| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Cell Biology and Biochemistry (A.J.R., S.C.W.,
D.M.S.) and Southwest Cancer Center (S.C.W.) Texas Tech
University Health Science Center Lubbock, Texas 79430
Department of Biochemistry University of Louisville School of
Medicine (B.J.C) Louisville, Kentucky 40292
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Recently it has been suggested that steroidogenic factor-1 (SF-1), an orphan nuclear receptor, may play important roles in the regulation of StAR transcription (10, 11, 12, 13, 14). SF-1 has been shown to play a role in the transcriptional regulation of many genes involved in steroidogenesis, including steroid hydroxylase genes (15, 16, 17), as well as LHß (18), the ACTH receptor (19), and the GnRH receptor (20). SF-1 null mice have also revealed a role for SF-1 in the development of the gonads and adrenal glands (11, 21). Combined, these reports suggest an important role for SF-1 in the regulation of steroidogenesis at a number of levels. However, there are many lines of evidence suggesting that SF-1, although important for StAR transcription, may not be a key transcription factor in the acute regulation of the StAR gene in response to cAMP stimulation. For example, transfection studies in nonsteroidogenic cell lines have shown that SF-1 is capable of transactivating a StAR reporter (13, 14). Yet, when multiple SF-1-binding sites were mutated in the mouse StAR promoter and analyzed in MA-10 cells, the cAMP responsiveness (fold activation) from the promoter was not disrupted (10). These data indicate that SF-1 is required for proper activation of the StAR promoter but may not confer cAMP responsiveness in steroidogenic cells. These findings have led us to examine other transcription factors, whose activity is acutely regulated in response to trophic hormone in steroidogenic tissues, for their involvement in the transcriptional regulation of the StAR gene.
Recent studies in our laboratory have suggested that the CCAAT/enhancer
binding protein (C/EBP) family of basic leucine zipper transcription
factors may be involved in the regulation of steroidogenesis in Leydig
cells. Thus far, six members of the C/EBP family have been identified:
C/EBP
, C/EBPß, C/EBP
, C/EBP
, C/EBP
(Ig/EBP), and C/EBP
(CHOP; Ref. 22). C/EBPß is the only member of the C/EBP family
expressed in unstimulated primary Leydig cell cultures and MA-10 cells
(A. J. Reinhart, D. Nalbant, S. C. Williams, and D. M.
Stocco, unpublished observation) and C/EBPß levels increase in MA-10
cells by 4.5-fold upon 4 h treatment with 1 mM
(Bu)2cAMP (23). It has also been shown that C/EBPß
activity can be altered, presumably by protein kinase A (PKA), upon
treatment with cAMP analogs (24, 25, 26, 27). Therefore, C/EBPß was examined
as a candidate transcription factor in the transcriptional regulation
of the StAR gene.
In the present study, we examined the StAR promoter for potential binding sites for transcription factors that may be involved in the regulation of StAR transcription. Two putative C/EBP response elements were identified; one of these sites was shown to bind to C/EBPß, and we determined that the other site was a low-affinity protein-binding site. Functional analysis revealed that mutation of these sites decreased basal and cAMP-stimulated activity from the StAR promoter in MA-10 cells. Furthermore, we report that SF-1-dependent transactivation of the StAR promoter in COS-1 cells required these putative C/EBP response elements, suggesting that C/EBPß and SF-1 may interact to regulate StAR gene transcription.
| RESULTS |
|---|
|
|
|---|
|
DNAse I footprint analysis of the mouse StAR promoter from
-66 to -254 was performed to identify possible transcription
factor-binding sites in this region. A schematic diagram of the
radioactive probe used in the footprint analysis is presented in Fig. 2A
. Addition of 25 and 50 µg of nuclear
extract prepared from (Bu)2cAMP-stimulated MA-10 cells
revealed a broad region of protection interspersed with two DNAse
I-hypersensitive sites, indicated by arrows (Fig. 2B
). The
protected regions included the C1 site and the SF-1 element at -135
and are marked by vertical bars adjacent to the sequence
(Fig. 2B
).
|
|
|
and C/EBPß share binding site preferences (22, 33),
and have both been shown to be expressed in reproductive tissues (34, 35), we examined their expression in MA-10 cells. By Western
analysis, we have determined that C/EBPß, but not C/EBP
, could be
detected in MA-10 cells, and that MA-10 nuclear extracts did not
contain C/EBP
-binding activity as evidenced by EMSA using the C1
oligo (data not shown).
C/EBP DNA Elements Are Required for Activation of the StAR
Promoter
To assess the role of the C1 and C2 sites in StAR
promoter function, we compared the activity in MA-10 cells of the
wild-type StAR promoter to mutants carrying changes in
either or both of these sites. The mutations were tested in the context
of a 966-bp fragment of the StAR gene that had previously
been shown to support basal and cAMP-inducible expression in MA-10
cells (10). The same mutations in the C1 and C2 sites used in the EMSAs
were introduced into the StAR promoter either alone or in
combination. Each construct was transfected into MA-10 cells, and
luciferase activities were measured in untreated cells and cells
incubated in the presence of (Bu)2cAMP for 6 h. The
wild-type promoter construct (-966 StAR Luc) displayed low basal
activity, which was stimulated 6.2-fold by (Bu)2cAMP (Fig. 5
). Mutation of either the C1 or C2 site
alone (-966 StAR C1m and -966 StAR C2m) resulted in significantly
lower basal activities, 20% and 15% of the wild-type value,
respectively. Mutation of both the C1 and C2 sites (-966 StAR C1m,
C2m) resulted in a further decrease in basal promoter activity to 10%
of the wild-type activity; however, the cAMP responsiveness of the
promoter was again relatively unchanged (Fig. 5
). Although the absolute
cAMP-induced activities of the mutated reporters was lower than the
wild-type promoter, the fold activation of all four reporters was
similar. These data indicate that the C1 and C2 sites are important for
high-level basal expression from the StAR promoter.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The upstream element, C1, is strongly bound by recombinant C/EBPß and
by C/EBPß in MA-10 nuclear extracts and appears to be the primary
site through which C/EBPß activates the StAR promoter. We
have considered two putative, nonexclusive functions for C/EBPß in
StAR gene regulation, namely, the activation of
StAR gene expression during development and the rapid
activation of StAR transcription in response to trophic
hormone. The observation that mutation of the C1 site did not abolish
cAMP induction (fold activation) of the StAR promoter
suggests that either C/EBPß does not mediate the cAMP-dependent
regulation of StAR gene expression, at least during the
acute phase of stimulation, or (Bu)2cAMP stimulation of
Leydig cells does not completely mimic all of the effects of hormone
stimulation. However, mutating the C1 site decreased basal level
activity from the StAR promoter to 20% of the wild-type
level. This finding, combined with our previous observation that both
C/EBPß and StAR protein levels increase during Leydig cell
development (23), indicates a role for C/EBPß in developmental
regulation of StAR gene expression. In support of a broad
role of C/EBPß in the developmental regulation of steroidogenesis,
analysis of the promoter regions of genes encoding steroidogenic
enzymes in Leydig cells, such as 3ß-hydroxysteroid dehydrogenase
(3ßHSD), cytochrome P450 side-chain cleavage
(P450scc), and 17,
-hydroxylase (CYP17), has
revealed the presence of putative C/EBP sites (our unpublished
observation), although functional studies of these sites are lacking at
present. Therefore, C/EBPß may participate in the regulation of
multiple Leydig cell genes during development.
Our mutational analysis also identified a second element (C2) that is
required for high-basal level expression of the StAR
promoter. Although the C2 site is not as highly conserved as the C1
site, it appears to be at least equally important for StAR
gene transcription as its mutation decreased promoter activity to 15%
of wild-type levels. We initially considered the C2 site to be a
binding site for C/EBPß based on the presence of an almost perfect
half-site in the mouse, porcine, and human genes, and a 7 of 10 match
to the consensus C/EBP binding site in the mouse gene. However, the C2
site complexed weakly with nuclear extract from MA-10 cells and was
unable to compete for C/EBP binding to the C1 element. In addition,
mutation of the C2 site in the StAR promoter had only a
slight negative effect on transactivation by C/EBPß in COS-1 cells.
These data could be interpreted in two ways. First, the C2 site may not
be a bona fide C/EBPß binding site in vivo,
instead serving as the binding site for another, as yet unidentified,
protein. Some candidate proteins might be members of the CCAAT
box-binding protein families, such as the constitutively expressed
nuclear factor-Y [NF-Y; a heterotrimer of NF-YA, NF-YB, and NF-YC (39, 40)]. Second, the C2 site may be a weak binding site for C/EBPß, and
efficient usage of this site by C/EBPß may require the presence of
cooperating factors such as SF-1. In support of this hypothesis, a
cryptic C/EBP-binding site is present in the promoter of the
liver-specific cytochrome P450 2D5 (2D5) gene as part of a
bi-partite binding site for C/EBPß and Sp1 (41). C/EBPß is unable
to bind to, or to activate transcription through, this element in the
absence of Sp1, and the selective interactions with Sp1 explain the
difference in the ability of C/EBPß and C/EBP
to activate the
2D5 promoter (41). Additional studies are required to
identify the proteins that bind the C2 site in vivo and
whether C/EBPß must interact with other proteins to bind to C2.
We (in this report) and others (14) have demonstrated that exogenously expressed SF-1 is capable of transactivating the StAR promoter in COS-1 cells. However, SF-1-dependent activation was diminished or lost when either one or both the C1 or C2 sites were mutated, despite the fact that these mutations would not be expected to significantly affect SF-1 binding to its cognate sites. Furthermore, we have shown that SF-1 and C/EBPß associate in vitro. We interpret these results to indicate that SF-1 physically interacts with C/EBPß and possibly other proteins bound to these sites and that these interactions are a prerequisite for SF-1 action. These interactions could be direct protein-protein interactions or may involve the recruitment of accessory factors such as coactivators to the promoter. In regard to the former possibility, C/EBPß has been shown to functionally and/or physically interact with numerous members of the steroid hormone superfamily, including the estrogen receptor (42), glucocorticoid receptor (43), and hepatocyte nuclear factor-4 [HNF4 (44)]. SF-1 has also been shown to interact with a number of proteins that may be involved in the transcriptional regulation of the StAR gene, including the steroid receptor coactivator-1 [SRC-1/NCoA-1 (45, 46)] and DAX-1 [for dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (47)]. The requirement of intact C1 and C2 sites for efficient SF-1-mediated transactivation of the StAR promoter and the physical interaction observed between SF-1 and C/EBPß distinguishes the StAR promoter as an important model with which to investigate how transcription factors may cooperate to regulate transcription.
A central unanswered question surrounding the StAR gene is the mechanism by which the promoter responds acutely to trophic hormone stimulation and, more specifically, how the interactions between transcription factors bound to the StAR promoter affect cAMP-dependent regulation of the StAR gene. We have shown in this report that the complex of proteins bound to the C1 site is relatively unaffected by (Bu)2cAMP stimulation. We have also reported that disruption of the C1 and C2 sites interfered with basal (unstimulated) transcription of the StAR gene, and that these sites were required for SF-1-dependent transcription from the StAR promoter. Additionally, it has been shown that StAR transcriptional activation does not require de novo protein synthesis (10). Collectively, these findings indicate that C/EBPß (and/or other proteins) bound to the C1 and C2 sites interacts with SF-1 regardless of cAMP stimulation, and that cAMP stimulation regulates a step distal to the formation of this complex, which, in turn, may activate transcription from the StAR promoter. There are several nonexclusive mechanisms by which this may transpire. For example, upon stimulation with trophic hormone, increased cAMP levels cause the release of the catalytic subunit of PKA, which can enter the nucleus (48). Posttranslational modifications have been shown to activate C/EBPß independently from its ability to bind DNA (25), and a specific target residue for PKA has been identified in the C/EBPß basic region (27). This posttranslational modification of C/EBPß may activate transcription either directly through C/EBPß or through recruitment of coactivators to the promoter. An alternative model involves the orphan nuclear receptor DAX-1. DAX-1 has been shown to be a powerful repressor of StAR promoter activity, through binding to a hairpin loop structure located proximal to the C2 site (49). Our data demonstrate that similar complexes, which include C/EBPß, are formed on the C1 site regardless of cAMP stimulation. SF-1 and other factors may also bind to the promoter in the absence of cAMP stimulation, which should result in a high level of basal transcription from the promoter. Since DAX-1 has been shown to repress StAR, its presence on this promoter could effectively inhibit transcription, even in the presence of positive factors such as SF-1, Sp1, and C/EBPß. Upon cAMP stimulation, DAX-1 may be displaced from the promoter, or disassociated from corepressors, allowing high levels of transcription from the StAR promoter. DAX-1 null mice have recently been described, and steroidogenesis appears to be relatively normal (50). The observed phenocopy appears to be less severe than expected, given that mutations in the DAX-1 gene in humans results in X-linked, adrenal hypoplasia congenita (AHC). The precise role of DAX-1 in the regulation of the StAR gene remains a most interesting question, which clearly requires additional study and a more detailed analysis of the DAX-1 null mice. Work is currently underway to study in more detail the direct interaction between C/EBPß and SF-1 and to study whether transcriptional coactivators and repressors are involved in SF-1- or C/EBPß-mediated regulation of the StAR gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and Construction of StAR Promoter
Mutants
pMEX C/EBPß has been described previously (51), and the SF-1
expression plasmid was a generous gift of Dr. Keith Parker (University
of Texas, Southwestern Medical School, Dallas, TX).
Site-directed mutagenesis was performed to mutate both of the C/EBP-binding sites in the StAR promoter. The Gene Editor kit (Promega Corp., Madison, WI) was used to introduce mutations into p-966 Luc (described in Ref. 10); referred to in this study as Star -966) to eliminate the C/EBP elements such that the mutated sequences would contain a novel SalI restriction site. The oligonucleotides used to introduce the mutations were as follows (mutations are underlined):
C1m: CACTGCAGGATGGTCGACTCATTCCATCCT
C2m: CTTGACCCTCTGGTCGACGACTGATGACTT
C1,2m: GCACTGCAGGATGGTCGACTCATTCCATCCTT - GACCCTCTGGTCGACGACGATGAC.
Resulting plasmids were partially sequenced to confirm that the C/EBP-binding sites had been mutated as expected.
Transfections
MA-10 and COS-1 cells were transfected by electroporation.
Briefly, 350 µl of a suspension of cells (12.5 x
106 cells/ml) were mixed with various amounts of effector
and reporter plasmids along with sheared salmon sperm DNA (Sigma Chemical Co., St. Louis, MO.) as carrier DNA to equalize the
total amount of DNA electroporated to 70 µg in each electroporation.
For the transfection studies in MA-10 cells, 75 ng of pRL-SV40 vector
(a plasmid that constitutively expresses Renilla luciferase under the
control of the SV40 promoter; Promega Corp.) was also
transfected in all cases as a transfection control. Cells were
electroporated in cuvettes (Invitrogen, Carlsbad, CA) with
a gap width of 4 mm, using the electro cell manipulator 600 (BTX
Inc., San Diego, CA) using the following parameters: capacitance =
960 µFarads; voltage = 250 V; resistance = 129
,
yielding an electroporation time of 2030 msec. After electroporation,
1 ml normal growth medium was added to the cuvette, and the cells were
incubated for 15 min at room temperature (RT). The cells were then
brought to 12 ml in normal growth medium, and 2 ml were placed in each
well of a six-well (35-mm) dish. Twenty-four hours after
electroporation, the medium was replaced with fresh medium. Twenty-four
hours later, three wells of each six-well plate were treated for 6
h with 1 mM (Bu)2cAMP (Sigma Chemical Co., St. Louis MO), in 1 ml of WAY+, while the control wells
received only 1 ml of WAY+. After (Bu)2cAMP stimulation the
cells were harvested for luciferase assays as described below.
Luciferase Assays
Extracts for luciferase assays were prepared using luciferase
assay system reporter lysis buffer (Promega Corp.). At the
time of harvesting, medium was removed, and the cells were rinsed three
times with ice-cold PBS. Reporter lysis buffer (250 µl) was added to
the cells, and the cells were scraped into 1.5-ml centrifuge tubes. The
cellular debris was then pelleted by centrifugation at 13,800 x
g at 4 C, and the supernatant fluid was placed in a 1.5-ml
centrifuge tube and was either used immediately or stored at -80
C.
Luciferase assays were performed using luciferase or dual luciferase assay kits (Promega Corp.) exactly as described in the protocol provided with the kit. Relative light units were measured using a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). Students unpaired one-tailed or two-tailed t tests were performed using Statview SE+ graphics software (Abacus Concepts, Berkeley, CA).
EMSA
Nuclear extracts were prepared from confluent cell cultures as
described (52). Briefly, cell monolayers were rinsed three times with
ice-cold PBS and scraped in 1 ml of PBS into 1.5-ml centrifuge tubes.
The cells were pelleted by centrifugation at 1500 x g
for 3 min. The pellets were resuspended in 400 µl of buffer A (10
mM HEPES, pH 7.9; 10 mM KCl; 0.1 mM
EDTA; 0.1 mM EGTA; 1 mM dithiothreitol;
1 mM phenylmethylsulfonyl fluoride). The cells were swelled
for 15 min at 4 C, and then 25 µl of 10% NP-40 were added and the
tubes were vortexed. The homogenates were centrifuged 30 sec at
13,800 x g in a microfuge to pellet the nuclei; then
50 µl of buffer C (20 mM HEPES, pH 7.9; 0.4 M
NaCl; 1 mM EDTA; 1 mM EGTA; 1 mM
dithiothreitol; 1 mM phenylmethylsulfonyl fluoride) was
added, and the samples were vigorously rocked for 15 min at 4 C. The
nuclear lysate was then centrifuged for 5 min at 13,800 x
g in a microfuge at 4 C, and the supernatant fluid was
placed into a fresh microfuge tube and stored at -80 C or used
immediately. The pSVSportC/EBPß plasmid (provided by Dr. Elmus Beale,
Texas Tech University, Health Sciences Center, Lubbock, TX) was
transcribed using SP6 polymerase and was translated using the TNT kit
(Promega Corp.). The double-stranded DNA probes used were
C1 (C/EBP binding site at -113) and C2 (C/EBP binding site at -87),
and mutants of C1 and C2 in which underlined bases have been
mutated to disrupt the specific binding of C/EBP proteins:
C1: GGCTGCAGGATGAGGCAATCATTCCA
C1m: GGCTGCAGGATGGTCGACTCATTCCA
C2: GGGACCCTCTGCACAATGACTGATG
C2m: GGGACCCTCTGGTCGACGACTGATG
To generate radioactive probes, the sense and antisense
oligonucleotides were heated to 75 C for 5 min and then slowly cooled
over 2 h to room temperature in annealing buffer [10
mM Tris-HCl (pH 7.5), 100 mM NaCl, 1
mM EDTA]. 5'-GGG overhangs present in the double-stranded
oligonucleotides were filled in using
[32P] dCTP 3000
Ci/mmol (DuPont NEN, Boston, MA) and Klenow (Promega Corp.) at 37 C for 30 min. The 32P-labeled probes
were purified using Probe Quant spin columns (Pharmacia Biotech, Piscataway, NJ). Binding reactions were performed by
mixing 5 µg of nuclear extract with a binding cocktail containing 4%
Ficoll, 10 mM HEPES (pH 7.9), 1 mM EDTA (pH
8.0), and 1 µg poly (dI:dC) and the labeled probe at a final
concentration of 5 nM in 15 µl. Where noted, the protein
was first incubated 20 min at room temperature, in binding cocktail
with 100-fold molar excess of the unlabeled competitor DNA before
addition of the labeled DNA. For the supershift experiments, the
binding reaction was performed as described above for 20 min, after
which 1 µl of the C/EBPß antiserum was added and the reaction was
incubated an additional 20 min at room temperature. After the binding
reaction, the entire reaction was subjected to electrophoresis through
a 4% nondenaturing polyacrylamide gel. The gel was then dried and
autoradiography and phosphorimagery (Molecular Dynamics, Inc., Sunnyvale, CA) were performed.
DNAse I Footprint
To generate a radiolabeled DNA probe, the region spanning -254
to -35 of the StAR promoter was amplified using the
following oligonucleotide primers; 5'-primer is a 20 mer that spans
bases -254 to -235 and has additional bases at the 5'-end to generate
an MluI restriction endonuclease site, and the 3'-primer is
a 44 mer that spans -101 to -35 and; contains point mutations to
generate a BglII resriction endonuclease site centered at
base -63 and a XhoI resriction endonuclease site centered
at -95. The amplification product was cloned into the
MluI-SmaI sites of the pSport vector (Life Technologies, Gaithersburg, MD), and the sequence was verified
by the dideoxynucleotide sequencing method of Sanger using the T7
Sequenase Kit Version 2 (Amersham Pharmacia Biotech, Arlington Heights, IL). The StAR
promoter fragment was excised from pSport by MluI and
KpnI digestion and gel purified using QIAquick gel
extraction kit (Qiagen, Chatsworth, CA) and treated
with calf intestinal phosphatase (CIP, Promega Corp.). CIP
was inactivated by phenol-cholorform extraction, and the DNA was
precipitated with ethanol. Two picomoles of probe were radiolabed using
-[32P]ATP (DuPont NEN, Boston MA) and T4
polynucleotide kinase (Promega Corp.) followed by
inactivation of the kinase and digestion with BglII. The
resultant probe is labeled on the coding strand and spans -254 to -66
of the StAR promoter. The probe was purified by
phenol-chloroform extraction and ethanol precipitation, after which
DNAse I footprint analysis was performed using the Core Footprinting
System (Promega Corp.) with minor modifications. In brief,
2040 fmol of probe (50K-100K cpm) were added to the DNA
protein-binding reaction (10 mM Tris/Cl, pH 8.0, 150
mM KCl, 2.5 µg poly dI:dC, 4 µg/ml calf thymus DNA,
10% glycerol, and 2550 µg MA-10 nuclear extract. The reaction was
incubated on ice for 30 min and then transferred to 25 C, and
CaCl2 and MgCl2 were added to a final
concentration of 2.5 mM and 5 mM, respectively.
One unit of DNAse I (Promega Corp.) was added to the
reaction and was incubated for 15 sec in the presence of nuclear
extract or 30 sec in the presence or absence of nuclear extract. The
reactions were stopped by the addition of an equal volume of stop
buffer containing 200 mM NaCl, 30 mM EDTA, 1%
SDS, and 100 µg/ml yeast RNA, and the DNA was recovered by
phenol-chloroform extraction and ethanol precipitation. The reactions
were resuspended in formamide loading buffer, and the DNA was resolved
on a 6% polyacrylamide sequencing gel. The gel was dried and exposed
to x-ray film. Maxam and Gilbert (53) chemical sequencing reactions
were performed using 40 fmol of probe following standard protocols
(54).
GST Pull Down Assay
A GST-SF-1 fusion protein was prepared and isolated according to
standard protocols (52). The plasmid containing the SF-1 coding
sequence in the pGEX-1
T vector (Pharmacia Biotech,
Piscataway, NJ), was described previously (55), and the control GST
plasmid was pGEX4T-3 (Pharmacia Biotech). Both GST and
GST-SF-1 were subjected to PAGE and stained with Coomassie blue. The
appearance of a band at the correct molecular weight confirmed that
intact proteins were produced. In vitro transcribed and
translated C/EBPß was prepared as described above, except that the
STP3 kit (Novagen, Madison, WI) was used in the presence of
35[S]methionine according to protocols supplied by the
manufacturer. A binding reaction was prepared containing 10 µl of
in vitro transcribed and translated 35S-labeled
C/EBPß, 20 µg of the GST-SF-1 or GST protein bound to 70 µl of
glutathione linked to beaded agarose (Sigma Chemical Co.),
1 µg poly (dI:dC) in the binding cocktail described in the EMSA
methods above, with 50 ng of a PCR product spanning -5 to -158 of the
mouse StAR promoter (primer sequences avaliable upon
request). The binding reaction was incubated 20 min at 4 C,
DTSSP (Pierce Chemical Co., Rockford, IL), a
reversible cross-linking reagent, was added to a final concentration of
5 mM and incubation continued for an additional 20 min at 4
C. The binding reactions were then centrifuged at 13,000 x
g, the supernatant was removed, and the pellets were washed
four times in the binding cocktail. Pellets were resuspended in
denaturing sample buffer and incubated at 100 C for 10 min and
subjected to SDS-PAGE. Autoradiography and phosphorimagery were
performed on dried gels.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This research was supported by NIH Grants HD-17481 (D.M.S.) and DK-51656 (B.J.C.) and a Scientist Development Grant from the American Heart Association (S.C.W.).
Received for publication October 2, 1998. Revision received February 5, 1999. Accepted for publication February 17, 1999.
| REFERENCES |
|---|
|
|
|---|
-subunit gene in
MA-10 Leydig tumor cells. Mol Endocrinol 12:378390This article has been cited by other articles:
![]() |
H. A. LaVoie and S. R. King Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B Experimental Biology and Medicine, August 1, 2009; 234(8): 880 - 907. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, M. T. Dyson, and D. M. Stocco Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives Mol. Hum. Reprod., June 1, 2009; 15(6): 321 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Rincon Garriz, C. Suarez, and A. M. Capponi c-Fos Mediates Angiotensin II-Induced Aldosterone Production and Protein Synthesis in Bovine Adrenal Glomerulosa Cells Endocrinology, March 1, 2009; 150(3): 1294 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J Martin and J. J Tremblay The nuclear receptors NUR77 and SF1 play additive roles with c-JUN through distinct elements on the mouse Star promoter J. Mol. Endocrinol., February 1, 2009; 42(2): 119 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. El-Asmar, X. C Giner, and J. J Tremblay Transcriptional cooperation between NF-{kappa}B p50 and CCAAT/enhancer binding protein {beta} regulates Nur77 transcription in Leydig cells J. Mol. Endocrinol., February 1, 2009; 42(2): 131 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yivgi-Ohana, N. Sher, N. Melamed-Book, S. Eimerl, M. Koler, P. R. Manna, D. M. Stocco, and J. Orly Transcription of Steroidogenic Acute Regulatory Protein in the Rodent Ovary and Placenta: Alternative Modes of Cyclic Adenosine 3', 5'-Monophosphate Dependent and Independent Regulation Endocrinology, February 1, 2009; 150(2): 977 - 989. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. S. Brokken, A. Adamsson, J. Paranko, and J. Toppari Antiandrogen Exposure in Utero Disrupts Expression of Desert Hedgehog and Insulin-Like Factor 3 in the Developing Fetal Rat Testis Endocrinology, January 1, 2009; 150(1): 445 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Martin, N. Boucher, C. Brousseau, and J. J. Tremblay The Orphan Nuclear Receptor NUR77 Regulates Hormone-Induced StAR Transcription in Leydig Cells through Cooperation with Ca2+/Calmodulin-Dependent Protein Kinase I Mol. Endocrinol., September 1, 2008; 22(9): 2021 - 2037. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nishida, S. Miyagawa, M. Vieux-Rochas, M. Morini, Y. Ogino, K. Suzuki, N. Nakagata, H.-S. Choi, G. Levi, and G. Yamada Positive Regulation of Steroidogenic Acute Regulatory Protein Gene Expression through the Interaction between Dlx and GATA-4 for Testicular Steroidogenesis Endocrinology, May 1, 2008; 149(5): 2090 - 2097. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Kuhl, S. M. Ross, and K. W. Gaido CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis Endocrinology, December 1, 2007; 148(12): 5851 - 5864. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R Manna and D. M Stocco Crosstalk of CREB and Fos/Jun on a single cis-element: transcriptional repression of the steroidogenic acute regulatory protein gene J. Mol. Endocrinol., October 1, 2007; 39(4): 261 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Park, M. Tong, and J. L. Jameson Distinct Roles for Steroidogenic factor 1 and Desert hedgehog Pathways in Fetal and Adult Leydig Cell Development Endocrinology, August 1, 2007; 148(8): 3704 - 3710. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Mellon, S. R. Bair, C. Depoix, J.-L. Vigne, N. B. Hecht, and P. B. Brake Translin Coactivates Steroidogenic Factor-1-Stimulated Transcription Mol. Endocrinol., January 1, 2007; 21(1): 89 - 105. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J Casal, V. J P Sinclair, A. M Capponi, J. Nicod, U. Huynh-Do, and P. Ferrari A novel mutation in the steroidogenic acute regulatory protein gene promoter leading to reduced promoter activity. J. Mol. Endocrinol., August 1, 2006; 37(1): 71 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, S. P. Chandrala, S. R. King, Y. Jo, R. Counis, I. T. Huhtaniemi, and D. M. Stocco Molecular Mechanisms of Insulin-like Growth Factor-I Mediated Regulation of the Steroidogenic Acute Regulatory Protein in Mouse Leydig Cells Mol. Endocrinol., February 1, 2006; 20(2): 362 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Clem and B. J. Clark Association of the mSin3A-Histone Deacetylase 1/2 Corepressor Complex with the Mouse Steroidogenic Acute Regulatory Protein Gene Mol. Endocrinol., January 1, 2006; 20(1): 100 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Clem, E. A. Hudson, and B. J. Clark Cyclic Adenosine 3',5'-Monophosphate (cAMP) Enhances cAMP-Responsive Element Binding (CREB) Protein Phosphorylation and Phospho-CREB Interaction with the Mouse Steroidogenic Acute Regulatory Protein Gene Promoter Endocrinology, March 1, 2005; 146(3): 1348 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Wilson, P. Jeyasuria, K. L. Parker, and P. Koopman The Transcription Factors Steroidogenic Factor-1 and SOX9 Regulate Expression of Vanin-1 during Mouse Testis Development J. Biol. Chem., February 18, 2005; 280(7): 5917 - 5923. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jo and D. M. Stocco Regulation of Steroidogenesis and Steroidogenic Acute Regulatory Protein in R2C Cells by DAX-1 (Dosage-Sensitive Sex Reversal, Adrenal Hypoplasia Congenita, Critical Region on the X Chromosome, Gene-1) Endocrinology, December 1, 2004; 145(12): 5629 - 5637. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. LaVoie, D. Singh, and Y. Y. Hui Concerted Regulation of the Porcine Steroidogenic Acute Regulatory Protein Gene Promoter Activity by Follicle-Stimulating Hormone and Insulin-Like Growth Factor I in Granulosa Cells Involves GATA-4 and CCAAT/Enhancer Binding Protein {beta} Endocrinology, July 1, 2004; 145(7): 3122 - 3134. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Pisarska, J. Bae, C. Klein, and A. J. W. Hsueh Forkhead L2 Is Expressed in the Ovary and Represses the Promoter Activity of the Steroidogenic Acute Regulatory Gene Endocrinology, July 1, 2004; 145(7): 3424 - 3433. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hiroi, L. K. Christenson, L. Chang, M. D. Sammel, S. L. Berger, and J. F. Strauss III Temporal and Spatial Changes in Transcription Factor Binding and Histone Modifications at the Steroidogenic Acute Regulatory Protein (StAR) Locus Associated with StAR Transcription Mol. Endocrinol., April 1, 2004; 18(4): 791 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, D. W. Eubank, and D. M. Stocco Assessment of the Role of Activator Protein-1 on Transcription of the Mouse Steroidogenic Acute Regulatory Protein Gene Mol. Endocrinol., March 1, 2004; 18(3): 558 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Holland, S. P. Bliss, K. A. Berghorn, and M. S. Roberson A Role for CCAAT/Enhancer-Binding Protein {beta} in the Basal Regulation of the Distal-Less 3 Gene Promoter in Placental Cells Endocrinology, March 1, 2004; 145(3): 1096 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Borud, G. Mellgren, J. Lund, and M. Bakke Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional Activity of Nuclear Receptors Mol. Endocrinol., November 1, 2003; 17(11): 2303 - 2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugawara, H. Shimizu, N. Hoshi, A. Nakajima, and S. Fujimoto Steroidogenic Acute Regulatory Protein-binding Protein Cloned by a Yeast Two-hybrid System J. Biol. Chem., October 24, 2003; 278(43): 42487 - 42494. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Jordan, J. H.-C. Shen, R. Olaso, H. A. Ingraham, and E. Vilain Wnt4 overexpression disrupts normal testicular vasculature and inhibits testosterone synthesis by repressing steroidogenic factor 1/{beta}-catenin synergy PNAS, September 16, 2003; 100(19): 10866 - 10871. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez, P. Val, I. Sahut-Barnola, C. Aigueperse, G. Veyssiere, and A.-M. Lefrancois-Martinez Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site Endocrinology, May 1, 2003; 144(5): 2111 - 2120. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gillio-Meina, Y. Y. Hui, and H. A. LaVoie GATA-4 and GATA-6 Transcription Factors: Expression, Immunohistochemical Localization, and Possible Function in the Porcine Ovary Biol Reprod, February 1, 2003; 68(2): 412 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, I. T. Huhtaniemi, X.-J. Wang, D. W. Eubank, and D. M. Stocco Mechanisms of Epidermal Growth Factor Signaling: Regulation of Steroid Biosynthesis and the Steroidogenic Acute Regulatory Protein in Mouse Leydig Tumor Cells Biol Reprod, November 1, 2002; 67(5): 1393 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takemori, Y. Katoh, N. Horike, J. Doi, and M. Okamoto ACTH-induced Nucleocytoplasmic Translocation of Salt-inducible Kinase. IMPLICATION IN THE PROTEIN KINASE A-ACTIVATED GENE TRANSCRIPTION IN MOUSE ADRENOCORTICAL TUMOR CELLS J. Biol. Chem., October 25, 2002; 277(44): 42334 - 42343. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Tremblay, F. Hamel, and R. S. Viger Protein Kinase A-Dependent Cooperation between GATA and CCAAT/Enhancer-Binding Protein Transcription Factors Regulates Steroidogenic Acute Regulatory Protein Promoter Activity Endocrinology, October 1, 2002; 143(10): 3935 - 3945. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, M. T. Dyson, D. W. Eubank, B. J. Clark, E. Lalli, P. Sassone-Corsi, A. J. Zeleznik, and D. M. Stocco Regulation of Steroidogenesis and the Steroidogenic Acute Regulatory Protein by a Member of the cAMP Response-Element Binding Protein Family Mol. Endocrinol., January 1, 2002; 16(1): 184 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells Am. J. Pathol., January 1, 2002; 160(1): 369 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hsia and G. A. Cornwall CCAAT/Enhancer Binding Protein {beta} Regulates Expression of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Biol Reprod, November 1, 2001; 65(5): 1452 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Stocco Tracking the Role of a StAR in the Sky of the New Millennium Mol. Endocrinol., August 1, 2001; 15(8): 1245 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Johnson and J. T. Bridgham Regulation of Steroidogenic Acute Regulatory Protein and Luteinizing Hormone Receptor Messenger Ribonucleic Acid in Hen Granulosa Cells Endocrinology, July 1, 2001; 142(7): 3116 - 3124. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. K. Shea-Eaton, M. J. Trinidad, D. Lopez, A. Nackley, and M. P. McLean Sterol Regulatory Element Binding Protein-1a Regulation of the Steroidogenic Acute Regulatory Protein Gene Endocrinology, April 1, 2001; 142(4): 1525 - 1533. [Abstract] [Full Text] |
||||
![]() |
H. Pincas, K. Amoyel, R. Counis, and J.-N. Laverrière Proximal cis-Acting Elements, Including Steroidogenic Factor 1, Mediate the Efficiency of a Distal Enhancer in the Promoter of the Rat Gonadotropin-Releasing Hormone Receptor Gene Mol. Endocrinol., February 1, 2001; 15(2): 319 - 337. [Abstract] [Full Text] |
||||
![]() |
C. Aigueperse, P. Val, C. Pacot, C. Darne, E. Lalli, P. Sassone-Corsi, G. Veyssiere, C. Jean, and A. Martinez SF-1 (Steroidogenic Factor-1), C/EBP{beta} (CCAAT/Enhancer Binding Protein), and Ubiquitous Transcription Factors NF1 (Nuclear Factor 1) and Sp1 (Selective Promoter Factor 1) Are Required for Regulation of the Mouse Aldose Reductase-Like Gene (AKR1B7) Expression in Adrenocortical Cells Mol. Endocrinol., January 1, 2001; 15(1): 93 - 111. [Abstract] [Full Text] |
||||
![]() |
P. R. Manna, J. Kero, M. Tena-Sempere, P. Pakarinen, D. M. Stocco, and I. T. Huhtaniemi Assessment of Mechanisms of Thyroid Hormone Action in Mouse Leydig Cells: Regulation of the Steroidogenic Acute Regulatory Protein, Steroidogenesis, and Luteinizing Hormone Receptor Function Endocrinology, January 1, 2001; 142(1): 319 - 331. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sekar, H. A. LaVoie, and J. D. Veldhuis Concerted Regulation of Steroidogenic Acute Regulatory Gene Expression by Luteinizing Hormone and Insulin (or Insulin-Like Growth Factor I) in Primary Cultures of Porcine Granulosa-Luteal Cells Endocrinology, November 1, 2000; 141(11): 3983 - 3992. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugawara, M. Saito, and S. Fujimoto Sp1 and SF-1 Interact and Cooperate in the Regulation of Human Steroidogenic Acute Regulatory Protein Gene Expression Endocrinology, August 1, 2000; 141(8): 2895 - 2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Le Roy, J. Y. Li, D. M. Stocco, D. Langlois, and J. M. Saez Regulation by Adrenocorticotropin (ACTH), Angiotensin II, Transforming Growth Factor-{beta}, and Insulin-Like Growth Factor I of Bovine Adrenal Cell Steroidogenic Capacity and Expression of ACTH Receptor, Steroidogenic Acute Regulatory Protein, Cytochrome P450c17, and 3{beta}-Hydroxysteroid Dehydrogenase Endocrinology, May 1, 2000; 141(5): 1599 - 1607. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Wooton-Kee and B. J. Clark Steroidogenic Factor-1 Influences Protein-Deoxyribonucleic Acid Interactions within the Cyclic Adenosine 3',5'-Monophosphate-Responsive Regions of the Murine Steroidogenic Acute Regulatory Protein Gene Endocrinology, April 1, 2000; 141(4): 1345 - 1355. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Clark and R. Combs Angiotensin II and Cyclic Adenosine 3',5'-Monophosphate Induce Human Steroidogenic Acute Regulatory Protein Transcription through a Common Steroidogenic Factor-1 Element Endocrinology, October 1, 1999; 140(10): 4390 - 4398. [Abstract] [Full Text] |
||||
![]() |
L. K. Christenson, P. F. Johnson, J. M. McAllister, and J. F. Strauss III CCAAT/Enhancer-binding Proteins Regulate Expression of the Human Steroidogenic Acute Regulatory Protein (StAR) Gene J. Biol. Chem., September 10, 1999; 274(37): 26591 - 26598. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Reyland, R. M. Evans, and E. K. White Lipoproteins Regulate Expression of the Steroidogenic Acute Regulatory Protein (StAR) in Mouse Adrenocortical Cells J. Biol. Chem., November 17, 2000; 275(47): 36637 - 36644. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Christenson, R. L. Stouffer, and J. F. Strauss III Quantitative Analysis of the Hormone-induced Hyperacetylation of Histone H3 Associated with the Steroidogenic Acute Regulatory Protein Gene Promoter J. Biol. Chem., July 13, 2001; 276(29): 27392 - 27399. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Gyles, C. J. Burns, B. J. Whitehouse, D. Sugden, P. J. Marsh, S. J. Persaud, and P. M. Jones ERKs Regulate Cyclic AMP-induced Steroid Synthesis through Transcription of the Steroidogenic Acute Regulatory (StAR) Gene J. Biol. Chem., September 7, 2001; 276(37): 34888 - 34895. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |