relative light units (Berthold)] was measured in integration mode for 12 sec/sample after a 2-sec delay. Luciferase standards (Analytical Luminescence Laboratory) were included (2.5–20 ng) for each experiment to ensure the assay was linear. A260 and A280 measurements were obtained with a Beckman DU-64 spectrophotometer (Beckman Instruments, Fullerton, CA). Cell lysate protein concentrations were determined using the following formula: [((A280 * 1399)+(A260*-699))*dilution factor]/1000= mg/ml. Duplicate samples were measured for all luciferase and protein assays. Error bars represent one half the range of duplicate samples. A whole-cell binding assay was sometimes performed 24 h after transfection to determine the number of GRs per cell and to ensure even transfection between treatments. There was some variation in receptor level between experiments (usually 150,000 to 175,00 GRs per cell) but because variation within an experiment was less than 10%, no correction was made for transfection efficiency.

Oligo Binding Assay
COS-7 cells were harvested and washed once with PBS-G. Cell pellets were resuspended in 7 volumes FT buffer containing 5 mM CHAPS and incubated for 10 min on ice. Lysates were spun at 12,000 x g for 10 min. Cell lysates were saved and nuclear pellets were resuspended in 3.5 volumes of 0.4 M NaCl FT buffer with 5 mM CHAPS for 10 min. Lysates were spun as indicated above. Nuclear extracts were diluted with 2 volumes of FT buffer to dilute the salt concentration to approximately 130 mM. Neutravidin beads (Pierce, Rockford, IL) were prepared by washing 100 µl beads/group with 3 ml of FT buffer. A double-stranded biotinylated oligo(Biotin-CAGCAGAGCTCAGCGTCACTCAGCCCCGGATCAAA ACG-TTCCGTCCTGC GGG) coding for the cGRE sequence was incubated with nuclear cell extracts for 15 min at 4 C and bound to neutravidin beads for 15 min. A control oligo (Biotin-TGCATCACGGCCCCAAAGGTCAGCCTCCTGGCTTTGAA-GCGCTGAATTAAAGC), which did not contain the GRE or CRE sequences, was used to determine nonspecific binding. Beads were spun briefly to pellet and washed three times with FT buffer. Cytosolic extracts were then incubated with oligo-bound beads for 15 min at 4 C, spinning slowly. Beads were put on a 1-ml column and washed three times with FT buffer containing 50 mM NaCl followed by four washes with FT buffer without NaCl. Beads were washed with 1 column volume of 2x sample buffer (SB) without SDS. Proteins were eluted with 2 x 75 µl SB containing SDS, and columns were centrifuged at 3000 rpm for 5 min into Eppendorf tubes. Samples were analyzed by SDS-PAGE and Western blot as described below.

SDS-PAGE and Western Blot Analysis
After SDS-PAGE and transfer to immobilon membrane (28), blots were blocked for 2 h, 37 C, with 3.5% fish gelatin (Sigma), 0.1% Tween 20 (Sigma), and 0.2% casein (heat inactivated at 85 C for 30 min, spun for 10 min and filtered) in Tris-buffered saline (TBS). Western blots were probed with an ATF-1 monoclonal antibody which cross-reacts with a shared epitope on CREB, ATF1, and CREM (Santa Cruz Biotechnology, Santa Cruz, CA; 0.05 µg/ml final concentration) and with the anti-GR monoclonal antibody FiGR (28). After washing blots three times for 10 min in TBS containing 0.35% fish gelatin and 0.1% Tween 20, blots were incubated with alkaline-phosphatase antimouse secondary antibody (Sigma). The blots were washed as described above, followed by three 10-min washes in TBS, 0.1% Tween 20 without fish gelatin. After a brief incubation with Tris (0.1 M pH 9.5), MgCl2 (1 mM) buffer, antibodies were detected with Vistra alkaline phosphatase substrate (Amersham, Arlington Heights, IL) and analyzed using ImageQuant software on a Fluorimager (model 575, Molecular Dynamics, Sunnyvale, CA).

Dominant Negative A-CREB
A-CREB acts as a dominant negative inhibitor of CREB and its family members by heterodimerizing with CREB. A-CREB contains an acidic region that interacts with the DNA binding domain of the CREB leucine zipper domain, a basic amino acid sequence found in B-ZIP proteins. This interaction prevents CREB from binding to DNA. COS-7 cells were transfected as described above with the addition of 3 µg of A-CREB DNA, the cGRE luciferase reporter construct, and GR DNA. After treatment with cortisol (5 x 10-8 M), forskolin (10-5 M) and both cortisol and forskolin, cells were harvested and luciferase activity was analyzed. Controls to demonstrate the specificity of CREB included another dominant-negative inhibitor, C/EBP, or empty vector (pRC/CMV500, Invitrogen, San Diego, CA).


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Mark Danielsen and Dr. Anna Riegel for the kind gift of the 29+ cells and Dr. Margaret Hirst and Dr. Larry Chasin for the DG44 and WCL2 cells. We thank Dr. Allan Munck and Dr. Lynn Sheldon for helpful discussions and for reading the manuscript. Thanks to Ms. Fiona Swift for helpful discussions and assistance in constructing many of the luciferase reporters.


    FOOTNOTES
 
Address requests for reprints to: Dr. Jack Bodwell, Department of Physiology, Dartmouth Medical School, Lebanon, New Hamphire 03756-0001. E-mail: Jack.Bodwell{at}Dartmouth.edu

This work has been supported by NIH Grants DK-45337 and DK-03535.

Received for publication December 31, 1997. Revision received December 1, 1998. Accepted for publication January 7, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ronzio RA, Rowe WR, Meister A 1969 Studies on the mechanism of inhibition of glutamine synthetase by methionine sulfoximine. Biochemistry 8:1066–1075[CrossRef][Medline]
  2. Linser P, Moscona AA 1979 Induction of glutamine synthetase in embryonic neural retina: localization in Müller fibers and dependence on cell interactions. Proc Natl Acad Sci USA 76:6476–6480[Abstract/Free Full Text]
  3. Moscona AA, Moscona M 1979 The development of inducibility for glutamine synthetase in embryonic neural retina: inhibiton by BrdU. Differentiation 13:165–172[Medline]
  4. Patejunas G, Young AP 1990 Constitutive and glucocorticoid-mediated activation of glutamine synthetase gene expression in the developing chicken retina. J Biol Chem 265:15280–15285[Abstract/Free Full Text]
  5. Vardimon L, Fox LL, Degenstein L, Moscona AA 1988 Cell contacts are required for induction by cortisol of glutamine synthetase gene transcription in the retina. Proc Natl Acad Sci USA 85:5981–5985[Abstract/Free Full Text]
  6. Patejunas G, Young AP 1987 Tissue-specific regulation of avian glutamine synthetase expression during development and in response to glucocorticoid hormones. Mol Cell Biol 7:1070–1077[Abstract/Free Full Text]
  7. Zhang H, Young AP 1991 A single upstream glucocorticoid response element juxtaposed to an AP1/ATF/CRE-like site renders the chicken glutamine synthetase gene hormonally inducible in transfected retina. J Biol Chem 266:24332–24338[Abstract/Free Full Text]
  8. Zhang H, Young AP 1993 Exogenous but not endogenous, glucocorticoid receptor induces glutamine synthetase gene expression in early stage embryonic retina. J Biol Chem 268:2850–2856[Abstract/Free Full Text]
  9. Montminy M 1997 Transcriptional regulation by cyclic AMP. Annu Rev Biochem 66:807–822[CrossRef][Medline]
  10. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. BioTechniques 6:454–458[Medline]
  11. Housley PR, Forsthoefel AM 1989 Isolation and characterization of a mouse L cell variant deficient in glucocorticoid receptors. Biochem Biophys Res Commun 164:480–487[CrossRef][Medline]
  12. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty D, Vinson C 1998 A dominate-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol 18:967–977[Abstract/Free Full Text]
  13. Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson C 1997 A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J Biol Chem 272:18586–18594 (Abstract)[Abstract/Free Full Text]
  14. Zhang S, Danielsen M 1995 Selective effects of 8-Br-cAMP on agonist and antagonists of the glucocorticoid receptor. Endocrine 3:5–12
  15. Diamond MI, Miner JN, Yoshinaga SK, Yamamoto KR 1990 Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249:1266–1272[Abstract/Free Full Text]
  16. Pearce D, Yamamoto KR 1993 Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science 259:1161–1165[Abstract/Free Full Text]
  17. Pearce D, Matsui W, Miner JN, Yamamoto KR 1998 Glucocorticoid receptor transcriptional activity determined by spacing of receptor and nonreceptor sites. J Biol Chem 273:30081–30085[Abstract/Free Full Text]
  18. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353–5356[Abstract/Free Full Text]
  19. Li YC, Hayes S, Young AP 1994 Transactivation of the ’promoterless’ luciferase-encoding vectors pXP1 and pXP2 by C/EBP alpha. Gene 138:257–258[CrossRef][Medline]
  20. Kwok RPS, Lundblad JP, Chriva JC, Richards JP, Bächinger HP, Brennan RG, Roberts SGE, Green MR, Goodman RH 1994 Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223–226[CrossRef][Medline]
  21. Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H, Montminy M, Evans RM 1996 Role of CBP/P 300 in nuclear receptor signalling. Nature 383:99–103[CrossRef][Medline]
  22. Hu J-M, Bodwell JE, Munck A 1997 Control by basal phosphorylation of cell cycle-dependent, hormone-induced glucocorticoid receptor hyperphosphorylation. Mol Endocrinol 11:305–311[Abstract/Free Full Text]
  23. Hirst MA, Northrop JP, Danielsen M, Ringold GM 1990 High level expression of wild type and variant mouse glucocorticoid receptors in Chinese hamster ovary cells. Mol Endocrinol 4:162–170[Abstract]
  24. Danielsen M, Hinck L, Ringold GM 1989 Mutational analysis of the mouse glucocorticoid receptor. Cancer Res [Suppl] 49:2286s–2291s
  25. Jantzen HM, Strähle U, Gloss B, Stewart F, Schmid W, Boshart M, Miksicek R, Schütz G 1987 Cooperativity of glucocorticoid response elements located far upstream of the tyrosine aminotransferase gene. Cell 49:29–38[CrossRef][Medline]
  26. Scheidereit C, Geisse S, Westphal HM, Beato M 1983 The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumor virus. Nature 304:749–752[CrossRef][Medline]
  27. Bodwell J, Swift F, Richardson J 1999 Long duration electroporation for achieving high level expression of glucocorticoid receptors in mammalian cell lines. J Steroid Biochem Mol Biol, in press
  28. Bodwell JE, Ortí E, Coull JM, Pappin DJC, Smith LI, Swift F 1991 Identification of phosphorylated sites in the mouse glucocorticoid receptor. J Biol Chem 266:7549–7555[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richardson, J.
Right arrow Articles by Bodwell, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richardson, J.
Right arrow Articles by Bodwell, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals