Molecular Endocrinology 13 (4): 546-554
Copyright © 1999 by The Endocrine Society
Cyclic Adenosine-3',5'-Monophosphate-Mediated Activation of a Glutamine Synthetase Composite Glucocorticoid Response Element
Jan Richardson,
Charles Vinson and
Jack Bodwell
Department of Physiology (J.R., J.B.) Dartmouth Medical
School Lebanon, New Hampshire 03756
Laboratory of
Biochemistry (C.V.) National Cancer Institute National
Institutes of Health Bethesda, Maryland 20892
 |
ABSTRACT
|
|---|
The glutamate synthetase gene (GS) contains a
composite glucocorticoid response element (cGRE) comprised of a GRE and
an adjacent element with features of both a cAMP-response element (CRE)
and a 12-O-tetradecanoylphorbol 13-acetate (TPA) response
element (TRE). The CRE/TRE element of the cGRE contributed to
two modes of transcriptional activation: 1) enhancement of the response
to cortisol and 2) a synergistic response to cortisol and increased
cAMP. COS-7 cells transfected with a cGRE-luciferase construct show
minimal expression under basal conditions or forskolin treatment. After
cortisol treatment, luciferase activity from the cGRE is enhanced 4- to
8-fold greater than the GRE portion of the cGRE or a GRE from the
tyrosine aminotransferase gene. Treatment with both forskolin and
cortisol produced a 2- to 4-fold synergistic response over cortisol
alone. Synergy is also seen with 8-bromo-cAMP, is specific for
the cGRE, and occurs in a number of established cell lines. Elimination
of the GRE or CRE/TRE reduces the synergy by 70100%. Altering the
CRE/TRE to GRE spacing changed both enhancement and synergy. Moving the
elements 3 bp closer or extending 15 bp reduced enhancement. Synergy
was markedly reduced when elements were one half of a helical turn out
of phase. Western blots verified that CREB (cAMP-responsive binding
protein) and ATF-1 (activating transcription factor-1) binds to the
cGRE sequence. A specific dominant negative inhibitor of the CREB
family, A-CREB, reduced synergy by 50%. These results suggest that the
GS cGRE can potentially integrate signaling from both the cAMP and
glucocorticoid receptor transduction pathways and that CREB/ATF-1 may
play an important role in this process.
 |
INTRODUCTION
|
|---|
Glutamine synthetase (GS) catalyzes the formation of
glutamine from glutamic acid and ammonia in an ATP-dependent reaction
(1). Physiologically, GS is a critical enzyme in neurotransmitter,
energy, and nitrogen metabolism. GS is also a well characterized enzyme
marker of Müller glial cells in the chick retina (2) and is
developmentally regulated in these cells by glucocorticoids (3, 4, 5).
Glucocorticoid regulation of GS in Muller glial cells does not begin
until day 7.5 of development, despite the presence of glucocorticoid
receptors before that time (6). The glucocorticoid response element in
the GS gene, characterized by deoxyribonuclease I footprinting assays,
is located at -2107 to -2079 upstream of the transcriptional start
site (7, 8). Nine base pairs 5' of the glucocorticoid response element
(GRE) (-2113 to -2120) is a site that has features of both a cAMP
response element (CRE) and a TPA response element [TRE, see Fig. 1
for sequence (4, 5)]. Together, the
GRE and the CRE/TRE response elements will be referred to in the text
as a composite GRE (cGRE).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 1. Structure of GS cGRE and Mutant cGRE Promoters
The cGRE from the chicken GS gene contains a CRE/TRE site adjacent to a
GRE. The sequence of the cGRE is shown above the
diagrams of the promoters. The CRE/TRE and the GRE are
underlined and in boldface type. Labeled
boxes in the schematic of mutant cGRE promoter-reporter constructs
represent the CRE/TRE, GRE, TATA region, or luciferase-coding regions.
Deletions and substitution of element mutants are shown in panel A, and
CRE/TRE-GRE spacing mutants are shown in panel B.
|
|
Characterization of proteins that bind to the CRE/TRE sequence from the
cGRE showed that a variety of proteins from the CREB (cAMP-responsive
binding protein)/ATF (activating transcription factor) and AP-1
families of transcription factors can bind to the response element.
Electrophoretic mobility shift assays using only the CRE/TRE portion of
the cGRE sequence showed that c-Jun/ATF-3 heterodimers bind to
this response element (7). In addition, when nuclear extracts from
retinal cells were used in mobility shift assays, ATF-1 bound to the
CRE/TRE, as demonstrated by supershift assays with anti-ATF-1 antibody
(7). cAMP activation of protein kinase A, one of the primary
kinases responsible for phosphorylation and subsequent activation of
CREB and ATF-1 (9), greatly enhances glucocorticoid-induced expression
of GS in retina cells (7). Taken together, these results suggest that
members of the CREB ATF-1 family of transcription factors may interact
with the glucocorticoid receptor (GR) to modulate glucocorticoid
effects on the GS cGRE promoter. For convenience we will use the term
CREB to refer to the CREB family of transcription factors.
The mechanism whereby cAMP and glucocorticoids induce enhancement and
synergistic activation from the GS promoter is not well understood. In
this paper, the necessity of the CRE/TRE and the GRE elements and the
importance of their relative spacing and alignment in these processes
are examined. In vitro and in vivo evidence
identifying the importance of CREB in this system is also
presented.
 |
RESULTS
|
|---|
Synergistic Response on GS cGRE Is Evident in Multiple Cell
Lines
Figure 1A
depicts the cGRE (-2120 to -2079) from the chicken GS
gene, which contains a CRE/TRE site adjacent to a single GRE. The cGRE
or modified sequences were cloned into a PXP2-based luciferase reporter
vector (10) to create the cGRE luciferase reporters used in these
studies (see Fig. 1
, A and B, for altered constructs; see
Materials and Methods for sequences). Initial experiments
were conducted to examine the effects of glucocorticoids and cAMP on
COS-7 cells, which have no endogenous GR activity. COS-7 cells were
transfected with the cGRE-luciferase reporter (Fig. 1A
) and mouse
glucocorticoid receptor DNA. Thirty hours after transfection, cells
were treated for 15 h with cortisol (5 x 10-8
M), which activates the GR, with forskolin
(10-5), which increases cAMP levels in the cell through
activation of the adenylate cyclase pathway, with both cortisol and
forskolin or with vehicle alone. The results, shown in Fig. 2
, demonstrate that cortisol enhanced
luciferase activity significantly above basal levels (150 mV/sec/mg
protein vs. 2200 mV/sec/mg protein) whereas forskolin alone
had no effect. The level of cortisol-induced luciferase expression
represents an enhancement of 4- to 8-fold over that seen with only the
GRE element from the cGRE (Fig. 7
) or of the GRE from the tyrosine
amino tranfersase gene (data not shown). A significant synergistic
response was seen by treating cells with both cortisol and forskolin,
resulting in at least a 2.2-fold increase in luciferase activity
compared with cortisol alone (Fig. 2
). In other experiments, synergy
(2- to 4-fold increase above cortisol alone) occurred with cortisol
concentrations ranging from 1 x 10-9 M
to 1 x 10-6 M as well as with
dexamethasone and triamcinolone acetonide. The synergy ratio also
increased with increasing forskolin concentrations up to the highest
level tested (10-5 M; results not shown). The
cGRE-luciferase reporter was tested in three other cell lines: two
Chinese hamster ovary (CHO) cell lines (epithelial in origin), DG44 and
WCL2, and 29+ cells [a mouse L cell line variant deficient in GR
(11)]. WCL2 cells are a stably transfected cell line that express
5 x 105 mouse GRs/cell, whereas DG44 and 29+ cells
were transiently transfected with GR in these experiments. Each of
these three cell lines was transfected with the cGRE-luciferase
reporter followed by treatment with cortisol and/or forskolin as
described for COS-7 cells (Fig. 2
). Forskolin and cortisol treatment
resulted in a 6.5-fold increase in luciferase activity compared with
cortisol alone in DG44 cells, a 3.6-fold increase in 29+ cells, and an
8.9-fold increase in WCL2 cells. These results demonstrate that the
synergistic response occurs in cell lines from different species and
cell types as well as with either stably or transiently transfected
GR.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Synergistic Activation of the GS cGRE with Cortisol
and Forskolin Treatment in COS-7, WCL2, 29+, and DG44 Cells
Luciferase activity was measured in cell extracts from cells
transiently transfected with the GR and the GS cGRE-luciferase
reporter. WCL2 cells were transfected with only the reporter gene since
they have stably integrated GR DNA. Transfected cells were treated with
vehicle alone, cortisol (5 x 10-8 M),
forskolin (10-5 M), or cortisol and forskolin
for 1416 h, beginning 2430 h after transfection. In the cell
types tested, cortisol/forskolin treatment resulted in 3- to 8.9-fold
induction of luciferase activity compared with cortisol treatment alone
[fold induction values (synergy ratios) are shown above
the cortisol/forskolin bars on the figure]. Data are average of
duplicate samples. Error bars are one-half of the range. Results are
representative of three separate experiments.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Figure 7. Deletion/Substitutions of cGRE Elements Demonstrate
Significant Sequence Requirements for Synergy and Enhancement
Luciferase activity was measured in COS-7 cells transfected with
mutated cGRE-reporter constructs shown in Fig. 1A and GR DNA (see
Materials and Methods for sequences). Cells were
cultured for 24 h and then treated for 1416 h with media alone
or media containing cortisol (5 x 10-8
M), forskolin (10-5 M), or both
cortisol and forskolin. The inset shows the synergy
ratio for each construct. Data are average of duplicate samples. Error
bars are one half of the range. Results are representative of four
separate experiments.
|
|
cAMP Activation of the GS cGRE
Direct manipulation of cAMP levels with the cell-permeable cAMP
analog, 8-bromo-cAMP, was used to confirm the forskolin results with
the cGRE reporter gene. COS-7 cells were transfected with the
cGRE-luciferase reporter and mouse GR DNA. Cells were treated with
8-bromo-cAMP alone and in combination with cortisol. As shown in Fig. 3
, 8
-bromo-cAMP, like forskolin alone,
did not increase luciferase activity from the cGRE-luciferase reporter.
Cortisol (5 x 10-8) and 8-bromo-cAMP (10
µM) together resulted in a 2.1-fold increase in
luciferase activity from the GRE-luciferase reporter compared with
cortisol alone. Increasing 8-bromo-cAMP concentration to 100
µM together with cortisol resulted in a 3-fold increase
in luciferase activity compared with cortisol alone (Fig. 3
). In other
experiments, COS-7 cells transfected with the cGRE-luciferase reporter
and mouse GR were treated with dideoxyforskolin, an inactive analog of
forskolin, in the presence and absence of cortisol (Fig. 3
).
Dideoxyforskolin did not promote synergy with cortisol treatment,
indicating a requirement for biological activity. These results support
the hypothesis that cortisol/forskolin synergy utilizes the cAMP
pathway.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Synergistic Effect on GS cGRE Is Mediated through
cAMP Activation
COS-7 cells were transfected with GR and the GS cGRE-luciferase
reporter DNA. Twenty four hours after transfection, cells were treated
with forskolin, dideoxy (dd) forskolin, or 8-bromo-cAMP alone and with
cortisol. Fold induction values (synergy ratios) for cortisol/cAMP
treatments (over cortisol alone) are shown above the
appropriate bar on the figure). Data are average of duplicate samples.
Error bars are one-half of the range. Results are representative of
three separate experiments.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 8. Response Element Spacing Mutations Demonstrate
Significant Sequence Requirements for the GS cGRE
Experiments were performed as in Fig. 7 except that mutant cGREs that
alter the spacing between the CRE/TRE and GRE elements were used (Fig. 1B ). The inset shows the synergy ratio for each
construct. Data are average of duplicate samples. Error bars are one
half of the range. Results are representative of four separate
experiments.
|
|
Cortisol and Forskolin Do Not Induce Strong Synergistic Effects on
Reporter Genes Containing other GREs
To directly compare the cortisol/forskolin effects seen with the
GS cGRE with other GREs, four luciferase reporters containing either a
single GRE, two GREs, a GRE and an inverted GRE, or the mouse mammary
tumor virus (MMTV) promoter (two GREs and four half-sites), were
tested. COS-7 cells were transiently transfected with the mouse GR and
each of the GRE-containing reporters, followed by treatment with
cortisol, forskolin, and both cortisol and forskolin. The ratio
of luciferase activity from cells treated with cortisol and forskolin
to cortisol alone (synergy ratio) is shown in Fig. 4
. The GS cGRE-containing promoter gave
the strongest response (2-fold higher than cortisol alone) while the
synergy ratio for the other promoters ranged from 0.8- to 1.2-fold.
These results show that the synergistic response to cortisol and
forskolin on the GS cGRE is both specific and more robust than the
response of the other GREs tested.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 4. Synergistic Effect of cAMP and Cortisol Is Specific
for cGRE Promoter
Luciferase reporter constructs containing a single (GRE) or two GREs
(GRE2), a single GRE and an inverted GRE (GiG), or a MMTV promoter (2
GREs and 4 half-site GREs) were cotransfected into COS-7 cells with GR
DNA. Cells were treated with cortisol (5 x 10-8
M), forskolin (10-5 M), and both
cortisol and forskolin, as described previously. The synergy ratio is
the luciferase activity from cortisol and forskolin treatment relative
to cortisol alone. Data are average of duplicate samples. Error bars
are one-half of the range. Results are representative of three separate
experiments.
|
|
In Vitro Binding of CREB and GR to a cGRE-Containing
Oligo
These results suggested that the cAMP-activated binding protein
(CREB) or members of the CREB family such as ATF-1 or CRE modulator
(CREM) might be important in the synergistic activation on the cGRE. It
was important to establish that the GR and CREB, or its family members,
would bind to a cGRE containing oligo in vitro. CREB exists
predominately in a nuclear bound form, presumably bound to its CRE (9).
To mimic protein binding that might be occurring in vivo, we
incubated a double-stranded biotinylated oligo containing the cGRE
sequence or a control oligo with nuclear extracts (CREB enriched) from
WCL2 cells. After collection and washing on neutravidin beads,
cytosolic extract (GR enriched) was added. Bound proteins were eluted
from neutravidin beads (see Materials and Methods) and
analyzed by SDS-PAGE and Western blot using antibodies that recognized
members of the CREB family (including ATF-1 and CREM) or GR. As seen in
Fig. 5
, 12 times as much CREB and 3 times
as much GR were detected on the cGRE oligo (lane 1) compared with the
control oligo (lane 2), and minimal levels were detected on neutravidin
beads alone (lane 3). Low levels of ATF-1 were also specifically bound
to the cGRE sequence (lane 1). These results confirm that the
cAMP-activated proteins from the CREB/ATF family, as well as the GR,
can specifically interact with the cGRE sequence and are potential
partners for mediating expression from the cGRE.

View larger version (84K):
[in this window]
[in a new window]
|
Figure 5. Western Blot Analysis of CREB and GR Binding to
cGRE Containing Oligo Duplex
Biotinylated 46-mer double-stranded oligos containing the cGRE
sequence, control oligo without cGRE sequences, or no oligo was
incubated with WCL2 extracts. After purification of the oligo on
neutravidin beads, proteins were eluted and analyzed by SDS-PAGE and
Western blot analysis using anti-CREB/ATF-1 and GR antibodies. See
Materials and Methods for details. Specific binding of
proteins to the cGRE sequence is reflected by the difference in binding
between the cGRE oligo (lane 1) and the control oligo (lane 2).
|
|
A Dominant-Negative Inhibitor of CREB Reduces Synergy but Not
Enhancement from the cGRE
A-CREB (12) is a modified CREB that was engineered to act as a
specific dominant-negative inhibitor of CREB and ATF-1. A-CREB was
created by substituting an acidic extension for the basic DNA-binding
region of CREB. A-CREB forms a heterodimer with CREB that is 3300 times
more stable than the CREB homodimer. In the A-CREB:CREB heterodimer,
the acidic region of A-CREB is paired with the basic region of CREB
such that DNA binding cannot occur and transcription activity is
specifically inhibited. The effect of A-CREB on expression from the
cGRE was studied by transfecting COS-7 cells with A-CREB,
A-C/EBP, or vector DNA in conjunction with the cGRE luciferase
reporter and GR DNA. A-C/EBP is a positive control that is an
engineered dominant-negative inhibitor for CCAAT/enhancer-binding
protein (C/EBP), a transcription factor that binds to the CAAT box
sequence (13). Cells were treated with cortisol, forskolin, both, or
neither as described previously. Luciferase activity was measured in
cell lysates 16 h later. As shown in Fig. 6
, A-CREB inhibited the synergistic
activation by forskolin and cortisol (synergy ratio 1.0), whereas the
vector alone and A-C/EBP had ratios of 1.7 and 2 (Fig. 6
). A-CREB does
not affect transcriptional enhancement by cortisol (compare results of
cortisol treatment between vector and A-CREB), suggesting that
enhancement from the CRE/TRE in the absence of cAMP may be due to a
mechanism distinct from the synergy seen with cortisol and
forskolin.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6. A-CREB Inhibits Synergism of Cortisol and Forskolin
on the GS cGRE
COS-7 cells were transfected with the PXP2 cGRE reporter construct GR
DNA and either A-CREB, A-C/EBP, or pRc/CMV500, the base vector of the
A-constructs. Twenty eight hours post transfection, cells were treated
with medium (O) or medium containing cortisol (C, 5 x
10-8 M), forskolin (F, 10-5
M), and both cortisol and forskolin (CF), as described
previously. The number above the CF bar is the synergy
ratio (luciferase activity from cortisol and forskolin treatment
compared with cortisol alone). Data are average of duplicate samples.
Error bars are one half of the range. Results are representative of
four separate experiments.
|
|
Spatial and Sequence Requirements of the GS cGRE Response
Element
A series of mutant cGREs (see Materials and Methods for
sequences) were constructed to determine the sequence and spatial
requirements for enhancement and synergy. COS-7 cells were transfected
with DNAs for the mutant promoters and mouse GR. Cells were treated
with cortisol and/or forskolin as previously described. Deletion of
either the CRE/TRE or the GRE from the cGRE (Figs. 1
and 7
) reduced
enhancement by cortisol treatment alone by 70% and 99%, respectively.
Likewise, the synergy ratio was reduced from 3.9 to 2.20 and 1.76,
respectively (Fig. 7
, inset).
Clearly, both the CRE/TRE and the GRE elements are needed for both
enhancement and synergy.
Deletion of the TATA region (Fig. 7
) greatly reduced expression from
the cGRE and completely eliminated synergy (Fig. 7
, inset).
It is likely that synergy is somehow associated with one or more of the
many basic transcription factors assembled at the TATA region or with
factors that need to associate with them.
To investigate the spatial relationships between the CRE and the GRE, a
number of constructs were made that altered the distance between the
two elements (Fig. 1B
). Altering the inter element spacing had
different effects on enhancement vs. synergy. The normal
spacing between the CRE and the GRE is 9 bp, but by shortening it by 3
bp (Fig. 8
, cortisol only treatment)
there was an 80% reduction in enhancement with a minimal effect on
synergy (Fig. 8
, inset). Extending the distance between the
two elements by 5 bp or one half of a turn of the DNA helix has no
effect on enhancement but drops the synergy ratio from 3.4 to 2, which
is near the no-cGRE control ratio of 1.5. Extending the distance by
another 5 bp reestablishes the original alignment of the elements but
with an additional 10 bp between the elements. This restored the
synergy ratio to original levels (3.4), and there was no effect on
enhancement. Extending the elements 15 bp or 1.5 turns of the helix
again put the elements out of their original alignment. Synergy was
reduced to 2.0, and the enhancement was reduced by one third. Clearly,
synergy is dependent on the alignment of the two elements, while
enhancement appears to be more of a function of the distance between
the elements.
 |
DISCUSSION
|
|---|
Cooperation or antagonism between transcription factors on
composite response elements provides an additional level of modulation
for transcriptional regulation of gene expression. The CRE/TRE and GRE
response elements of the cGRE, analyzed in these studies, allow the
examination of functional associations between the GR- and
cAMP-activated transcription factors. Our results extend previous
studies (7) that demonstrate the CRE/TRE site in the cGRE enhances
transcription from the GRE sequence with cortisol treatment as well as
with cortisol in combination with cAMP. On the cGRE, there is a marked
synergistic effect with glucocorticoids and treatments that increased
cAMP, resulting in 2.2- to 8.6-fold greater responses than with
cortisol treatments alone. The GS cGRE response to glucocorticoids and
increased cAMP levels occurs in cell lines from different species and
tissues, suggesting that the synergism is not cell type specific.
Glucocorticoid/cAMP synergy on the cGRE is distinct from the general
potentiation of glucocorticoid-mediated transcription seen with
increased cAMP levels (14). Zhang and Danielsen (14) showed that a MMTV
CAT (chloramphenicol acetyltransferase) reporter gene was stimulated
approximately 1.7-fold with 8-bromo-cAMP in COS-7 cells but did not use
a reporter gene containing the cGRE. This value is much higher than we
see for MMTV-luciferase, but their induction period was 40 h
instead of the
16 h used in this study. We find that the actual
ratios for the different GREs is somewhat variable from experiment to
experiment but the relative relationship to the cGRE remains the
same.
Our data strongly suggest that cAMP-responsive proteins cannot act
alone on the cGRE but require activated GR because, in the absence of
cortisol, there is no reporter response to forskolin (Fig. 2
, forskolin
treatment alone). Additionally, in the absence of the GRE, there is
also no reporter response to forskolin (Fig. 7
). The mutant cGRE
reporter construct, made without the GRE, also showed very little
transcriptional activation with cortisol or cortisol and forskolin
treatment. This demonstrates that the CRE/TRE is an ineffective
promoter in the absence of the GRE. Conversely, in the intact cGRE, the
CRE/TRE site plays an important role in the enhancement of
cortisol-induced transcriptional activation (Fig. 7
; compare "no CRE
promoter plus cortisol" to the "cGRE plus cortisol"). The CRE/TRE
element also plays an important role in the synergistic response to
both cortisol and forskolin (Fig. 7
, inset, compare cGRE to
no CRE). Thus, both the CRE/TRE and the GRE response elements are
necessary for enhancement and synergy.
Mutant cGREs with altered spacing between the GRE and the CRE/TRE
provide additional evidence for two distinct modes of transcriptional
activation on the cGRE. There is transcriptional enhancement by
cortisol on the cGRE that depends on the presence of the CRE/TRE.
Enhancement is not affected by alignment on the helix, as the 5- and
10-bp inserts (Fig. 8
) had analogous expression levels with cortisol.
Enhancement was sensitive to the length of insertion/deletion, as
moving the CRE/TRE closer by 3 bp or extending by more than 15 bp from
the GRE reduced luciferase expression. Second, the synergistic response
with cAMP and cortisol is greatly reduced when the CRE/TRE element is
rotated so that it is on the opposite side of the DNA helix relative to
its normal relationship to the GRE, as it is in the mutants with 5- and
15-bp inserts (Fig. 8
, inset). These results suggest that
the interactions necessary for enhanced transcriptional activation and
synergy on the cGRE require close physical association between factors
bound to the CRE/TRE and the GRE. On the 25-bp cGRE from the proliferin
gene (plfG, Ref. 15), recent studies have used spacing between its AP-1
and GR response elements to examine transcriptional control at this
site. On the wild-type p1fG cGRE, whether hormonal activation or
repression of transcription occurs depends on the composition of the
AP-1 complex (16). cJun homodimers specify activation and cJun/Fos
heterodimers result in repression. Modifications of the nucleotide
spacing between the AP-1 site and the simple GRE determine whether
synergy occurs. When elements were spaced more than 25 bp apart, GR
synergized with both cJun and cJun/Fos whereas reporters with
separations of 1418 bp between the GRE and AP-1 site responded like
the p1fG (17). Our results with the GS cGRE show that nucleotide
spacing is also critical, but the distance between elements appears to
be critical for enhancement while helical phasing is more important for
synergy.
We provide in vitro and in vivo evidence that
CREB is important for cortisol/cAMP synergy on the cGRE. Specific
binding of CREB and GR to the cGRE oligo in vitro provides
biochemical evidence for the physical interaction of CREB and the GR
with the cGRE sequence. We also used a dominant-negative inhibitor of
CREB (A-CREB) that functions by heterodimerizing with endogenous CREB
and prevents CREB from binding to its response element (12). A-CREB has
been shown to selectively inhibit CREB and its family members ATF-1 and
CREM (12). In studies reported here, cAMP/cortisol synergy was
alleviated in cells cotransfected with A-CREB. The transcriptional
response to cortisol alone remained strong in the presence of A-CREB
and was comparable to controls transfected with a control vector
A-C/EBP or vector alone (see Fig. 6
). CREB and GR can also be
coimmunoprecipitated from cell extracts, suggesting that direct
interactions between the proteins on a promoter may also be possible
(Ref. 18 , and J. Bodwell and J. Richardson, unpublished results). These
findings suggest that CREB or family members are involved in the
synergistic activity generated by treating cells with cortisol and
cAMP. Strikingly, although the strong response to cortisol alone
(enhancement) requires the CRE/TRE, A-CREB does not inhibit the
response, suggesting that a factor or factors other than CREB may be
involved in the cortisol response. The C/EBP provides another control
for the PXP2 vector used as the base of the reporter vector in these
studies. The PXP2 reporter contains a CAATA box (19) that can be
activated through C/EBP. Since the A-C/EBP had no negative effect on
transcription in this system, it suggests that the CAATA box is not
used.
Because of the composition of the CRE/TRE, which appears able to bind
members of the cAMP-responsive family of transcription factors,
integration of transcriptional control from different signal
transduction pathways could occur on the GS cGRE. We have shown that
activation by cAMP and glucocorticoids leads to synergistic activation
on the cGRE. The actual mechanisms involved remain to be elucidated but
at least three scenarios can be envisioned to account for synergy.
Synergy could be due to activated cAMP- responsive proteins
(i.e. CREB and ATF) bound to the CRE which 1) recruit
additional factors used by the GR for enhanced transcriptional
activation; 2) physically stabilize the GR on the GRE, permitting
increased transcriptional activity; and/or 3) the combined surface area
created by the proteins bound to the CRE/TRE and the GRE together
facilitates recruitment of transcription factors/coactivators to
enhance transcription. Recruitment of coactivators, such as
CREB-binding protein (CBP), is an appealing idea, as the coactivators
could act as a bridge between proteins on the two response elements and
the basic transcription machinery. Interestingly, CBP has been shown to
be essential in GR- and CREB-mediated responses (20, 21). Future
studies will examine the role of protein-protein interactions on the
integration of signaling from the cAMP and glucocorticoid pathways on
the GS cGRE.
 |
MATERIALS AND METHODS
|
|---|
Reagents and Buffers
Cortisol (Steraloids, Newport, RI) was solubilized in
ethanol as a 1 mM stock and stored at -20 C. Forskolin
(Sigma Chemical Co., St. Louis, MO) was dissolved in dimethylsulfoxide
(DMSO) as a 0.1 M stock and stored at 4 C. 8-bromo-cAMP
(Sigma) was dissolved in water and stored as a 0.1 M stock
at -20 C. Dideoxyforskolin (Sigma) was dissolved in DMSO as a 0.1
M stock and stored at -20 C. Iron-supplemented calf serum
was purchased from Sigma. Methotrexate was purchased from Calbiochem
(La Jolla, CA). DMEM was purchased from GIBCO/BRL (Gaithersburg, MD).
Charcoal-stripped serum was prepared as previously described (22).
D-Luciferin potassium salt was from Analytical Luminescence
Laboratory (Ann Arbor, MI).
Cell Lines and Vectors
Two CHO epithelial cell lines, WCL2 (23) and DG44 (23), were
generous gifts of Dr. Margaret Hirst and Dr. Larry Chasin. WCL2 stably
expresses 0.51 x 106 mouse GRs per cell. DG44
expresses endogenous GR (
1 x 104 receptors per
cell). COS-7 cells, an African green monkey kidney fibroblast line
acquired from the American Type Culture Collection (Manassas, VA),
contain
1 x 10 4 GRs/cell but are not
transcriptionally active. 29+ cells are derived from a mouse L
cell line variant that contain no detectable GRs (11). They were a gift
from Dr. Anna Riegel and Dr. Mark Danielsen (Georgetown, MD). PXP2, a
luciferase reporter vector without a promoter, served as the basis for
the GS-cGRE vectors (10) (Fig. 1
). The ± strands of the 42-bp
sequence, -2120 to -2079 from the GS gene (7), were synthesized
commercially, annealed, and cloned into the SalI and
BamHI sites of the PXP2 vector. This sequence consists of a
CRE/TRE site adjacent to a GRE which, in conjunction with the TATA box
from the collagenase gene, provides a promoter activity for luciferase
expression. A similar strategy was used for the modified GS promoter
reporters described in Fig. 1
. Sequences cloned into the PXP2 vector
are: A, cGRE:
AGCTCAGCGTCACTCAGC[CCCGGATCAAAACG-TTCCGTCCTGCGGG]; B, No CRE:
CAAGCTCTCAGATCCAAGCTC[CCCGGATCAAAACGTTCCGTCCTGCGGG]; C, No GRE:
AGCTCAGCGTCACTCAGCGCCCTCCTGGCTTT-GAAAAGCCAACCCG; D, C - 3 G
GAGCTCAGCGTCACTC[CCCGGATCAAAACGTTCCGTCCTGCGGG]; E. C + 5 G:
A-GCTCAGCGTCACTCAAGCTTGA[CCCGGATCAAAACGTT-CCGTCCTGCGGG];
F, C + 10
G:AGCTCAGCGTCACTCA-AGCTGGCTTTGA[CCCGGATCAAAACGTTCCGT-CCTGCGGG].
G, C + 15 G
AGCTCAGCGTCACTCAAGCT-AGCGGCCGCTAGCTTGA[CCCGGATCAAAACGTTCC-
GTCCTGCGGG]; H, consensus GRE
AGCTCAGCGTCACTCAGC[CCCGGTACAAAATGTTCCGTCCTGCGGG]; I, consensus CRE:
AGCTTGACGTCACTCAGC[CCCGGATCAAAACGTTCCGTCCTGCGGG]. The
sequences correspond with diagrams in Fig. 1
. The GS cGRE sequence and
modified sequences were scanned with the TFMatrix transcription
factor-binding site profile database to confirm that new transcription
factor-binding sites were not introduced [E. Wingender, R. Knueppel,
P. Dietze, H. Karas (GBF, Braunschweig, Germany) and Version 1.3
TFSearch (Ytaka Akiyama, Kyoto University, Kyoto, Japan;
http://pdap1.trc.rwcp.or.jp/misc/db/TFSEARCH.html.). The pSV2 WT2Rec
(24) that encodes the mouse GR was used in transfections of DG44,
COS-7, and 29+ cells. Four other PXP2 GRE reporters were used. Three
contained multiples of a GRE from the tyrosine aminotransferase (TAT)
gene (25) (a single GRE, two GREs, or a GRE and an inverted GRE). The
other promoter contained the MMTV long terminal repeat (26)
(includes two GREs and four half-sites). The selected GRE sequence from
the TAT gene has been shown to be active by itself (25). TAT GRE:
TGTACAGGATGTTCT.
Cell Culture
COS-7 cells were grown in DMEM (4.5 g glucose/liter, GIBCO/BRL)
containing 10% iron fortified calf serum (Sigma) supplemented with
39.5 mg proline/liter and 100 µg/ml gentamicin. DG44 cells were grown
in
-modification MEM (
-MEM, Sigma) supplemented with 39.5 mg
proline/liter, 2.2 g sodium bicarbonate/liter, and 10% iron
fortified calf serum. WCL2 cells were grown in DMEM, as described for
COS-7 cells, with the addition of 3 µM methotrexate and
10% charcoal-stripped iron-fortified serum. Cells were trypsinized 1
day before transfection and plated out to achieve log phase growth
(6075% confluence) on the day of transfection.
Transient Transfections
Transient transfections were performed by electroporation using
a BTX ECM 600 electroporation system (BTX, a division of Genetronics
Inc., San Diego, CA). Conditions were optimized to 170 V200 V with
time constants of 135145 msec (27). Between 13 x 107 cells were used for each treatment group. Briefly, cells were
harvested by trypsinization, washed in 30 ml HEPES-buffered saline (20
mM HEPES, 14 mM NaCl, 0.5 mM KCL,
0.067 mM Na 2 HPO 4, 0.6
mM glucose, pH 7.05), centrifuged 3 min at 700
x g, and resuspended at 13 x
107cells/300 µl of HEPES-buffered saline and
cooled on ice. Four micrograms of mouse GR (clone WT2X) and 10 µg of
the particular PXP2-luciferase reporter DNA were added to the cells in
a 50-µl volume for a total volume of 350 µl. Cells were
electroporated in 4-mm gap cuvettes (Bio-Rad, Richmond, CA, or BTX) and
then resuspended in fresh medium containing 10% 2x charcoal-stripped
serum. Cells were plated into 100-mm cell culture dishes (Corning,
Inc., Corning, NY) and incubated overnight at 37 C. Twenty four to
30 h post transfection, the culture medium was replaced with 15 ml
DMEM containing 1% or 10% 2x stripped serum with the indicated
concentrations of cortisol (usually 5 x 10-
M). Forskolin (usually 1 x 10-5
M)or other reagents (see Results). Equivalent
volumes of vehicle (ethanol or DMSO) were added to cells used for
controls. Cells were incubated 1416 h and then harvested, and cell
lysates were assayed as described below.
Luciferase, GR, and Protein Assays
Transfected cells in cell culture dishes were rinsed with 2
x 10 ml PBS with glucose (PBS-G) briefly at room temperature. Plates
containing cells were chilled on ice for 510 min, and then cells were
scraped from plates in 1.5 ml PBS-G. After pelleting (3 min, 700
x g), cells were lysed in 250 µl freeze-thaw buffer (FT;
0.025 M TES, 0.02 M NaMO 4, 0.05
M NaF, 10% glycero l, 0.002 M EDTA, 0.002
M EGTA) containing 5 mM CHAPS
(3-([(3-chloamidopropyl)dimethyammonio]-1-propanesulfonate, Sigma)
for 5 min at 4 C. Cell lysates were centrifuged for 10 min at
12,000 x g. Two hundred microliters of the cell lysate
were transferred to a new tube, and samples were assayed for luciferase
activity as described below on either a Wallac luminometer (model 1251,
Wallac, Gaithersburg, MD) or a EG&G Berthold (Wildbad, Germany)
microplate luminometer (model LB96V). Cell lysate (2040 µl) was
added to either 300 or 150 µl (Wallac and Berthold instruments,
respectively) luciferase buffer (30 mM HEPES, pH 7.8, 30
mM MgSO4, 5 mM ATP, pH 7.0, 2
µM pyrophosphate). D-Luciferin potassium salt
(1 mm in water) was injected (100 µl/Wallac and 50 µl/Berthold)
into the cell lysate-buffer mixture and light [millivolts per sec
(Wallac) or relative light units (Berthold)] was measured in
integration mode for 12 sec/sample after a 2-sec delay. Luciferase
standards (Analytical Luminescence Laboratory) were included (2.520
ng) for each experiment to ensure the assay was linear.
A260 and A280 measurements were obtained with a
Beckman DU-64 spectrophotometer (Beckman Instruments, Fullerton, CA).
Cell lysate protein concentrations were determined using the following
formula: [((A280 * 1399)+(A260*-699))*dilution factor]/1000= mg/ml.
Duplicate samples were measured for all luciferase and protein assays.
Error bars represent one half the range of duplicate samples. A
whole-cell binding assay was sometimes performed 24 h after
transfection to determine the number of GRs per cell and to ensure even
transfection between treatments. There was some variation in receptor
level between experiments (usually 150,000 to 175,00 GRs per cell) but
because variation within an experiment was less than 10%, no
correction was made for transfection efficiency.
Oligo Binding Assay
COS-7 cells were harvested and washed once with PBS-G. Cell
pellets were resuspended in 7 volumes FT buffer containing 5
mM CHAPS and incubated for 10 min on ice. Lysates were spun
at 12,000 x g for 10 min. Cell lysates were saved and
nuclear pellets were resuspended in 3.5 volumes of 0.4 M
NaCl FT buffer with 5 mM CHAPS for 10 min. Lysates were
spun as indicated above. Nuclear extracts were diluted with 2 volumes
of FT buffer to dilute the salt concentration to approximately 130
mM. Neutravidin beads (Pierce, Rockford, IL) were prepared
by washing 100 µl beads/group with 3 ml of FT buffer. A
double-stranded biotinylated
oligo(Biotin-CAGCAGAGCTCAGCGTCACTCAGCCCCGGATCAAA ACG-TTCCGTCCTGC
GGG) coding for the cGRE sequence was incubated with nuclear cell
extracts for 15 min at 4 C and bound to neutravidin beads for 15 min. A
control oligo
(Biotin-TGCATCACGGCCCCAAAGGTCAGCCTCCTGGCTTTGAA-GCGCTGAATTAAAGC),
which did not contain the GRE or CRE sequences, was used to determine
nonspecific binding. Beads were spun briefly to pellet and washed three
times with FT buffer. Cytosolic extracts were then incubated with
oligo-bound beads for 15 min at 4 C, spinning slowly. Beads were put on
a 1-ml column and washed three times with FT buffer containing 50
mM NaCl followed by four washes with FT buffer without
NaCl. Beads were washed with 1 column volume of 2x sample buffer (SB)
without SDS. Proteins were eluted with 2 x 75 µl SB containing
SDS, and columns were centrifuged at 3000 rpm for 5 min into Eppendorf
tubes. Samples were analyzed by SDS-PAGE and Western blot as described
below.
SDS-PAGE and Western Blot Analysis
After SDS-PAGE and transfer to immobilon membrane (28), blots
were blocked for 2 h, 37 C, with 3.5% fish gelatin (Sigma), 0.1%
Tween 20 (Sigma), and 0.2% casein (heat inactivated at 85 C for 30
min, spun for 10 min and filtered) in Tris-buffered saline (TBS).
Western blots were probed with an ATF-1 monoclonal antibody which
cross-reacts with a shared epitope on CREB, ATF1, and CREM (Santa Cruz
Biotechnology, Santa Cruz, CA; 0.05 µg/ml final concentration) and
with the anti-GR monoclonal antibody FiGR (28). After washing blots
three times for 10 min in TBS containing 0.35% fish gelatin and 0.1%
Tween 20, blots were incubated with alkaline-phosphatase antimouse
secondary antibody (Sigma). The blots were washed as described above,
followed by three 10-min washes in TBS, 0.1% Tween 20 without fish
gelatin. After a brief incubation with Tris (0.1 M pH 9.5),
MgCl2 (1 mM) buffer, antibodies were detected
with Vistra alkaline phosphatase substrate (Amersham, Arlington
Heights, IL) and analyzed using ImageQuant software on a Fluorimager
(model 575, Molecular Dynamics, Sunnyvale, CA).
Dominant Negative A-CREB
A-CREB acts as a dominant negative inhibitor of CREB and its
family members by heterodimerizing with CREB. A-CREB contains an acidic
region that interacts with the DNA binding domain of the CREB leucine
zipper domain, a basic amino acid sequence found in B-ZIP proteins.
This interaction prevents CREB from binding to DNA. COS-7 cells were
transfected as described above with the addition of 3 µg of A-CREB
DNA, the cGRE luciferase reporter construct, and GR DNA. After
treatment with cortisol (5 x 10-8 M),
forskolin (10-5 M) and both cortisol and
forskolin, cells were harvested and luciferase activity was analyzed.
Controls to demonstrate the specificity of CREB included another
dominant-negative inhibitor, C/EBP, or empty vector (pRC/CMV500,
Invitrogen, San Diego, CA).
 |
ACKNOWLEDGMENTS
|
|---|
We would like to thank Dr. Mark Danielsen and Dr. Anna Riegel
for the kind gift of the 29+ cells and Dr. Margaret Hirst and Dr. Larry
Chasin for the DG44 and WCL2 cells. We thank Dr. Allan Munck and Dr.
Lynn Sheldon for helpful discussions and for reading the manuscript.
Thanks to Ms. Fiona Swift for helpful discussions and assistance in
constructing many of the luciferase reporters.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Jack Bodwell, Department of Physiology, Dartmouth Medical School, Lebanon, New Hamphire 03756-0001. E-mail: Jack.Bodwell{at}Dartmouth.edu
This work has been supported by NIH Grants DK-45337 and DK-03535.
Received for publication December 31, 1997.
Revision received December 1, 1998.
Accepted for publication January 7, 1999.
 |
REFERENCES
|
|---|
-
Ronzio RA, Rowe WR, Meister A 1969 Studies on the
mechanism of inhibition of glutamine synthetase by methionine
sulfoximine. Biochemistry 8:10661075[CrossRef][Medline]
-
Linser P, Moscona AA 1979 Induction of glutamine synthetase
in embryonic neural retina: localization in Müller fibers and
dependence on cell interactions. Proc Natl Acad Sci USA 76:64766480[Abstract/Free Full Text]
-
Moscona AA, Moscona M 1979 The development of inducibility
for glutamine synthetase in embryonic neural retina: inhibiton by BrdU.
Differentiation 13:165172[Medline]
-
Patejunas G, Young AP 1990 Constitutive and
glucocorticoid-mediated activation of glutamine synthetase gene
expression in the developing chicken retina. J Biol Chem 265:1528015285[Abstract/Free Full Text]
-
Vardimon L, Fox LL, Degenstein L, Moscona AA 1988 Cell
contacts are required for induction by cortisol of glutamine synthetase
gene transcription in the retina. Proc Natl Acad Sci USA 85:59815985[Abstract/Free Full Text]
-
Patejunas G, Young AP 1987 Tissue-specific regulation of
avian glutamine synthetase expression during development and in
response to glucocorticoid hormones. Mol Cell Biol 7:10701077[Abstract/Free Full Text]
-
Zhang H, Young AP 1991 A single upstream glucocorticoid
response element juxtaposed to an AP1/ATF/CRE-like site renders the
chicken glutamine synthetase gene hormonally inducible in transfected
retina. J Biol Chem 266:2433224338[Abstract/Free Full Text]
-
Zhang H, Young AP 1993 Exogenous but not endogenous,
glucocorticoid receptor induces glutamine synthetase gene expression in
early stage embryonic retina. J Biol Chem 268:28502856[Abstract/Free Full Text]
-
Montminy M 1997 Transcriptional regulation by cyclic AMP.
Annu Rev Biochem 66:807822[CrossRef][Medline]
-
Nordeen SK 1988 Luciferase reporter gene vectors for analysis
of promoters and enhancers. BioTechniques 6:454458[Medline]
-
Housley PR, Forsthoefel AM 1989 Isolation and characterization
of a mouse L cell variant deficient in glucocorticoid receptors.
Biochem Biophys Res Commun 164:480487[CrossRef][Medline]
-
Ahn S, Olive M, Aggarwal S, Krylov D, Ginty D, Vinson C 1998 A
dominate-negative inhibitor of CREB reveals that it is a general
mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol 18:967977[Abstract/Free Full Text]
-
Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson
C 1997 A dominant negative to activation protein-1 (AP1) that abolishes
DNA binding and inhibits oncogenesis. J Biol Chem 272:1858618594
(Abstract)[Abstract/Free Full Text]
-
Zhang S, Danielsen M 1995 Selective effects of 8-Br-cAMP on
agonist and antagonists of the glucocorticoid receptor. Endocrine 3:512
-
Diamond MI, Miner JN, Yoshinaga SK, Yamamoto KR 1990 Transcription factor interactions: selectors of positive or negative
regulation from a single DNA element. Science 249:12661272[Abstract/Free Full Text]
-
Pearce D, Yamamoto KR 1993 Mineralocorticoid and
glucocorticoid receptor activities distinguished by nonreceptor factors
at a composite response element. Science 259:11611165[Abstract/Free Full Text]
-
Pearce D, Matsui W, Miner JN, Yamamoto KR 1998 Glucocorticoid
receptor transcriptional activity determined by spacing of receptor and
nonreceptor sites. J Biol Chem 273:3008130085[Abstract/Free Full Text]
-
Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein
interaction and the response of the phosphoenolpyruvate carboxykinase
gene to glucocorticoids. J Biol Chem 268:53535356[Abstract/Free Full Text]
-
Li YC, Hayes S, Young AP 1994 Transactivation of the
promoterless luciferase-encoding vectors pXP1 and pXP2 by C/EBP
alpha. Gene 138:257258[CrossRef][Medline]
-
Kwok RPS, Lundblad JP, Chriva JC, Richards JP, Bächinger
HP, Brennan RG, Roberts SGE, Green MR, Goodman RH 1994 Nuclear protein
CBP is a coactivator for the transcription factor CREB. Nature 370:223226[CrossRef][Medline]
-
Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG,
Juguilon H, Montminy M, Evans RM 1996 Role of CBP/P 300 in nuclear
receptor signalling. Nature 383:99103[CrossRef][Medline]
-
Hu J-M, Bodwell JE, Munck A 1997 Control by basal
phosphorylation of cell cycle-dependent, hormone-induced glucocorticoid
receptor hyperphosphorylation. Mol Endocrinol 11:305311[Abstract/Free Full Text]
-
Hirst MA, Northrop JP, Danielsen M, Ringold GM 1990 High level
expression of wild type and variant mouse glucocorticoid receptors in
Chinese hamster ovary cells. Mol Endocrinol 4:162170[Abstract]
-
Danielsen M, Hinck L, Ringold GM 1989 Mutational analysis of
the mouse glucocorticoid receptor. Cancer Res [Suppl] 49:2286s2291s
-
Jantzen HM, Strähle U, Gloss B, Stewart F, Schmid W,
Boshart M, Miksicek R, Schütz G 1987 Cooperativity of
glucocorticoid response elements located far upstream of the tyrosine
aminotransferase gene. Cell 49:2938[CrossRef][Medline]
-
Scheidereit C, Geisse S, Westphal HM, Beato M 1983 The
glucocorticoid receptor binds to defined nucleotide sequences near the
promoter of mouse mammary tumor virus. Nature 304:749752[CrossRef][Medline]
-
Bodwell J, Swift F, Richardson J 1999 Long duration
electroporation for achieving high level expression of glucocorticoid
receptors in mammalian cell lines. J Steroid Biochem Mol Biol, in
press
-
Bodwell JE, Ortí E, Coull JM, Pappin DJC, Smith LI,
Swift F 1991 Identification of phosphorylated sites in the mouse
glucocorticoid receptor. J Biol Chem 266:75497555[Abstract/Free Full Text]