help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lazennec, G.
Right arrow Articles by Katzenellenbogen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lazennec, G.
Right arrow Articles by Katzenellenbogen, B. S.
Molecular Endocrinology 13 (6): 969-980
Copyright © 1999 by The Endocrine Society

Adenovirus-Mediated Delivery of a Dominant Negative Estrogen Receptor Gene Abrogates Estrogen-Stimulated Gene Expression and Breast Cancer Cell Proliferation

Gwendal Lazennec1, Joseph L. Alcorn and Benita S. Katzenellenbogen

Department of Molecular and Integrative Physiology (G.L., B.S.K.) and Department of Cell and Structural Biology (B.S.K.) University of Illinois Urbana, Illinois 61801
Department of Biochemistry (J.L.A.) University of Texas Southwestern Medical School Dallas, Texas 75235


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Dominant negative estrogen receptors are transcriptionally inactive, altered forms of the estrogen receptor (ER) that can dimerize with the ER and have the potential to inactivate the biological functions of this receptor. Here, we provide the first report that adenoviral delivery of a dominant negative ER to ER-positive breast cancer cells is able to effectively suppress estrogen-stimulated cell proliferation and the hormonal induction of endogenous genes. We constructed recombinant adenoviral vectors expressing a dominant negative ER (S554 fs, Ad-fs) or, for comparison, antisense ER (Ad-AS), or the sense wild-type ER (Ad-WT). Expression of the dominant negative ER or antisense ER, but not wild-type ER, blocked estradiol stimulation of the estrogen-responsive genes pS2 and c-myc. The dominant negative ER also fully abolished the estradiol-induced increase in proliferation of MCF-7 breast cancer cells, as did the antisense ER. The antiproliferative effects of the dominant negative and antisense ERs are explained by an increase in the number of cells in the G0/G1 stage of the cell cycle and decrease in the number of cells in G2/M as determined by flow cytometry, and also by a significant increase in the percentage of cells undergoing apoptosis. Our data strongly support the idea that targeting ER action using recombinant viral delivery of dominant negative ERs is an effective way to suppress ER-positive breast cancer cell proliferation and suggests the potential attractiveness of dominant negative gene therapy approaches targeted to the ER for the treatment of hormone-responsive breast cancer.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The proliferation and metastatic potential of breast cancer cells are markedly influenced by estrogen (1, 2, 3). Studies in breast cancer tissue both in vivo and in vitro have shown that estrogen dramatically escalates proliferative and metastatic activity in these tumor cells, in part via the induction of growth factors, proteases, and basement membrane receptors (1, 2, 3).

Since the growth of approximately 40% of all human breast cancers is dependent upon the presence of an estradiol-estrogen receptor (ER) complex (4, 5), there is currently intense interest in exploring different ways to functionally inactivate the ER. Although antiestrogens, such as tamoxifen, are widely used to slow the growth of these tumors and are beneficial in about two-thirds of receptor-containing breast cancer patients, the development of resistant cells, the weak agonist activity of tamoxifen, and the metabolism of antiestrogens like tamoxifen to estrogenic compounds often limit their long-term effectiveness (4, 6). The more recently developed pure antiestrogens, such as ICI 182780, also engender resistance in animal model systems, although more slowly (7). An intriguing alternative approach, one that we explore in this study, involves the use of dominant negative ER mutants to suppress the activity of the endogenous ER in estrogen-dependent breast cancer cells.

Dominant negative ERs are ER mutants that are unable to activate transcription and have the additional property of being able to suppress the transcriptional activity of the wild-type ER when they are coexpressed in the same cells. We have identified and studied three ER mutants, altered near the C terminus of the receptor, that have this strong dominant negative activity (8, 9, 10, 11). These dominant negative ERs thus represent a potential new approach to inhibiting ER-mediated bioactivities and, ultimately perhaps, to controlling the growth of estrogen-dependent breast cancer cells. Of the three dominant negative ERs we have developed, the frame-shifted ER (denoted S554fs) has proven to be the most effective in transfection assays employing estrogen-responsive reporter genes (8, 9, 10). Dominant negative ER effectiveness appears to involve three essential aspects: 1) competition between the dominant negative ER and wild-type ER for estrogen response element (ERE) DNA binding, 2) formation of inactive heterodimers between the dominant negative ER and wild-type ER, and 3) interference with some aspect of the transcriptional process resulting in ER-specific transcriptional silencing (10).

In our efforts to ascertain the attractiveness of using dominant negative ERs as a novel strategy for treatment of hormone-responsive breast cancer targeted to the ER, we have chosen an adenoviral gene delivery system because it allows highly efficient gene transfer and expression. For this purpose, we constructed a recombinant adenovirus coding for the potent frameshift dominant negative ER (denoted Ad-fs, adenovirus frameshift). For comparison, we constructed recombinant adenoviruses coding for antisense human ER{alpha} (Ad-AS) or for the sense wild-type ER{alpha} (Ad-WT). We show that adenoviruses expressing the dominant negative ER are very effective in repressing estrogen-mediated gene expression and proliferation of ER-positive MCF-7 breast cancer cells, and we explore the effects of the dominant negative ER on the cell cycle and on apoptosis. This approach should improve our understanding of how estrogens act in breast cancer cells and may also provide a gene therapy approach for extinguishing the growth of ER-positive breast cancers.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of Recombinant Viruses and Characterization of ER Expression
We performed in vivo recombination in 293 cells, as detailed in Materials and Methods, with pJM17 and the pACsk12CMV5 shuttle vector coding for human ER cDNA sequences. To obtain recombinant viruses, permissive 293 cells (human embryonic kidney cell line transformed by the E1A and E1b) were cotransfected (12) with the recombinant pACsk12CMV5-hER plasmid and with pJM17, which contains the remainder of the adenoviral genome (13). In vivo recombination of the plasmids yields a recombinant viral genome (Ad-WT, Ad-fs, Ad-AS) of packagable size and the subsequent generation of infectious viral particles. The resulting viruses are denoted Ad-WT (encoding human ER{alpha} wild type), Ad-AS (antisense WT ER{alpha}) and Ad-fs (dominant negative 1–554 fs ER; see Fig. 1Go). Viral plaques were isolated and propagated to produce a lysate containing infectious recombinant virus. To optimize MCF-7 cell infection with recombinant adenoviruses, MCF-7 cells were infected at different multiplicities of infection (MOI) with adenovirus coding for the ß-galactosidase protein (Ad-GAL), and at 48 h, cells were stained to determine the degree of infection (Fig. 2Go). In the absence of Ad-GAL virus, as expected, no ß-galactosidase activity could be detected. As the MOI was increased, we could observe a great increase in the number of ß-galactosidase-expressing cells. At the highest concentration of virus used, more than 90% of the cells were positively stained and about 70% of them showed a very high degree of staining. Time course studies showed that expression was easily detectable after 1 day, was maximal at 2–4 days of adenoviral infection, and was still quite high at day 6 (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Schematic Depicting Construction of the Adenoviral Vector Expressing Wild-Type, Dominant Negative, or Antisense ERs

See text for details.

 


View larger version (113K):
[in this window]
[in a new window]
 
Figure 2. An Adenovirus Expressing ß-Galactosidase (Ad-GAL) Is Able to Efficiently Infect MCF-7 Cells

MCF-7 cells were infected overnight with no virus (A), or Ad-GAL virus at MOI 0.25 (B), 12.5 (C), or 125 (D). ß-Galactosidase activity was monitored at 48 h after infection. Magnification is 40x.

 
Viral clones encoding Ad-WT, Ad-AS, and Ad-fs were amplified and tested for their expression ability in ER-negative MDA-MB-231 human breast cancer cells (Fig. 3Go, A and B). ER RNA transcription was monitored by RT-PCR using primers specific for the human ER{alpha} ligand-binding domain (Fig. 3AGo). RT-PCR was performed on RNA from cells infected with Adrr5 (empty virus), dominant negative Ad-fs, or Ad-WT recombinant virus. A specific amplification product of the correct size was observed only with RNA from Ad-WT human ER and Ad-fs- infected MDA-MB-231 cells (Fig. 3AGo). The same specific amplified product was also obtained with Ad-AS virus when performed on DNA isolated from the virus (data not shown). To determine whether the wild type or dominant negative ER protein was also correctly produced, whole-cell extracts from MDA-MB-231 cells infected with Adrr5, Ad-AS, Ad-WT, or Ad-fs were prepared. Using H222 anti-hER{alpha} specific antibody, we were able to detect a signal at approximately 66 kDa, the expected size of the dominant negative and wild-type ERs, only with Ad-fs- and Ad-WT-infected MDA-MB-231 cells (Fig. 3BGo), as expected.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Wild-Type (WT) Human ER and Dominant Negative (1–554 fs) ER RNAs (A) and Proteins (B) Are Correctly Expressed in ER-Negative MDA-MB-231 Cells Infected with Ad-WT and Ad-fs Adenoviral Vectors

MDA-MB-231 cells were infected at MOI 100 with Adrr5 empty virus (Ad5), Ad-AS human ER antisense virus (AS), Ad-WT human ER virus (hER), or Ad-fs dominant negative human ER virus (fs). A, Total RNA from infected cells was isolated. After reverse transcription, the cDNAs produced were subjected to PCR with human ER{alpha}-specific primers for the ligand binding domain. B, Proteins were extracted from infected MDA-MB-231 cells. ER protein expression was analyzed by Western immunoblot using H222 anti-hER{alpha}-specific antibody. C, Ad-fs and Ad-AS viral infection results in ERs that are transcriptionally inactive in MDA-MB-231 cells. MDA-MB-231 cells were infected with the Adrr5, Ad-ER WT, Ad-fs, or Ad-AS viruses at MOI 100 and were transfected with the 2ERE-pS2-CAT reporter plasmid and CMV-ßgal internal reference reporter plasmid as described in Materials and Methods. Cells were treated for 24 h with control ethanol vehicle or E2 (10-8 M). Transactivation was determined by CAT activity normalized to the internal ß-galactosidase transfection efficiency control. Results are expressed as percent of the activity for Ad-hER WT in the presence of E2, which is set at 100%. Error bars represent the mean ± SD of three or more experiments.

 
We also examined the abilities of the different recombinant viruses to activate the transcription of an estrogen-responsive reporter gene in transient transfection experiments in the ER-negative MDA-MB-231 cells (Fig. 3CGo). As expected, the empty Adrr5 virus and the Ad-fs and Ad-AS virus did not show any significant transcriptional activity in the absence or the presence of estradiol (E2), whereas only Ad-WT was able to activate strongly estrogen-responsive gene transcription in the presence of E2. Thus, the wild-type, dominant negative, and antisense ER recombinant viral constructs behaved as reported previously for these plasmid-produced proteins (8, 9, 10), indicating that the adenoviral delivery and cell infection conditions altered neither the nature of the ER proteins produced nor the cell response to these different ERs.

Adenovirus-Mediated Expression of the Dominant Negative ER or Antisense ER Represses Transcriptional Activity by the Endogenous ER in Breast Cancer Cells
ER-positive MCF-7 breast cancer cells were infected with the various recombinant adenoviruses to determine whether these viruses could affect the ability of the endogenous ER to activate the transcription of estrogen-responsive reporter genes in transient transfection experiments (Fig. 4Go). We tested three MOIs for each virus, and all the infected cells were treated with E2. Adrr5 and Ad-WT viruses did not modify significantly the magnitude of E2 stimulation of reporter gene activity by the endogenous MCF-7 cell ER. By contrast, the antisense ER (Ad-AS) and especially the dominant negative ER (Ad-fs) strongly reduced the E2 induction, to basal levels in the case of Ad-fs at the highest MOI.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. Ad-fs and Ad-AS Viral Infection Produces Receptors That Are Able to Repress the Endogenous ER Activity in MCF-7 Cells

MCF-7 cells were infected with increasing amounts (MOI 2, 10 or 50) of the different viruses. After the overnight 16 h adenoviral infection, cells were transfected with the ERE-pS2-CAT reporter gene plasmid and CMV-ßgal internal reference reporter plasmid. Uninfected cells (leftmost two bars, labeled control) were treated for 24 h with control ethanol vehicle (-) or E2 (10-9 M) for comparison. All infected cells were treated with 10-9 M E2. Transactivation was determined by CAT activity normalized to the internal ß-galactosidase control. Error bars represent the mean ± SD of three or more experiments. Data are expressed as the % of CAT activity in control uninfected MCF-7 cells treated with E2, which is set at 100%.

 
We then examined whether Ad-fs and Ad-AS could repress the transcription of endogenous genes in MCF-7 cells that are regulated by E2. MCF-7 cells were either uninfected or infected with the different viruses at three distinct MOIs, and cells were then treated with E2 (Fig. 5Go). We analyzed the expression of two endogenous genes: pS2, which is strongly E2 regulated (14), and c-myc, which is rapidly induced in response to mitogenic signals such as E2 (15). For comparison, actin was examined as a negative control gene, since it is not regulated by E2 in these cells.




View larger version (69K):
[in this window]
[in a new window]
 
Figure 5. Suppression of Endogenous Estrogen-Responsive Gene Expression in MCF-7 Cells by the Recombinant Dominant Negative ER and Antisense ER Adenoviruses

In panels A, B, and C, MCF-7 cells were uninfected (control) or were infected at low, medium, or high MOI (2, 10 or 50) with the different recombinant viruses. At 24 h after infection, the cells were treated with control ethanol vehicle (-E) or with estradiol (10-9 M) for 36 h. RNA was isolated from the cells, and 10 µg of total RNA were analyzed by slot blot hybridization with pS2, c-myc, or actin probes. The data have been corrected for the specific RNA relative to 36B4 RNA (to correct for any minor differences in RNA loading). The results are presented as the percentage of RNA expression levels at 36 h of E2 treatment in uninfected control MCF-7 cells and are the mean ± range from two experiments with duplicate determinations.

 
Expression of the dominant negative ER or the antisense ER was able to block estradiol-stimulated expression of the pS2 and c-myc genes (Fig. 5Go, A and B), while actin expression was not influenced by estrogen and was minimally, if at all, affected by expression of the proteins encoded by the recombinant adenoviral vectors (Fig. 5CGo). For the estrogen-regulated genes, the dominant negative frameshift and antisense ER constructs markedly reduced estrogen-stimulated gene expression and, in the case of the c-myc gene, even low MOIs substantially reduced the estrogen stimulation (Fig. 5BGo). In some cases (e.g. Fig. 5AGo), the frameshift dominant negative ER was somewhat more efficacious in reducing estradiol stimulation compared with the antisense ER. Infection with the empty adenovirus, or the adenovirus expressing the wild-type ER, had little effect on the estrogen-stimulated response, except at the high MOI, where a modest (~30%) reduction in estrogen response was observed upon infection with the Ad-WT ER adenovirus (Fig. 5Go, A and B). That the effects of the dominant negative and antisense ERs are specific for suppression of estrogen-stimulated gene expression is seen by the fact that viral infection and expression of the wild-type, dominant negative frameshift, or antisense ER had essentially no effect on expression of actin, a gene that is not regulated by estrogen in these breast cancer cells (Fig. 5CGo).

Dominant Negative ER or Antisense ER Expression Extinguishes Estrogen-Stimulated Cell Proliferation
ER-positive MCF-7 cells show a marked estrogen-induced stimulation of proliferation. Therefore, it was of particular interest to determine whether our recombinant viruses could influence the proliferation rate of MCF-7 cells in the presence of E2. We analyzed the proliferation of MCF-7 cells treated with control vehicle or E2. Cells were either uninfected (control) or infected with Adrr5, Ad-WT, Ad-fs, and Ad-AS viruses at three different MOIs (Fig. 6Go). The dominant negative ER and the antisense ER at medium and high MOIs reduced cell proliferation by approximately 50% and 90%, respectively. By contrast, the empty virus (Ad5) and expression of the wild-type ER had little effect on MCF-7 cell proliferation, except at the highest MOI, where approximately 25% reduction in proliferation was observed with expression of the wild-type ER. Thus, the dominant negative and antisense receptors could completely abolish the estrogen-induced proliferation, reducing it to the control (no E2) level.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. The Dominant Negative ER or Antisense ER, Delivered in an Adenoviral Vector (Ad-fs or Ad-AS), Suppresses the E2-Induced Proliferation of MCF-7 Cells

MCF-7 cells were either uninfected (control) or infected with empty Adrr5, Ad-WT, Ad-fs, or Ad-AS viruses at different MOIs (low, 2; medium, 10; high, 50). At 24 h after the beginning of the infection, the cells were then treated with 0.1% ethanol vehicle (open bars) or 10-8 M E2 (filled bars). Proliferation was analyzed by measuring [methyl-3H] thymidine incorporation for 3 h at day 4. Results represent the mean ± SD of six or more determinations and are expressed as the percentage of the noninfected control cells in the presence of E2, which is set at 100%.

 
Expression of Dominant Negative ER or Antisense ER Arrests Cells in the G0/G1 Stage of the Cell Cycle and Also Induces Apoptosis
To investigate whether Ad-fs- and Ad-AS-inhibitory effects on MCF-7 E2 induced proliferation were a result of growth arrest (i.e. arrest in the progression of the cell cycle) and/or the induction of apoptosis, we studied these cells by flow cytometry. We looked at the cell cycle distribution of the cells using propidium iodide to determine the total DNA content, and we also determined whether DNA breakage, one of the significant events occurring during apoptosis, was increased.

In MCF-7 cells infected with Adrr5 empty virus and exposed to control vehicle (no E2, Fig. 7AGo), most of the cells were in the G0/G1 stage (67%) of the cell cycle. Upon the addition of E2, both G0/G1 and G2/M peaks were sharpened; now, fewer of the cells (only 46%) were in G0/G1, and the proportion of cells in G2/M increased to 44%. Cells infected with Ad-WT virus and exposed to E2 showed a cell cycle distribution very similar to that observed for empty virus (Adrr5)-infected MCF-7 cells exposed to E2, indicating that the expression of additional wild-type ER was without substantial impact on the cell cycle effects of E2 evoked by the endogenous MCF-7 cell ER. By contrast, the effects of Ad-AS and Ad-fs viruses were quite dramatic, as they blocked most of the cells in the G0/G1 phase (60% and 67%, respectively) and reduced the number of cells in G2/M phase (to 32% and 27%, respectively), giving a distribution similar to that observed for cells that are not treated with E2. Repeat experiments gave cell cycle distributions for the different treatment groups closely mirroring those shown in Fig. 7Go. Thus, both the dominant negative and antisense ER constructs reversed the effects of E2 on the cell cycle.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 7. Effects of Adenoviral Mediated Delivery of Dominant Negative ER and Antisense ER on the Cell Cycle Characteristics of MCF-7 Cells

Cells were infected (at MOI 20) with empty adenovirus (Ad5), adenovirus expressing wild-type ER (Ad-WT), adenovirus expressing antisense ER (Ad-AS), or adenovirus expressing the dominant negative ER (Ad-fs). Cells were treated with control vehicle or 10-8 M E2, as indicated, for 4 days before flow cytometry analysis. A representative experiment is shown. Cell cycle distribution of infected cells is based on propidium iodide incorporation and FACS analysis. The first peak corresponds to cells in G0/G1, the intermediary population to cells in S phase, and the second peak corresponds to cells in the G2/M phase. Very similar findings were observed in two repeat experiments.

 
To determine whether increases in the fraction of cells undergoing apoptosis also contributed to the reduction of cell proliferation by expressed dominant negative ER and antisense ER, we monitored DNA breakage using Br-dUTP (Fig. 8Go). MCF-7 cells infected with empty adenovirus (Adrr5) or adenovirus expressing wild-type ER (Ad-WT) did not exhibit substantial apoptosis, with only 2–5% of the cells undergoing apoptosis. In contrast, Ad-fs- and Ad-AS-infected cells showed a significant increase in the proportion of apoptotic cells, being 17–19% of total cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Effects of Dominant Negative ER and Antisense ER on Apoptosis in MCF-7 Cells

Cells were treated as described in Fig. 7Go legend. After 4 day exposure to E2 or control vehicle, MCF-7 cells were harvested, fixed, and treated with the Apo-BRdU kit as specified by the manufacturer. Cells were then analyzed by FACS. Examination of apoptosis is based on Br-dUTP incorporation. Cells undergoing apoptosis are detected in the upper part of the graph (above the line), whereas healthy cells are present in the lower part. A repeat experiment gave similar results.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The availability of a dominant negative ER that can biologically inactivate the ER in breast cancer cells, coupled with an efficient gene delivery vehicle, has enabled us to evaluate the concept of dominant negative ER strategies to block estrogen stimulation of endogenous gene expression and proliferation in ER-containing breast cancer cells. To deliver dominant negative ER expression constructs efficiently into breast cancer cells, adenovirus vectors seemed well suited as an alternative to plasmid-based gene transfer technologies. In this context, we have found adenovirus-mediated ER gene targeting to be quite effective in abrogating estrogen-inducible gene expression and breast cancer cell proliferation.

Since the ER plays important roles in the stimulation of hormone-responsive breast cancers, there is currently great interest in exploring approaches to inactivate the biological functions of this receptor. These include the use of dominant negative ERs, antisense ER constructs, and antiestrogen ligands such as tamoxifen and raloxifene. Of note, these three agents work by very different mechanisms. Antiestrogens, the most widely investigated agents, act by locking ERs in an inactive conformation, thereby blocking their transformation into a transcriptionally active state (4, 16). While antiestrogens are very important agents, they often have mixed estrogen agonist and estrogen antagonist properties, and resistance to antiestrogens often develops during long-term treatment. Antisense ER constructs are aimed at abolishing expression of the sense ER mRNA; their effectiveness, as observed in our studies, was good. However, antisense approaches can sometimes be compromised by the fact that antisense is not always optimally stable, thereby not completely abolishing expression of the sense mRNA. Dominant negative ERs are transcriptionally inactive ERs that can heterodimerize with the wild-type ER, thus forming inactive heterodimers (8, 10, 11). Their use to suppress hormone-induced endogenous gene expression and cell proliferation is described for the first time in this work.

Our previous studies showed that the frame-shifted dominant negative ER was able to complex to the wild-type ER in MCF-7 breast cancer cells and suppress estrogen-responsive reporter gene activity (9). Since previous transfection of MCF-7 cells with the dominant negative ER (9) was quite inefficient, with only 5–10% of the cells transfected with the dominant negative ER, we were not able to examine the effects of the dominant negative ER on cell proliferation and the hormonal regulation of endogenous genes. We now show that when the dominant negative ER is delivered to essentially all cells, this mutant ER can eliminate estrogen stimulation of endogenous estrogen-responsive genes (pS2, c-myc) and suppress estrogen-stimulated breast cancer cell proliferation. Intriguingly, the dominant negative receptors, in blocking ER functional activity, arrest cells in the G0/G1 phase of the cell cycle and increase the fraction of cells undergoing apoptosis, effects that have also been observed previously with antiestrogen treatment of breast cancer cells (17, 18).

In assays evaluating the suppression of estrogen action, the dominant negative ER (Ad-fs) was able to repress c-myc and pS2 gene induction by estrogen. Interestingly, repression of c-myc induction by Ad-fs could be achieved with medium and even low MOI of virus, whereas a total repression of pS2 gene induction was only observed with a high MOI of Ad-fs. This suggests that different levels of ER may be needed normally for induction of these different estrogen-regulated genes. Since our studies used MCF-7 cells that contain endogenous wild-type ER, and our antibodies cannot distinguish between endogenous ER and the dominant negative ER expressed by the virus, we used ß-galactosidase staining to determine optimal infection conditions. Based on our prior studies with this frame-shifted dominant negative ER, we know that an amount of dominant negative ER equal to that of wild-type ER gives substantial inhibition of wild-type receptor and that a 3-fold excess of dominant negative ER fully suppresses wild-type ER activity. At these levels, the dominant negative ER has no effect on other nuclear receptors such as the progesterone receptor (8, 9, 10). The data in Figs. 4Go and 5CGo, showing that reporter gene activity is not affected by the additional production of wild-type ER from the adenoviral vector, and that expression of a non-estrogen-regulated gene (actin) is not affected at the MOIs used, indicate that the effects of the dominant negative ER are selective and that transcriptional squelching is not occurring.

Ad-fs and Ad-AS were both good repressors of MCF-7 cell proliferation. The reduced proliferation brought about by the dominant negative or antisense ERs appears to be explained by a decrease in the number of cells in G2/M phase and an increase of cells in G0/G1, which mimicked closely the difference between nontreated and E2-treated MCF-7 cells. Of interest, a similar increase in the proportion of cells in the G0/G1 phase of the cell cycle has been observed with antiestrogen treatment of ER-positive breast cancer cells (17, 18), indicating that these agents, although acting by different mechanisms, can all bring about the abrogation of ER function in cancer cells.

Several other reports have shown the efficacy of gene therapy approaches with adenovirus for targeting important signaling proteins in breast cancer cells (19, 20, 21, 22), but most of these experiments were not performed in the presence of estrogen, and none were directed toward the abrogation of hormone responsiveness. Exciting studies have shown that use of an adenovirus coding for the dominant negative repressor of Bcl-2, Bcl-xs (which sensitizes cells to apoptosis), could dramatically reduce MCF-7 cell survival (22). With Ad-fs and Ad-AS, we also observed a significant increase in the proportion of cells undergoing apoptosis, indicating that the reduced proliferation obtained through disrupting the ER pathway is a consequence of impairment of the cell cycle that is reflected also by increased apoptosis.

In conclusion, our data demonstrate that use of adenoviruses coding for a dominant negative ER is a very effective way to abrogate hormone-induced gene expression and proliferation of ER-positive breast cancer cells. These findings suggest the potential value of this strategy, which disrupts the ER signal transduction pathway, in providing an alternative therapeutic approach to treatment of hormone-responsive breast cancer.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chemicals
Estradiol-17ß (E2) was from Sigma Chemical Co. (St. Louis, MO). [methyl-3H]Thymidine was from ICN Biochemicals, Inc. (Costa Mesa, CA).

Oligonucleotide Sequences
The sequences of the oligonucleotides used for RT-PCR or gel shift are indicated below (s, sense; as, antisense).

EREs: AGCTCTTTGATCAGGTCACTGTGACCTGACTTT

EREas: AGTCTAAAGTCAGGTCACAGTGACCTGATCAAAG

ACTINs: ACCATGGATGATGATATCGC

ACTINas: ACATGGCTGGGGTGTTGAAG

pS2s: TGACTCGGGGTCGCCTTTGGAG

pS2as: GTGAGCCGAGGCACAGCTGCAG

ERs: AACAGCCTGGCCTTGTCCCTG

ERas: GCACTTCATGCTGTACAGATGCT

Construction of Adenoviral Vectors and Infection Procedures
The complete coding sequence of human ER{alpha} wild type (encoding amino acids 1–595) in the sense (Ad-WT) or antisense (Ad-AS) orientation or mutant dominant negative ER (1–554-fs) (Ad-fs) (8, 11) cDNAs was subcloned in the BamHI site of the pACsk12CMV5 shuttle vector. To obtain recombinant viruses, permissive 293 cells (human embryonic kidney cell line transformed by the E1A and E1b) were cotransfected (12) with the recombinant pACsk12CMV5-hER plasmid and with pJM17, which contains the remainder of the adenoviral genome (13). In vivo recombination of the plasmids yields a recombinant viral genome (Ad-WT, Ad-fs, Ad-AS) of packagable size and the subsequent generation of infectious viral particles (see Fig. 1Go). Adrr5 is a control recombinant adenovirus that does not carry any transgene but has the same adenoviral backbone. Viral plaques were isolated and propagated to produce a lysate containing infectious recombinant virus as described by Graham et al. (12). DNAs from these viruses were screened for the presence of the fusion gene by PCR with ER primers, and titered virus stocks were used to infect MCF-7 cells.

To monitor adenovirus infection by ß-gal staining, MCF-7 cells were infected overnight and the staining was performed 48 h later. Cells were washed twice with PBS and then fixed at 4 C in fixing solution (2% formaldehyde, 0.2% glutaraldehyde, 1x PBS) for 5 min. Cells were then stained overnight at 37 C in staining solution (5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 1xPBS, 1 mg/ml X-Gal). Staining of cells was then observed under a microscope.

Cell Culture and Transient Transfection
293 cells were carried in 10% FCS in DMEM in a CO2 incubator. ER-positive human breast cancer MCF-7 cells and ER-negative human breast cancer MDA-MB-231 cells were grown at 37 C as previously described (9, 23). Cells were plated in 60-mm plates in 5% charcoal dextran-treated calf serum (CDCS) in Improved MEM (IMEM) and incubated for 48 h with 5% CO2. Transfections were performed using 4 µg of 2ERE-pS2-CAT and 0.8 µg of the internal reference ß-galactosidase reporter plasmid pCMVß. Cells were first infected with the different viruses overnight. After 24 h, cells were incubated with calcium phosphate-precipitated DNA overnight and then rinsed in HBSS. Ligand treatment was then added in growth medium. Cells were harvested 24 h after ligand treatment and lysed by cycles of freezing on dry ice and thawing at 37 C. Transactivation ability as determined by chloramphenicol acetyltransferase (CAT) activity on the whole cell extract was assayed as described previously (9, 23). CAT assays were normalized to ß-galactosidase activity from the cotransfected internal control plasmid.

RNA Isolation, RT-PCR, and Slot Blot Analysis
Total RNA was isolated using Triazol reagent from Life Technologies, Inc., (Gaithersburg, MD) as described by the manufacturer. Random primers (Perkin-Elmer Corp., Norwalk, CT) were used to synthesize a single-stranded cDNA using 10 µg of total RNA as described (24). A portion (1/50) of the cDNA solution was used to amplify fragments of human ER or other cDNAs in the presence of 2.5 U of Taq polymerase (Perkin-Elmer Corp.). Cycles of 45 sec at 94 C (denaturation), 1 min at annealing temperature, and 2 min at 72 C (extension) were done 30 times. A tenth of each PCR reaction was electrophoresed on 2% agarose gel. The following annealing temperatures were used: actin, 60 C; c-myc, 65 C; human ER, 65 C; pS2, 65 C.

For slot blot analysis, 10 µg of total RNA were blotted on nylon membrane by standard procedure (24). After fixation at 80 C for 1 h, the membrane was hybridized at 42 C in hybridization buffer (50% formamide, 5x SSC, 1x Denhardt’s, 0.1% SDS) and then washed at room temperature for 20 min in 1x SSC, 0.1% SDS, and three times for 20 min in 0.2x SSC, 0.1% SDS at 68 C.

Preparation of Whole-Cell Extracts
Cells were harvested, washed in PBS, and resuspended in TEG (10 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, and 10% glycerol)/0.4 M KCl) containing 5 µg/ml aprotinin, leupeptin, and pepstatin A and 0.1 mM phenylmethylsulfonyl fluoride. Then, cells were sonicated and the cellular debris was pelleted by centrifugation at 14,000 rpm for 20 min.

Western Blot Analysis
Thirty micrograms of nuclear proteins were subjected to SDS-PAGE followed by electrotransfer onto a nitrocellulose membrane. The blot was probed with H222 ER antibody (40 ng/ml) and then incubated with rabbit anti-rat IgG horseradish peroxidase-conjugated antibody (1 µg/ml). The enhanced chemiluminescence (ECL) kit from Amersham Pharmacia Biotech (Arlington, IL) was used for protein detection.

Cell Proliferation Studies
Cells were maintained for 7 days in 20% CDCS in IMEM and then seeded at 5,000 cells per well in 24-well dishes in 20% CDCS IMEM. Cells were infected overnight with the different viruses. The next morning, the medium was removed and replaced with fresh medium. Treatment with the different ligands was begun at the same time. After 4 days, the cells were incubated with 1 µCi [methyl-3H]thymidine at 37 C for 3 h. Plates were sequentially washed and fixed with ice-cold PBS, 10% trichloroacetic acid, MeOH, and the incorporated label was recovered by incubation of the wells in 0.5 N NaOH for 30 min at 37 C. Lysates were transferred to vials containing Scintiverse TM cocktail (Fisher Scientific, Pittsburgh, PA), and [3H]thymidine was determined by scintillation counting.

Flow Cytometry Experiments
To analyze the effects of recombinant viruses on the cell cycle and on apoptosis, MCF-7 cells were infected with the adenoviral vectors, and cells were treated with Br-dUTP and propidium iodide (Apo-BRDU kit, Phoenix Flow Systems, San Diego, CA). Br-dUTP is used to label the 3'-hydroxyl ends occurring during DNA breakage when apoptosis occurs. Propidium iodide was used to measure the total DNA content of cells. The reactions were performed as specified by the manufacturer. Fluorescence-activated cell sorting (FACS) analysis was performed on an Epics-XL flow cytometer (Beckman Coulter, Fullerton, CA).


    ACKNOWLEDGMENTS
 
We thank Dr. Carole Mendelson of Southwestern Medical School, Dallas, for her interest and assistance in these studies, and Gary Durak of the University of Illinois Biotechnology Center for his help with FACS analyses.


    FOOTNOTES
 
Address requests for reprints to: Dr. Benita S. Katzenellenbogen, Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, 524 Burrill Hall, 407 South Goodwin Ave. Urbana, Illinois 61801-3704. E-mail: katzenel{at}uiuc.edu

This work was supported by NIH Grant CA-60514 (B.S.K.) and in part by a postdoctoral fellowship from the Susan G. Komen Foundation (G.L.).

1 Current Address: INSERM U148, 60 rue de Navacelles, 34090, Montpellier, France. Back

Received for publication January 20, 1999. Revision received March 4, 1999. Accepted for publication March 9, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Katzenellenbogen BS 1996 Estrogen receptors: bioactivities and interactions with cell signaling pathways. Biol Reprod 54:287–293[Abstract]
  2. Read LD, Katzenellenbogen BS 1992 Characterization and regulation of estrogen and progesterone receptors in breast cancer. In: Dickson RB, Lippman ME (eds) Genes, Oncogenes and Hormones: Advances in Cellular and Molecular Biology of Breast Cancer. Kluwer-Nijhoff, Nowell, MA, pp 277–299
  3. Dickson RB, Lippman ME 1987 Estrogenic regulation of growth and polypeptide growth factor secretion in human breast carcinoma. Endocr Rev 8:29–43[Abstract/Free Full Text]
  4. Katzenellenbogen BS, Montano MM, Ekena K, Herman ME, McInerney EM 1997 Antiestrogens: mechanisms of action and resistance in breast cancer. Breast Cancer Res Treat 44:23–38[CrossRef][Medline]
  5. Santen R, Manni A, Harvey H, Redmond C 1990 Endocrine treatment of breast cancer in women. Endocr Rev 11:221–265[Abstract/Free Full Text]
  6. Katzenellenbogen BS 1991 Antiestrogen resistance: mechanisms by which breast cancer cells undermine the effectiveness of endocrine therapy. J Natl Cancer Inst 83:1434–1435[Free Full Text]
  7. Osborne CK, Coronado-Heinsohn EB, Hilsenbeck SG, McCue BL, Wakeling AE, McClelland RA, Manning DL, Nicholson RI 1995 Comparison of the effects of a pure steroidal antiestrogen with those of tamoxifen in a model of human breast cancer. J Natl Cancer Inst 87:746–750[Abstract/Free Full Text]
  8. Ince BA, Zhuang Y, Wrenn CK, Shapiro DJ, Katzenellenbogen BS 1993 Powerful dominant negative mutants of the human estrogen receptor. J Biol Chem 268:14026–14032[Abstract/Free Full Text]
  9. Ince BA, Schodin DJ, Shapiro DJ, Katzenellenbogen BS 1995 Repression of endogenous estrogen receptor activity in MCF-7 human breast cancer cells by dominant negative estrogen receptors. Endocrinology 136:3194–3199[Abstract]
  10. Schodin DJ, Zhuang Y, Shapiro DJ, Katzenellenbogen BS 1995 Analysis of mechanisms that determine dominant negative estrogen receptor effectiveness. J Biol Chem 270:31163–31171[Abstract/Free Full Text]
  11. Wrenn CK, Katzenellenbogen BS 1993 Structure-function analysis of the hormone binding domain of the human estrogen receptor by region-specific mutagenesis and phenotypic screening in yeast. J Biol Chem 268:24089–24098[Abstract/Free Full Text]
  12. Graham FL, Smilet J, Russel WC, Nairn R 1977 Characteristics of a human cell line transformed by DNA from adenovirus type 5. J Gen Virol 36:59–72[Abstract/Free Full Text]
  13. McGregory WJ, Bautista WJ, Graham FL 1988 A simple technique for the rescue of early region 1 mutations into infectious human adenovirus type 5. Virology 163:614–617[CrossRef][Medline]
  14. Brown AMC, Jeltsch JM, Roberts M, Chambon P 1984 Activation of pS2 gene transcription is a primary response to estrogen in the human breast cancer cell line MCF-7. Proc Natl Acad Sci USA 81:6344–6348[Abstract/Free Full Text]
  15. Dubik K, Dembinske TC, Shiu RP 1987 Stimulation of c-myc oncogene expression associated with estrogen-induced proliferation of human breast cancer cells. Cancer Res 47:6517–6521[Abstract/Free Full Text]
  16. Brzozowski AM, Pike ACW, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  17. Sutherland RL, Green MD, Hall RE, Reddel RR, Taylor IW 1983 Tamoxifen induces accumulation of MCF 7 human mammary carcinoma cells in the G0/G1 phase of the cell cycle. Eur J Cancer Clin Oncol 19:615–621[CrossRef][Medline]
  18. Sutherland RL, Hall RE, Taylor IW 1983 Cell proliferation kinetics of MCF-7 human mammary carcinoma cells in culture and effects of tamoxifen on exponentially growing and plateau-phase cells. Cancer Res 43:3998–4006[Abstract/Free Full Text]
  19. Zhang JF, Hu C, Geng Y, Selm Y, Klein SB, Orazi A, Taylor MW 1996 Treatment of a human breast cancer xenograft with an adenovirus vector containing an interferon gene results in rapid regression due to viral oncolysis and gene therapy. Proc Natl Acad Sci USA 93:4513–4518[Abstract/Free Full Text]
  20. Wright M, Grim J, Deshane J, Kim M, Strong TV, Seigal GP, Curiel DT 1997 An intracellular anti-erbB-2 single-chain antibody is specifically cytotoxic to human breast carcinoma cells overexpressing erbB-2. Gene Ther 4:317–322[CrossRef][Medline]
  21. Katayose D, Wersto R, Cowan KH, Seth P 1995 Effects of a recombinant adenovirus expressing WAF1/Cip1 on cell growth, cell cycle, and apoptosis. Cell Growth Differ 6:1207–1212[Abstract]
  22. Ealovega MW, McGinnis PK, Sumantran VN, Clarke MF, Wicha MS 1996 Bcl-xs gene therapy induces apoptosis of human mammary tumors in nude mice. Cancer Res 56:1965–1969[Abstract/Free Full Text]
  23. Pakdel F, Katzenellenbogen BS 1992 Human estrogen receptor mutants with altered estrogen and antiestrogen ligand discrimination. J Biol Chem 267:3429–3437[Abstract/Free Full Text]
  24. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed. 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen
Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding
Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. H. Hassan, S. A. Salama, H. M. M. Arafa, F. M. A. Hamada, and A. Al-Hendy
Adenovirus-Mediated Delivery of a Dominant-Negative Estrogen Receptor Gene in Uterine Leiomyoma Cells Abrogates Estrogen- and Progesterone-Regulated Gene Expression
J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3949 - 3957.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. C. Chang, J. Frasor, B. Komm, and B. S. Katzenellenbogen
Impact of Estrogen Receptor {beta} on Gene Networks Regulated by Estrogen Receptor {alpha} in Breast Cancer Cells
Endocrinology, October 1, 2006; 147(10): 4831 - 4842.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Frasor, E. C. Chang, B. Komm, C.-Y. Lin, V. B. Vega, E. T. Liu, L. D. Miller, J. Smeds, J. Bergh, and B. S. Katzenellenbogen
Gene expression preferentially regulated by tamoxifen in breast cancer cells and correlations with clinical outcome.
Cancer Res., July 15, 2006; 66(14): 7334 - 7340.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. T. Ruiz-Cortes, S. Kimmins, L. Monaco, K. H. Burns, P. Sassone-Corsi, and B. D. Murphy
Estrogen Mediates Phosphorylation of Histone H3 in Ovarian Follicle and Mammary Epithelial Tumor Cells via the Mitotic Kinase, Aurora B
Mol. Endocrinol., December 1, 2005; 19(12): 2991 - 3000.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Huang, X. Li, C. A. Maguire, R. Hilf, R. A. Bambara, and M. Muyan
Binding of Estrogen Receptor {beta} to Estrogen Response Element in Situ Is Independent of Estradiol and Impaired by Its Amino Terminus
Mol. Endocrinol., November 1, 2005; 19(11): 2696 - 2712.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. J. Lee and J L. Jameson
Gene therapy of pituitary diseases
J. Endocrinol., June 1, 2005; 185(3): 353 - 362.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Rai, A. Frolova, J. Frasor, A. E. Carpenter, and B. S. Katzenellenbogen
Distinctive Actions of Membrane-Targeted Versus Nuclear Localized Estrogen Receptors in Breast Cancer Cells
Mol. Endocrinol., June 1, 2005; 19(6): 1606 - 1617.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Stossi, D. H. Barnett, J. Frasor, B. Komm, C. R. Lyttle, and B. S. Katzenellenbogen
Transcriptional Profiling of Estrogen-Regulated Gene Expression via Estrogen Receptor (ER) {alpha} or ER{beta} in Human Osteosarcoma Cells: Distinct and Common Target Genes for These Receptors
Endocrinology, July 1, 2004; 145(7): 3473 - 3486.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al.
Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation
Cardiovasc Res, September 1, 2003; 59(3): 734 - 744.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. M. Garcia Pedrero, P. Zuazua, C. Martinez-Campa, P. S. Lazo, and S. Ramos
The Naturally Occurring Variant of Estrogen Receptor (ER) ER{Delta}E7 Suppresses Estrogen-Dependent Transcriptional Activation by Both Wild-Type ER{alpha} and ER{beta}
Endocrinology, July 1, 2003; 144(7): 2967 - 2976.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pedram, M. Razandi, M. Aitkenhead, C. C. W. Hughes, and E. R. Levin
Integration of the Non-genomic and Genomic Actions of Estrogen. MEMBRANE-INITIATED SIGNALING BY STEROID TO TRANSCRIPTION AND CELL BIOLOGY
J. Biol. Chem., December 20, 2002; 277(52): 50768 - 50775.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-C. Hu, C.-R. Shyr, W. Che, X.-M. Mu, E. Kim, and C. Chang
Suppression of Estrogen Receptor-mediated Transcription and Cell Growth by Interaction with TR2 Orphan Receptor
J. Biol. Chem., September 6, 2002; 277(37): 33571 - 33579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-R. Shyr, Y.-C. Hu, E. Kim, and C. Chang
Modulation of Estrogen Receptor-mediated Transactivation by Orphan Receptor TR4 in MCF-7 Cells
J. Biol. Chem., April 19, 2002; 277(17): 14622 - 14628.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. J. Lee, W. R. Duan, M. Jakacka, B. D. Gehm, and J. L. Jameson
Dominant Negative ER Induces Apoptosis in GH4 Pituitary Lactotrope Cells and Inhibits Tumor Growth in Nude Mice
Endocrinology, September 1, 2001; 142(9): 3756 - 3763.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Lazennec, D. Bresson, A. Lucas, C. Chauveau, and F. Vignon
ER{beta} Inhibits Proliferation and Invasion of Breast Cancer Cells
Endocrinology, September 1, 2001; 142(9): 4120 - 4130.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Oesterreich, P. Zhang, R. L. Guler, X. Sun, E. M. Curran, W. V. Welshons, C. K. Osborne, and A. V. Lee
Re-expression of Estrogen Receptor {alpha} in Estrogen Receptor {alpha}-negative MCF-7 Cells Restores both Estrogen and Insulin-like Growth Factor-mediated Signaling and Growth
Cancer Res., August 1, 2001; 61(15): 5771 - 5777.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Lazennec, L. Canaple, D. Saugy, and W. Wahli
Activation of Peroxisome Proliferator-Activated Receptors (PPARs) by Their Ligands and Protein Kinase A Activators
Mol. Endocrinol., December 1, 2000; 14(12): 1962 - 1975.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P.-Y. Chien, M. Ito, Y. Park, T. Tagami, B. D. Gehm, and J. L. Jameson
A Fusion Protein of the Estrogen Receptor (ER) and Nuclear Receptor Corepressor (NCoR) Strongly Inhibits Estrogen-Dependent Responses in Breast Cancer Cells
Mol. Endocrinol., December 1, 1999; 13(12): 2122 - 2136.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lazennec, G.
Right arrow Articles by Katzenellenbogen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lazennec, G.
Right arrow Articles by Katzenellenbogen, B. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals