help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, D.
Right arrow Articles by Bagchi, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, D.
Right arrow Articles by Bagchi, M. K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE
Molecular Endocrinology 13 (6): 993-1004
Copyright © 1999 by The Endocrine Society

Potential Regulation of Membrane Trafficking by Estrogen Receptor {alpha} via Induction of Rab11 in Uterine Glands during Implantation

Dahu Chen, Padmaja Ganapathy, Li-Ji Zhu, Xueping Xu, Quanxi Li, Indrani C. Bagchi and Milan K. Bagchi

Population Council and The Rockefeller University New York, New York 10021


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The steroid hormone estrogen profoundly influences the early events in the uterus leading to embryo implantation. It is thought that estrogen triggers the expression of a unique set of genes in the preimplantation endometrium that in turn control implantation. To identify these estrogen-induced genes, we used a delayed implantation model system in which embryo attachment to endometrium is dependent on estrogen administration. Using a mRNA differential display (DD) method, we isolated a number of cDNAs representing mRNAs whose expression is either turned on or turned off in response to an implantation-inducing dose of estrogen. We identified one of these cDNAs as that encoding rab11, a p21ras-like GTP-binding protein (G protein), which functions in the targeting of transport vesicles to the plasma membrane. In normal pregnant rats, rab11 mRNA was expressed at low levels on days 1–2 of pregnancy, but its expression was markedly enhanced (~6- to 8-fold) between days 3–5 immediately before implantation. In situ hybridization and immunocytochemistry revealed that rab11 expression in the uterus was predominantly in the glandular epithelium. In ovariectomized rats, the expression of rab11 mRNA was induced in the endometrium in response to estrogen. To determine whether this effect of estrogen was mediated through its nuclear receptors, we examined rab11 expression in a transformed endometrial cell line, Ishikawa. In transient transfection experiments, we observed that overexpression of estrogen receptor (ER) {alpha} or ß induced endogenous rab11 mRNA in a hormone-dependent manner. ER bound to an antagonist, ICI 182,780, failed to activate this gene expression. These findings, together with the observation that ER{alpha} but not ERß is detected in the glands of the preimplantation uterus, indicate that rab11 is one of the proteins that are specifically induced by estrogen-complexed ER{alpha} in rat endometrium at the onset of implantation. Our results imply that estrogen, which induces the synthesis of many growth factors and their receptors and other secretory proteins that are thought to be critical for implantation, may also facilitate their transport to the membrane and/or secretion by stimulating the expression of rab11, a component of the membrane-trafficking pathway. This study therefore provides novel insights into the diverse cellular mechanisms by which estrogen, acting via its nuclear receptors, may influence blastocyst implantation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Initiation of implantation leading to the establishment of pregnancy results from the culmination of a series of complex interactions between the developing embryo and the uterus (1, 2, 3, 4). Although the details of implantation vary in different species, the basic features of the blastocyst attachment and penetration of the uterine surface epithelium are common to many mammals. In humans and rodents, implantation occurs 4–6 days after fertilization when the blastocyst reaches the uterus. It is generally believed that the endometrium and the fertilized ovum must undergo synchronized developmental changes for implantation to succeed. Studies by Psychoyos (1) demonstrated that rat uterus can accept the blastocyst to implant only for a brief period of time known as the receptive phase. The specific modifications leading to acquisition of the receptive state of the uterus are regulated by a timely interplay of the maternal steroid hormones, estrogen and progesterone (5, 6).

Estrogen profoundly influences uterine functions at various phases of the menstrual cycle and pregnancy. In the rat, the preovulatory ovarian estrogen is important for uterine cellular proliferation and differentiation during early stages (days 1 and 2 postfertilization) of pregnancy (7, 8). This transformation of the uterus in response to estrogen is important for subsequent uterine preparation for embryonic implantation and successful establishment of pregnancy (7, 8). After fertilization the level of estrogen declines and remains low throughout gestation, except a transitory rise in estrogen level that occurs on day 4 of pregnancy (9). Although estrogen is essential to create the receptive state of the uterus that allows implantation on day 5, the molecular basis of this hormonal effect remains unclear.

The cellular actions of estrogen are mediated through estrogen receptors, ER{alpha} and ERß, which function as ligand-inducible transcription factors (10, 11, 12, 13). The uterotropic hormonal responses to estrogen are believed to be mediated through the expression of specific estrogen-regulated genes in the uterus (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). Studies in rodents employing immature and ovariectomized model systems have demonstrated that in the uterus estrogen modulates the expression of several genes that are likely to be involved in the regulation of cell growth and division. These include the genes encoding protooncogenes, such as c-fos and c-myc, growth factors, such as epidermal growth factor (EGF) and insulin-like growth factor-I, and their receptors (14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). However, the relationship of these gene activation events to the complex estrogen-regulated physiological processes, such as uterine receptivity, secretory protein production, and embryonic implantation, have not been clearly established.

To investigate the molecular basis of the estrogen regulation of implantation, we sought to identify the genes whose expression in the preimplantation endometrium is induced by estrogen. For this purpose, we employed a delayed implantation rat model that allows one to determine the independent functional roles of estrogen and progesterone on implantation (1, 2). In these rats, which have undergone ovariectomy on day 4 of gestation, implantation is blocked in the absence of ovarian estrogen. Continued administration of progesterone allows the blastocysts to remain viable, but the attachment of the embryo to the uterine epithelium will not occur in the absence of estrogen. Such a delayed state can be maintained for up to 7–10 days after fertilization. Administration of estrogen to the ovariectomized pregnant rats triggers implantation within 12–24 h, emphasizing the critical role of estrogen in this process (25, 26).

We used the mRNA differential display (DD) technique to isolate a number of cDNAs representing mRNAs whose expression are either turned on or turned off in response to an implantation-inducing dose of estrogen in rats undergoing delayed implantation. Our studies revealed that rab11, which is present at a low level in the progesterone-treated delayed rats, is markedly induced when estrogen is administered to these rats to overcome the delay. rab11 belongs to the rab family of low-molecular mass G proteins that share significant homologies with p21 ras (27, 28, 29). The members of the rab family are thought to be required at distinct steps in transport along the secretory pathway, especially for the targeting and fusion of transport vesicles with the plasma membrane. The timing of its enhanced expression in the endometrial glands prompts us to propose that rab11 may function by regulating secretory activities that are critical for blastocyst implantation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of rab11 cDNA by mRNA DD Analysis
To isolate the uterine genes that are regulated by estrogen during delayed implantation, we employed the mRNA DD method (30, 31, 32). We compared RNA samples prepared from uteri of delayed rats treated with either progesterone alone or progesterone plus an implantation-initiating dose of estrogen. Our studies revealed several cDNA clones representing genes whose expression in the uteri of rats undergoing delayed implantation is up- or down-regulated within 24 h of estrogen treatment (D. Chen, P. Ganapathy, and I. Bagchi, unpublished observation). One of the differentially displayed bands, which was absent in the uteri of delayed rats but appeared after estrogen treatment (marked by * in Fig. 1Go, panel A, right lane), was selected for further characterization. The band of interest was recovered from the gel and amplified by PCR (40 cycles). Using this cDNA fragment as a probe, we isolated a full-length cDNA from the rat uterus cDNA library. Nucleotide sequence analysis of the isolated cDNA and comparison with the Genbank data base revealed its identity as rab11, a member of the rab family of GTPases (33).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 1. Profiles of Differentially Expressed mRNAs in Uterine Tissues of Delayed Implanting Rats

A, Delayed implantation was performed according to the protocol described in Materials and Methods. Total RNA (2 µg) isolated from uteri of ovariectomized pregnant rats treated with either progesterone or progesterone and estrogen was subjected to DD. A band representing mRNA that is up-regulated with estrogen treatment is marked by * in the right lane. B, RNA was analyzed by Northern blotting followed by hybridization with a 32P-labeled rab11 or GAPDH cDNA probe. Lane 1: RNA from delayed rats treated with progesterone alone; lane 2: RNA from delayed rat after progesterone and estrogen treatment. The experiment was repeated twice for reproducibility. The results of a representative experiment are shown.

 
The differential expression of rab11 mRNA during estrogen-induced delayed implantation was confirmed by Northern blotting. A rab11 cDNA fragment was labeled with 32P and used to probe blots of mRNAs obtained from uteri of delayed rats on day 8 of pregnancy before estrogen treatment (Fig. 1Go, panel B, lane 1) and after administration of estrogen (lane 2). Two weak signals corresponding to 2.3-kb and 1-kb transcripts emerged in lane 1, while signals of markedly enhanced intensity were observed in lane 2. Hybridization of the blot with a control probe [glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] indicated that the difference in intensities of the signals in lanes 1 and 2 did not arise due to unequal loading of mRNAs in these lanes. These results indicated that the rab11 mRNA is indeed up-regulated in delayed rats upon administration of an implantation-initiating dose of estrogen. It has been reported previously that rab11 is encoded by a single gene from which two transcripts, 2.3 kb and 1 kb, are generated by alternative use of two polyadenylation sites (34). Both of these transcripts give rise to the same protein. The sizes of the induced mRNAs in our Northern blot in Fig. 1BGo are in excellent agreement with those reported previously for the rab11 transcripts (34).

Rab11 Transcripts Are Induced in Pregnant Rat Uterus within the Window of Implantation
We next examined the profiles of expression of the 2.3-kb and 1-kb rab11 transcripts in normal pregnant rat uterus during days 1–6 of gestation by employing Northern blot analysis. As shown in Fig. 2Go, the overall profiles of expression of the two transcripts were similar. Both transcripts were detected on days 1–2 of pregnancy. However, the shorter transcript was consistently expressed at a higher level than the longer one. The levels of both transcripts increased significantly on day 3, attained a maximum on days 4–5, and then declined sharply by day 6 of pregnancy. These results indicated that a transient surge of rab11 mRNA expression occurs in the uterus in a highly stage-specific manner, that is between days 3–5 of gestation, and this temporally coincides with the preparatory events leading to implantation. The relative levels of expression of the 2.3-kb and 1-kb transcripts were estimated by densitometric scanning, followed by normalization with respect to the control GAPDH mRNA signal. By our estimate, the level of either transcript on day 4–5 was about 6- to 8-fold higher than that on day 1 of gestation (Fig. 2BGo).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Profile of Expression of rab11 mRNA in Rat Uterus at Different Stages of Early Pregnancy

A, Total RNA (20 µg/lane) from uteri of animals at days 1–6 of pregnancy was analyzed by Northern blotting. Hybridization was performed with a 32P-labeled rab11 cDNA probe. The positions of the 1-kb and 2.3-kb rab11 transcripts are indicated. The lower panel shows the same blot after hybridization with a control 32P-labeled GAPDH probe. B, The intensities of the signals corresponding to the 2.3-kb (upper panel) and 1-kb (lower panel) rab11 transcripts were quantitated by densitometric scanning of the autoradiogram and normalized with respect to the GAPDH signals of the Northern blot shown in panel A. The results are representative of two independent experiments.

 
rab11 mRNA and Protein Are Localized in the Endometrial Glands
The site of expression of rab11 mRNA in the pregnant rat uterus was investigated by employing in situ hybridization (Fig. 3AGo). Uterine sections from day 4 pregnant animals were hybridized with a 400-bp digoxigenin-labeled (DIG) antisense or sense RNA probe containing sequences from rab11 cDNA. While control uterine sections (pregnant, day 4) hybridized with the sense RNA probe did not exhibit any significant signal (panel B), we observed a strong hybridization signal in the glandular epithelial cells of these uterine sections upon hybridization with the antisense probe (panel A). A weaker but specific hybridization signal was also found in the luminal epithelium. These results demonstrated that the glandular epithelium is the primary site of synthesis of rab11 mRNA in the uteri of pregnant rats.



View larger version (113K):
[in this window]
[in a new window]
 
Figure 3. Localization of rab11 mRNA in the Rat Uteri by in Situ Hybridization

A, Uterine sections from pregnant (day 4) rats were subjected to in situ hybridization. The hybridization was performed employing a 400-bp long DIG-labeled antisense (panel A) or sense (panel B) cRNA probe specific for rab11 gene as described in Materials and Methods. g and l, Glandular and luminal epithelium, respectively. Magnification, 43x. B, Uterine sections from pregnant rats at days 1–6 of gestation (panels D1–D6) were subjected to in situ hybridization as described in panel A. Magnification, 215x.

 
We performed in situ hybridization of uterine sections at different days of gestation to further confirm the stage-specific expression of rab11. The level of rab11 mRNA in glandular epithelial cells markedly increased on day 3, reached a peak on day 4, and then diminished on day 6 of pregnancy (Fig. 3BGo, panels D1–D6). These results confirmed our Northern blot results (Fig. 2Go) that rab11 expression is induced in the endometrial glands in an implantation stage-specific manner.

We also investigated the site of accumulation of rab11 protein by immunocytochemical staining of sections of uteri isolated from day 4 pregnant animals using a polyclonal antibody specific for this protein. As shown in Fig. 4Go (left panel), rab11-specific immunostaining was present predominantly in the glandular epithelial cells. Weaker but specific immunostaining was observed in the luminal epithelium. No significant staining was observed in the stroma or myometrium. Control sections of the same uterine tissue, when incubated with preimmune serum, showed no immunoreactivity, indicating the specificity of the immunostaining (Fig. 4Go, right panel). These results, consistent with the in situ hybridization analysis, showed that rab11 protein is expressed in the glandular epithelial cells around the time of implantation.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 4. Localization of rab11 in Rat Uterus by Immunocytochemistry

Immunocytochemistry was performed employing polyclonal rabbit anti-rab11 using sections from day 4 pregnant (panel A) rat uterus as described in Materials and Methods. Left panel, Red deposits indicate site of specific immunoreactivity. Right panel, Control sections of day 4 pregnant uterus incubated with preimmune serum. G and L, Glandular epithelium and luminal epithelium, respectively. Magnification, A and B, 150x.

 
Estrogen Induces rab11 mRNA Expression in the Uterus
Since expression of rab11 is stimulated during estrogen-induced delayed implantation, we considered the possibility that rab11 is under estrogenic regulation. To determine whether rab11 expression in the uterus is indeed regulated by estrogen, we administered steroid hormones to ovariectomized rats. A week after ovariectomy, the animals were treated with either estrogen or progesterone or a combination of both. Uteri were collected from animals 16 h after the last injection, and mRNAs were isolated from these tissues for Northern blot analysis. As shown in Fig. 5AGo, rab11 mRNA was barely detectable in uteri of ovariectomized rats (lane ovex). Progesterone treatment for 4 days (lane P4) did not significantly increase rab11 mRNA. In contrast, both rab11 transcripts were markedly induced after treatment with estrogen for 4 consecutive days (lane E4). The net estrogen-dependent stimulation in rab11 mRNA after 4 days of treatment was quantitated to be about 20-fold relative to the level in the ovariectomized animals (Fig. 5BGo). The slight increase in lane E+3P is most likely due to the brief estrogen treatment before progesterone administration. Simultaneous administration of estrogen and progesterone [lane E+3(P+E)] elicited the same response as estrogen alone, indicating that progesterone does not significantly affect rab11 expression. In a time-course experiment, we observed that the levels of both rab11 transcripts in ovariectomized rat uterus rose significantly (~5-fold) within 24 h of injection with a single dose of estrogen (data not shown). Collectively, these results established that rab11 expression in the uterus is under estrogenic regulation.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Estrogen Regulation of rab11 Gene Expression

A, Total RNA (20 µg per lane) was subjected to Northern blot analysis and hybridized with 32P-labeled rab11 or GAPDH (not shown) probe. Lane "ovex" represents RNA from uteri of animals injected with vehicle only after ovariectomy; lane 4P, RNA from uteri of animals injected with progesterone for 4 consecutive days; lane 4E, RNA from uteri of animals injected with estrogen for 4 consecutive days; lanes E+3P and E+3(P+E), RNA from uteri of animals injected with estradiol on day 1 followed by progesterone, and estrogen plus progesterone, respectively, for 3 consecutive days. B, The bars represent the levels of rab11 mRNAs quantitated by densitometric scanning of the signals in the autoradiogram of the Northern blot (shown in panel A). The rab11 signals were normalized with respect to GAPDH mRNA signals in the same blot. The normalized value of 4E sample was set to 100%. The results are representative of two independent experiments. Panel C, lane 1, RNA from the uteri of animals injected with vehicle on days 1–3 of pregnancy and killed on day 4; lane 2, RNA from the uteri of animals given ICI 182,780 during days 1–3 and killed on day 4 of pregnancy.

 
An Antagonist of ER Blocks rab11 mRNA Expression during Implantation
We further investigated the estrogenic regulation of rab11 mRNA expression by employing an antiestrogen, ICI 182,780, which is known to severely impair the transcriptional activity of ER. Animals were injected in the preimplantation phase of pregnancy either with a vehicle or ICI 182,780, which blocks implantation in rats (35). As depicted in Fig. 5CGo, treatment with this antiestrogen drug caused a drastic (~85%) decline in the level of rab11 mRNA but did not affect the expression of GAPDH mRNA. These results strongly suggested that ICI 182,780 switched off the rab11 gene expression during implantation by inhibiting the ERs.

ER{alpha} Level Increases in the Glandular Epithelium during rab11 Expression
If rab11 mRNA synthesis during implantation is mediated by ERs, one would expect to find these receptor proteins in the glandular cells at the time of this gene induction. To monitor the expression of ERs in glandular epithelium during early pregnancy, we performed immunohistochemical staining of sections of uteri isolated from pregnant animals (days 1–5) using polyclonal antibodies specific for each ER isoform. When we used an antibody against ER{alpha}, the uterine sections of animals on day 1 of pregnancy exhibited very little immunostaining in the glandular epithelium, while those from day 4 or day 5 pregnant animals showed significant ER{alpha}-specific staining (Fig. 6Go, panels D1, D4, and D5, respectively). The ER{alpha} immunostaining declined to undetectable levels on day 6 of gestation (panel D6). We noted considerable ER{alpha} stromal immunostaining on days 1–6 (panels D1–D6). Sections of uteri (days 1–6) incubated with control serum did not exhibit any specific immunostaining (data not shown). We failed to detect any expression of ERß in the endometrial sections using an ERß-specific antibody, although this antibody efficiently immunoreacted with ERß present in other tissues such as prostate (data not shown). These results are consistent with recent reports indicating that ER{alpha} is the predominant isoform of ER in the endometrium (36). Sufficient quantities of ER{alpha} are therefore present in the glandular epithelial cells while rab11 mRNA is induced between days 3–5 of gestation. This observation is consistent with a direct regulatory role for ER{alpha} in rab11 gene expression during implantation.



View larger version (125K):
[in this window]
[in a new window]
 
Figure 6. Immunocytochemical Localization of ER in Rat Uteri at Different Days of Pregnancy

Immunocytochemistry of uterine sections from day 1 (D1), day 4 (D4), day 5 (D5), and day 6 (D6) pregnant rats was performed employing an ER{alpha} antibody. g, Glands. Magnification, 100x.

 
Overexpression of ER{alpha} or ERß in Ishikawa Cells Induces rab11 mRNA
To analyze the role of ER in rab11 mRNA induction, we examined the regulation of the rab11 gene by each ER isoform in human endometrial Ishikawa cells using transient transfection. The rab11 expression was monitored by RT-PCR using total RNA isolated from these cells. Ishikawa cells contain only low levels of endogenous ER and displayed a low, basal level of rab11 expression irrespective of hormone addition (Fig. 7Go, lanes 1 and 2). This basal promoter activity did not change significantly when expression vectors harboring either ER{alpha} or ERß was transfected into these cells in the absence of estrogen (lanes 3 and 7). However, when either ER expression vector was transfected in the presence of 100 nM estrogen, a 6- to 8-fold induction in rab11 mRNA was observed (lanes 4 and 8). This ER-mediated induction of rab11 transcripts was completely dependent on estrogen, since ER{alpha} complexed with ICI 182,780 failed to promote rab11 expression (lane 5 and 6). These results clearly indicated that the rab11 gene induction by estrogen is mediated by the ER, and both receptor isoforms have the ability to perform this regulatory function.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Induction of rab11 mRNA in Response to Estrogen in Ishikawa Cells

Ishikawa cells were cultured and transiently transfected using the lipofectamine procedure as described in Materials and Methods. Experiments were performed with medium containing charcoal-stripped serum. Semiconfluent cells received either empty vector (lanes 1 and 2) or expression vectors containing ER{alpha} (lanes 3–6) or ERß (lanes 7 and 8). After 24 h, the cells were incubated in fresh medium with ligands (10-7 M estrogen or estrogen along with 10-5 M ICI 182,780) or solvent. Twenty four hours after treatment with ligands, cells were harvested and mRNA was isolated and subjected to RT-PCR analysis employing rab11 or GAPDH-specific primers. PCR reactions using both rab11 and GAPDH primers were performed through multiple rounds ranging from 15–40 cycles to ensure that the amplifications were in the linear range. The data shown above represent 25 cycles of PCR amplification. The authenticity of the PCR products was confirmed by Southern blotting employing 32P-labeled rab11 and GAPDH cDNA probes. Lanes 1, 3, and 7 represent cells treated with vehicle; lanes 2, 4, and 8 represent cells treated with estrogen; lane 6 represents cells treated with ICI 182,780; and lane 5 represents cells treated with estrogen in combination with ICI 182,780. The relative levels of rab11 mRNA were as follows: lane 1 (13 ± 1.75), lane 2 (12 ± 2), lane 3 (13 ± 1.25), lane 4 (100 ± 8), lane 5 (22 ± 2.5), lane 6 (11 ± 2), lane 7 (15 ± 1.5), and lane 8 (90 ± 5).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Blastocyst implantation in rodents is controlled by the synergistic action of both ovarian steroids, estrogen and progesterone. In these species, implantation fails to occur unless estrogen becomes available. An increase in the estrogen level immediately before implantation appears to be essential for blastocyst attachment (1, 2). The precise mechanisms by which estrogen acts within the uterus to influence implantation remain unclear. It is believed that one of the major actions of estrogen in inducing implantation is related to its effect in promoting the synthesis of new proteins that are secreted into the uterine lumen at the time of implantation to critically regulate this process. Indeed, it has been known for a long time that the uterine epithelium secretes a variety of proteins in response to estrogen, and some of these might regulate implantation. The estrogen-regulated secretory proteins include growth factors such as EGF, insulin-like growth factor-I, leukemia inhibitory factor (LIF), and heparin-binding EGF-like growth factor (37, 38, 39, 40), and other proteins such as lactoferrin, keratan sulfate proteoglycan, and complement C3 (41, 42, 43, 44).

The control of estrogen-dependent secretions of important regulatory factors during implantation may occur at multiple levels. At one level, estrogen may induce the synthesis of a number of growth factors and other proteins in the glands that are positive modulators of the implantation process. At another level, estrogen may facilitate secretion of these induced factors by regulating critical components of the secretory pathway. It has been reported that in mice undergoing delayed implantation, no LIF is synthesized in the uteri containing viable but unattached blastocysts. A single injection of estrogen, which interrupts the delay, also induces secretion of LIF by the endometrial glands within 18–24 h (39, 45). It is conceivable that estrogen plays a dual regulatory role by controlling both synthesis and secretion of LIF during implantation. Our finding in this paper supports such a scenario, as estrogen significantly enhances the expression of rab11, which is known to function in membrane trafficking and cellular secretory pathway.

Rab11 is a recently discovered member of a large superfamily of small ras-related GTP-binding proteins that has been grouped into several main branches: ras, rho, and rab, according to their sequence homologies and functional features (27, 28, 29). The members of the rab subgroup function as key signal components that regulate many aspects of vesicular transport along both the endocytotic and exocytotic pathways (27, 28, 29). Different rab proteins exhibit cell type-specific variations in expression, as well as differential localization to distinct vesicular compartments and organelles that perform multiple sorting functions. The cDNA encoding rab11 has been isolated and is found to be highly conserved among different species (27). Transcription of the mammalian rab11 gene yields two mRNAs, 1 and 2.3 kb, which share identical coding sequences but differ in the length and sequence of their 3'-untranslated regions (34). Sequence analysis of the cDNAs identified two different poly A signals at positions 927 and 2302 of the larger transcript (34). It has been suggested that the two mRNA species originate from a single gene by the use of different polyadenylation sites (34). Both rab11 transcripts yield the same protein product.

Although ubiquitously expressed, rab11 is more abundant in tissues with a high level of secretion (33). This observation led to the suggestion that rab11 might function in the exocytic pathway. All cells secrete some proteins in a constitutive fashion. Urbe et al. (49) found rab11 associated with the trans-Golgi network-derived vesicles involved in both the constitutive and the regulated secretory pathway in the neuroendocrine cell line PC12. Goldenring et al. (50) localized rab11 in the apical tubulovesicles of the acid-secreting parietal cells in the gastrointestinal tract. In addition, rab11 was found associated with the apical vesicular populations in a variety of polarized epithelial cells (51). Rab11 interconverts between GDP and GTP-bound conformations, as part of a catalytic cycle of vesicle delivery and rab protein recycling.

Rab11 expression, however, is not restricted to the secretory cells. This protein has been localized in the pericentriolar recycling endosomes of certain nonpolarized cells in which it is thought to function in the recycling pathway of plasma membrane receptors (52). Studies using rab11 mutants that are preferentially in the GTP- or GDP-bound state showed that GTP activation is necessary for rab11 to function in protein trafficking through the sorting endosomes to either the recycling compartment or the plasma membrane (52, 53). The precise role of rab11 in the membrane trafficking in endometrial glands is unknown. However, it is reasonable to assume that rab11 is in some way involved in targeting the transport vesicles destined to fuse with the plasma membrane. In this way, it may facilitate secretion of estrogen-induced secretory proteins. Additionally, rab11 may also be involved in recycling of estrogen-induced growth factor receptors.

How does estrogen modulate rab11 expression? Estrogen mediates its gene-regulatory activity through intracellular ER isoforms, ER{alpha} and ERß, which regulate transcription of target cellular genes (13). Our studies show clearly that both isoforms of ER are able to induce rab11 expression in Ishikawa endometrial cells. In the uterine glands, however, the expression of ER{alpha} is far greater than that of ERß, which is virtually undetectable. It is therefore reasonable to infer that ER{alpha}, rather than ERß, mediates estrogen regulation of rab11 expression in the glandular epithelium. Consistent with this scenario, the profile of rab11 expression in the uterine glands overlaps closely that of ER{alpha} (Fig. 6Go).

Previous studies indicated that a transient surge of estrogen on day 4 of gestation in the rat is essential for implantation on the following day (1, 2). The relationship between this preimplantation estrogen surge and rab11 expression remains unclear. Our studies indicate that rab11 expression, which starts to rise on day 3 and attains a peak on day 4–5, slightly precedes the preimplantation estrogen surge. Nevertheless, it is clear from our antiestrogen studies (Fig. 5CGo) that the expression of rab11 between days 3–5 of gestation is primarily under estrogenic regulation. Furthermore, there is an excellent correlation between the expression profiles of rab11 and ER{alpha} in the glands (Figs. 3BGo and 6Go). However, we cannot rule out the possibility that other factor(s) in addition to ER{alpha} modulates rab11 expression in the preimplantation uterus. This view is supported by a low but detectable level of uterine rab11 expression in ICI 182,780-treated or delayed implanting rats (see Figs. 1BGo and 5CGo).

The possibility that ER directly regulates rab11 gene expression in glandular epithelium has interesting implications for cell type-specific actions of ER within the endometrium. It was previously thought that estrogen acting through ER stimulates uterine epithelial cell growth, proliferation, and differentiation. Recent studies by Cooke et al. (54) however, question the role of epithelial ER{alpha} in the normal uterine response to estrogen. Using tissue recombinants prepared with uterine tissue from adult ER{alpha} knockout (ERKO) and normal neonatal mice, these workers observed that epithelial ER{alpha} is neither necessary nor sufficient to mediate the mitogenic response to estrogen in the epithelium. Interestingly, estrogen-induced epithelial proliferation appears to be mediated through stromal ER{alpha} in a paracrine manner. In contrast, the same group ofworkers recently reported that both epithelial and stromal ER{alpha} are essential for secretory protein production in uterine epithelial cells (55). These findings are consistent with our hypothesis that glandular ER facilitates uterine secretions by stimulating the cellular levels of specific components of the secretory pathway such as rab11. We have noted strong stromal ER{alpha} expression during the entire preimplantation period (Fig. 6Go). However, it is not clear whether these stromal ER{alpha}s play a role in estrogen-mediated rab11 induction in the tissue. Further studies in primary cell culture systems and tissue recombinants using rab11 as a specific marker of estrogen action in the epithelium will help us to understand the intra- and intercellular signaling mechanisms that modulate the gene-regulatory activity of ER in specific uterine cell types.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Progesterone and 17ß-estradiol were purchased from Sigma Chemical Co. (St. Louis, MO). ICI 182,780 was a gift from Zeneca Pharmaceuticals (Cheshire, U.K.). Rab11 antibody was purchased from Zymed Laboratories, Inc. (Burlingame, CA). ER{alpha} and -ß antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Animals
All experiments involving animals were conducted according to NIH standards for the care and use of experimental animals. Virgin female rats (Sprague-Dawley, from Charles River Laboratories, Inc., Wilmington, MA; 60–75 days of age), in proestrus, were mated with adult males. The different stages of the cycle in the nonpregnant rats were ascertained by examining vaginal smears. The presence of a vaginal plug after mating was designated as day 1 of pregnancy. The animals were killed at various stages of gestation and the uteri collected. In some experiments, animals were ovariectomized and 2 weeks later were injected subcutaneously with either estradiol (2 µg/kg body weight), progesterone (40 mg/kg body weight), or a combination of both hormones or vehicle (sesame oil) as described in Results. The rats were killed 16 h after final injection.

To induce and maintain delayed implantation, rats were ovariectomized on day 4 of pregnancy and injected daily with progesterone (10 mg) from days 5–8. To terminate delayed implantation and induce blastocyst activation, the progesterone-primed delayed implanting rats were given an injection of estrogen (0.25 µg) on the third day of the delay (day 8). Rats were killed at 24 h after the estrogen injection.

DD
Total RNAs were extracted from delayed rats before and after estrogen treatment using an RNAgents isolation system (Promega Corp., Madison, WI). RNA samples were freed of DNA after treatment with DNAse I (Genehunter Corp., Brookline, MA) and subjected to DD reactions as described previously (30, 31, 32) with certain modifications. Briefly, 2 µg of DNA-free total RNA were reverse-transcribed with 200 U of MMLV reverse transcriptase (Promega Corp.) in the presence of 1 mM T12MA, or T12MC or T12MG primer (Genehunter Corp.), where M is a mixture containing dG, dA, and dC. The reaction was performed at 37 C for 1 h. One tenth of this reaction was then used in a PCR amplification reaction containing 2 mM each of deoxynucleoside triphosphates, 10 mCi of [35S] dATP (Amersham, Arlington Heights, IL), two primers: 1 mM of a T12 oligonucleotide and 0.2 mM of one of the five arbitrary decamers, AP-1 (5'-AGCCAGCGAA-3'); AP-2 (5'-GACCGCTTGT-3'); AP-3 (5'-AGGTGACCGT-3'); AP-4 (5'-GGTACTCCAC-3'); AP-5 (5'-GTTGCGATCC-3'). These reactions also contained 1 U of AmpliTaq DNA polymerase (Perkin Elmer Corp., Norwalk, CT). The cycling parameters for PCR were 94 C for 30 sec, 40 C for 2 min, and 72 C for 30 sec for 40 cycles. After PCR amplification, samples were analyzed on a 6% polyacrylamide sequencing gel, dried without fixation, and exposed to Kodak XAR-5 film (Eastman Kodak Co., Rochester, NY) for 72 h. Bands exhibiting differential expression were cut out from the gel, and DNA was eluted by boiling as described previously (30, 31, 32). Eluted DNA samples were then reamplified by PCR using the corresponding pair of primers under the same conditions as described above, except that neither 25 mM deoxynucleoside triphosphate nor radioisotope was used. The PCR products were cut from 2.5% low-melt agarose gels, subcloned into Pinpoint Vector (Promega Corp.), and subjected to nucleotide sequence analysis.

Northern Blot Analysis
For Northern analysis 20 µg of total RNA were separated by formaldehyde agarose gel electrophoresis and transferred to Duralon membrane (Stratagene, La Jolla, CA). After transfer, the membranes were baked at 80 C for 2 h. Blots were prehybridized in 50 mM NaPO4, pH 6.5/5x SSC/5x Denhardt’s/50% formamide/0.1% SDS and 100 µg/ml salmon sperm DNA for 4 h at 42 C. Hybridization was carried out overnight in the same buffer containing 106 cpm/ml of a 32P-labeled rab11 cDNA fragment. The filters were washed twice for 15 min in 1x SSC/0.1% SDS at room temperature, and then twice for 20 min in 0.2x SSC/0.1% SDS at 55 C, and the filters were exposed to x-ray films for 24–72 h. The intensities of signals on the autoradiogram were estimated by densitometric scanning. To correct for RNA loading, the obtained signals were normalized with respect to the GAPDH signal in the same blot. For this the filters were stripped of the radioactive probe by washing for 10 min in 0.5% SDS at 95 C. The blots were then reprobed with a 32P-labeled GAPDH probe (CLONTECH Laboratories, Inc., Palo Alto, CA) as described above.

In Situ Hybridization
Uterine tissue from pregnant animals was collected and frozen. Tissues were fixed in 4% paraformaldehyde at 4 C. Cryostat sections were cut at 8 µm and attached to 3-aminopropyl triethyl silane-coated slides (Sigma Chemical Co.). In situ hybridization was performed with DIG-labeled sense or antisense RNA probes complimentary to nucleotides 341–730 of rat rab11 gene. DIG-labeled RNA probes were synthesized from rab11 cDNA using T3 or T7 RNA polymerase and DIG-labeled nucleotides according to manufacturer’s specifications (Boehringer Mannheim, Indianapolis, IN). Prehybridization was carried out in a damp chamber at 37 C for 60 min in hybridization buffer (50% formamide, 5x SSC, 2% blocking reagent, 0.02% SDS, 0.1% N-laurylsarcosine). Hybridization was carried out at 42 C overnight in a damp humidified chamber. To develop the substrate, sections were sequentially washed in 2x SSC, 1x SSC, and 0.1x SSC for 15 min in each buffer at 37 C. Sections were then incubated with anti-DIG alkaline phosphatase-conjugated antibody. Excess antibody was washed away, and the color substrate (nitroblue tetrazolium salt and 5-bromo-4-chloro-3-indoylphosphate) was added. Slides were allowed to develop in the dark, and the color was visualized under light microscopy until maximum levels of staining were achieved. The reaction was stopped and the slides were counterstained in Nuclear Fast Red for 5 min. The slides were washed in water, dehydrated, and coverslipped. Control incubations used a DIG-labeled RNA sense strand and were performed under identical conditions.

Immunohistochemistry
Polyclonal antibodies against rab11 (Zymed Laboratories, Inc., Burlingame, CA) and ER{alpha} and ERß (Santa Cruz Biotechnology, Inc.) were diluted 1:1000 for immunohistochemistry. Frozen uteri were sectioned at 7 µm, mounted on slides, and then fixed in 5% formaldehyde in PBS. Sections were washed in PBS for 20 min and then incubated in a blocking solution containing 10% normal goat serum for 10 min before incubation in primary antibody overnight at 4 C. Immunostaining was performed using a Streptavidin-Biotin kit for rabbit primary antibody (Zymed Laboratories, Inc.). Red deposits indicate the sites of immunostaining.

Transient Transfection Experiments
Ishikawa endometrial adenocarcinoma cells were maintained in DMEM (Gibco BRL, Grand Island, NY) supplemented with 5% FBS (HyClone Laboratories, Inc., Logan, UT). Cells (5 x 105) were plated on 10-cm tissue culture dishes in phenol red-free medium containing 5% charcoal-stripped serum. After 24–48 h, cells were transiently transfected with plasmid DNAs using Lipofectamine (Life Technologies, Grand Island, NY) according to the manufacturer’s guidelines. Typically, cells received 1 µg of ER{alpha} or ERß plasmids. After 24 h the cells were washed with PBS and incubated in fresh phenol red-free medium with either 10-7 M estrogen or 10-7 M estrogen and 10-5 M ICI, or solvent. Cells were harvested after 24 h and RNA was isolated for RT-PCR analysis. The experiment was repeated at least three times.

RT-PCR
Total RNA (5 µg) was subjected to RT reaction using a Stratascript RT-PCR kit. Briefly, the RNA samples were mixed with oligo (dT) primer, incubated at 65 C for 5 min, and annealed at room temperature. First-strand cDNA was synthesized using MMLV reverse transcriptase at 37 C, and the reaction was stopped by heating the tubes at 95 C for 5 min. PCR reaction was then performed in 100 µl total volume using 35 ng of primers, 200 µM each of dATP, dGTP, dCTP, and dTTP, 1.5 mM Mg++, and 0.5 µl of Taq DNA polymerase (Perkin-Elmer Corp.). The nucleotide sequences of the oligonucleotide primers were ATAGTAACATTGTTATCATG and ACCACAAGAATTACAAATAT. The conditions for PCR were 94 C (30 sec) for 1 cycle followed by 94 C (30 sec), 65 C (30 sec), and 68 C (2 min) for 25 cycles. PCR products were electrophoresed on agarose gels and processed for Southern blot analysis.

Southern Blot Analysis
PCR products (2 µl each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to Duralon membrane (Stratagene). The membrane was prehybridized in 6x SSC, 5x Denhardt’s, 0.5% SDS, and 100 µg/ml salmon sperm DNA for 2 h at 68 C. Hybridization was performed in the same buffer containing 106 cpm/ml of 32P-labeled cDNA fragment of rab11 overnight at 68 C. The membrane was washed with 2x SSC and 0.1% SDS for 15 min at room temperature, in 0.1x SSC containing 0.5% SDS at 68 C for 45 min and exposed to x-ray film for 12 h.


    ACKNOWLEDGMENTS
 
We acknowledge the excellent technical assistance of Michelle Macaraig. We also acknowledge Donald McDonnell for ER{alpha} and ERß expression vectors and Bruce Lessey for Ishikawa cells. We thank Evan Read for the artwork and Jean Schweis for carefully reading the manuscript.


    FOOTNOTES
 
Address requests for reprints to: Milan K. Bagchi, Ph.D., The Population Council, 1230 York Avenue, New York, New York 10021. E-mail: milan{at}popcbr.rockefeller.edu

This work was supported by NIH Grants R01 HD-34527 and National Cooperative Program on Markers of Uterine Receptivity for Blastocyst Implantation HD-34760 to I.C.B. M.K.B. is supported by NIH Grants R01DK-50257–02 and HD-13541–18.

Received for publication February 3, 1999. Revision received March 1, 1999. Accepted for publication March 5, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Psychoyos A 1973 Endocrine control of egg implantation. In: Greep RO, Astwood EG (eds) Handbook of Physiology. American Physiological Society, Washington, DC, pp 187–215
  2. Yoshinaga K 1988 Uterine receptivity for blastocyst implantation. Ann NY Acad Sci 541:424–431[Medline]
  3. Parr MB, Parr EL 1989 The Implantation Reaction. In: Wynn RM, Jollie WP (eds) Biology of The Uterus. Plenum Press, New York, pp 233–277
  4. Weitlauf HM 1994 Biology of implantation. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 391–440
  5. Psychoyos A 1973 Hormonal control of ovoimplantation. Vitam Horm 31:205–255
  6. Psychoyos A 1976 Hormonal control of uterine receptivity for nidation. J Reprod Fertil Suppl 25:17–28
  7. Psychoyos A 1986 Uterine receptivity for nidation. Ann NY Acad Sci 476:36–42[Medline]
  8. Finn CA 1971 The implantation reaction. In: Wynn RM (ed) Biology of the Uterus. Plenum Press, New York, pp 246–308
  9. Yoshinaga K, Hawkins RA, Stocker JF 1969 Estrogen secretion by the rat ovary in vivo during the estrous cycle and pregnancy. Endocrinology 85:103–112[Abstract/Free Full Text]
  10. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  11. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  12. O’Malley BW 1990 The steroid receptor superfamily: more excitement predicted for the future. Mol Endocrinol 4:363–369[Abstract/Free Full Text]
  13. Katzenellenbogen BS, Korach KS 1997 A new actor in the estrogen receptor drama—enter ER-ß. Endocrinology 138:861–862[Free Full Text]
  14. Murphy LJ, Murphy LC, Freisen HG 1987 Estrogen induction of N-myc and c-myc proto-oncogene expression in the rat uterus. Endocrinology 120:1882[Abstract/Free Full Text]
  15. Travers MT, Knowler JT 1987 Oestrogen-induced expression of oncogenes in the immature rat uterus. FEBS Lett 211:27–30[CrossRef][Medline]
  16. Murphy LJ, Murphy LC, Freisen HG 1987 Estrogen induces insulin-like growth factor-1 in the rat uterus. Mol Endocrinol 1:445–450[Abstract/Free Full Text]
  17. DiAugustine RP, Petrusz P, Bell GI, Brown CF, Korach KS, McLachlan JA, Teng CT 1988 Influence of estrogens on mouse uterine epidermal growth factor precursor protein and messenger ribonucleic acid. Endocrinology. 122:2355–2363
  18. Lingham RB, Stancel GM, Loose-Mitchell DS 1988 Estrogen induction of the epidermal growth factor receptor mRNA. Mol Endocrinol 2:230–233[Abstract/Free Full Text]
  19. Weisz A, Bresciani F 1988 Estrogen induces expression of c-fos and c-myc protooncogenes in rat uterus. Mol Endocrinol 2:816–824[Abstract/Free Full Text]
  20. Loose-Mitchell DS, Chiappetta C, Stancel GM 1988 Estrogen regulation of c-fos messenger ribonucleic acid. Mol Endocrinol 2:946–951[Abstract/Free Full Text]
  21. Ghahary A, Murphy LJ 1989 Uterine insulin-like growth factor-1 receptors: regulation by estrogen and variation throughout the estrous cycle. Endocrinology 125:597–604[Abstract/Free Full Text]
  22. Chiappetta C, Kirkland JL, Loose-Mitchell DS, Murthy L, Stancel GM 1992 Estrogen regulates expression of the jun family of protooncogenes in the uterus. J Steroid Biochem Mol Biol 41:113–123[CrossRef][Medline]
  23. Nelson KG, Takahashi T, Lee DC, Luetteke NC, Bossert NL, Ross K, Eitzman BE, McLachlan JA 1992 Transforming growth factor-{alpha} is a potential mediator of estrogen action in the mouse uterus. Endocrinology 131:1657–1664[Abstract/Free Full Text]
  24. Bove-Cullinan K, Koos RD 1993 Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology 133:829–837[Abstract/Free Full Text]
  25. Yoshinaga K, Adams CE 1966 Delayed implantation in the spayed, progesterone treated adult mouse. J Reprod Fertil 12:593–595[Abstract/Free Full Text]
  26. Gidley-Baird AA 1981 Endocrine control of implantation and delayed implantation in rats and mice. J Reprod Fertil [Suppl] 29:97–109[Medline]
  27. Pfeffer SR 1994 Rab GT Pases: master regulators of membrane trafficking. Curr Opin Cell Biol 6:522–526[CrossRef][Medline]
  28. Novick P, Brennwald P 1993 Friends and family: the role of the Rab GTPases in vesicular traffic. Cell 75:597–601[CrossRef][Medline]
  29. Ferro-Novick S, Novick P 1993 The role of GTP-binding proteins in transport along the exocytic pathway. Annu Rev Cell Biol 9:575–599[CrossRef]
  30. Liang P, Pardee AB 1992 Differential display of eukaryotic messenger RNA by means of polymerase chain reaction. Science 257:967–971[Abstract/Free Full Text]
  31. Utans U, Liang P, Wyner LR, Karnovsky MJ, Russell ME 1994 Chronic cardiac rejection: identification of five upregulated genes in transplanted hearts by differential mRNA display. Proc Natl Acad Sci USA 91:6463–6467[Abstract/Free Full Text]
  32. Aiello LP, Robinson GS, Lin YW, Nishio Y, King GL 1994 Identification of multiple genes in bovine retinal pericytes altered by exposure to elevated levels of glucose by using mRNA differential display. Proc Natl Acad Sci USA 91:6231–6235[Abstract/Free Full Text]
  33. Sakurada K, Uchida K, Yamaguchi K, Aisaka K, Ito S, Ohmori T, Takeyama Y, Ueda T, Hori Y, Ohyanagi H 1991 Molecular cloning and characterization of a ras p21-like GTP-binding protein (24 KG) from rat liver. Biochem Biophys Res Commun 177:1224–1232[CrossRef][Medline]
  34. Gromov PS, Celis JE, Hansen C, Tommerup N, Gromova I, Madsen P 1998 Human rab11a: transcription, chromosome mapping and effect on the expression levels of host GTP-binding proteins. FEBS Lett 429:359–364[CrossRef][Medline]
  35. Dao B, Vanage G, Marshall A, Bardin CW, Koide SS 1996 Anti-implantation activity of antiestrogens and mifepristone. Contraception 54:253–258[CrossRef][Medline]
  36. Couse JF, Lindzey J, Grandien K, Gustafsson JA, Korach KS 1997 Tissue distribution and quantitative analysis of estrogen receptor-{alpha} (ER{alpha}) and estrogen receptor-ß (ERß) messenger ribonucleic acid in the wild-type and ER {alpha}-knockout mouse. Endocrinology 138:4613–4621[Abstract/Free Full Text]
  37. Huet-Hudson YM, Chakraborty C, De SK, Suzuki Y, Andrews GK, Dey SK 1990 Estrogen regulates the synthesis of epidermal growth factor in mouse uterine epithelial cells. Mol Endocrinol 4:510–523[Abstract/Free Full Text]
  38. Kapur S, Tamada H, Dey SK, Andrews GK 1992 Expression of insulin-like growth factor-I (IGF-I) and its receptor in the peri-implantation mouse uterus, and cell-specific regulation of IGF-I gene expression by estradiol and progesterone. Biol Reprod 46:208–219[Abstract]
  39. Bhatt H, Brunet LJ, Stewart CL 1991 Uterine expression of leukemia inhibitory factor coincides with the onset of blastocyst implantation. Proc Natl Acad Sci USA 88:11408–11412[Abstract/Free Full Text]
  40. Wang XN, Das SK, Damm D, Klagsbrun M, Abraham JA, Dey SK 1994 Differential regulation of heparin-binding epidermal growth factor-like growth factor in the adult ovariectomized mouse uterus by progesterone and estrogen. Endocrinology 135:1264–1271[Abstract]
  41. Pentecost BT, Teng CT 1987 Lactotransferrin is the major estrogen inducible protein of mouse uterine secretions. J Biol Chem 262:10134–10139[Abstract/Free Full Text]
  42. Julian J, Carson DD, Glasser SR 1992 Polarized rat uterine epithelium in vitro: constitutive expression of estrogen-induced proteins. Endocrinology 130:79–87[Abstract/Free Full Text]
  43. Couse JF, Curtis SW, Washburn TF, Lindzey J, Golding TS, Lubahn DB Smithies O, Korach KS 1995 Analysis of transcription and estrogen insensitivity in the female mouse after targeted disruption of the estrogen receptor gene. Mol Endocrinol 9:1441–1454[Abstract/Free Full Text]
  44. Sundstrom SA, Komm BS, Ponce-de-Leon H, Yi Z, Teuscher C, Lyttle CR 1989 Estrogen regulation of tissue-specific expression of complement C3. J Biol Chem 264:16941–16947[Abstract/Free Full Text]
  45. Stewart CL 1994 Leukaemia inhibitory factor and the regulation of pre-implantation development of the mammalian embryo. Mol Reprod Dev 39:233–238[CrossRef][Medline]
  46. Burgess TL, Kelly RB 1987 Constitutive and regulated secretion of proteins. Annu Rev Cell Biol 3:243–293[CrossRef]
  47. Tooze SA, Stinchcombe JC 1992 Biogenesis of secretory granules. Semin Cell Biol 3:357–366[CrossRef][Medline]
  48. Burgoyne RD, Morgan A 1993 Regulated exocytosis. Biochem J 293:305–316
  49. Urbe S, Huber LA, Zerial M, Tooze SA, Parton RG 1993 Rab11, a small GTPase associated with both constitutive and regulated secretory pathways in PC 12 cells. FEBS Lett 334:175–182[CrossRef][Medline]
  50. Goldenring JR, Soroka CJ, Shen KR, Tang LH, Rodriguez W, Vaughan HD, Stoch SA, Modlin IM 1994 Enrichment of rab11, a small GTP-binding protein, in gastric parietal cells. Am J Physiol 267:G187–194
  51. Goldenring JR, Smith J, Vaughan HD, Cameron P, Hawkins W, Navarre J 1996 Rab 11 is an apically located small GTP-binding protein in epithelial tissues. Am J Physiol 270:G515–525
  52. Ullrich O, Reinsch S, Urbe S, Zerial M, Parton RG 1996 Rab 11 regulates recycling through the pericentriolar recycling endosome. J Cell Biol 135:913–924[Abstract/Free Full Text]
  53. Ren M, Xu G, Zeng J, De Lemos-Chiarandini C, Adesnik M, Sabatini DD 1998 Hydrolysis of GTP on rab 11 is required for the direct delivery of transferrin from the pericentriolar recycling compartment to the cell surface but not from sorting endosomes. Proc Natl Acad Sci USA 95:6187–6192[Abstract/Free Full Text]
  54. Cooke PS, Buchanan DL, Young P, Setiawan T, Brody J, Korach KS, Taylor J, Lubahn DB, Cunha GR 1997 Stromal estrogen receptors mediate mitogenic effects of estradiol on uterine epithelium. Proc Natl Acad Sci USA 94:6535–6540[Abstract/Free Full Text]
  55. Buchanan DL, Setiawan T, Lubahn DB, Taylor JA, Kurita T, Cunha G, Cooke PS 1999 Tissue compartment-specific estrogen receptor {alpha} participation in the mouse uterine epithelial secretory response. Endocrinology 140:484–491[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
J. A Desmarais, M. Cao, A. Bateman, and B. D Murphy
Spatiotemporal expression pattern of progranulin in embryo implantation and placenta formation suggests a role in cell proliferation, remodeling, and angiogenesis
Reproduction, August 1, 2008; 136(2): 247 - 257.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. F. J. van de Graaf, J. G. J. Hoenderop, and R. J. M. Bindels
Regulation of TRPV5 and TRPV6 by associated proteins
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1295 - F1302.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
V S Patil, G Sachdeva, D N Modi, R R Katkam, D D Manjramkar, I Hinduja, and C P Puri
Rab coupling protein (RCP): a novel target of progesterone action in primate endometrium
J. Mol. Endocrinol., October 1, 2005; 35(2): 357 - 372.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Chen, X. Xu, Y.-P. Cheon, M. K. Bagchi, and I. C. Bagchi
Estrogen Induces Expression of Secretory Leukocyte Protease Inhibitor in Rat Uterus
Biol Reprod, August 1, 2004; 71(2): 508 - 514.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. K. Dey, H. Lim, S. K. Das, J. Reese, B. C. Paria, T. Daikoku, and H. Wang
Molecular Cues to Implantation
Endocr. Rev., June 1, 2004; 25(3): 341 - 373.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
M. Huber, I. Bahr, J. R. Kratzschmar, A. Becker, E.-C. Muller, P. Donner, H.-D. Pohlenz, M. R. Schneider, and A. Sommer
Comparison of Proteomic and Genomic Analyses of the Human Breast Cancer Cell Line T47D and the Antiestrogen-resistant Derivative T47D-r
Mol. Cell. Proteomics, January 1, 2004; 3(1): 43 - 55.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. G. Simmons and T. G. Kennedy
Uterine Sensitization-Associated Gene-1: A Novel Gene Induced Within the Rat Endometrium at the Time of Uterine Receptivity/Sensitization for the Decidual Cell Reaction
Biol Reprod, November 1, 2002; 67(5): 1638 - 1645.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. P. Greenfield, L. W. Leung, D. Cai, K. Kaasik, R. S. Gross, E. Rodriguez-Boulan, P. Greengard, and H. Xu
Estrogen Lowers Alzheimer beta -Amyloid Generation by Stimulating trans-Golgi Network Vesicle Biogenesis
J. Biol. Chem., March 29, 2002; 277(14): 12128 - 12136.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Harris, R. A. Henderson, R. A. Bhat, and B. S. Komm
Regulation of Metallothionein II Messenger Ribonucleic Acid Measures Exogenous Estrogen Receptor-{beta} Activity in SAOS-2 and LNCaPLN3 Cells
Endocrinology, February 1, 2001; 142(2): 645 - 652.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, D.
Right arrow Articles by Bagchi, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, D.
Right arrow Articles by Bagchi, M. K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*PROGESTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals