| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
via Induction of Rab11 in Uterine Glands during Implantation
Population Council and The Rockefeller University New York, New York 10021
| ABSTRACT |
|---|
|
|
|---|
6- to 8-fold) between days 35 immediately before
implantation. In situ hybridization and immunocytochemistry
revealed that rab11 expression in the uterus was predominantly in the
glandular epithelium. In ovariectomized rats, the expression of rab11
mRNA was induced in the endometrium in response to estrogen. To
determine whether this effect of estrogen was mediated through its
nuclear receptors, we examined rab11 expression in a transformed
endometrial cell line, Ishikawa. In transient transfection experiments,
we observed that overexpression of estrogen receptor (ER)
or ß
induced endogenous rab11 mRNA in a hormone-dependent manner. ER bound
to an antagonist, ICI 182,780, failed to activate this gene expression.
These findings, together with the observation that ER
but not ERß
is detected in the glands of the preimplantation uterus, indicate that
rab11 is one of the proteins that are specifically induced by
estrogen-complexed ER
in rat endometrium at the onset of
implantation. Our results imply that estrogen, which induces the
synthesis of many growth factors and their receptors and other
secretory proteins that are thought to be critical for implantation,
may also facilitate their transport to the membrane and/or secretion by
stimulating the expression of rab11, a component of the
membrane-trafficking pathway. This study therefore provides novel
insights into the diverse cellular mechanisms by which estrogen, acting
via its nuclear receptors, may influence blastocyst implantation. | INTRODUCTION |
|---|
|
|
|---|
Estrogen profoundly influences uterine functions at various phases of the menstrual cycle and pregnancy. In the rat, the preovulatory ovarian estrogen is important for uterine cellular proliferation and differentiation during early stages (days 1 and 2 postfertilization) of pregnancy (7, 8). This transformation of the uterus in response to estrogen is important for subsequent uterine preparation for embryonic implantation and successful establishment of pregnancy (7, 8). After fertilization the level of estrogen declines and remains low throughout gestation, except a transitory rise in estrogen level that occurs on day 4 of pregnancy (9). Although estrogen is essential to create the receptive state of the uterus that allows implantation on day 5, the molecular basis of this hormonal effect remains unclear.
The cellular actions of estrogen are mediated through estrogen
receptors, ER
and ERß, which function as ligand-inducible
transcription factors (10, 11, 12, 13). The uterotropic hormonal
responses to estrogen are believed to be mediated through the
expression of specific estrogen-regulated genes in the uterus (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24).
Studies in rodents employing immature and ovariectomized model systems
have demonstrated that in the uterus estrogen modulates the expression
of several genes that are likely to be involved in the regulation of
cell growth and division. These include the genes encoding
protooncogenes, such as c-fos and c-myc, growth
factors, such as epidermal growth factor (EGF) and insulin-like growth
factor-I, and their receptors (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). However, the
relationship of these gene activation events to the complex
estrogen-regulated physiological processes, such as uterine
receptivity, secretory protein production, and embryonic implantation,
have not been clearly established.
To investigate the molecular basis of the estrogen regulation of implantation, we sought to identify the genes whose expression in the preimplantation endometrium is induced by estrogen. For this purpose, we employed a delayed implantation rat model that allows one to determine the independent functional roles of estrogen and progesterone on implantation (1, 2). In these rats, which have undergone ovariectomy on day 4 of gestation, implantation is blocked in the absence of ovarian estrogen. Continued administration of progesterone allows the blastocysts to remain viable, but the attachment of the embryo to the uterine epithelium will not occur in the absence of estrogen. Such a delayed state can be maintained for up to 710 days after fertilization. Administration of estrogen to the ovariectomized pregnant rats triggers implantation within 1224 h, emphasizing the critical role of estrogen in this process (25, 26).
We used the mRNA differential display (DD) technique to isolate a number of cDNAs representing mRNAs whose expression are either turned on or turned off in response to an implantation-inducing dose of estrogen in rats undergoing delayed implantation. Our studies revealed that rab11, which is present at a low level in the progesterone-treated delayed rats, is markedly induced when estrogen is administered to these rats to overcome the delay. rab11 belongs to the rab family of low-molecular mass G proteins that share significant homologies with p21 ras (27, 28, 29). The members of the rab family are thought to be required at distinct steps in transport along the secretory pathway, especially for the targeting and fusion of transport vesicles with the plasma membrane. The timing of its enhanced expression in the endometrial glands prompts us to propose that rab11 may function by regulating secretory activities that are critical for blastocyst implantation.
| RESULTS |
|---|
|
|
|---|
|
Rab11 Transcripts Are Induced in Pregnant Rat Uterus within the
Window of Implantation
We next examined the profiles of expression of the 2.3-kb
and 1-kb rab11 transcripts in normal pregnant rat uterus during days
16 of gestation by employing Northern blot analysis. As shown in Fig. 2
, the overall profiles of expression of
the two transcripts were similar. Both transcripts were detected on
days 12 of pregnancy. However, the shorter transcript was
consistently expressed at a higher level than the longer one. The
levels of both transcripts increased significantly on day 3, attained a
maximum on days 45, and then declined sharply by day 6 of pregnancy.
These results indicated that a transient surge of rab11 mRNA expression
occurs in the uterus in a highly stage-specific manner, that is between
days 35 of gestation, and this temporally coincides with the
preparatory events leading to implantation. The relative levels of
expression of the 2.3-kb and 1-kb transcripts were estimated by
densitometric scanning, followed by normalization with respect to the
control GAPDH mRNA signal. By our estimate, the level of either
transcript on day 45 was about 6- to 8-fold higher than that on day 1
of gestation (Fig. 2B
).
|
|
We also investigated the site of accumulation of rab11 protein by
immunocytochemical staining of sections of uteri isolated from day 4
pregnant animals using a polyclonal antibody specific for this protein.
As shown in Fig. 4
(left
panel), rab11-specific immunostaining was present predominantly in
the glandular epithelial cells. Weaker but specific immunostaining was
observed in the luminal epithelium. No significant staining was
observed in the stroma or myometrium. Control sections of the same
uterine tissue, when incubated with preimmune serum, showed no
immunoreactivity, indicating the specificity of the immunostaining
(Fig. 4
, right panel). These results, consistent with the
in situ hybridization analysis, showed that rab11 protein is
expressed in the glandular epithelial cells around the time of
implantation.
|
5-fold) within 24 h of injection with a single dose of
estrogen (data not shown). Collectively, these results established that
rab11 expression in the uterus is under estrogenic regulation.
|
85%) decline in the level of rab11 mRNA but did
not affect the expression of GAPDH mRNA. These results strongly
suggested that ICI 182,780 switched off the rab11 gene expression
during implantation by inhibiting the ERs.
ER
Level Increases in the Glandular Epithelium during rab11
Expression
If rab11 mRNA synthesis during implantation is mediated by ERs,
one would expect to find these receptor proteins in the glandular cells
at the time of this gene induction. To monitor the expression of ERs in
glandular epithelium during early pregnancy, we performed
immunohistochemical staining of sections of uteri isolated from
pregnant animals (days 15) using polyclonal antibodies specific for
each ER isoform. When we used an antibody against ER
, the uterine
sections of animals on day 1 of pregnancy exhibited very little
immunostaining in the glandular epithelium, while those from day 4 or
day 5 pregnant animals showed significant ER
-specific staining (Fig. 6
, panels D1, D4, and D5, respectively).
The ER
immunostaining declined to undetectable levels on day 6 of
gestation (panel D6). We noted considerable ER
stromal
immunostaining on days 16 (panels D1D6). Sections of uteri (days
16) incubated with control serum did not exhibit any specific
immunostaining (data not shown). We failed to detect any expression of
ERß in the endometrial sections using an ERß-specific antibody,
although this antibody efficiently immunoreacted with ERß present in
other tissues such as prostate (data not shown). These results are
consistent with recent reports indicating that ER
is the predominant
isoform of ER in the endometrium (36). Sufficient quantities of ER
are therefore present in the glandular epithelial cells while rab11
mRNA is induced between days 35 of gestation. This observation is
consistent with a direct regulatory role for ER
in rab11 gene
expression during implantation.
|
or ERß in Ishikawa Cells Induces rab11
mRNA
or ERß was transfected into these cells in the absence
of estrogen (lanes 3 and 7). However, when either ER expression vector
was transfected in the presence of 100 nM estrogen, a 6- to
8-fold induction in rab11 mRNA was observed (lanes 4 and 8). This
ER-mediated induction of rab11 transcripts was completely dependent on
estrogen, since ER
complexed with ICI 182,780 failed to promote
rab11 expression (lane 5 and 6). These results clearly indicated that
the rab11 gene induction by estrogen is mediated by the ER, and both
receptor isoforms have the ability to perform this regulatory
function.
|
| DISCUSSION |
|---|
|
|
|---|
The control of estrogen-dependent secretions of important regulatory factors during implantation may occur at multiple levels. At one level, estrogen may induce the synthesis of a number of growth factors and other proteins in the glands that are positive modulators of the implantation process. At another level, estrogen may facilitate secretion of these induced factors by regulating critical components of the secretory pathway. It has been reported that in mice undergoing delayed implantation, no LIF is synthesized in the uteri containing viable but unattached blastocysts. A single injection of estrogen, which interrupts the delay, also induces secretion of LIF by the endometrial glands within 1824 h (39, 45). It is conceivable that estrogen plays a dual regulatory role by controlling both synthesis and secretion of LIF during implantation. Our finding in this paper supports such a scenario, as estrogen significantly enhances the expression of rab11, which is known to function in membrane trafficking and cellular secretory pathway.
Rab11 is a recently discovered member of a large superfamily of small ras-related GTP-binding proteins that has been grouped into several main branches: ras, rho, and rab, according to their sequence homologies and functional features (27, 28, 29). The members of the rab subgroup function as key signal components that regulate many aspects of vesicular transport along both the endocytotic and exocytotic pathways (27, 28, 29). Different rab proteins exhibit cell type-specific variations in expression, as well as differential localization to distinct vesicular compartments and organelles that perform multiple sorting functions. The cDNA encoding rab11 has been isolated and is found to be highly conserved among different species (27). Transcription of the mammalian rab11 gene yields two mRNAs, 1 and 2.3 kb, which share identical coding sequences but differ in the length and sequence of their 3'-untranslated regions (34). Sequence analysis of the cDNAs identified two different poly A signals at positions 927 and 2302 of the larger transcript (34). It has been suggested that the two mRNA species originate from a single gene by the use of different polyadenylation sites (34). Both rab11 transcripts yield the same protein product.
Although ubiquitously expressed, rab11 is more abundant in tissues with a high level of secretion (33). This observation led to the suggestion that rab11 might function in the exocytic pathway. All cells secrete some proteins in a constitutive fashion. Urbe et al. (49) found rab11 associated with the trans-Golgi network-derived vesicles involved in both the constitutive and the regulated secretory pathway in the neuroendocrine cell line PC12. Goldenring et al. (50) localized rab11 in the apical tubulovesicles of the acid-secreting parietal cells in the gastrointestinal tract. In addition, rab11 was found associated with the apical vesicular populations in a variety of polarized epithelial cells (51). Rab11 interconverts between GDP and GTP-bound conformations, as part of a catalytic cycle of vesicle delivery and rab protein recycling.
Rab11 expression, however, is not restricted to the secretory cells. This protein has been localized in the pericentriolar recycling endosomes of certain nonpolarized cells in which it is thought to function in the recycling pathway of plasma membrane receptors (52). Studies using rab11 mutants that are preferentially in the GTP- or GDP-bound state showed that GTP activation is necessary for rab11 to function in protein trafficking through the sorting endosomes to either the recycling compartment or the plasma membrane (52, 53). The precise role of rab11 in the membrane trafficking in endometrial glands is unknown. However, it is reasonable to assume that rab11 is in some way involved in targeting the transport vesicles destined to fuse with the plasma membrane. In this way, it may facilitate secretion of estrogen-induced secretory proteins. Additionally, rab11 may also be involved in recycling of estrogen-induced growth factor receptors.
How does estrogen modulate rab11 expression? Estrogen mediates its
gene-regulatory activity through intracellular ER isoforms, ER
and
ERß, which regulate transcription of target cellular genes (13). Our
studies show clearly that both isoforms of ER are able to induce rab11
expression in Ishikawa endometrial cells. In the uterine glands,
however, the expression of ER
is far greater than that of ERß,
which is virtually undetectable. It is therefore reasonable to infer
that ER
, rather than ERß, mediates estrogen regulation of rab11
expression in the glandular epithelium. Consistent with this scenario,
the profile of rab11 expression in the uterine glands overlaps closely
that of ER
(Fig. 6
).
Previous studies indicated that a transient surge of estrogen on day 4
of gestation in the rat is essential for implantation on the following
day (1, 2). The relationship between this preimplantation estrogen
surge and rab11 expression remains unclear. Our studies indicate that
rab11 expression, which starts to rise on day 3 and attains a peak on
day 45, slightly precedes the preimplantation estrogen surge.
Nevertheless, it is clear from our antiestrogen studies (Fig. 5C
) that
the expression of rab11 between days 35 of gestation is primarily
under estrogenic regulation. Furthermore, there is an excellent
correlation between the expression profiles of rab11 and ER
in the
glands (Figs. 3B
and 6
). However, we cannot rule out the possibility
that other factor(s) in addition to ER
modulates rab11 expression in
the preimplantation uterus. This view is supported by a low but
detectable level of uterine rab11 expression in ICI 182,780-treated or
delayed implanting rats (see Figs. 1B
and 5C
).
The possibility that ER directly regulates rab11 gene expression in
glandular epithelium has interesting implications for cell
type-specific actions of ER within the endometrium. It was previously
thought that estrogen acting through ER stimulates uterine epithelial
cell growth, proliferation, and differentiation. Recent studies by
Cooke et al. (54) however, question the role of epithelial
ER
in the normal uterine response to estrogen. Using tissue
recombinants prepared with uterine tissue from adult ER
knockout
(ERKO) and normal neonatal mice, these workers observed that epithelial
ER
is neither necessary nor sufficient to mediate the mitogenic
response to estrogen in the epithelium. Interestingly, estrogen-induced
epithelial proliferation appears to be mediated through stromal ER
in a paracrine manner. In contrast, the same group ofworkers
recently reported that both epithelial and stromal ER
are essential
for secretory protein production in uterine epithelial cells (55).
These findings are consistent with our hypothesis that glandular ER
facilitates uterine secretions by stimulating the cellular levels of
specific components of the secretory pathway such as rab11. We have
noted strong stromal ER
expression during the entire preimplantation
period (Fig. 6
). However, it is not clear whether these stromal ER
s
play a role in estrogen-mediated rab11 induction in the tissue. Further
studies in primary cell culture systems and tissue recombinants using
rab11 as a specific marker of estrogen action in the epithelium will
help us to understand the intra- and intercellular signaling mechanisms
that modulate the gene-regulatory activity of ER in specific uterine
cell types.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and -ß antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Animals
All experiments involving animals were conducted according to
NIH standards for the care and use of experimental animals. Virgin
female rats (Sprague-Dawley, from Charles River Laboratories, Inc., Wilmington, MA; 6075 days of age), in proestrus, were
mated with adult males. The different stages of the cycle in the
nonpregnant rats were ascertained by examining vaginal smears. The
presence of a vaginal plug after mating was designated as day 1 of
pregnancy. The animals were killed at various stages of gestation and
the uteri collected. In some experiments, animals were ovariectomized
and 2 weeks later were injected subcutaneously with either estradiol (2
µg/kg body weight), progesterone (40 mg/kg body weight), or a
combination of both hormones or vehicle (sesame oil) as described in
Results. The rats were killed 16 h after final
injection.
To induce and maintain delayed implantation, rats were ovariectomized on day 4 of pregnancy and injected daily with progesterone (10 mg) from days 58. To terminate delayed implantation and induce blastocyst activation, the progesterone-primed delayed implanting rats were given an injection of estrogen (0.25 µg) on the third day of the delay (day 8). Rats were killed at 24 h after the estrogen injection.
DD
Total RNAs were extracted from delayed rats before and after
estrogen treatment using an RNAgents isolation system (Promega Corp., Madison, WI). RNA samples were freed of DNA after
treatment with DNAse I (Genehunter Corp., Brookline, MA) and subjected
to DD reactions as described previously (30, 31, 32) with certain
modifications. Briefly, 2 µg of DNA-free total RNA were
reverse-transcribed with 200 U of MMLV reverse transcriptase
(Promega Corp.) in the presence of 1 mM
T12MA, or T12MC or T12MG primer
(Genehunter Corp.), where M is a mixture containing dG, dA, and
dC. The reaction was performed at 37 C for 1 h. One tenth of this
reaction was then used in a PCR amplification reaction containing 2
mM each of deoxynucleoside triphosphates, 10
mCi of [35S] dATP (Amersham, Arlington
Heights, IL), two primers: 1 mM of a T12
oligonucleotide and 0.2 mM of one of the five arbitrary
decamers, AP-1 (5'-AGCCAGCGAA-3'); AP-2 (5'-GACCGCTTGT-3'); AP-3
(5'-AGGTGACCGT-3'); AP-4 (5'-GGTACTCCAC-3'); AP-5 (5'-GTTGCGATCC-3').
These reactions also contained 1 U of AmpliTaq DNA polymerase
(Perkin Elmer Corp., Norwalk, CT). The cycling parameters
for PCR were 94 C for 30 sec, 40 C for 2 min, and 72 C for 30 sec for
40 cycles. After PCR amplification, samples were analyzed on a 6%
polyacrylamide sequencing gel, dried without fixation, and exposed to
Kodak XAR-5 film (Eastman Kodak Co., Rochester, NY) for
72 h. Bands exhibiting differential expression were cut out from
the gel, and DNA was eluted by boiling as described previously
(30, 31, 32). Eluted DNA samples were then reamplified by PCR using the
corresponding pair of primers under the same conditions as described
above, except that neither 25 mM deoxynucleoside
triphosphate nor radioisotope was used. The PCR products were
cut from 2.5% low-melt agarose gels, subcloned into Pinpoint Vector
(Promega Corp.), and subjected to nucleotide sequence
analysis.
Northern Blot Analysis
For Northern analysis 20 µg of total RNA were separated by
formaldehyde agarose gel electrophoresis and transferred to Duralon
membrane (Stratagene, La Jolla, CA). After transfer, the
membranes were baked at 80 C for 2 h. Blots were prehybridized in
50 mM NaPO4, pH 6.5/5x SSC/5x
Denhardts/50% formamide/0.1% SDS and 100 µg/ml salmon sperm DNA
for 4 h at 42 C. Hybridization was carried out overnight in the
same buffer containing 106 cpm/ml of a
32P-labeled rab11 cDNA fragment. The filters were washed
twice for 15 min in 1x SSC/0.1% SDS at room temperature, and then
twice for 20 min in 0.2x SSC/0.1% SDS at 55 C, and the filters were
exposed to x-ray films for 2472 h. The intensities of signals on the
autoradiogram were estimated by densitometric scanning. To correct for
RNA loading, the obtained signals were normalized with respect to the
GAPDH signal in the same blot. For this the filters were stripped of
the radioactive probe by washing for 10 min in 0.5% SDS at 95 C. The
blots were then reprobed with a 32P-labeled GAPDH probe
(CLONTECH Laboratories, Inc., Palo Alto, CA) as described
above.
In Situ Hybridization
Uterine tissue from pregnant animals was collected and frozen.
Tissues were fixed in 4% paraformaldehyde at 4 C. Cryostat sections
were cut at 8 µm and attached to 3-aminopropyl triethyl silane-coated
slides (Sigma Chemical Co.). In situ
hybridization was performed with DIG-labeled sense or antisense RNA
probes complimentary to nucleotides 341730 of rat rab11 gene.
DIG-labeled RNA probes were synthesized from rab11 cDNA using T3 or T7
RNA polymerase and DIG-labeled nucleotides according to manufacturers
specifications (Boehringer Mannheim, Indianapolis, IN).
Prehybridization was carried out in a damp chamber at 37 C for 60 min
in hybridization buffer (50% formamide, 5x SSC, 2% blocking reagent,
0.02% SDS, 0.1% N-laurylsarcosine). Hybridization was
carried out at 42 C overnight in a damp humidified chamber. To develop
the substrate, sections were sequentially washed in 2x SSC, 1x SSC,
and 0.1x SSC for 15 min in each buffer at 37 C. Sections were then
incubated with anti-DIG alkaline phosphatase-conjugated antibody.
Excess antibody was washed away, and the color substrate (nitroblue
tetrazolium salt and 5-bromo-4-chloro-3-indoylphosphate) was
added. Slides were allowed to develop in the dark, and the color was
visualized under light microscopy until maximum levels of staining were
achieved. The reaction was stopped and the slides were counterstained
in Nuclear Fast Red for 5 min. The slides were washed in water,
dehydrated, and coverslipped. Control incubations used a DIG-labeled
RNA sense strand and were performed under identical conditions.
Immunohistochemistry
Polyclonal antibodies against rab11 (Zymed Laboratories, Inc., Burlingame, CA) and ER
and ERß (Santa Cruz Biotechnology, Inc.) were diluted 1:1000 for
immunohistochemistry. Frozen uteri were sectioned at 7 µm, mounted on
slides, and then fixed in 5% formaldehyde in PBS. Sections were washed
in PBS for 20 min and then incubated in a blocking solution containing
10% normal goat serum for 10 min before incubation in primary antibody
overnight at 4 C. Immunostaining was performed using a
Streptavidin-Biotin kit for rabbit primary antibody (Zymed Laboratories, Inc.). Red deposits indicate the sites of
immunostaining.
Transient Transfection Experiments
Ishikawa endometrial adenocarcinoma cells were maintained in
DMEM (Gibco BRL, Grand Island, NY) supplemented with 5%
FBS (HyClone Laboratories, Inc., Logan, UT). Cells (5
x 105) were plated on 10-cm tissue culture dishes in
phenol red-free medium containing 5% charcoal-stripped serum. After
2448 h, cells were transiently transfected with plasmid DNAs using
Lipofectamine (Life Technologies, Grand Island, NY)
according to the manufacturers guidelines. Typically, cells received
1 µg of ER
or ERß plasmids. After 24 h the cells were
washed with PBS and incubated in fresh phenol red-free medium with
either 10-7 M estrogen or 10-7
M estrogen and 10-5 M ICI, or
solvent. Cells were harvested after 24 h and RNA was isolated for
RT-PCR analysis. The experiment was repeated at least three times.
RT-PCR
Total RNA (5 µg) was subjected to RT reaction using a
Stratascript RT-PCR kit. Briefly, the RNA samples were mixed with oligo
(dT) primer, incubated at 65 C for 5 min, and annealed at room
temperature. First-strand cDNA was synthesized using MMLV reverse
transcriptase at 37 C, and the reaction was stopped by heating the
tubes at 95 C for 5 min. PCR reaction was then performed in 100 µl
total volume using 35 ng of primers, 200 µM each of dATP,
dGTP, dCTP, and dTTP, 1.5 mM Mg++, and 0.5 µl
of Taq DNA polymerase (Perkin-Elmer Corp.). The
nucleotide sequences of the oligonucleotide primers were
ATAGTAACATTGTTATCATG and ACCACAAGAATTACAAATAT. The conditions for PCR
were 94 C (30 sec) for 1 cycle followed by 94 C (30 sec), 65 C (30
sec), and 68 C (2 min) for 25 cycles. PCR products were electrophoresed
on agarose gels and processed for Southern blot analysis.
Southern Blot Analysis
PCR products (2 µl each) were run on 1% agarose gel. After
electrophoresis, the gel was transferred to Duralon membrane
(Stratagene). The membrane was prehybridized in 6x SSC,
5x Denhardts, 0.5% SDS, and 100 µg/ml salmon sperm DNA for 2
h at 68 C. Hybridization was performed in the same buffer containing
106 cpm/ml of 32P-labeled cDNA fragment of
rab11 overnight at 68 C. The membrane was washed with 2x SSC and 0.1%
SDS for 15 min at room temperature, in 0.1x SSC containing 0.5% SDS
at 68 C for 45 min and exposed to x-ray film for 12 h.
| ACKNOWLEDGMENTS |
|---|
and ERß
expression vectors and Bruce Lessey for Ishikawa cells. We thank
Evan Read for the artwork and Jean Schweis for carefully
reading the manuscript. | FOOTNOTES |
|---|
This work was supported by NIH Grants R01 HD-34527 and National Cooperative Program on Markers of Uterine Receptivity for Blastocyst Implantation HD-34760 to I.C.B. M.K.B. is supported by NIH Grants R01DK-5025702 and HD-1354118.
Received for publication February 3, 1999. Revision received March 1, 1999. Accepted for publication March 5, 1999.
| REFERENCES |
|---|
|
|
|---|
is a
potential mediator of estrogen action in the mouse uterus.
Endocrinology 131:16571664
(ER
) and estrogen receptor-ß (ERß) messenger ribonucleic acid in
the wild-type and ER
-knockout mouse. Endocrinology 138:46134621
participation in the mouse uterine epithelial secretory response.
Endocrinology 140:484491This article has been cited by other articles:
![]() |
J. A Desmarais, M. Cao, A. Bateman, and B. D Murphy Spatiotemporal expression pattern of progranulin in embryo implantation and placenta formation suggests a role in cell proliferation, remodeling, and angiogenesis Reproduction, August 1, 2008; 136(2): 247 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. J. van de Graaf, J. G. J. Hoenderop, and R. J. M. Bindels Regulation of TRPV5 and TRPV6 by associated proteins Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1295 - F1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
V S Patil, G Sachdeva, D N Modi, R R Katkam, D D Manjramkar, I Hinduja, and C P Puri Rab coupling protein (RCP): a novel target of progesterone action in primate endometrium J. Mol. Endocrinol., October 1, 2005; 35(2): 357 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, X. Xu, Y.-P. Cheon, M. K. Bagchi, and I. C. Bagchi Estrogen Induces Expression of Secretory Leukocyte Protease Inhibitor in Rat Uterus Biol Reprod, August 1, 2004; 71(2): 508 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Dey, H. Lim, S. K. Das, J. Reese, B. C. Paria, T. Daikoku, and H. Wang Molecular Cues to Implantation Endocr. Rev., June 1, 2004; 25(3): 341 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huber, I. Bahr, J. R. Kratzschmar, A. Becker, E.-C. Muller, P. Donner, H.-D. Pohlenz, M. R. Schneider, and A. Sommer Comparison of Proteomic and Genomic Analyses of the Human Breast Cancer Cell Line T47D and the Antiestrogen-resistant Derivative T47D-r Mol. Cell. Proteomics, January 1, 2004; 3(1): 43 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Simmons and T. G. Kennedy Uterine Sensitization-Associated Gene-1: A Novel Gene Induced Within the Rat Endometrium at the Time of Uterine Receptivity/Sensitization for the Decidual Cell Reaction Biol Reprod, November 1, 2002; 67(5): 1638 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Greenfield, L. W. Leung, D. Cai, K. Kaasik, R. S. Gross, E. Rodriguez-Boulan, P. Greengard, and H. Xu Estrogen Lowers Alzheimer beta -Amyloid Generation by Stimulating trans-Golgi Network Vesicle Biogenesis J. Biol. Chem., March 29, 2002; 277(14): 12128 - 12136. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Harris, R. A. Henderson, R. A. Bhat, and B. S. Komm Regulation of Metallothionein II Messenger Ribonucleic Acid Measures Exogenous Estrogen Receptor-{beta} Activity in SAOS-2 and LNCaPLN3 Cells Endocrinology, February 1, 2001; 142(2): 645 - 652. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |