| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Physiology and Pharmacology and Centre for Molecular and Cellular Biology University Queensland St. Lucia, Queensland, Australia 4072
| ABSTRACT |
|---|
|
|
|---|
Truncations of the proximal 1 kb of the egr-1 promoter revealed that a 374-bp region (-624 to -250) contributes about 80% of GH inducibility in 3T3-F442A cells and approximately 90% inducibility in CHO-K1 cells. This region contains three juxtaposed SRE (serum response element)/Ets site pairs known to be important for egr-1 activity in response to exogenous stimuli. Site-specific mutations of individual SRE and Ets sites within this region each reduced GH inducibility of the promoter. Use of these site-specific mutations in EMSA showed that disruption of either Ets or SRE sites abrogated ternary complex formation at the composite sites. DNA binding of ternary complexes, but not binary complexes, in EMSA was rapidly and transiently increased by GH. EMSA supershifts indicated these ternary complexes contained serum response factor (SRF) and the Ets factors Elk-1 and Sap-1a. Coexpression of Sap-1a and Elk-1 resulted in a marked increase in GH induction of egr-1 promoter activity, although transfection with expression vectors for either Ets factor alone did not significantly enhance the GH response. We conclude that GH stimulates transcription of egr-1 primarily through activation of these Ets factors at multiple sites on the promoter and that stabilization of ternary complexes with SRF at these sites maximizes this response.
| INTRODUCTION |
|---|
|
|
|---|
One model of GH-dependent differentiation is the adipose conversion of the murine embryonic preadipocyte lines, 3T3-F442A and Ob1771 (9, 10, 11). Unlike the majority of other GH-responsive cell culture models in use, these cells express endogenous receptor, and in this respect represent a useful system in which to study intracellular responses and downstream transcriptional events after a GH stimulus (9). The 3T3-F442A cell line was originally subcloned from the mouse 3T3 cell line based upon its ability to undergo rapid and extensive adipogenesis with appropriate differentiative stimuli (12). After growth arrest of these cells in culture, GH initiates a primed insulin-responsive state, which is characterized by a variety of morphological and biochemical changes in the cell, before terminal differentiation (13, 14). We and others have used this model to study transcriptional activation by GH of the immediate early gene c-fos and have identified the transcription factor binding sites, SIE (STAT), p62TCF, SRE, and AP-1, as inducing this response (4, 5, 16).
We have recently extended this study to an analysis of transcription factors directly regulated by GH in these cells, so as to obtain a profile of transcription factors that respond to GH (15, 17). This will allow us to understand how GH specifically regulates downstream target genes involved in GH-induced adipogenesis. Here we describe the induction of early growth response factor-1 (egr-1), one of 11 transcription factors shown in our laboratory to be regulated by GH (17). egr-1 belongs to a family of related immediate early response genes that encode DNA-binding proteins (18). The egr family of proteins contain a conserved zinc finger domain that confers binding specificity for GC-rich sequences. Regulation of egr-1 expression is similar in kinetics and specificity to the c-fos gene, which has led to the suggestion that these genes share common signaling pathways (18). We show here that this gene is transcriptionally activated by GH through juxtaposed SRE/Ets elements located between -425 and -300 and could find no evidence for functional STAT elements within 932 bases upstream of the start site.
| RESULTS |
|---|
|
|
|---|
|
|
Egr-1 was originally described as an immediate early gene activated following mitogenic stimuli (18, 25). We wished, therefore, to test whether the observed activation of egr-1 by GH correlated with a proliferative signal. We tested the effect of GH on DNA synthesis in confluent cell culture by assessing thymidine incorporation up to 30 h after GH stimulation. While there was a gradual decline in thymidine uptake with time, consistent with the confluent cells entering G0, no difference was observed between GH-stimulated and unstimulated cells (data not shown). This result is not consistent with a role for egr-1 induction by GH in a proliferative response.
GH Regulates Egr-1 Promoter Activity via Serum Response and Ets
Elements
To determine the cis elements responsible for
transactivation of the egr-1 gene, serial 5'-truncations of the egr-1
promoter were made upstream of the luciferase reporter gene, and these
constructs were transfected into 3T3-F442A preadipocytes or CHO-K1
cells and examined for GH responsiveness (Fig. 3
). GH increased the activity of a 932-bp
egr-1 promoter fragment (egr-1200) by 3.81 ± 0.27-fold in
3T3-F442A cells and 4.34 ± 0.13 fold in CHO-K1 cells. A 374-bp
region (-624 to -250) contributed about 80% of GH inducibility in
3T3-F422A cells. This region contains three functional serum response
elements and at least three Ets factor (p62TCF)-binding sites as
described elsewhere (Fig. 3A
) (37, 41). One or more of these sites have
been implicated in the response of this promoter to serum, antigen
receptor cross-linking in B lymphocytes (19), and pharmacological
stimuli (27). A similar pattern of activation by GH was obtained in
CHO-K1 cells (
80% inducibility between -624 to -250), suggesting
a common mechanism of egr-1 induction by GH (Fig. 3C
).
|
|
Analysis of the egr-1200 sequence revealed a lack of putative
STAT-binding sites based on loose sequence homology to STAT factor
consensus sequences over the 932 bases of promoter sequence. Two
degenerate sites were identified at positions -786 (ISRE, Ref. 29),
situated in the distal third of the promoter that exhibited no GH
inducibility, and -215 (APRF, Ref. 30) between CRE and SRE elements, a
region that exhibited no GH inducibility in 3T3-F442A cells (Fig. 4B
).
Gel shift analyses using these putative sites as probes yielded no
specific binding, nor could STAT proteins be immunologically identified
using a panel of commercially available STAT antibodies in EMSA (data
not shown). Thus, the proximal 1-kb egr-1 promoter appears to differ
from the c-fos promoter with respect to the absence of a
GH-responsive STAT site.
GH Induces Multiple Ternary Complex Factors to Activate Egr-1 and
c-fos Promoters
We wished to identify the factors binding to the GH-responsive Ets
and SRE elements in the Egr-1 promoter and to establish whether the
same factors previously identified to be responsible for GH-induced
c-fos activity were responsible for Egr-1 induction (4, 5, 16).
Gel shift analyses were performed on nuclear extracts from GH-treated
cells using oligonucleotide probes derived from the GH-responsive ets
and SRE elements of the Egr-1 promoter. Two or three major complexes
were observed with these probes, provided SRE and Ets sites were
present together (
Figs. 57![]()
![]()
). Binding of the high molecular weight
complex (B1), common to ES5, ES4, and ES3, was increased within 5 min
of GH stimulation and remained high relative to unstimulated cells for
up to 60 min. Use of mutant oligonucleotide probes with ES5 (EmS5 and
mES5) shows that the induced upper complex (B1, Fig. 5
) is dependent on both intact Ets and
SRE sites. The invariant complex B2 requires an intact SRE only and B3,
which is specific to ES5, requires an intact Ets site alone. Binding of
the same nuclear extracts to the composite SRE element from the
c-fos promoter exhibits a similar banding pattern and a
concomitant transient increase in a high mol wt complex (Fig. 5
). The
intensities of the GH-induced c-fos and egr SRE/Ets bands
relative to uninduced bands in the same lanes suggests that the
GH-induced complex bound to the fos SRE element is less stable than the
complex bound to the egr-1 element under these EMSA conditions. Mutant
oligonucleotides E5mS5 and mE5S5 do not allow the B1 complex to form,
suggesting that GH increases the stability of a ternary complex,
presumably through interaction between Ets-like factors, SRF,
and possibly other transcription factors.
|
|
|
Use of specific antibodies in gel shift identify the components of the
ternary complex as SRF, Elk-1, and Sap-1a (Fig. 7
). SRF antibody completely supershifts
both the SRF complex and the ternary complexes on ES5, ES4, and ES3,
suggesting that SRF occupies all of these sites. The SRF antibody also
supershifts the single band seen with an SRE1 (S1) oligonucleotide
probe (Fig. 7
). No complex was seen with a SRE 2 oligonucleotide (not
shown). While incubation of egr ES5, ES4, and ES3 with Elk-1 or Sap-1a
antibodies separately resulted in partial supershift of the B1 complex,
incubation with Elk-1 and Sap-1a antibodies together completely
supershifted these ternary complexes, suggesting that Elk-1 and/or
Sap-1a are bound in all ternary complexes in GH-stimulated 3T3-F442A
cells. We were unable to detect fli-1 using commercially available
supershift antibody to murine fli-1 (Fig. 7
).
To provide functional evidence for Elk-1 and Sap-1a involvement in
egr-1 transactivation, expression constructs for Sap-1a and Elk-1 were
transfected with the egr-1 reporter construct, and the effect of GH on
egr-1 promoter activity was determined by luciferase assay (Fig. 8
). There was a nonsignificant increase
in induction with both Elk-1 and Sap-1a coexpression, but when these
were combined, a marked and highly significant increase in GH
inducibility was seen (Fig. 8
).
|
| DISCUSSION |
|---|
|
|
|---|
In this study, mRNA levels of two immediate early genes, egr-1 and c-fos are shown to be increased by GH in quiescent preadipocytes. Both have been implicated in mitogenic responses to exogenous stimuli. However, rather than stimulating proliferation, several lines of evidence suggest that GH acts to specifically induce differentiation in these cells. First, the original characterization of 3T3-F442A cells by Green and Kehinde (33) showed that the cells must undergo cell cycle arrest for appropriate adipogenesis to occur. Adipogenesis is then dependent upon GH stimulation under the conditions described (34). In support of this, Sonenberg and co-workers showed that GH antagonized the mitotic effects of insulin (35) or serum (36) in proliferating 3T3-F442A cells and directly prevented G1-to-S phase transition. Second, thymidine uptake experiments (data not shown) demonstrated that 3T3-F442A preadipocytes do not undergo DNA replication after GH stimulation under the conditions used here to study egr-1 induction. Third, we have examined the cell cycle-dependent transcription factor E2F in these cells and observed no change in DNA binding in response to GH (15).
Both c-fos and egr-1 are known to be associated with a multiplicity of cellular processes. Thus egr-1 has been implicated in cell lineage determination (37, 38, 39, 40, 41), differentiation (22, 43, 45), growth arrest (42, 43, 44), and apoptosis (44, 46), while c-fos has been associated with similarly diverse processes (reviewed in Ref. 47). Although induction of egr-1 and c-fos in quiescent F442A cells appears to correlate with a differentiative rather than proliferative signal, establishment of a definitive role for egr-1 in adipogenesis remains to be determined. The apparent reliance of 3T3-L1 cells on peroxisome proliferator-activated receptor-related signals for growth arrest and subsequent commitment to adipogenesis (48, 49) provides a potential target of egr-1 and c-fos in this model of GH-induced differentiation.
Analysis of immediate early gene regulation provides a means of
identifying the transcription factors and associated proteins activated
as a direct result of the initial GH stimulus at the cell surface. In
this study we have shown that a 376-bp region of the egr-1 promoter is
responsible for about 80% of the observed GH response in 3T3-F442A
cells. This region contains three juxtaposed Ets/SRE elements (ES5,
ES4, and ES3) known to be responsible for induction of the egr-1
promoter in response to a variety of exogenous stimuli (19, 38, 45, 50, 51, 52, 53, 54, 55). The same region was also responsible for approximately 90% of
GH inducibility in CHO cells (Fig. 3C
), suggestive of a conserved
pathway for egr-1 activation by GH in different cell types.
Here we show that mutation of individual Ets and SRE binding elements
inhibited GH inducibility to varying degrees (Fig. 4
). Our analysis
indicates that multiple SRE/Ets sites on the egr-1 promoter, in
particular the Ets/SRE elements 3, 4, and 5, mediate GH activation.
There is no doubt that Ets factors are important in transactivation of
the egr-1 gene (19, 56). Interestingly, Elk-1, Sap-1a, and fli-1 are
able to bind to Ets sites on the egr-1 promoter in an SRF-independent
manner (56, 57), which is supported by our gel shift data for egrES5
(Fig. 6
). This ability is dependent upon the flanking sequences present
around the Ets boxes, as Elk-1, for example, is unable to bind to the
c-fos SRE or egrES1 sites without SRF but, like Sap-1a, is reportedly
able to bind to Ets 4 in the absence of SRF (19, 56, 57). Figure 6
suggests a higher affinity of the ternary complex for the SRE over Ets
or SRF bound alone (lanes 16). Accordingly, the primary role of SRF
in GH induction of egr-1 may be to stabilize DNA binding of Ets factors
to specific Ets sites so that Sap-1a and Elk-1, rather than SRF, are
critical targets for GH induction of egr-1. This is in contrast to the
c-fos promoter where SRF is critical for both recruitment
and stabilization of TCFs, as well as stimulation of the SRE (5, 28, 57, 58). It is nonetheless probable that SRF phosphorylation by
GH-activated p90rsk (59) does contribute to transactivation
by the SRF (60).
Northern blot analysis (Fig. 2
), transcriptional assays (see Ref. 5 and
Fig. 3
), and EMSA (see Ref.15 and Fig. 1
) all indicate that egr-1 is
more sensitive to GH stimulation than c-fos (AP-1). This is
likely due to the fact that the egr-1 promoter contains multiple
functional SRE elements, compared with c-fos, which carries
only one. In addition, gel shift analysis shows that Ets factors and
the ternary complex bind with relatively lower affinity to
c-fos SRE than egrES5 (Figs. 5
and 6
). This lower affinity
of Sap-1a and Elk-1 for the c-fos promoter may also
contribute toward the lesser sensitivity of c-fos to GH
stimulation.
Here we have shown by functional assay and by supershift analysis that
Elk-1 and Sap-1a form ternary complexes with SRE sites in both
c-fos and egr-1 promoters and that Ets factors constitute a
GH-responsive complex with the SRF. A recent report describes the
importance of Elk-1 in transactivating c-fos in response to
GH (16). Our EMSA supershift data, plus the strong synergism in
transactivating the Egr-1 1200 promoter when both Ets factors are
coexpressed together, indicates that both play a role in
vivo. One possibile explanation for the latter result is that
overexpression of both Elk-1 and Sap-1a aids the formation of
quaternary complexes with SRF (19, 57), and these may enhance induction
by maximizing the interaction with the transcriptional machinery as
previously suggested (19). Indeed, both Sap-1a and Elk-1 are present in
a high molecular weight complex in Fig. 7
, although it is not possible
to establish in this figure whether these factors make up ternary or
quaternary complexes. Sap-1a and Elk-1 are activated by a number of
signaling cascades involving ERK, JNK, and p38 kinase pathways
(61, 62, 63, 64, 65, 66). Whether these factors are activated by distinct or common
pathways is dependent upon the cell type studied. We (15) and others
(67) have previously reported the rapid activation of ERKs 1 and 2 by
GH in 3T3F442A cells, and ERK is able to mediate activation of Elk-1 by
phosphorylation of serine 383 in its transcriptional activation domain
(68). Indeed, Liao et al. (16) have recently shown that
Elk-1 overexpressed in CHO cells can be phosphorylated on serine 383 as
a result of GHR activation. This activation requires the JAK 2 binding
sequence on the receptor, box 1 (69). Sap-1a is also activated by ERKs,
through phosphorylation of serines 381 and 387 (62). In a recent report
studying a number of Ets-related factors, expressed in
vitro, fli-1 was shown to be able to form ternary complexes with
SRF on this SRE/Ets site (57). Given that Ets factors have novel
functions (57), recruitment of different Ets factors to promoters would
be one mechanism of tissue selectivity in transcriptional responses. We
have used fli-1 antibody in EMSA with egr-1 ES4 (Fig. 7
) and
c-fos SRE (unpublished) oligonucleotides but have been
unable to obtain any significant supershift. This indicates either the
amount of fli-1 is very low or absent or that fli-1 is not activated by
GH in these cells.
AP-1 and STAT factors have been shown to contribute to the c-fos response to GH (4, 5). Two putative AP-1 sites are present in the distal third of the egr-1 promoter. One of these sites resides within an unresponsive region of the promoter while the other lies at the extreme 5'-end of the GH-responsive region. While Ets sites contribute the majority of this response in this region, based on our mutagenic analysis, we cannot exclude the possibility that AP-1 has some effect on the promoter. However, given the time course of message induction, it is unlikely that this site would contribute to the initial transactivation by GH.
There appears to be no STAT site in the proximal 1 kb of the egr-1 promoter, as ascertained by sequence analysis. Known STAT-binding sites from the literature, including degenerate consensus sequences such as TTN5AA, were used in this search. Two degenerate sites that exhibited closest homology (CAGTTTTCCCGGTGAC at -786, and GGCTTTCCAGGAGCCT at -215), plus one degenerate site within SRE3 exhibited no specific binding in EMSA. The absence of a STAT site in the egr-1 promoter would constitute an important difference between c-fos and egr-1 regulation and would further emphasize the use of multiple Ets/SRE sites within the egr-1 promoter. A more extensive analysis of egr-1 promoter activity in the presence of exogenous STAT factors should establish whether hitherto undefined STAT sites exist in this promoter or whether STATs interact through other factors to influence egr-1 transcription.
We have shown that approximately 80% of the GH inducibility of Egr-1
in 3T3-F442A cells resides within a 376-bp region, encompassing ES3,
ES4, and ES5 elements, within which Ets sites have a prominent role
(Fig. 5
). The proximal 116 bp of the egr-1 promoter also provide
significant inducibility in 3T3-F442A cells, and this region contains
two additional SREs (S1 and S2, Fig. 4
) that contribute to egr-1
inducibility in other cell types (50, 52, 53, 54). However, these sites do
not form ternary complexes in 3T3F442A cells, and we find SRE 2 is
unable to bind in EMSA, although SRE 1 does bind to SRF (Fig. 7
). We
propose that SRE 1 is most likely responsible for the residual GH
inducibility.
In conclusion, this study has directly implicated egr-1 for the first time in GH-mediated signaling and shown that Elk-1 and Sap-1a are proximal components of its GH-induced transcription. Our data indicate that GH utilizes multiple SRE/Ets sites for rapid and effective induction of this important immediate early gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
All antibodies were purchased from Santa Cruz Biotechnologies Inc. (Santa Cruz, CA). The Luciferase reporter gene assay, constant light signal kit was purchased from Boehringer Mannheim (Mannheim, Germany).
DNA Constructs and Oligonucleotides
A 1.2-kb egr-1 promoter fragment containing 932 bp upstream of
the transcription start site was a gift of Dr. S. B. McMahon (19).
The 1.2-kb ClaI/SalI fragment was subcloned into
pBluescript and transferred into SacI/XhoI sites
of the luciferase minimal reporter vector, pGLBasic (Promega, Madison,
WI). All subsequent mutageneses were performed on this construct
(egr-1200). Four 5'-deletion constructs were created using available
restriction sites within the promoter and the multiple cloning site of
pGLBasic. The promoter-internal restriction sites used were: egr-624,
SfcI; egr-385, BamHI; egr-250, SmaI; and egr-116,
EagI. Site-directed mutagenesis was performed using the
Quickchange method (Stratagene, La Jolla, CA). All mutants were
verified by sequencing, and at least two separate CsCl preparations of
plasmid DNA were used in transfection assays. Elk-1 and Sap-1a
expression vectors were a generous gift from Professor R. Janknecht and
have been described previously (20, 21).
Double-stranded oligonucleotides for site-directed mutagenesis and EMSA
experiments were synthesized by the CMCB oligonucleotide facility
(University of Queensland, Australia). The sequences used in EMSA
experiments were as follows: egr-1,
5'-CGTTCCGAGAGCGGGGGCGAGCGTGAAAG; egrES5, 5'-CCGA
CCCGGAAACGCCATATAAGGAGCAGG corresponding to -420 to -389;
egrES4, 5'-CCGCCGGAACAGACCTTATTTGGGCAGC corresponding to 381
to 353; egrES3, 5'-TTGGGCAGCGCCTTATATGG AGTGGCCCAA
TATGGCCCTGCCGCTTCCGGCTCTGGGAGGAGGGGCGAGC corresponding to -350 to
-297; and egrS1, 5'-GCTTCCTGCTTCCCATA TATGGCCATGTACGTC
corresponding to -95 to -61. Mutant oligonucleotides used to produce
mutant promoter constructs are as follows with mutations in
lowercase: mCRE,
5'-GGATGGGAGGGCTTCtgGTCtCTCCGCTCCTCC; mEts3,
5'-CCGCTTCCGGCTCTGtGcGcAGGGGCGAGCG; mSre3, 5'-GGG
CAGCGCCTTAagTGGAGTGGCCC; mEts4, 5'-GGAAGGATCCCCCGCgTt
tAACAGACCTTATTTGGGC; mSre4, 5'-CGCCGGAACAGACCTTATTaaT
GCAGCGCCTTATATGGA; mEts5, 5'-CCGACCCGcAtAtGCCATATAAG
GAGCAGG; mSre5, 5'-CCGACCCGGAAACGCCATATgAaGAGCAGG. Mutant
oligonucleotides used to produce mutant promoter constructs are shown
in Fig. 4A
.
Cell Culture
Early passage 3T3-F442A preadipocytes were kindly provided by
Dr. Howard Green (Harvard University, Boston, MA) and maintained in
DMEM supplemented with 10% newborn calf serum. Cells, grown to
appropriate confluency, were washed in PBS and incubated in serum-free
DMEM for 3 or 16 h before hormone treatment. Cells indicated as
100% confluent were allowed to reach 100% confluence and incubated
for a further 16 h before serum starvation. Two-day differentiated
cells were obtained by incubating 100% confluent cells in conditioned
differentiation medium (13) for 48 h before serum starvation.
Cells were not used for experiments after passage 12.
CHO K1 cells were purchased from ATCC (Manassas, VA; CCL-61) and cultured in Hams F12-supplemented 10% Serum Supreme. All cell cultures were maintained in a humidified 5% CO2 incubator at 37 C.
EMSA
Confluent 3T3-F442A cells were serum starved for 3 h
before stimulation with 2.2 nM hGH for 30 min, and nuclear
extracts were prepared from these cells over a period of 4 h, as
previously described (15). Nuclear extracts (510 µg total protein)
were incubated in the presence of 0.51.0 ng radiolabeled
oligonucleotide probe in binding buffer (4 µg BSA, 2 µg poly dI-dC,
12 mM HEPES (pH 7.9), 12% glycerol, 0.12 mM
EDTA, 0.9 mM MgCl2, 0.6 mM
dithiothreitol, 0.6 mM phenylmethylsulfonyl fluoride, and
1.2 µg/ml aprotinin and leupeptin). For supershifting experiments the
nuclear extracts were incublated overnight at 4 C with 2 µg of
appropriate antibody, and then incubated at room temperature for 15 min
with probe. Binding reactions were electrophoresed at 150 V for
approximately 3 h in 6% polyacrylamide gels at 4 C, and then
dried and analyzed on a GS-363 Molecular Imager (Bio-Rad, Regents Park,
NSW, Australia). Polyclonal antibodies used in gel shifts were
purchased from Santa Cruz Biotechnology Inc. (sc-189 X for Egr-1,
sc-335 X for SRF, sc-355 X for Elk-1, sc-1426 X for Sap-1a, and sc-356
X for Fli-1). To equalize loadings in the EMSA, a prior run was
undertaken with Oct-1 probe, and then nuclear extracts were added into
the binding mix in proportion to the Oct-1 signal for subsequent EMSA
with the Ets/SRF (ES) probes (15).
Northern Blot Analysis
Total cytoplasmic RNA was prepared using the Pharmacia RNA
Extraction Kit according to the manufacturers instructions. The
resultant pellet was resuspended in 10 µl H2O and
incubated for 15 min at 55 C with 5 µl formaldehyde, and then 7 µl
formamide in 1x 3-(N-morpholino)-propanesulfonic acid
gel buffer was added and the sample was applied to a 1.2%
agarose, 17.8% formaldehyde gel. After electrophoresis the gel was
washed and the RNA transferred to Hybond-N membrane (Amersham, Ryde,
NSW, Australia). After UV fixing, membranes were prehybridized in 5x
SSPE, 50% formamide, 5x Denhardts, 1% SDS, and 100 µg/ml herring
sperm DNA for 3 h at 42 C. A 550-bp Egr-1 cDNA fragment from
within exon 2 of the Egr-1 gene was PCR amplified from genomic DNA
isolated from a murine embryonic stem cell line and cloned into the
plasmid vector pBluescript. cDNA probes were labeled with
[
-32P]dCTP by the random priming method (15) and
incubated with membranes at 42 C for 16 h. Membranes were then
washed in 1x SSPE, 1% SDS at 65 C, and bound probe was visualized by
autoradiography and analyzed by densitometry (Bio-Rad, GS-700
densitometer, Bio-Rad Laboratories, Richmond, CA). Hybridizations were
performed on all filters simultaneously with identical probes and
washing conditions. Equivalent amounts of RNA were loaded on each blot
as confirmed by control 18S probes.
Receptor Binding Assay
3T3-F442A fibroblasts were grown to 60% confluence, 100%
confluence, or 2 days differentiation in 90-mm dishes. Cells were
incubated in serum-free media (DMEM only) for 3 h at 37 C followed
by incubation in 5 ml physiological buffer (25 mM Tris, 130
mM NaCl, 2 mM MgCl2, 0.1% BSA, pH
7.4) and 7 x 105 cpm [125I]hGH in the
presence or absence of 10 µg (excess) unlabeled bovine GH for 16
h at 4 C (22). Cells were washed in PBS and lysed with 2 ml 0.1
M NaOH before counting. Binding was normalized to cell
protein determined by Bradford dye assay.
[3H]Thymidine Incorporation
3T3-F442A cells were grown to confluence in six-well plates,
maintained for a further 16 h, serum starved for 3 h in DMEM
followed by stimulation with 2.2 nM hGH or DMEM alone in
the presence of [3H]thymidine (15 µCi) for the periods
shown. Cells were then washed twice with PBS and lysed in 0.2
M NaOH with shaking for 15 min. Lysates were collected and
counted by scintillation counter (CA 1900; Packard Instruments,
Meriden, CT).
Cotransfections and Luciferase Assays
Seventy percent confluent CHO K1 cells were seeded into six-well
plates at 2.2 x 105 cells per well 24 h before
transfection. After aspiration of the medium, 160 µl of transfection
reagent-DNA mixture containing 2 µg of reporter construct, 1 µg of
pECE-rabbit GHR (rGHR), 0.5 µg ß-gal reporter, and 20 µl
of DOTAP in HBS (20 mM HEPES, 150 mM NaCl, pH
7.4) were added to each well and mixed gently for 30 sec, and then 3 ml
of Hams F12 containing 0.25% Serum Supreme were added to each well.
After incubation for 40 h, transfected cells were treated with 9
nM recombinant human GH for a further 5.5 h, at
which time the cells were harvested for luciferase activity. All
constructs were transfected in triplicate for each experiment, and all
experiments were repeated a minimum of three times. Luciferase
activities were normalized to ß-galactosidase activity before
calculating relative fold induction values reported in
Results. ß-Galactosidase was measured by ELISA assay
using o-nitrophenyl ß-D-galactopyranoside (Boehringer
Mannheim, Mannheim, Germany).
3T3-F442A cells were transfected by electroporation at 150 V with a capacitance of 960 µFarads using the Bio-Rad Gene Pulser. Approximately 1.5 x 106 cells were electroporated in 100 µl of DMEM containing 10% newborn bovine serum and immediately transferred into 12 ml of DMEM plus 10% newborn bovine serum and evenly distributed into six-well plates. Routinely, 12 µg of appropriate reporter construct and 1 µg of pECE-rGHR were electroporated in all transfections except for the overexpression study, in which expression constructs for Sap-1a or Elk-1 were cotransfected. After cells reached 100% confluence, they were serum starved for 16 h in DMEM followed by stimulation with 23 nM of recombinant human GH for 5 h. Each construct was quantitated in six wells without and six wells with GH for each transfection. A minimum of three separate transfections (usually five) were used to obtain mean values for each construct.
Reporter Assay
Cells were harvested and lysed in 100 µl of lysis buffer (0.5
M HEPES, pH 7.4, 2% Triton N 101, 1 mM
MgCl2, 1 mM CaCl2) and combined
with 200 µl of luciferase reporter gene assay constant light signal
reagent according to Packards specifications. Light emission was
measured using a 1450 Microbeta Trilux liquid scintillation and
luminescence counter (Wallac, Turku, Finland). Results for individual
constructs are expressed as a percent of the GH induction seen with the
Egr-1 1200 promoter for each transfection.
Statistics
ANOVA was used for multiple comparisons, with Dunnetts post
hoc test used for comparison of all values with the Egr-1 1200 promoter
construct. Significance level was set at P <
0.05.
| FOOTNOTES |
|---|
1 Current Address: Sir Alistair Currie CRC Laboratories, Molecular
Medicine Centre, University of Edinburgh, Edinburgh, UK, EH4 2XU. ![]()
Received for publication April 29, 1998. Revision received December 30, 1998. Accepted for publication January 5, 1999.
| REFERENCES |
|---|
|
|
|---|
and other
extracellular signaling proteins. Science 264:14151421This article has been cited by other articles:
![]() |
M. Kawai, N. Namba, S. Mushiake, Y. Etani, R. Nishimura, M. Makishima, and K. Ozono Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPAR{gamma} pathway J. Mol. Endocrinol., January 1, 2007; 38(1): 19 - 34. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Huo, R. C. McEachin, T. X. Cui, N. K. Duggal, T. Hai, D. J. States, and J. Schwartz Profiles of Growth Hormone (GH)-regulated Genes Reveal Time-dependent Responses and Identify a Mechanism for Regulation of Activating Transcription Factor 3 By GH J. Biol. Chem., February 17, 2006; 281(7): 4132 - 4141. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. McLaughlin, M. R. Mazzoni, J. H. Cleator, L. Earls, A. L. Perdigoto, J. D. Brooks, J. A. S. Muldowney III, D. E. Vaughan, and H. E. Hamm Thrombin Modulates the Expression of a Set of Genes Including Thrombospondin-1 in Human Microvascular Endothelial Cells J. Biol. Chem., June 10, 2005; 280(23): 22172 - 22180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mostecki, B. M. Showalter, and P. B. Rothman Early Growth Response-1 Regulates Lipopolysaccharide-induced Suppressor of Cytokine Signaling-1 Transcription J. Biol. Chem., January 28, 2005; 280(4): 2596 - 2605. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Vickers, A. Kasza, I. A. Kurnaz, A. Seifert, L. A. H. Zeef, A. O'Donnell, A. Hayes, and A. D. Sharrocks Ternary Complex Factor-Serum Response Factor Complex-Regulated Gene Activity Is Required for Cellular Proliferation and Inhibition of Apoptotic Cell Death Mol. Cell. Biol., December 1, 2004; 24(23): 10340 - 10351. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-C. Leung, G. Johannsson, G. M. Leong, and K. K. Y. Ho Estrogen Regulation of Growth Hormone Action Endocr. Rev., October 1, 2004; 25(5): 693 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hjoberg, L. Le, A. Imrich, V. Subramaniam, S. I. Mathew, J. Vallone, K. J. Haley, F. H. Y. Green, S. A. Shore, and E. S. Silverman Induction of early growth-response factor 1 by platelet-derived growth factor in human airway smooth muscle Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L817 - L825. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Colao, D. Ferone, P. Marzullo, and G. Lombardi Systemic Complications of Acromegaly: Epidemiology, Pathogenesis, and Management Endocr. Rev., February 1, 2004; 25(1): 102 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Shang and M. J. Waters Constitutively Active Signal Transducer and Activator of Transcription 5 Can Replace the Requirement for Growth Hormone in Adipogenesis of 3T3-F442A Preadipocytes Mol. Endocrinol., December 1, 2003; 17(12): 2494 - 2508. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamazaki, H. Kubota, M. Nozaki, and K. Nagata Transcriptional Regulation of the Cytosolic Chaperonin {theta} Subunit Gene, Cctq, by Ets Domain Transcription Factors Elk-1, Sap-1a, and Net in the Absence of Serum Response Factor J. Biol. Chem., August 15, 2003; 278(33): 30642 - 30651. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell, K. M. H. Doyle, I. Gonzales-Robayna, C. Pipaon, and J. S. Richards Egr-1 Induction in Rat Granulosa Cells by Follicle-Stimulating Hormone and Luteinizing Hormone: Combinatorial Regulation By Transcription Factors Cyclic Adenosine 3',5'-Monophosphate Regulatory Element Binding Protein, Serum Response Factor, Sp1, and Early Growth Response Factor-1 Mol. Endocrinol., April 1, 2003; 17(4): 520 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mora-Garcia, J. Cheng, H. N. Crans-Vargas, A. Countouriotis, D. Shankar, and K. M. Sakamoto Transcriptional Regulators and Myelopoiesis: The Role of Serum Response Factor and CREB as Targets of Cytokine Signaling Stem Cells, March 1, 2003; 21(2): 123 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xi and G. J. Kersh Induction of the Early Growth Response Gene 1 Promoter by TCR Agonists and Partial Agonists: Ligand Potency Is Related to Sustained Phosphorylation of Extracellular Signal-Related Kinase Substrates J. Immunol., January 1, 2003; 170(1): 315 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells Blood, December 15, 2002; 100(13): 4454 - 4461. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. SHIN, J. KO, J.-S. CHANG, D. S. MIN, C. CHOI, S. S. BAE, M. J. KIM, D. S. HYUN, J.-H. KIM, M. Y. HAN, et al. Negative regulatory role of overexpression of PLC{gamma}1 in the expression of early growth response 1 gene in rat 3Y1 fibroblasts FASEB J, October 1, 2002; 16(12): 1504 - 1514. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Duan, M. Ito, Y. Park, E. T. Maizels, M. Hunzicker-Dunn, and J. L. Jameson GnRH Regulates Early Growth Response Protein 1 Transcription Through Multiple Promoter Elements Mol. Endocrinol., February 1, 2002; 16(2): 221 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bernal-Mizrachi, W. Wen, S. Srinivasan, A. Klenk, D. Cohen, and M. A. Permutt Activation of Elk-1, an Ets transcription factor, by glucose and EGF treatment of insulinoma cells Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1286 - E1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, J. Chai, G. Azhar, P. Sheridan, A. M. Borras, M. C. Furr, K. Khrapko, J. Lawitts, R. P. Misra, and J. Y. Wei Early Postnatal Cardiac Changes and Premature Death in Transgenic Mice Overexpressing a Mutant Form of Serum Response Factor J. Biol. Chem., October 19, 2001; 276(43): 40033 - 40040. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guillemot, A. Levy, M. Raymondjean, and B. Rothhut Angiotensin II-induced Transcriptional Activation of the Cyclin D1 Gene Is Mediated by Egr-1 in CHO-AT1A Cells J. Biol. Chem., October 12, 2001; 276(42): 39394 - 39403. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. N. Shoba, M. Newman, W. Liu, and W. L. Lowe Jr. LY 294002, an Inhibitor of Phosphatidylinositol 3-Kinase, Inhibits GH-Mediated Expression of the IGF-I Gene in Rat Hepatocytes Endocrinology, September 1, 2001; 142(9): 3980 - 3986. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guha, M. A. O'Connell, R. Pawlinski, A. Hollis, P. McGovern, S.-F. Yan, D. Stern, and N. Mackman Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor {alpha} expression by inducing Elk-1 phosphorylation and Egr-1 expression Blood, September 1, 2001; 98(5): 1429 - 1439. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Kaulsay, T. Zhu, W. F. Bennett, K.-O. Lee, and P. E. Lobie The Effects of Autocrine Human Growth Hormone (hGH) on Human Mammary Carcinoma Cell Behavior Are Mediated via the hGH Receptor Endocrinology, February 1, 2001; 142(2): 767 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhu and P. E. Lobie Janus Kinase 2-dependent Activation of p38 Mitogen-activated Protein Kinase by Growth Hormone. RESULTANT TRANSCRIPTIONAL ACTIVATION OF ATF-2 AND CHOP, CYTOSKELETAL RE-ORGANIZATION AND MITOGENESIS J. Biol. Chem., January 21, 2000; 275(3): 2103 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mora-Garcia and K. M. Sakamoto Granulocyte Colony-stimulating Factor Induces egr-1 Up-regulation through Interaction of Serum Response Element-binding Proteins J. Biol. Chem., July 14, 2000; 275(29): 22418 - 22426. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |