help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clarkson, R. W. E.
Right arrow Articles by Waters, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clarkson, R. W. E.
Right arrow Articles by Waters, M. J.
Molecular Endocrinology 13 (4): 619-631
Copyright © 1999 by The Endocrine Society

Ternary Complex Factors Elk-1 and Sap-1a Mediate Growth Hormone-Induced Transcription of Egr-1 (Early Growth Response Factor-1) in 3T3-F442A Preadipocytes

Richard W. E. Clarkson1, Catherine A. Shang, Linda K. Levitt, Tammy Howard and Michael J. Waters

Department of Physiology and Pharmacology and Centre for Molecular and Cellular Biology University Queensland St. Lucia, Queensland, Australia 4072


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In our search for transcription factors induced by GH, we have analyzed immediate early gene activation in a model of GH-dependent differentiation. Here we describe the activation of early growth response factor-1 (egr-1) in GH-stimulated 3T3-F442A preadipocytes and the transcription factors responsible for its transactivation. Binding activity of egr-1 in electrophoretic mobility shift assay (EMSA) increased transiently 1 h after GH stimulation, accompanied by a concomitant increase in egr-1 mRNA. egr-1 induction appeared not to be related to proliferation since it was amplified in quiescent preadipocytes at a time when cells were refractive to GH-stimulated DNA synthesis.

Truncations of the proximal 1 kb of the egr-1 promoter revealed that a 374-bp region (-624 to -250) contributes about 80% of GH inducibility in 3T3-F442A cells and approximately 90% inducibility in CHO-K1 cells. This region contains three juxtaposed SRE (serum response element)/Ets site pairs known to be important for egr-1 activity in response to exogenous stimuli. Site-specific mutations of individual SRE and Ets sites within this region each reduced GH inducibility of the promoter. Use of these site-specific mutations in EMSA showed that disruption of either Ets or SRE sites abrogated ternary complex formation at the composite sites. DNA binding of ternary complexes, but not binary complexes, in EMSA was rapidly and transiently increased by GH. EMSA supershifts indicated these ternary complexes contained serum response factor (SRF) and the Ets factors Elk-1 and Sap-1a. Coexpression of Sap-1a and Elk-1 resulted in a marked increase in GH induction of egr-1 promoter activity, although transfection with expression vectors for either Ets factor alone did not significantly enhance the GH response. We conclude that GH stimulates transcription of egr-1 primarily through activation of these Ets factors at multiple sites on the promoter and that stabilization of ternary complexes with SRF at these sites maximizes this response.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The long-term effects of GH on growth and differentiation are mediated by a specific membrane-bound receptor appropriately expressed in target tissues (1). The intracellular signals initiated by hormone-induced receptor dimerization, commencing with JAK2 activation, involve a cascade of events within the cell that result in long-term changes in gene expression (2). Recent reports describe a growing number of genes that are regulated by GH. Studies of their regulation can identify nuclear factors controlling expression of these genes as well as providing a basis for understanding the many actions of GH in growth, differentiation, and metabolism. The best characterized transcriptional responses to GH are 1) induction of the liver-specific serine protease gene spi 2.1 through a GH response element that binds STAT 5, a member of the STAT (signal transducer and activator of transcription) family of transcription factors (3); 2) induction of the immediate early gene c-fos, which is induced via the combined actions of a STAT site [c-sis-inducible element (SIE)] and composite sites within the serum response element (SRE) (4, 5); 3) induction of the CYP3A10/6 ß hydroxylase gene via activated STAT 5 (6); and 4) regulation of the cytochrome p450 2C11, 2C12, and 2C13 genes, of which 2C13 is regulated through hepatocyte nuclear factor and CCAAT/enhancer binding protein (C/EBP) sites in response to pulsatile GH (7, 8). It is becoming clear that STAT factors play an important, but not universal, role in GH signaling in concert with other transcription factors. The extent to which other transcription factors contribute to GH signaling may be determined by studying additional transcriptional responses to GH.

One model of GH-dependent differentiation is the adipose conversion of the murine embryonic preadipocyte lines, 3T3-F442A and Ob1771 (9, 10, 11). Unlike the majority of other GH-responsive cell culture models in use, these cells express endogenous receptor, and in this respect represent a useful system in which to study intracellular responses and downstream transcriptional events after a GH stimulus (9). The 3T3-F442A cell line was originally subcloned from the mouse 3T3 cell line based upon its ability to undergo rapid and extensive adipogenesis with appropriate differentiative stimuli (12). After growth arrest of these cells in culture, GH initiates a primed insulin-responsive state, which is characterized by a variety of morphological and biochemical changes in the cell, before terminal differentiation (13, 14). We and others have used this model to study transcriptional activation by GH of the immediate early gene c-fos and have identified the transcription factor binding sites, SIE (STAT), p62TCF, SRE, and AP-1, as inducing this response (4, 5, 16).

We have recently extended this study to an analysis of transcription factors directly regulated by GH in these cells, so as to obtain a profile of transcription factors that respond to GH (15, 17). This will allow us to understand how GH specifically regulates downstream target genes involved in GH-induced adipogenesis. Here we describe the induction of early growth response factor-1 (egr-1), one of 11 transcription factors shown in our laboratory to be regulated by GH (17). egr-1 belongs to a family of related immediate early response genes that encode DNA-binding proteins (18). The egr family of proteins contain a conserved zinc finger domain that confers binding specificity for GC-rich sequences. Regulation of egr-1 expression is similar in kinetics and specificity to the c-fos gene, which has led to the suggestion that these genes share common signaling pathways (18). We show here that this gene is transcriptionally activated by GH through juxtaposed SRE/Ets elements located between -425 and -300 and could find no evidence for functional STAT elements within 932 bases upstream of the start site.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GH Induces egr-1 DNA Binding Activity
Using gel shift assays as a measure of DNA binding activity we have previously described the induction of AP-1 and C/EBP activity by GH in 3T3-F442A preadipocytes (15). We have extended this study to an analysis of 24 known transcription factors, of which 7 exhibit changes in DNA binding activity within the first 3 h of GH stimulation (17). Of these activities, DNA binding to a high-affinity egr-1-binding site exhibited the greatest change. Specific DNA binding activity was transiently increased from negligible levels before GH to a maximum at 60 min after GH addition, with a return to basal levels after 4 h (Fig. 1AGo). Each electromobility shift assay (EMSA) reaction was incubated with H2B probe containing the wild-type octomer motif that binds the unregulated octomer binding protein, Oct-1, to normalize for slight variations in nuclear extract concentration (15) (Fig. 1BGo). The identity of the DNA-bound complex was confirmed in EMSA using an affinity-purified polyclonal antibody to the egr-1 protein. All of the DNA-bound complex was supershifted in the presence of this antibody but was unaffected by the presence of control antibody specific for the transcription factor AP-2, which also binds to a GC-rich consensus sequence (Fig. 1CGo). Cycloheximide abrogated GH-induced DNA binding (data not shown), indicating that protein synthesis was required for induction of egr-1 by GH. We cannot rule out the possibility that GH further enhanced the DNA binding activity of egr-1 through phosphorylation (23).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 1. EMSA of egr-1 in GH-Stimulated 3T3-F442A Preadipocytes

Confluent cultures were stimulated with 2.2 nM hGH, and nuclei were harvested at time points shown. Nuclear extracts were incubated with radiolabeled egr-1 binding site probe alone (A) or in the presence of 0.5 µg polyclonal antibodies to egr-1 or AP-2 (C). Binding of the same extracts to H2B probe (B), which specifically binds to the unregulated factor OCT-1, was used to to normalize for variations in concentration between extracts. Arrow indicates egr-1 complex; *, egr-1/antibody complex; FP, free probe.

 
GH Transiently Transactivates the egr-1 Gene
To establish whether GH induces transcription of the egr-1 gene, we studied mRNA levels during the 4-h period after GH addition. Levels of egr-1 mRNA increased transiently in response to GH in confluent cell culture (Fig. 2AGo). mRNA levels reached a maximum at 60 min and returned to basal levels by 4 h, paralleling the gel shift data. Coincubation with cycloheximide superinduced and prolonged the mRNA levels (data not shown). A markedly reduced induction of egr-1 mRNA by GH was observed in proliferating cells (Fig. 2BGo). We also compared the amounts of mRNA for the immediate early gene c-fos under the same conditions. c-fos mRNA levels transiently increased in confluent preadipocytes after GH treatment, while in proliferating cells c-fos expression was undetectable.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 2. Northern Blot Analysis of egr-1 and c-fos in GH-Stimulated 3T3-F442A Preadipocytes

A, Confluent cultures maintained for 16 h before stimulation with 2.2 nM hGH. B, Proliferating cells (60% confluent) stimulated with 2.2 nM hGH. Total RNA was harvested at time points shown, blotted, and probed sequentially for egr-1, c-fos, and 18S rRNA. Blots from panels A and B were probed simultaneously under identical conditions.

 
This increase in egr-1 and c-fos sensitivity to GH in confluent cells could be a result of an increase in cell surface GH receptor (GHR) expression. To test this, we performed GHR-binding assays on confluent, preconfluent, and 2-day differentiated cells. GHR expression was increased in confluent cells compared with both proliferating and differentiating cells. (60% confluent, 3% ± 2%; 100% confluent, 26% ± 5%; differentiated, 14% ± 1.5% specific binding/mg protein). This confirms previous reports of receptor expression in preadipocytes and supports a role for GH early in the differentiation pathway (13, 24).

Egr-1 was originally described as an immediate early gene activated following mitogenic stimuli (18, 25). We wished, therefore, to test whether the observed activation of egr-1 by GH correlated with a proliferative signal. We tested the effect of GH on DNA synthesis in confluent cell culture by assessing thymidine incorporation up to 30 h after GH stimulation. While there was a gradual decline in thymidine uptake with time, consistent with the confluent cells entering G0, no difference was observed between GH-stimulated and unstimulated cells (data not shown). This result is not consistent with a role for egr-1 induction by GH in a proliferative response.

GH Regulates Egr-1 Promoter Activity via Serum Response and Ets Elements
To determine the cis elements responsible for transactivation of the egr-1 gene, serial 5'-truncations of the egr-1 promoter were made upstream of the luciferase reporter gene, and these constructs were transfected into 3T3-F442A preadipocytes or CHO-K1 cells and examined for GH responsiveness (Fig. 3Go). GH increased the activity of a 932-bp egr-1 promoter fragment (egr-1200) by 3.81 ± 0.27-fold in 3T3-F442A cells and 4.34 ± 0.13 fold in CHO-K1 cells. A 374-bp region (-624 to -250) contributed about 80% of GH inducibility in 3T3-F422A cells. This region contains three functional serum response elements and at least three Ets factor (p62TCF)-binding sites as described elsewhere (Fig. 3AGo) (37, 41). One or more of these sites have been implicated in the response of this promoter to serum, antigen receptor cross-linking in B lymphocytes (19), and pharmacological stimuli (27). A similar pattern of activation by GH was obtained in CHO-K1 cells (~80% inducibility between -624 to -250), suggesting a common mechanism of egr-1 induction by GH (Fig. 3CGo).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. Effect of Serial 5'-Deletions of egr-1 Promoter on GH Inducibility in 3T3-F442A and CHO-K1 Cells

A, Relative positions of 5'-truncations with respect to previously identified transcription factor-binding sites on egr-1 promoter (19 26 28 ). EBS, egr-1-binding site; A, AP-1; S, SRE; CRE, CREB site; TATA, TATA box; arrow indicates ets-like site (including E413, E376, and E306). B, Activity of egr-1 promoter-luciferase reporter constructs in 3T3-F442A cells. C, Activity of egr-1 promoter-luciferase reporter constructs in CHO-K1 cells. Data are presented as percent of wild-type induction of egr-1 promoter [3.81 + 0.27 (mean ± SEM) fold for 3T3-F442A cells and 4.34 ± 0.13 fold for CHO cells] from a minimum of three triplicated experiments for each construct. Error bars denote SEM. *, P < 0.05 by ANOVA.

 
The contribution of individual binding sites within the GH-responsive region -624 to -250 was defined by site-directed mutagenesis of the promoter (Fig. 4Go). Mutations that abrogated transcription factor binding were introduced into the binding sites of individual Ets and SRE elements (Fig. 4AGo) and combinations of Ets/SRE 3 and 4. In 3T3-F442A cells, mutated Ets sites (Ets 3, 4, and 5) all significantly reduced the GH inducibility, with the Ets 3 site having the greatest effect. Likewise, mutation of each of the SRE 3, 4, and 5 sites significantly reduced GH inducibility, although with these mutations the loss was similar for all three elements (Fig. 4BGo).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. Effect of Site-Directed Mutagenesis of egr-1 Promoter on GH Inducibility in 3T3-F442A Cells

A, Wild-type sequences involved in particular elements are underlined and mutations made to abrogate activity are shown in lowercase. B, GH inducibility of mutants. Activity of egr-1 promoter luciferase constructs was normalized to wild-type induction [3.75 + 0.13 (mean ± SEM) fold]. Ets (open boxes), SRF (solid boxes), and CREB (gray boxes) binding sites, mutated by site-directed mutagenesis, are shown schematically on the 1200-bp egr-1 promoter. Data are presented from a minimum of three triplicated experiments for each construct. Error bars denote SEM. *, P < 0.05 by ANOVA.

 
To analyze the interaction between these elements, combined mutations were also made and examined for GH inducibility in 3T3-F442A cells (Fig. 4BGo). Combined mutation of SRE 3 and 4 did decrease the induction seen with either element mutated alone, but about 50% inducibility remained, presumably mostly a result of the remaining SRE 5/Ets 5. Combining the SRE 3 and 4 mutations with mutant Ets 3 did not decrease the induction below the level seen with the Ets 3 mutation alone. We conclude that each of the three juxtaposed Ets/SRE sites contributes to GH inducibility. The downstream cAMP-responsive element (CRE) at -135 is not involved (Fig. 4BGo). This site has previously been shown to mediate induction of EGR-1 in response to certain cytokines (28). Nonfunctionality was confirmed in EMSA where binding to this CRE site was found to be unaltered after GH addition (data not shown). Thus, it seems likely that the residual GH inducibility seen with the Egr 250 construct in 3T3-F442A cells and, to a lesser extent, in CHO cells is a result of the SRE sites 3' of -116 (see below).

Analysis of the egr-1200 sequence revealed a lack of putative STAT-binding sites based on loose sequence homology to STAT factor consensus sequences over the 932 bases of promoter sequence. Two degenerate sites were identified at positions -786 (ISRE, Ref. 29), situated in the distal third of the promoter that exhibited no GH inducibility, and -215 (APRF, Ref. 30) between CRE and SRE elements, a region that exhibited no GH inducibility in 3T3-F442A cells (Fig. 4BGo). Gel shift analyses using these putative sites as probes yielded no specific binding, nor could STAT proteins be immunologically identified using a panel of commercially available STAT antibodies in EMSA (data not shown). Thus, the proximal 1-kb egr-1 promoter appears to differ from the c-fos promoter with respect to the absence of a GH-responsive STAT site.

GH Induces Multiple Ternary Complex Factors to Activate Egr-1 and c-fos Promoters
We wished to identify the factors binding to the GH-responsive Ets and SRE elements in the Egr-1 promoter and to establish whether the same factors previously identified to be responsible for GH-induced c-fos activity were responsible for Egr-1 induction (4, 5, 16).

Gel shift analyses were performed on nuclear extracts from GH-treated cells using oligonucleotide probes derived from the GH-responsive ets and SRE elements of the Egr-1 promoter. Two or three major complexes were observed with these probes, provided SRE and Ets sites were present together ( Figs. 5–7GoGoGo). Binding of the high molecular weight complex (B1), common to ES5, ES4, and ES3, was increased within 5 min of GH stimulation and remained high relative to unstimulated cells for up to 60 min. Use of mutant oligonucleotide probes with ES5 (EmS5 and mES5) shows that the induced upper complex (B1, Fig. 5Go) is dependent on both intact Ets and SRE sites. The invariant complex B2 requires an intact SRE only and B3, which is specific to ES5, requires an intact Ets site alone. Binding of the same nuclear extracts to the composite SRE element from the c-fos promoter exhibits a similar banding pattern and a concomitant transient increase in a high mol wt complex (Fig. 5Go). The intensities of the GH-induced c-fos and egr SRE/Ets bands relative to uninduced bands in the same lanes suggests that the GH-induced complex bound to the fos SRE element is less stable than the complex bound to the egr-1 element under these EMSA conditions. Mutant oligonucleotides E5mS5 and mE5S5 do not allow the B1 complex to form, suggesting that GH increases the stability of a ternary complex, presumably through interaction between Ets-like factors, SRF, and possibly other transcription factors.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. EMSA of Ets- and SRE-Binding Sites from egr-1 and c-fos Promoters in GH-Stimulated 3T3-F442A Preadipocytes

Oligonucleotides encompassing egr-1 ES4, egr-1 ES5, and c-fos EtsSRE (ES) were incubated with nuclear extracts from hGH (2.2 nM)-treated cells harvested at time points shown. Mutant binding sites for E413 (mE5S5) and S405 (E5mS5) identical to site-directed mutants in Fig. 5Go were used in EMSA. Major complexes are labeled B1, B2, and B3. FP, Free probe; Or, sample origin.

 


View larger version (92K):
[in this window]
[in a new window]
 
Figure 6. Use of Competitive Oligonucleotides in EMSA of egr-1 ES5 and c-fos SRE

Pooled nuclear extracts from 15 min, 30 min, and 60 min GH-induced cells were incubated with radiolabeled ES5 (lanes 1–12) or c-fos SRE (lanes 13–16) and excess wild-type and mutant oligonucleotides (25-fold and 50-fold excess) as indicated. ES5 wild-type oligonucleotide (E/S in the figure) was used at 50- fold excess in lane 2. Major complexes corresponding to Fig. 5Go are labeled B1, B2, and B3. FP, Free probe; NS, nonspecific band.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Supershift EMSA of SRF and Ets Factors in 3T3-F442A Preadipocytes

Nuclear extracts from GH-stimulated cells were coincubated with radioactively labeled S1, ES3, ES4, or ES5 oligonucleotides and 0.5 µg polyclonal antibodies for SRF, Elk-1, or Sap-1a alone or in combination, or fli-1 (ES4) were added before EMSA, as described in Materials and Methods.

 
Competition of egrES5 binding with mutated oligonucleotides in EMSA (Fig. 6Go) confirms that the high molecular weight complex, B1, is a ternary complex of the two higher mobility complexes, B2 and B3 (see lanes 1–6, Fig. 6Go). The serum response factor (SRF) appears to bind in complex B2 and the Ets factor in complex B3 within the SRE/Ets 5 composite oligonucleotide probe. Reciprocal competition of egrES5 binding with c-fos SRE/Ets oligonucleotides (lanes 7–12, Fig. 6Go) suggests that the Ets-like factor bound to the egrES5 complex does not bind with high affinity to the c-fos SRE/Ets site, while proteins bind with similar affinity to both c-fos and egr-1 promoter SRE sites. Furthermore, ternary complex formation on egr-1 ES5 is predominantly dependent upon ets-like factor binding (lanes 1–4, Fig. 6Go).

Use of specific antibodies in gel shift identify the components of the ternary complex as SRF, Elk-1, and Sap-1a (Fig. 7Go). SRF antibody completely supershifts both the SRF complex and the ternary complexes on ES5, ES4, and ES3, suggesting that SRF occupies all of these sites. The SRF antibody also supershifts the single band seen with an SRE1 (S1) oligonucleotide probe (Fig. 7Go). No complex was seen with a SRE 2 oligonucleotide (not shown). While incubation of egr ES5, ES4, and ES3 with Elk-1 or Sap-1a antibodies separately resulted in partial supershift of the B1 complex, incubation with Elk-1 and Sap-1a antibodies together completely supershifted these ternary complexes, suggesting that Elk-1 and/or Sap-1a are bound in all ternary complexes in GH-stimulated 3T3-F442A cells. We were unable to detect fli-1 using commercially available supershift antibody to murine fli-1 (Fig. 7Go).

To provide functional evidence for Elk-1 and Sap-1a involvement in egr-1 transactivation, expression constructs for Sap-1a and Elk-1 were transfected with the egr-1 reporter construct, and the effect of GH on egr-1 promoter activity was determined by luciferase assay (Fig. 8Go). There was a nonsignificant increase in induction with both Elk-1 and Sap-1a coexpression, but when these were combined, a marked and highly significant increase in GH inducibility was seen (Fig. 8Go).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 8. Effect of Sap-1a and Elk-1 Coexpression on GH Induction of egr-1 Promoter in 3T3-F442A Cells

Seventy percent confluent early-passage cells were pooled and electroporated as described in Materials and Methods with 12 µg Egr-1 1200 reporter, 1 µg rGHR vector, and either Elk-1 (5 µg), Sap-1a (5 µg), or both (2.5 µg each) expression vectors. Cells were replated after transfection into six-well plates and 3 days later, when fully confluent, were challenged with 22 nM GH or solvent, after an overnight serum starve. After 3 h the cells were harvested and luciferase assays were undertaken. Twelve wells were used for each Ets vector combination (six with, six without GH), as well as a set with empty pEV expression vector. The experiment was performed four times and shows the mean value of the GH response as fold induction (*, P < 0.01 by ANOVA).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The long-term effects of GH on adipocyte differentiation and on energy metabolism in adult life are well documented (31, 32), although whether GH plays a positive or negative role in differentiation of stem cells in vivo remains contentious. However, the fact remains that GH is able to specifically induce adipogenesis in both 3T3-F442A and Ob1771 preadipocytes, and these cells form functional fat depots when implanted into appropriate donors (33). The 3T3-F442A cell line has been used extensively to study direct actions of GH on cellular differentiation and provides an ideal model for analyzing rapid GH transactivations independent of secondary (e.g. IGF-I mediated) mechanisms.

In this study, mRNA levels of two immediate early genes, egr-1 and c-fos are shown to be increased by GH in quiescent preadipocytes. Both have been implicated in mitogenic responses to exogenous stimuli. However, rather than stimulating proliferation, several lines of evidence suggest that GH acts to specifically induce differentiation in these cells. First, the original characterization of 3T3-F442A cells by Green and Kehinde (33) showed that the cells must undergo cell cycle arrest for appropriate adipogenesis to occur. Adipogenesis is then dependent upon GH stimulation under the conditions described (34). In support of this, Sonenberg and co-workers showed that GH antagonized the mitotic effects of insulin (35) or serum (36) in proliferating 3T3-F442A cells and directly prevented G1-to-S phase transition. Second, thymidine uptake experiments (data not shown) demonstrated that 3T3-F442A preadipocytes do not undergo DNA replication after GH stimulation under the conditions used here to study egr-1 induction. Third, we have examined the cell cycle-dependent transcription factor E2F in these cells and observed no change in DNA binding in response to GH (15).

Both c-fos and egr-1 are known to be associated with a multiplicity of cellular processes. Thus egr-1 has been implicated in cell lineage determination (37, 38, 39, 40, 41), differentiation (22, 43, 45), growth arrest (42, 43, 44), and apoptosis (44, 46), while c-fos has been associated with similarly diverse processes (reviewed in Ref. 47). Although induction of egr-1 and c-fos in quiescent F442A cells appears to correlate with a differentiative rather than proliferative signal, establishment of a definitive role for egr-1 in adipogenesis remains to be determined. The apparent reliance of 3T3-L1 cells on peroxisome proliferator-activated receptor-related signals for growth arrest and subsequent commitment to adipogenesis (48, 49) provides a potential target of egr-1 and c-fos in this model of GH-induced differentiation.

Analysis of immediate early gene regulation provides a means of identifying the transcription factors and associated proteins activated as a direct result of the initial GH stimulus at the cell surface. In this study we have shown that a 376-bp region of the egr-1 promoter is responsible for about 80% of the observed GH response in 3T3-F442A cells. This region contains three juxtaposed Ets/SRE elements (ES5, ES4, and ES3) known to be responsible for induction of the egr-1 promoter in response to a variety of exogenous stimuli (19, 38, 45, 50, 51, 52, 53, 54, 55). The same region was also responsible for approximately 90% of GH inducibility in CHO cells (Fig. 3CGo), suggestive of a conserved pathway for egr-1 activation by GH in different cell types.

Here we show that mutation of individual Ets and SRE binding elements inhibited GH inducibility to varying degrees (Fig. 4Go). Our analysis indicates that multiple SRE/Ets sites on the egr-1 promoter, in particular the Ets/SRE elements 3, 4, and 5, mediate GH activation. There is no doubt that Ets factors are important in transactivation of the egr-1 gene (19, 56). Interestingly, Elk-1, Sap-1a, and fli-1 are able to bind to Ets sites on the egr-1 promoter in an SRF-independent manner (56, 57), which is supported by our gel shift data for egrES5 (Fig. 6Go). This ability is dependent upon the flanking sequences present around the Ets boxes, as Elk-1, for example, is unable to bind to the c-fos SRE or egrES1 sites without SRF but, like Sap-1a, is reportedly able to bind to Ets 4 in the absence of SRF (19, 56, 57). Figure 6Go suggests a higher affinity of the ternary complex for the SRE over Ets or SRF bound alone (lanes 1–6). Accordingly, the primary role of SRF in GH induction of egr-1 may be to stabilize DNA binding of Ets factors to specific Ets sites so that Sap-1a and Elk-1, rather than SRF, are critical targets for GH induction of egr-1. This is in contrast to the c-fos promoter where SRF is critical for both recruitment and stabilization of TCFs, as well as stimulation of the SRE (5, 28, 57, 58). It is nonetheless probable that SRF phosphorylation by GH-activated p90rsk (59) does contribute to transactivation by the SRF (60).

Northern blot analysis (Fig. 2Go), transcriptional assays (see Ref. 5 and Fig. 3Go), and EMSA (see Ref.15 and Fig. 1Go) all indicate that egr-1 is more sensitive to GH stimulation than c-fos (AP-1). This is likely due to the fact that the egr-1 promoter contains multiple functional SRE elements, compared with c-fos, which carries only one. In addition, gel shift analysis shows that Ets factors and the ternary complex bind with relatively lower affinity to c-fos SRE than egrES5 (Figs. 5Go and 6Go). This lower affinity of Sap-1a and Elk-1 for the c-fos promoter may also contribute toward the lesser sensitivity of c-fos to GH stimulation.

Here we have shown by functional assay and by supershift analysis that Elk-1 and Sap-1a form ternary complexes with SRE sites in both c-fos and egr-1 promoters and that Ets factors constitute a GH-responsive complex with the SRF. A recent report describes the importance of Elk-1 in transactivating c-fos in response to GH (16). Our EMSA supershift data, plus the strong synergism in transactivating the Egr-1 1200 promoter when both Ets factors are coexpressed together, indicates that both play a role in vivo. One possibile explanation for the latter result is that overexpression of both Elk-1 and Sap-1a aids the formation of quaternary complexes with SRF (19, 57), and these may enhance induction by maximizing the interaction with the transcriptional machinery as previously suggested (19). Indeed, both Sap-1a and Elk-1 are present in a high molecular weight complex in Fig. 7Go, although it is not possible to establish in this figure whether these factors make up ternary or quaternary complexes. Sap-1a and Elk-1 are activated by a number of signaling cascades involving ERK, JNK, and p38 kinase pathways (61, 62, 63, 64, 65, 66). Whether these factors are activated by distinct or common pathways is dependent upon the cell type studied. We (15) and others (67) have previously reported the rapid activation of ERKs 1 and 2 by GH in 3T3F442A cells, and ERK is able to mediate activation of Elk-1 by phosphorylation of serine 383 in its transcriptional activation domain (68). Indeed, Liao et al. (16) have recently shown that Elk-1 overexpressed in CHO cells can be phosphorylated on serine 383 as a result of GHR activation. This activation requires the JAK 2 binding sequence on the receptor, box 1 (69). Sap-1a is also activated by ERKs, through phosphorylation of serines 381 and 387 (62). In a recent report studying a number of Ets-related factors, expressed in vitro, fli-1 was shown to be able to form ternary complexes with SRF on this SRE/Ets site (57). Given that Ets factors have novel functions (57), recruitment of different Ets factors to promoters would be one mechanism of tissue selectivity in transcriptional responses. We have used fli-1 antibody in EMSA with egr-1 ES4 (Fig. 7Go) and c-fos SRE (unpublished) oligonucleotides but have been unable to obtain any significant supershift. This indicates either the amount of fli-1 is very low or absent or that fli-1 is not activated by GH in these cells.

AP-1 and STAT factors have been shown to contribute to the c-fos response to GH (4, 5). Two putative AP-1 sites are present in the distal third of the egr-1 promoter. One of these sites resides within an unresponsive region of the promoter while the other lies at the extreme 5'-end of the GH-responsive region. While Ets sites contribute the majority of this response in this region, based on our mutagenic analysis, we cannot exclude the possibility that AP-1 has some effect on the promoter. However, given the time course of message induction, it is unlikely that this site would contribute to the initial transactivation by GH.

There appears to be no STAT site in the proximal 1 kb of the egr-1 promoter, as ascertained by sequence analysis. Known STAT-binding sites from the literature, including degenerate consensus sequences such as TTN5AA, were used in this search. Two degenerate sites that exhibited closest homology (CAGTTTTCCCGGTGAC at -786, and GGCTTTCCAGGAGCCT at -215), plus one degenerate site within SRE3 exhibited no specific binding in EMSA. The absence of a STAT site in the egr-1 promoter would constitute an important difference between c-fos and egr-1 regulation and would further emphasize the use of multiple Ets/SRE sites within the egr-1 promoter. A more extensive analysis of egr-1 promoter activity in the presence of exogenous STAT factors should establish whether hitherto undefined STAT sites exist in this promoter or whether STATs interact through other factors to influence egr-1 transcription.

We have shown that approximately 80% of the GH inducibility of Egr-1 in 3T3-F442A cells resides within a 376-bp region, encompassing ES3, ES4, and ES5 elements, within which Ets sites have a prominent role (Fig. 5Go). The proximal 116 bp of the egr-1 promoter also provide significant inducibility in 3T3-F442A cells, and this region contains two additional SREs (S1 and S2, Fig. 4Go) that contribute to egr-1 inducibility in other cell types (50, 52, 53, 54). However, these sites do not form ternary complexes in 3T3F442A cells, and we find SRE 2 is unable to bind in EMSA, although SRE 1 does bind to SRF (Fig. 7Go). We propose that SRE 1 is most likely responsible for the residual GH inducibility.

In conclusion, this study has directly implicated egr-1 for the first time in GH-mediated signaling and shown that Elk-1 and Sap-1a are proximal components of its GH-induced transcription. Our data indicate that GH utilizes multiple SRE/Ets sites for rapid and effective induction of this important immediate early gene.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recombinant hGH was a gift from Genentech, Inc. (South San Francisco, CA). Ham’s F12 was supplied by Trace Biosciences (Castle Hill, NSW, Australia), Serum Supreme was obtained from BioWhittaker (Wakersville, MD), DMEM was purchased from GIBCO-BRL (Gaithersburg, MD), and newborn calf serum was supplied by both GIBCO-BRL and Trace Biosciences. Poly-dI-dC was supplied by Pharmacia (Piscataway, NJ), while restriction enzymes and DOTAP lipofection components were purchased from Boehringer Mannheim (Mannheim, Germany).

All antibodies were purchased from Santa Cruz Biotechnologies Inc. (Santa Cruz, CA). The Luciferase reporter gene assay, constant light signal kit was purchased from Boehringer Mannheim (Mannheim, Germany).

DNA Constructs and Oligonucleotides
A 1.2-kb egr-1 promoter fragment containing 932 bp upstream of the transcription start site was a gift of Dr. S. B. McMahon (19). The 1.2-kb ClaI/SalI fragment was subcloned into pBluescript and transferred into SacI/XhoI sites of the luciferase minimal reporter vector, pGLBasic (Promega, Madison, WI). All subsequent mutageneses were performed on this construct (egr-1200). Four 5'-deletion constructs were created using available restriction sites within the promoter and the multiple cloning site of pGLBasic. The promoter-internal restriction sites used were: egr-624, SfcI; egr-385, BamHI; egr-250, SmaI; and egr-116, EagI. Site-directed mutagenesis was performed using the Quickchange method (Stratagene, La Jolla, CA). All mutants were verified by sequencing, and at least two separate CsCl preparations of plasmid DNA were used in transfection assays. Elk-1 and Sap-1a expression vectors were a generous gift from Professor R. Janknecht and have been described previously (20, 21).

Double-stranded oligonucleotides for site-directed mutagenesis and EMSA experiments were synthesized by the CMCB oligonucleotide facility (University of Queensland, Australia). The sequences used in EMSA experiments were as follows: egr-1, 5'-CGTTCCGAGAGCGGGGGCGAGCGTGAAAG; egrES5, 5'-CCGA CCCGGAAACGCCATATAAGGAGCAGG corresponding to -420 to -389; egrES4, 5'-CCGCCGGAACAGACCTTATTTGGGCAGC corresponding to 381 to 353; egrES3, 5'-TTGGGCAGCGCCTTATATGG AGTGGCCCAA TATGGCCCTGCCGCTTCCGGCTCTGGGAGGAGGGGCGAGC corresponding to -350 to -297; and egrS1, 5'-GCTTCCTGCTTCCCATA TATGGCCATGTACGTC corresponding to -95 to -61. Mutant oligonucleotides used to produce mutant promoter constructs are as follows with mutations in lowercase: mCRE, 5'-GGATGGGAGGGCTTCtgGTCtCTCCGCTCCTCC; mEts3, 5'-CCGCTTCCGGCTCTGtGcGcAGGGGCGAGCG; mSre3, 5'-GGG CAGCGCCTTAagTGGAGTGGCCC; mEts4, 5'-GGAAGGATCCCCCGCgTt tAACAGACCTTATTTGGGC; mSre4, 5'-CGCCGGAACAGACCTTATTaaT GCAGCGCCTTATATGGA; mEts5, 5'-CCGACCCGcAtAtGCCATATAAG GAGCAGG; mSre5, 5'-CCGACCCGGAAACGCCATATgAaGAGCAGG. Mutant oligonucleotides used to produce mutant promoter constructs are shown in Fig. 4AGo.

Cell Culture
Early passage 3T3-F442A preadipocytes were kindly provided by Dr. Howard Green (Harvard University, Boston, MA) and maintained in DMEM supplemented with 10% newborn calf serum. Cells, grown to appropriate confluency, were washed in PBS and incubated in serum-free DMEM for 3 or 16 h before hormone treatment. Cells indicated as 100% confluent were allowed to reach 100% confluence and incubated for a further 16 h before serum starvation. Two-day differentiated cells were obtained by incubating 100% confluent cells in conditioned differentiation medium (13) for 48 h before serum starvation. Cells were not used for experiments after passage 12.

CHO K1 cells were purchased from ATCC (Manassas, VA; CCL-61) and cultured in Ham’s F12-supplemented 10% Serum Supreme. All cell cultures were maintained in a humidified 5% CO2 incubator at 37 C.

EMSA
Confluent 3T3-F442A cells were serum starved for 3 h before stimulation with 2.2 nM hGH for 30 min, and nuclear extracts were prepared from these cells over a period of 4 h, as previously described (15). Nuclear extracts (5–10 µg total protein) were incubated in the presence of 0.5–1.0 ng radiolabeled oligonucleotide probe in binding buffer (4 µg BSA, 2 µg poly dI-dC, 12 mM HEPES (pH 7.9), 12% glycerol, 0.12 mM EDTA, 0.9 mM MgCl2, 0.6 mM dithiothreitol, 0.6 mM phenylmethylsulfonyl fluoride, and 1.2 µg/ml aprotinin and leupeptin). For supershifting experiments the nuclear extracts were incublated overnight at 4 C with 2 µg of appropriate antibody, and then incubated at room temperature for 15 min with probe. Binding reactions were electrophoresed at 150 V for approximately 3 h in 6% polyacrylamide gels at 4 C, and then dried and analyzed on a GS-363 Molecular Imager (Bio-Rad, Regents Park, NSW, Australia). Polyclonal antibodies used in gel shifts were purchased from Santa Cruz Biotechnology Inc. (sc-189 X for Egr-1, sc-335 X for SRF, sc-355 X for Elk-1, sc-1426 X for Sap-1a, and sc-356 X for Fli-1). To equalize loadings in the EMSA, a prior run was undertaken with Oct-1 probe, and then nuclear extracts were added into the binding mix in proportion to the Oct-1 signal for subsequent EMSA with the Ets/SRF (ES) probes (15).

Northern Blot Analysis
Total cytoplasmic RNA was prepared using the Pharmacia RNA Extraction Kit according to the manufacturer’s instructions. The resultant pellet was resuspended in 10 µl H2O and incubated for 15 min at 55 C with 5 µl formaldehyde, and then 7 µl formamide in 1x 3-(N-morpholino)-propanesulfonic acid gel buffer was added and the sample was applied to a 1.2% agarose, 17.8% formaldehyde gel. After electrophoresis the gel was washed and the RNA transferred to Hybond-N membrane (Amersham, Ryde, NSW, Australia). After UV fixing, membranes were prehybridized in 5x SSPE, 50% formamide, 5x Denhardts, 1% SDS, and 100 µg/ml herring sperm DNA for 3 h at 42 C. A 550-bp Egr-1 cDNA fragment from within exon 2 of the Egr-1 gene was PCR amplified from genomic DNA isolated from a murine embryonic stem cell line and cloned into the plasmid vector pBluescript. cDNA probes were labeled with [{alpha}-32P]dCTP by the random priming method (15) and incubated with membranes at 42 C for 16 h. Membranes were then washed in 1x SSPE, 1% SDS at 65 C, and bound probe was visualized by autoradiography and analyzed by densitometry (Bio-Rad, GS-700 densitometer, Bio-Rad Laboratories, Richmond, CA). Hybridizations were performed on all filters simultaneously with identical probes and washing conditions. Equivalent amounts of RNA were loaded on each blot as confirmed by control 18S probes.

Receptor Binding Assay
3T3-F442A fibroblasts were grown to 60% confluence, 100% confluence, or 2 days differentiation in 90-mm dishes. Cells were incubated in serum-free media (DMEM only) for 3 h at 37 C followed by incubation in 5 ml physiological buffer (25 mM Tris, 130 mM NaCl, 2 mM MgCl2, 0.1% BSA, pH 7.4) and 7 x 105 cpm [125I]hGH in the presence or absence of 10 µg (excess) unlabeled bovine GH for 16 h at 4 C (22). Cells were washed in PBS and lysed with 2 ml 0.1 M NaOH before counting. Binding was normalized to cell protein determined by Bradford dye assay.

[3H]Thymidine Incorporation
3T3-F442A cells were grown to confluence in six-well plates, maintained for a further 16 h, serum starved for 3 h in DMEM followed by stimulation with 2.2 nM hGH or DMEM alone in the presence of [3H]thymidine (15 µCi) for the periods shown. Cells were then washed twice with PBS and lysed in 0.2 M NaOH with shaking for 15 min. Lysates were collected and counted by scintillation counter (CA 1900; Packard Instruments, Meriden, CT).

Cotransfections and Luciferase Assays
Seventy percent confluent CHO K1 cells were seeded into six-well plates at 2.2 x 105 cells per well 24 h before transfection. After aspiration of the medium, 160 µl of transfection reagent-DNA mixture containing 2 µg of reporter construct, 1 µg of pECE-rabbit GHR (rGHR), 0.5 µg ß-gal reporter, and 20 µl of DOTAP in HBS (20 mM HEPES, 150 mM NaCl, pH 7.4) were added to each well and mixed gently for 30 sec, and then 3 ml of Ham’s F12 containing 0.25% Serum Supreme were added to each well. After incubation for 40 h, transfected cells were treated with 9 nM recombinant human GH for a further 5.5 h, at which time the cells were harvested for luciferase activity. All constructs were transfected in triplicate for each experiment, and all experiments were repeated a minimum of three times. Luciferase activities were normalized to ß-galactosidase activity before calculating relative fold induction values reported in Results. ß-Galactosidase was measured by ELISA assay using o-nitrophenyl ß-D-galactopyranoside (Boehringer Mannheim, Mannheim, Germany).

3T3-F442A cells were transfected by electroporation at 150 V with a capacitance of 960 µFarads using the Bio-Rad Gene Pulser. Approximately 1.5 x 106 cells were electroporated in 100 µl of DMEM containing 10% newborn bovine serum and immediately transferred into 12 ml of DMEM plus 10% newborn bovine serum and evenly distributed into six-well plates. Routinely, 12 µg of appropriate reporter construct and 1 µg of pECE-rGHR were electroporated in all transfections except for the overexpression study, in which expression constructs for Sap-1a or Elk-1 were cotransfected. After cells reached 100% confluence, they were serum starved for 16 h in DMEM followed by stimulation with 23 nM of recombinant human GH for 5 h. Each construct was quantitated in six wells without and six wells with GH for each transfection. A minimum of three separate transfections (usually five) were used to obtain mean values for each construct.

Reporter Assay
Cells were harvested and lysed in 100 µl of lysis buffer (0.5 M HEPES, pH 7.4, 2% Triton N 101, 1 mM MgCl2, 1 mM CaCl2) and combined with 200 µl of luciferase reporter gene assay constant light signal reagent according to Packard’s specifications. Light emission was measured using a 1450 Microbeta Trilux liquid scintillation and luminescence counter (Wallac, Turku, Finland). Results for individual constructs are expressed as a percent of the GH induction seen with the Egr-1 1200 promoter for each transfection.

Statistics
ANOVA was used for multiple comparisons, with Dunnett’s post hoc test used for comparison of all values with the Egr-1 1200 promoter construct. Significance level was set at P < 0.05.


    FOOTNOTES
 
Address requests for reprints to: Professor M. J. Waters, Centre for Molecular and Cellular Biology, The University of Queensland, St. Lucia, Queensland, Australia 4072. E-mail: m.waters{at}mailbox.uq.edu.au

1 Current Address: Sir Alistair Currie CRC Laboratories, Molecular Medicine Centre, University of Edinburgh, Edinburgh, UK, EH4 2XU. Back

Received for publication April 29, 1998. Revision received December 30, 1998. Accepted for publication January 5, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Waters MJ 1999 The growth hormone receptor. In: Kostyo J (ed) Handbook of Physiology, Chap 13, section 7. Oxford University Press, Oxford, UK
  2. Argetsinger LS, Carter-Su C 1996 Mechanism of signaling by growth-hormone receptor. Physiol Rev 76:1089–1107[Abstract/Free Full Text]
  3. Yoon JB, Berry SA, Seelig S, Towle HC 1990 An inducible nuclear factor binds to a growth hormone-regulated gene. J Biol Chem 265:19947–19954[Abstract/Free Full Text]
  4. Meyer DJ, Stephenson EW, Johnson L, Cochran BH, Schwartz J 1993 The serum response element can mediate induction of c-fos by growth- hormone. Proc Natl Acad Sci USA 90:6721–6725[Abstract/Free Full Text]
  5. Chen CM, Clarkson RWE, Xie Y, Hume DA, Waters MJ 1995 Growth-hormone and colony-stimulating factor-1 share multiple response elements in the c-fos promoter. Endocrinology 136:4505–4516[Abstract]
  6. Subramanian A, Teixeira J, Wang JM, Gil G 1995 A STAT factor mediates the sexually dimorphic regulation of hepatic cytochrome-P450 3A10/lithocholic acid 6-beta-hydroxylase gene- expression by growth-hormone. Mol Cell Biol 15:4672–4682[Abstract]
  7. Legraverend C, Mode A, Westin S, Strom A, Eguchi H, Zaphiropoulos PG, Gustafsson JA 1992 Transcriptional regulation of rat P-450 2C gene subfamily members by the sexually dimorphic pattern of growth-hormone secretion. Mol Endocrinol 6:259–266[Abstract]
  8. Legraverend C, Eguchi H, Strom A, Lahuna O, Mode A, Tollet P, Westin S, Gustafsson JA 1994 Transactivation of the rat CYP2C13 gene promoter involves HNF-1, HNF- 3, and members of the orphan receptor subfamily. Biochemistry 33:9889–9897[CrossRef][Medline]
  9. Morikawa M, Nixon T, Green H 1982 Growth hormone and the adipose conversion of 3T3 cells. Cell 29:783–789[CrossRef][Medline]
  10. Ailhaud G, Amri E, Cermolacce C, Djian P, Forest C, Gaillard D, Grimaldi P, Khoo J, Negrel R, Serrerodave G, Vannier C 1983 Hormonal requirements for growth and differentiation of Ob17 preadipocyte cells in vitro. Diabete Metab 9:125–133[Medline]
  11. Doglio A, Dani C, Grimaldi P, Ailhaud G 1986 Growth-hormone regulation of the expression of differentiation-dependent genes in preadipocyte Ob1771 cells. Biochem J 238:123–129[Medline]
  12. Nixon T, Green H 1983 Properties of growth-hormone receptors in relation to the adipose conversion of 3T3-cells. J Cell Physiol 115:291–296[CrossRef][Medline]
  13. Green H, Morikawa M, Nixon T 1985 A dual effector theory of growth-hormone action. Differentiation 29:195–198[CrossRef][Medline]
  14. Zezulak KM, Green H 1986 The generation of insulin-like growth factor-1 sensitive cells by growth-hormone action. Science 233:551–553[Abstract/Free Full Text]
  15. Clarkson RWE, Chen CM, Harrison S, Wells C, Muscat GEO, Waters MJ 1995 Early responses of transactivating factors to growth-hormone in preadipocytes—differential regulation of CCAAT enhancer-binding protein-beta (C/EBP-beta) and C/EBP-delta. Mol Endocrinol 9:108–120[Abstract]
  16. Liao JF, Hodge C, Meyer D, Ho PS, Rosenspire K, Schwartz J 1997 Growth hormone regulates ternary complex factors and serum response factor associated with the c-fos serum response element. J Biol Chem 272:25951–25958[Abstract/Free Full Text]
  17. Clarkson RWE, Shang CA, Monks T, Waters MJ, Early activation of transcription and regulation of trans-activating factors by growth hormone. Program of the 10th International Congress of Endocrinology, San Francisco, CA, 1996 (Abstract 717)
  18. Sukhatme VP, Cao XM, Chang LC, Tsaimorris CH, Stamenkovich D, Ferreira PCP, Cohen DR, Edwards SA, Shows TB, Curran T, Lebeau MM, Adamson ED 1988 A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell 53:37–43[CrossRef][Medline]
  19. McMahon SB, Monroe JG 1995 A ternary complex factor-dependent mechanism mediates induction of egr-1 through selective serum response elements following antigen receptor cross-linking in B-lymphocytes. Mol Cell Biol 15:1086–1093[Abstract]
  20. Janknecht R, Ernst WH, Nordheim A 1995 SAP1a is a nuclear target for signalling cascades involving ERKs. Oncogene 10:1209–1216[Medline]
  21. Janknecht R, Ernst WH, Pingoud V, Nordheim A 1993 Activation of ternary complex factor Elk-1 by MAP kinases. EMBO J 12:5097–5104[Medline]
  22. Gobius KS, Rowlinson SW, Barnard R, Mattick JS, Waters MJ 1992 The first disulfide loop of the rabbit growth-hormone receptor is required for binding to the hormone. J Mol Endocrinol 9:213–220[Abstract]
  23. Huang RP, Darland T, Okamura D, Mercola D, Adamson ED 1994 Suppression of v-sis-dependent transformation by the transcription factor, egr-1. Oncogene 9:1367–1377[Medline]
  24. Nixon T, Green H 1984 Contribution of growth-hormone to the adipogenic activity of serum. Endocrinology 114:527–532[Abstract]
  25. Sukhatme VP, Kartha S, Toback FG, Taub R, Hoover RG, Tsaimorris CH 1987 A novel early growth-response gene rapidly induced by fibroblast, epithelial-cell and lymphocyte mitogens. Oncogene Res 1:343–355[Medline]
  26. Morris CHT, Cao X, Sukhatme VP 1988 5' flanking sequence and genomic structure of egr-1, a murine mitogen inducible zinc finger encoding gene. Nucleic Acids Res 16:8835–8846[Abstract/Free Full Text]
  27. Kharbanda S, Saleem A, Hirano M, Emoto Y, Sukhatme V, Blenis J, Kufe D 1994 Activation of early growth-response-1 gene-transcription and pp90rsk during induction of monocytic differentiation. Cell Growth Differ 5:259–265[Abstract]
  28. Sakamoto KM, Fraser JK, Lee HJJ, Lehman E, Gasson JC 1994 Granulocyte-macrophage colony-stimulating factor and interleukin-3 signaling pathways converge on the CREB-binding site in the human egr-1 promoter. Mol Cell Biol 14:5975–5985[Abstract/Free Full Text]
  29. Darnell JE, Kerr IM, Stark GR 1994 JAK-STAT pathways and transcriptional activation in response to IFN{gamma} and other extracellular signaling proteins. Science 264:1415–1421[Abstract/Free Full Text]
  30. Wegenka UM, Buschmann J, Lutticken C, Heinrich PC, Horn F 1993 Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level. Mol Cell Biol 13:276–288[Abstract/Free Full Text]
  31. Harant I, Beauville M, Crampes F, Riviere D, Tauber MT, Tauber JP, Garrigues M 1994 Response of fat cells to growth hormone (GH): effect of long-term treatment with recombinant human GH in GH-deficient adults. J Clin Endocrinol Metab 78:1392–1395[Abstract]
  32. Hauser H 1992 Physiology of the fat cell, with emphasis on the role of growth hormone. Acta Paediatr 81:47–51
  33. Green H, Kehinde O 1979 Formation of normally differentiated subcutaneous fat pads by an established preadipose cell line. J Cell Physiol 101:169–172[CrossRef][Medline]
  34. Guller S, Sonenberg M, Wu KY, Szabo P, Corin RE 1989 Growth hormone-dependent events in the adipose differentiation of 3T3–F442A fibroblasts: modulation of macromolecular synthesis. Endocrinology 125:2360–2367[Abstract]
  35. Tang BQ, Jeoung DI, Sonenberg M 1995 Effect of human growth-hormone and insulin on [3H] thymidine incorporation, cell-cycle progression, and cyclin-D expression in 3T3–F442A preadipose cells. Endocrinology 136:3062–3069[Abstract]
  36. Corin RE, Guller S, Wu KY, Sonenberg M 1990 Growth hormone and adipose differentiation: growth hormone induced anti-mitogenic state in 3T3–F442A preadipose cells. Proc Natl Acad Sci USA 87:7507–7511[Abstract/Free Full Text]
  37. Nguyen HQ, Hoffmanliebermann B, Liebermann DA 1993 The zinc finger transcription factor egr-1 is essential for and restricts differentiation along the macrophage lineage. Cell 72:197–209[CrossRef][Medline]
  38. Varnum BC, Lim RW, Kujubu DA, Luner SJ, Kaufman SE, Greenberger JS, Gasson JC, Herschman HR 1989 Granulocyte-macrophage colony-stimulating factor and tetradecanoyl phorbol acetate induce a distinct, restricted subset of primary- response genes in both proliferating and terminally differentiated myeloid cells. Mol Cell Biol 9:3580–3583[Abstract/Free Full Text]
  39. Kharbanda S, Nakamura T, Stone R, Hass R, Bernstein S, Datta R, Sukhatme VP, Kufe D 1991 Expression of the early growth response-1 and response-2 zinc finger genes during induction of monocytic differentiation. J Clin Invest 88:571–577
  40. Huang RP, Liu CT, Fan Y, Mercola D, Adamson ED 1995 Egr-1 negatively regulates human tumor-cell growth via the DNA-binding domain. Cancer Res 55:5054–5062[Abstract/Free Full Text]
  41. Krishnaraju K, Nguyen HQ, Liebermann DA, Hoffman B 1995 The zinc-finger transcription factor egr-1 potentiates macrophage differentiation of hematopoietic-cells. Mol Cell Biol 15:5499–5507[Abstract]
  42. Liu CT, Adamson E, Mercola D 1996 Transcription factor egr-1 suppresses the growth and transformation of human HT-1080 fibrosarcoma cells by induction of transforming growth-factor-beta-1. Proc Natl Acad Sci USA 93:11831–11836[Abstract/Free Full Text]
  43. Milbrandt J 1987 A nerve growth-factor induced gene encodes a possible transcriptional regulatory factor. Science 238:797–799[Abstract/Free Full Text]
  44. Ahmed MM, Venkatasubbarao K, Fruitwala SM, Muthukkumar S, Wood DP, Sells SF, Mohiuddin M, Rangnekar VM 1996 Egr-1 induction is required for maximal radiosensitivity in A375–C6 melanoma-cells. J Biol Chem 271:29231–29237[Abstract/Free Full Text]
  45. Cao XM, Koski RA, Gashler A, Mckiernan M, Morris CF, Gaffney R, Hay RV, Sukhatme VP 1990 Identification and characterization of the egr-1 gene-product, a DNA-binding zinc finger protein-induced by differentiation and growth signals. Mol Cell Biol 10:1931–1939[Abstract/Free Full Text]
  46. Muthukkumar S, Nair P, Sells SF, Maddiwar NG, Jacob RJ, Rangnekar VM 1995 Role of egr-1 in thapsigargin-inducible apoptosis in the melanoma cell-line A375–C6. Mol Cell Biol 15:6262–6272[Abstract]
  47. Verma IM, Graham WR 1998 The fos oncogene. Adv Cancer Res 49:29–52
  48. Altiok S, Xu M, Spiegelman BM 1997 PPAR gamma induces cell cycle withdrawal: inhibition of E2F/DP DNA- binding activity via down-regulation of PP2A. Genes Dev 11:1987–1998[Abstract/Free Full Text]
  49. Shao DL, Lazar MA 1997 Peroxisome proliferator activated receptor gamma, CCAAT/enhancer-binding protein alpha, and cell cycle status regulate the commitment to adipocyte differentiation. J Biol Chem 272:21473–21478[Abstract/Free Full Text]
  50. Christy B, Nathans D 1989 Functional serum response elements upstream of the growth factor-inducible gene zif 268. Mol Cell Biol 9:4889–4895[Abstract/Free Full Text]
  51. Datta R, Rubin E, Sukhatme V, Qureshi S, Hallahan D, Weichselbaum RR, Kufe DW 1992 Ionizing-radiation activates transcription of the egr-1 gene via CARG elements. Proc Natl Acad Sci USA 89:10149–10153[Abstract/Free Full Text]
  52. Gius D, Cao XM, Rauscher FJ, Cohen DR, Curran T, Sukhatme VP 1990 Transcriptional activation and repression by fos are independent functions: the C-terminus represses immediate-early gene-expression via CARG elements. Mol Cell Biol 10:4243–4255[Abstract/Free Full Text]
  53. Rupprecht HD, Sukhatme VP, Lacy J, Sterzel RB, Coleman DL 1993 PDGF-induced egr-1 expression in rat mesangial cells is mediated through upstream serum response elements. Am J Physiol 265:F351–F360
  54. Watanabe S, Kubota H, Sakamoto KM, Arai K 1997 Characterization of cis-acting sequences and trans-acting signals regulating early growth response 1 and c-fos promoters through the granulocyte-macrophage colony-stimulating factor receptor in BA/F3 cells. Blood 89:1197–1206[Abstract/Free Full Text]
  55. Rim M, Qureshi SA, Gius D, Nho J, Sukhatme VP, Foster DA 1992 Evidence that activation of the egr-1 promoter by v-raf involves serum response elements. Oncogene 7:2065–2068[Medline]
  56. Hipskind RA, Rao VN, Mueller CGF, Reddy ESP, Nordheim A 1991 Ets-related protein Elk-1 is homologous to the c-fos regulatory factor p62TCF. Nature 354:531–534[CrossRef][Medline]
  57. Watson DK, Robinson L, Hodge DR, Kola I, Papas TS, Seth A 1997 Fli-1 and Ews-Fli-1 function as ternary complex factors and Elk-1 and Sap1a function as ternary and quaternary complex factors on the egr-1 promoter serum response elements. Oncogene 14:213–221[CrossRef][Medline]
  58. Edwards SA, Darland T, Sosnowski R, Samuels M, Adamson ED 1991 The transcription factor egr-1 is rapidly modulated in response to retinoic acid in p19 embryonal carcinoma-cells. Dev Biol 148:165–173[CrossRef][Medline]
  59. Anderson NG 1993 Simultaneous activation of p90rsk and p70s6k S6 kinases by GH in 3T3–F442A preadipocytes. Biochem Biophys Res Commun 193:284–290[CrossRef][Medline]
  60. Marais RM, Hsuan JJ, McGuigan C, Wynne J, Treisman R 1992 Casein kinase II phosphorylation increases the rate of serum response factor binding site exchange. EMBO J 11:97–105[Medline]
  61. Hipskind RA, Buscher D, Nordheim A, Baccarini M 1994 Ras/map kinase-dependent and kinase-independent signaling pathways target distinct ternary complex factors. Genes Dev 8:1803–1816[Abstract/Free Full Text]
  62. Janknecht R, Hunter T 1997 Convergence of MAP kinase pathways on the ternary complex factor Sap1a. EMBO J 16:1620–1627[CrossRef][Medline]
  63. Janknecht R, Hunter T 1997 Activation of the Sap1a transcription factor by the c-jun N-terminal kinase (JNK) mitogen-activated protein kinase. J Biol Chem 272:4219–4224[Abstract/Free Full Text]
  64. Janknecht R, Nordheim A 1996 Regulation of the c-fos promoter by the ternary complex factor Sap-1a and its coactivator CBP. Oncogene 12:1961–1969[Medline]
  65. Shore P, Whitmarsh AJ, Bhaskaran R, Davis RJ, Waltho JP, Sharrocks AD 1996 Determinants of DNA-binding specificity of ets-domain transcription factors. Mol Cell Biol 16:3338–3349[Abstract]
  66. Whitmarsh AJ, Yang SH, Su MSS, Sharrocks AD, Davis RJ 1997 Role of p38 and JNK mitogen-activated protein kinases in the activation of ternary complex factors. Mol Cell Biol 17:2360–2371[Abstract]
  67. VanderKuur JA, Wang XY, Zhang LY, Campbell GS, Alevatto G, Billestrup N, Norstedt G, Carter-Su C 1994 Domains of the GH receptor required for association and activation of JAK2 tyrosine kinase. J Biol Chem 269:21709–21717[Abstract/Free Full Text]
  68. Gille H, Kortenjann M, Thomae O, Moomaw C, Slaughter C, Cobb MH, Shaw PE 1995 ERK phosphorylation potentiates Elk-1 mediated ternary complex formation and transactivation. EMBO J 14:951–962[Medline]
  69. Gong T-WL, Meyer DJ, Liao J, Hodgell CL, Campbell GS, Wang X, Billestrup N, Carter-Su C, Schwartz J 1998 Regulation of glucose transport and c-fos and egr-1 expression in cells with mutated or endogenous GH receptors. Endocrinology 139:1863–1871[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
M. Kawai, N. Namba, S. Mushiake, Y. Etani, R. Nishimura, M. Makishima, and K. Ozono
Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPAR{gamma} pathway
J. Mol. Endocrinol., January 1, 2007; 38(1): 19 - 34.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Huo, R. C. McEachin, T. X. Cui, N. K. Duggal, T. Hai, D. J. States, and J. Schwartz
Profiles of Growth Hormone (GH)-regulated Genes Reveal Time-dependent Responses and Identify a Mechanism for Regulation of Activating Transcription Factor 3 By GH
J. Biol. Chem., February 17, 2006; 281(7): 4132 - 4141.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. N. McLaughlin, M. R. Mazzoni, J. H. Cleator, L. Earls, A. L. Perdigoto, J. D. Brooks, J. A. S. Muldowney III, D. E. Vaughan, and H. E. Hamm
Thrombin Modulates the Expression of a Set of Genes Including Thrombospondin-1 in Human Microvascular Endothelial Cells
J. Biol. Chem., June 10, 2005; 280(23): 22172 - 22180.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Mostecki, B. M. Showalter, and P. B. Rothman
Early Growth Response-1 Regulates Lipopolysaccharide-induced Suppressor of Cytokine Signaling-1 Transcription
J. Biol. Chem., January 28, 2005; 280(4): 2596 - 2605.
[Abstract] [Full Text] [PDF]