| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular and Integrative Physiology (G.L., B.S.K.)
and Department of Cell and Structural Biology (B.S.K.) University
of Illinois Urbana, Illinois 61801
Department of
Biochemistry (J.L.A.) University of Texas Southwestern Medical
School Dallas, Texas 75235
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Since the growth of approximately 40% of all human breast cancers is dependent upon the presence of an estradiol-estrogen receptor (ER) complex (4, 5), there is currently intense interest in exploring different ways to functionally inactivate the ER. Although antiestrogens, such as tamoxifen, are widely used to slow the growth of these tumors and are beneficial in about two-thirds of receptor-containing breast cancer patients, the development of resistant cells, the weak agonist activity of tamoxifen, and the metabolism of antiestrogens like tamoxifen to estrogenic compounds often limit their long-term effectiveness (4, 6). The more recently developed pure antiestrogens, such as ICI 182780, also engender resistance in animal model systems, although more slowly (7). An intriguing alternative approach, one that we explore in this study, involves the use of dominant negative ER mutants to suppress the activity of the endogenous ER in estrogen-dependent breast cancer cells.
Dominant negative ERs are ER mutants that are unable to activate transcription and have the additional property of being able to suppress the transcriptional activity of the wild-type ER when they are coexpressed in the same cells. We have identified and studied three ER mutants, altered near the C terminus of the receptor, that have this strong dominant negative activity (8, 9, 10, 11). These dominant negative ERs thus represent a potential new approach to inhibiting ER-mediated bioactivities and, ultimately perhaps, to controlling the growth of estrogen-dependent breast cancer cells. Of the three dominant negative ERs we have developed, the frame-shifted ER (denoted S554fs) has proven to be the most effective in transfection assays employing estrogen-responsive reporter genes (8, 9, 10). Dominant negative ER effectiveness appears to involve three essential aspects: 1) competition between the dominant negative ER and wild-type ER for estrogen response element (ERE) DNA binding, 2) formation of inactive heterodimers between the dominant negative ER and wild-type ER, and 3) interference with some aspect of the transcriptional process resulting in ER-specific transcriptional silencing (10).
In our efforts to ascertain the attractiveness of using dominant
negative ERs as a novel strategy for treatment of hormone-responsive
breast cancer targeted to the ER, we have chosen an adenoviral gene
delivery system because it allows highly efficient gene transfer and
expression. For this purpose, we constructed a recombinant adenovirus
coding for the potent frameshift dominant negative ER (denoted Ad-fs,
adenovirus frameshift). For comparison, we constructed recombinant
adenoviruses coding for antisense human ER
(Ad-AS) or for the sense
wild-type ER
(Ad-WT). We show that adenoviruses expressing the
dominant negative ER are very effective in repressing estrogen-mediated
gene expression and proliferation of ER-positive MCF-7 breast cancer
cells, and we explore the effects of the dominant negative ER on the
cell cycle and on apoptosis. This approach should improve our
understanding of how estrogens act in breast cancer cells and may also
provide a gene therapy approach for extinguishing the growth of
ER-positive breast cancers.
| RESULTS |
|---|
|
|
|---|
wild type), Ad-AS (antisense WT
ER
) and Ad-fs (dominant negative 1554 fs ER; see Fig. 1
|
|
ligand-binding domain (Fig. 3A
specific
antibody, we were able to detect a signal at approximately 66 kDa, the
expected size of the dominant negative and wild-type ERs, only with
Ad-fs- and Ad-WT-infected MDA-MB-231 cells (Fig. 3B
|
Adenovirus-Mediated Expression of the Dominant Negative ER or
Antisense ER Represses Transcriptional Activity by the Endogenous ER in
Breast Cancer Cells
ER-positive MCF-7 breast cancer cells were infected with the
various recombinant adenoviruses to determine whether these viruses
could affect the ability of the endogenous ER to activate the
transcription of estrogen-responsive reporter genes in transient
transfection experiments (Fig. 4
). We
tested three MOIs for each virus, and all the infected cells were
treated with E2. Adrr5 and Ad-WT viruses did not modify
significantly the magnitude of E2 stimulation of reporter
gene activity by the endogenous MCF-7 cell ER. By contrast, the
antisense ER (Ad-AS) and especially the dominant negative ER (Ad-fs)
strongly reduced the E2 induction, to basal levels in the
case of Ad-fs at the highest MOI.
|
|
30%) reduction in estrogen
response was observed upon infection with the Ad-WT ER adenovirus (Fig. 5
Dominant Negative ER or Antisense ER Expression Extinguishes
Estrogen-Stimulated Cell Proliferation
ER-positive MCF-7 cells show a marked estrogen-induced stimulation
of proliferation. Therefore, it was of particular interest to determine
whether our recombinant viruses could influence the proliferation rate
of MCF-7 cells in the presence of E2. We analyzed the
proliferation of MCF-7 cells treated with control vehicle or
E2. Cells were either uninfected (control) or infected with
Adrr5, Ad-WT, Ad-fs, and Ad-AS viruses at three different MOIs (Fig. 6
). The dominant negative ER and the
antisense ER at medium and high MOIs reduced cell proliferation by
approximately 50% and 90%, respectively. By contrast, the empty virus
(Ad5) and expression of the wild-type ER had little effect on MCF-7
cell proliferation, except at the highest MOI, where approximately 25%
reduction in proliferation was observed with expression of the
wild-type ER. Thus, the dominant negative and antisense receptors could
completely abolish the estrogen-induced proliferation, reducing it to
the control (no E2) level.
|
In MCF-7 cells infected with Adrr5 empty virus and exposed to control
vehicle (no E2, Fig. 7A
),
most of the cells were in the G0/G1 stage
(67%) of the cell cycle. Upon the addition of E2, both
G0/G1 and G2/M peaks were
sharpened; now, fewer of the cells (only 46%) were in
G0/G1, and the proportion of cells in
G2/M increased to 44%. Cells infected with Ad-WT virus and
exposed to E2 showed a cell cycle distribution very similar
to that observed for empty virus (Adrr5)-infected MCF-7 cells
exposed to E2, indicating that the expression of additional
wild-type ER was without substantial impact on the cell cycle effects
of E2 evoked by the endogenous MCF-7 cell ER. By contrast,
the effects of Ad-AS and Ad-fs viruses were quite dramatic, as they
blocked most of the cells in the G0/G1 phase
(60% and 67%, respectively) and reduced the number of cells in
G2/M phase (to 32% and 27%, respectively), giving a
distribution similar to that observed for cells that are not treated
with E2. Repeat experiments gave cell cycle distributions
for the different treatment groups closely mirroring those shown in
Fig. 7
. Thus, both the dominant negative and antisense ER constructs
reversed the effects of E2 on the cell cycle.
|
|
| DISCUSSION |
|---|
|
|
|---|
Since the ER plays important roles in the stimulation of hormone-responsive breast cancers, there is currently great interest in exploring approaches to inactivate the biological functions of this receptor. These include the use of dominant negative ERs, antisense ER constructs, and antiestrogen ligands such as tamoxifen and raloxifene. Of note, these three agents work by very different mechanisms. Antiestrogens, the most widely investigated agents, act by locking ERs in an inactive conformation, thereby blocking their transformation into a transcriptionally active state (4, 16). While antiestrogens are very important agents, they often have mixed estrogen agonist and estrogen antagonist properties, and resistance to antiestrogens often develops during long-term treatment. Antisense ER constructs are aimed at abolishing expression of the sense ER mRNA; their effectiveness, as observed in our studies, was good. However, antisense approaches can sometimes be compromised by the fact that antisense is not always optimally stable, thereby not completely abolishing expression of the sense mRNA. Dominant negative ERs are transcriptionally inactive ERs that can heterodimerize with the wild-type ER, thus forming inactive heterodimers (8, 10, 11). Their use to suppress hormone-induced endogenous gene expression and cell proliferation is described for the first time in this work.
Our previous studies showed that the frame-shifted dominant negative ER was able to complex to the wild-type ER in MCF-7 breast cancer cells and suppress estrogen-responsive reporter gene activity (9). Since previous transfection of MCF-7 cells with the dominant negative ER (9) was quite inefficient, with only 510% of the cells transfected with the dominant negative ER, we were not able to examine the effects of the dominant negative ER on cell proliferation and the hormonal regulation of endogenous genes. We now show that when the dominant negative ER is delivered to essentially all cells, this mutant ER can eliminate estrogen stimulation of endogenous estrogen-responsive genes (pS2, c-myc) and suppress estrogen-stimulated breast cancer cell proliferation. Intriguingly, the dominant negative receptors, in blocking ER functional activity, arrest cells in the G0/G1 phase of the cell cycle and increase the fraction of cells undergoing apoptosis, effects that have also been observed previously with antiestrogen treatment of breast cancer cells (17, 18).
In assays evaluating the suppression of estrogen action, the dominant
negative ER (Ad-fs) was able to repress c-myc and pS2 gene
induction by estrogen. Interestingly, repression of c-myc
induction by Ad-fs could be achieved with medium and even low MOI of
virus, whereas a total repression of pS2 gene induction was only
observed with a high MOI of Ad-fs. This suggests that different levels
of ER may be needed normally for induction of these different
estrogen-regulated genes. Since our studies used MCF-7 cells that
contain endogenous wild-type ER, and our antibodies cannot distinguish
between endogenous ER and the dominant negative ER expressed by the
virus, we used ß-galactosidase staining to determine optimal
infection conditions. Based on our prior studies with this
frame-shifted dominant negative ER, we know that an amount of dominant
negative ER equal to that of wild-type ER gives substantial inhibition
of wild-type receptor and that a 3-fold excess of dominant negative ER
fully suppresses wild-type ER activity. At these levels, the dominant
negative ER has no effect on other nuclear receptors such as the
progesterone receptor (8, 9, 10). The data in Figs. 4
and 5C
, showing that
reporter gene activity is not affected by the additional production of
wild-type ER from the adenoviral vector, and that expression of a
non-estrogen-regulated gene (actin) is not affected at the MOIs used,
indicate that the effects of the dominant negative ER are selective and
that transcriptional squelching is not occurring.
Ad-fs and Ad-AS were both good repressors of MCF-7 cell proliferation. The reduced proliferation brought about by the dominant negative or antisense ERs appears to be explained by a decrease in the number of cells in G2/M phase and an increase of cells in G0/G1, which mimicked closely the difference between nontreated and E2-treated MCF-7 cells. Of interest, a similar increase in the proportion of cells in the G0/G1 phase of the cell cycle has been observed with antiestrogen treatment of ER-positive breast cancer cells (17, 18), indicating that these agents, although acting by different mechanisms, can all bring about the abrogation of ER function in cancer cells.
Several other reports have shown the efficacy of gene therapy approaches with adenovirus for targeting important signaling proteins in breast cancer cells (19, 20, 21, 22), but most of these experiments were not performed in the presence of estrogen, and none were directed toward the abrogation of hormone responsiveness. Exciting studies have shown that use of an adenovirus coding for the dominant negative repressor of Bcl-2, Bcl-xs (which sensitizes cells to apoptosis), could dramatically reduce MCF-7 cell survival (22). With Ad-fs and Ad-AS, we also observed a significant increase in the proportion of cells undergoing apoptosis, indicating that the reduced proliferation obtained through disrupting the ER pathway is a consequence of impairment of the cell cycle that is reflected also by increased apoptosis.
In conclusion, our data demonstrate that use of adenoviruses coding for a dominant negative ER is a very effective way to abrogate hormone-induced gene expression and proliferation of ER-positive breast cancer cells. These findings suggest the potential value of this strategy, which disrupts the ER signal transduction pathway, in providing an alternative therapeutic approach to treatment of hormone-responsive breast cancer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotide Sequences
The sequences of the oligonucleotides used for RT-PCR or gel
shift are indicated below (s, sense; as, antisense).
EREs: AGCTCTTTGATCAGGTCACTGTGACCTGACTTT
EREas: AGTCTAAAGTCAGGTCACAGTGACCTGATCAAAG
ACTINs: ACCATGGATGATGATATCGC
ACTINas: ACATGGCTGGGGTGTTGAAG
pS2s: TGACTCGGGGTCGCCTTTGGAG
pS2as: GTGAGCCGAGGCACAGCTGCAG
ERs: AACAGCCTGGCCTTGTCCCTG
ERas: GCACTTCATGCTGTACAGATGCT
Construction of Adenoviral Vectors and Infection Procedures
The complete coding sequence of human ER
wild type (encoding
amino acids 1595) in the sense (Ad-WT) or antisense (Ad-AS)
orientation or mutant dominant negative ER (1554-fs) (Ad-fs) (8, 11)
cDNAs was subcloned in the BamHI site of the
pACsk12CMV5 shuttle vector. To obtain recombinant viruses,
permissive 293 cells (human embryonic kidney cell line transformed by
the E1A and E1b) were cotransfected (12) with the recombinant
pACsk12CMV5-hER plasmid and with pJM17, which contains the remainder of
the adenoviral genome (13). In vivo recombination of the
plasmids yields a recombinant viral genome (Ad-WT, Ad-fs, Ad-AS) of
packagable size and the subsequent generation of infectious viral
particles (see Fig. 1
). Adrr5 is a control recombinant adenovirus that
does not carry any transgene but has the same adenoviral backbone.
Viral plaques were isolated and propagated to produce a lysate
containing infectious recombinant virus as described by Graham et
al. (12). DNAs from these viruses were screened for the presence
of the fusion gene by PCR with ER primers, and titered virus stocks
were used to infect MCF-7 cells.
To monitor adenovirus infection by ß-gal staining, MCF-7 cells were infected overnight and the staining was performed 48 h later. Cells were washed twice with PBS and then fixed at 4 C in fixing solution (2% formaldehyde, 0.2% glutaraldehyde, 1x PBS) for 5 min. Cells were then stained overnight at 37 C in staining solution (5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 1xPBS, 1 mg/ml X-Gal). Staining of cells was then observed under a microscope.
Cell Culture and Transient Transfection
293 cells were carried in 10% FCS in DMEM in a CO2
incubator. ER-positive human breast cancer MCF-7 cells and ER-negative
human breast cancer MDA-MB-231 cells were grown at 37 C as previously
described (9, 23). Cells were plated in 60-mm plates in 5% charcoal
dextran-treated calf serum (CDCS) in Improved MEM (IMEM) and incubated
for 48 h with 5% CO2. Transfections were performed
using 4 µg of 2ERE-pS2-CAT and 0.8 µg of the internal reference
ß-galactosidase reporter plasmid pCMVß. Cells were first
infected with the different viruses overnight. After 24
h, cells were incubated with calcium phosphate-precipitated DNA
overnight and then rinsed in HBSS. Ligand treatment was then added in
growth medium. Cells were harvested 24 h after ligand treatment
and lysed by cycles of freezing on dry ice and thawing at 37 C.
Transactivation ability as determined by chloramphenicol
acetyltransferase (CAT) activity on the whole cell extract was assayed
as described previously (9, 23). CAT assays were normalized
to ß-galactosidase activity from the cotransfected internal control
plasmid.
RNA Isolation, RT-PCR, and Slot Blot Analysis
Total RNA was isolated using Triazol reagent from Life Technologies, Inc., (Gaithersburg, MD) as described by the
manufacturer. Random primers (Perkin-Elmer Corp., Norwalk,
CT) were used to synthesize a single-stranded cDNA using 10 µg of
total RNA as described (24). A portion (1/50) of the cDNA solution was
used to amplify fragments of human ER or other cDNAs in the presence of
2.5 U of Taq polymerase (Perkin-Elmer Corp.).
Cycles of 45 sec at 94 C (denaturation), 1 min at annealing
temperature, and 2 min at 72 C (extension) were done 30 times. A tenth
of each PCR reaction was electrophoresed on 2% agarose gel. The
following annealing temperatures were used: actin, 60 C;
c-myc, 65 C; human ER, 65 C; pS2, 65 C.
For slot blot analysis, 10 µg of total RNA were blotted on nylon membrane by standard procedure (24). After fixation at 80 C for 1 h, the membrane was hybridized at 42 C in hybridization buffer (50% formamide, 5x SSC, 1x Denhardts, 0.1% SDS) and then washed at room temperature for 20 min in 1x SSC, 0.1% SDS, and three times for 20 min in 0.2x SSC, 0.1% SDS at 68 C.
Preparation of Whole-Cell Extracts
Cells were harvested, washed in PBS, and resuspended in TEG
(10 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, and 10%
glycerol)/0.4 M KCl) containing 5 µg/ml aprotinin,
leupeptin, and pepstatin A and 0.1 mM phenylmethylsulfonyl
fluoride. Then, cells were sonicated and the cellular debris was
pelleted by centrifugation at 14,000 rpm for 20 min.
Western Blot Analysis
Thirty micrograms of nuclear proteins were subjected to SDS-PAGE
followed by electrotransfer onto a nitrocellulose membrane. The blot
was probed with H222 ER antibody (40 ng/ml) and then incubated with
rabbit anti-rat IgG horseradish peroxidase-conjugated antibody (1
µg/ml). The enhanced chemiluminescence (ECL) kit from Amersham Pharmacia Biotech (Arlington, IL) was used for protein
detection.
Cell Proliferation Studies
Cells were maintained for 7 days in 20% CDCS in IMEM and then
seeded at 5,000 cells per well in 24-well dishes in 20% CDCS IMEM.
Cells were infected overnight with the different viruses. The next
morning, the medium was removed and replaced with fresh medium.
Treatment with the different ligands was begun at the same time. After
4 days, the cells were incubated with 1 µCi
[methyl-3H]thymidine at 37 C for 3 h. Plates were
sequentially washed and fixed with ice-cold PBS, 10% trichloroacetic
acid, MeOH, and the incorporated label was recovered by incubation of
the wells in 0.5 N NaOH for 30 min at 37 C. Lysates were
transferred to vials containing Scintiverse TM cocktail (Fisher Scientific, Pittsburgh, PA), and [3H]thymidine was
determined by scintillation counting.
Flow Cytometry Experiments
To analyze the effects of recombinant viruses on the cell cycle
and on apoptosis, MCF-7 cells were infected with the adenoviral
vectors, and cells were treated with Br-dUTP and propidium iodide
(Apo-BRDU kit, Phoenix Flow Systems, San Diego, CA). Br-dUTP is
used to label the 3'-hydroxyl ends occurring during DNA breakage when
apoptosis occurs. Propidium iodide was used to measure the total DNA
content of cells. The reactions were performed as specified by the
manufacturer. Fluorescence-activated cell sorting (FACS)
analysis was performed on an Epics-XL flow cytometer (Beckman Coulter,
Fullerton, CA).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by NIH Grant CA-60514 (B.S.K.) and in part by a postdoctoral fellowship from the Susan G. Komen Foundation (G.L.).
1 Current Address: INSERM U148, 60 rue de Navacelles, 34090,
Montpellier, France. ![]()
Received for publication January 20, 1999. Revision received March 4, 1999. Accepted for publication March 9, 1999.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Hassan, S. A. Salama, H. M. M. Arafa, F. M. A. Hamada, and A. Al-Hendy Adenovirus-Mediated Delivery of a Dominant-Negative Estrogen Receptor Gene in Uterine Leiomyoma Cells Abrogates Estrogen- and Progesterone-Regulated Gene Expression J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3949 - 3957. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Chang, J. Frasor, B. Komm, and B. S. Katzenellenbogen Impact of Estrogen Receptor {beta} on Gene Networks Regulated by Estrogen Receptor {alpha} in Breast Cancer Cells Endocrinology, October 1, 2006; 147(10): 4831 - 4842. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Frasor, E. C. Chang, B. Komm, C.-Y. Lin, V. B. Vega, E. T. Liu, L. D. Miller, J. Smeds, J. Bergh, and B. S. Katzenellenbogen Gene expression preferentially regulated by tamoxifen in breast cancer cells and correlations with clinical outcome. Cancer Res., July 15, 2006; 66(14): 7334 - 7340. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. T. Ruiz-Cortes, S. Kimmins, L. Monaco, K. H. Burns, P. Sassone-Corsi, and B. D. Murphy Estrogen Mediates Phosphorylation of Histone H3 in Ovarian Follicle and Mammary Epithelial Tumor Cells via the Mitotic Kinase, Aurora B Mol. Endocrinol., December 1, 2005; 19(12): 2991 - 3000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang, X. Li, C. A. Maguire, R. Hilf, R. A. Bambara, and M. Muyan Binding of Estrogen Receptor {beta} to Estrogen Response Element in Situ Is Independent of Estradiol and Impaired by Its Amino Terminus Mol. Endocrinol., November 1, 2005; 19(11): 2696 - 2712. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Lee and J L. Jameson Gene therapy of pituitary diseases J. Endocrinol., June 1, 2005; 185(3): 353 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Rai, A. Frolova, J. Frasor, A. E. Carpenter, and B. S. Katzenellenbogen Distinctive Actions of Membrane-Targeted Versus Nuclear Localized Estrogen Receptors in Breast Cancer Cells Mol. Endocrinol., June 1, 2005; 19(6): 1606 - 1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stossi, D. H. Barnett, J. Frasor, B. Komm, C. R. Lyttle, and B. S. Katzenellenbogen Transcriptional Profiling of Estrogen-Regulated Gene Expression via Estrogen Receptor (ER) {alpha} or ER{beta} in Human Osteosarcoma Cells: Distinct and Common Target Genes for These Receptors Endocrinology, July 1, 2004; 145(7): 3473 - 3486. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al. Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation Cardiovasc Res, September 1, 2003; 59(3): 734 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Garcia Pedrero, P. Zuazua, C. Martinez-Campa, P. S. Lazo, and S. Ramos The Naturally Occurring Variant of Estrogen Receptor (ER) ER{Delta}E7 Suppresses Estrogen-Dependent Transcriptional Activation by Both Wild-Type ER{alpha} and ER{beta} Endocrinology, July 1, 2003; 144(7): 2967 - 2976. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pedram, M. Razandi, M. Aitkenhead, C. C. W. Hughes, and E. R. Levin Integration of the Non-genomic and Genomic Actions of Estrogen. MEMBRANE-INITIATED SIGNALING BY STEROID TO TRANSCRIPTION AND CELL BIOLOGY J. Biol. Chem., December 20, 2002; 277(52): 50768 - 50775. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Hu, C.-R. Shyr, W. Che, X.-M. Mu, E. Kim, and C. Chang Suppression of Estrogen Receptor-mediated Transcription and Cell Growth by Interaction with TR2 Orphan Receptor J. Biol. Chem., September 6, 2002; 277(37): 33571 - 33579. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Shyr, Y.-C. Hu, E. Kim, and C. Chang Modulation of Estrogen Receptor-mediated Transactivation by Orphan Receptor TR4 in MCF-7 Cells J. Biol. Chem., April 19, 2002; 277(17): 14622 - 14628. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Lee, W. R. Duan, M. Jakacka, B. D. Gehm, and J. L. Jameson Dominant Negative ER Induces Apoptosis in GH4 Pituitary Lactotrope Cells and Inhibits Tumor Growth in Nude Mice Endocrinology, September 1, 2001; 142(9): 3756 - 3763. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lazennec, D. Bresson, A. Lucas, C. Chauveau, and F. Vignon ER{beta} Inhibits Proliferation and Invasion of Breast Cancer Cells Endocrinology, September 1, 2001; 142(9): 4120 - 4130. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oesterreich, P. Zhang, R. L. Guler, X. Sun, E. M. Curran, W. V. Welshons, C. K. Osborne, and A. V. Lee Re-expression of Estrogen Receptor {alpha} in Estrogen Receptor {alpha}-negative MCF-7 Cells Restores both Estrogen and Insulin-like Growth Factor-mediated Signaling and Growth Cancer Res., August 1, 2001; 61(15): 5771 - 5777. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lazennec, L. Canaple, D. Saugy, and W. Wahli Activation of Peroxisome Proliferator-Activated Receptors (PPARs) by Their Ligands and Protein Kinase A Activators Mol. Endocrinol., December 1, 2000; 14(12): 1962 - 1975. [Abstract] [Full Text] |
||||
![]() |
P.-Y. Chien, M. Ito, Y. Park, T. Tagami, B. D. Gehm, and J. L. Jameson A Fusion Protein of the Estrogen Receptor (ER) and Nuclear Receptor Corepressor (NCoR) Strongly Inhibits Estrogen-Dependent Responses in Breast Cancer Cells Mol. Endocrinol., December 1, 1999; 13(12): 2122 - 2136. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |