help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wiebel, F. F.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wiebel, F. F.
Right arrow Articles by Gustafsson, J.-A.
Molecular Endocrinology 13 (7): 1105-1118
Copyright © 1999 by The Endocrine Society

Ligand-Independent Coregulator Recruitment by the Triply Activatable OR1/Retinoid X Receptor-{alpha} Nuclear Receptor Heterodimer

Franziska F. Wiebel1, Knut Rune Steffensen2, Eckardt Treuter, Dorothee Feltkamp and Jan-Åke Gustafsson

Center for Biotechnology (F.F.W., K.R.S., E.T., D.F.) Department of Biosciences Karolinska Institute NOVUM, S-141 57 Huddinge, Sweden
Department of Medical Nutrition (J.-A.G.) Karolinska Institute F-60 NOVUM, S-141 86 Huddinge, Sweden


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OR1 is a member of the superfamily of steroid/thyroid hormone nuclear receptors and recognizes DNA as a heterodimer with the 9-cis-retinoic acid receptor RXR (retinoid X receptor). The heterodimeric complex has been shown to be transcriptionally activatable by the RXR ligand as well as certain oxysterols via OR1, but to date uniquely also by heterodimerization itself. Recent studies on other members of the superfamily of nuclear receptors have led to the identification of a number of nuclear receptor-interacting proteins that mediate their regulatory effects on transcription. Here, we address the question of involvement of some of these cofactors in the three modes of activation by the OR1/RXR{alpha} complex. We show that in vitro the steroid receptor coactivator SRC-1 can be recruited by RXR{alpha} upon addition of its ligand, and to OR1 upon addition of 22(R)-OH-cholesterol, demonstrating that the latter can act as a direct ligand to OR1. Additionally, heterodimerization is sufficient to recruit SRC-1 to OR1/RXR{alpha}, indicating SRC-1 as a molecular mediator of dimerization-induced activation. In transfection experiments, coexpression of a nuclear receptor-interacting fragment of SRC-1 abolishes constitutive activation by OR1/RXR{alpha}, which can be restored by overexpression of full-length SRC-1. This constitutes evidence for an in vivo role of SRC-1 in dimerization-induced activation by OR1/RXR{alpha}.

Additionally, we show that the nuclear receptor-interacting protein RIP140 binds in vitro to OR1 and RXR{alpha} with requirements distinct from those of SRC-1, and that binding of the two cofactors is competitive. Taken together, our results suggest a complex modulation of differentially induced transactivation by OR1/RXR coregulatory molecules.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The superfamily of nuclear steroid/thyroid hormone receptors (1, 2) comprises a large number of transcription factors that are regulated by a variety of hormone and metabolite ligands to mediate physiological responses in development, differentiation, and organ-specific functions. They possess a characteristic and highly conserved DNA-binding domain (DBD) containing two zinc fingers, an N-terminal domain that is highly variable in both length and sequence and often contains a transactivation domain (AF-1), and a moderately conserved carboxy-terminal ligand-binding domain (LBD), which for many family members has been shown to bind receptor-specific, activating ligands. Ligand-dependent transactivation is mediated, at least in part, by activation function 2 (AF-2) comprising a specific AF-2 sequence motif found at the very carboxy-terminal end of most nuclear receptors (3), a region that, based on structural analysis (Ref. 4 and references therein and Ref. 5), is referred to as helix 12 (H12; also AF-2, {tau}c, tau-4) (3, 6, 7, 8).

While some family members bind to DNA as either monomers or homodimers, a large number of them have been shown to recognize their specific DNA response elements as heterodimers with one particular receptor variant, the 9-cis retinoic acid (9cRA) or retinoid X receptor (RXR) (9). Accordingly, the corresponding heterodimer complexes are potentially activated by two types of ligands, i.e. via both dimerization partners. However, the LBD also plays a major role in receptor dimerization, and the two functions are structurally not separable since they comprise overlapping regions. Ligand binding has been shown to induce a significant conformational change in receptor LBDs (10, 11, 12), which among other things is thought to reposition H12 in a different intramolecular context to form part of a complete AF-2 surface as a prerequisite for transactivation (4, 13, 14). It is thus not surprising that ligand binding and dimerization can affect each other in various ways. For example, ligand-binding can favor or disfavor homo- vs. heterodimerization, and heterodimerization can prevent or, on the contrary, be necessary for ligand binding by one of the partners (15, 16, 17, 18).

The nuclear receptor OR1 (UR, RIP15, NER, LXRß) (19, 20, 21) and its paralog RLD-1 (LXR{alpha}) (22, 23) are heterodimerization partners of RXR and have recently been shown to be activated by various oxysterols, which are cholesterol metabolites and precursors in the biosynthesis of steroid hormones and bile acids (24, 25). The identification of this novel class of nuclear receptor activators suggested a role of the OR1/RLD-1 nuclear receptor subgroup in cholesterol homeostasis and/or the regulation of downstream biosynthetic processes, which was recently elegantly demonstrated by targeted gene inactivation of the LXR{alpha} gene in mice (26, 27). Since in the complex with OR1 or LXR{alpha} the partner protein RXR remains highly permissive for activation by its ligand 9cRA (21, 23), a vitamin A metabolite, the heterodimer is a potential target for two very different classes of signaling molecules. Additionally, we have recently demonstrated that although neither OR1-/RLD-1-LBD nor RXR{alpha}-LBD transactivate by themselves, the heterodimer can confer constitutive transactivation (28); to date, all other described RXR heterodimers, with the exception of MB67/CAR (29, 30) and perhaps Nurr1 (15), appear to be ligand dependent for transactivation. OR1/RXR{alpha}-mediated constitutive activation might be of more general interest also for other nuclear receptor-mediated signaling pathways because OR1/RXR binds a motif (DR4) that is recognized by several other nuclear receptor dimers, e.g. an RXR heterodimer with the thyroid hormone receptor (TR) or a COUP-TF homodimer, and could thus modulate or interfere with transcriptional regulation by these receptors independent of ligand. Several lines of evidence indicate that the observed constitutive transactivation is based on dimerization-induced activation of OR1 upon interaction with RXR{alpha}, which constitutes a novel mechanism of nuclear receptor activation and makes the OR1/RXR{alpha} heterodimer the first nuclear receptor complex described to be activated in three different ways (28). Given that the relative strength of constitutive vs. ligand-dependent transcriptional activity of the heterodimer has been observed to vary greatly under different conditions, constitutive complex activation might play an important regulatory role not only by conferring basal transcriptional activation but also by tuning the ligand sensitivity of the heterodimer.

In recent years, a number of coregulatory proteins that mediate transcriptional regulation exerted by nuclear receptors have been described (see Refs. 31, 32 for reviews). Although there are some reports of direct interaction of family members with central components of the transcriptional machinery (e.g. Refs. 33, 34, 35), recruitment of intermediary factors seems to be of more general relevance. For example, several factors have been described that, upon their direct or indirect recruitment by the DNA-bound nuclear receptors, alter the acetylation status of neighboring histones (36, 37, 38, 39, 40, 41) and thereby the accessibility of the promoter region to further protein binding, revealing one mechanism by which nuclear receptor cofactors regulate transactivation.

In this work, we have extended our previous work on the nuclear receptor OR1/RXR{alpha} heterodimer to study the effect of differential activation of the complex on interaction with some known coregulatory proteins, with a focus on the nuclear receptor coactivator SRC-1 (42) and the coregulator RIP140 (43). Molecules of the SRC-1 coactivator class are recruited to nuclear receptors upon ligand binding and have recently been demonstrated to possess histone acetyltransferase activity (41) and to be able to recruit further histone acetyltransferases (44). We show that SRC-1 interacts with the OR1/RXR{alpha} heterodimer upon activation by any of the three modes, but not constitutively with either receptor. Thus, our experiments demonstrate 1) that 22(R)-OH-cholesterol [22(R)-HC] can act as a true ligand for OR1, and 2) that, just like ligand activation, dimerization-induced activation may act through SRC-1 as a molecular mediator. In transient transfection studies, it is shown that SRC-1 can indeed mediate the constitutive transcriptional activation by the OR1/RXR{alpha} complex. For the nuclear receptor-interacting protein RIP140, a distinct function in mammalian transcriptional regulation has so far not been identified, but a regulatory role by competition with SRC-1 has been proposed (45). We present evidence that, in contrast to SRC-1, RIP140 displays constitutive and only moderately ligand-enhanced interaction with either partner of the OR1/RXR{alpha} heterodimer in vitro, and that binding to the heterodimer cannot occur simultaneously with SRC-1. We discuss the possible roles of the accessory proteins in transcriptional regulation by the OR1/RXR{alpha} heterodimer and the implications for differential activation by this multiply activatable nuclear receptor complex.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The DNA-Bound OR1/RXR{alpha} Heterodimer Interacts with SRC-1 in Vitro
Since heterodimeric OR1/RXR{alpha} has been shown to be transcriptionally activated in three ways, i.e. by activators of each partner as well as by dimerization itself, we wished to determine how these modes of activation correlated with recruitment of a member of the best characterized nuclear receptor accessory protein group (41, 42, 46, 47, 48, 49, 50, 51, 52), the coactivator SRC-1 (42). To address this question, we tested the ability of the DNA-bound OR1/RXR{alpha} complex to interact with a fragment (SRC-iad, Fig. 1Go) comprising a previously described nuclear receptor interaction domain of SRC-1 (46, 52) in an electrophoretic mobility shift assay (EMSA). In vitro-translated receptors were bound to radiolabeled oligonucleotides containing a DR4 response element in the absence or presence of purified glutathione-S-transferase (GST)-tagged SRC-iad produced in Escherichia coli (Fig. 2AGo). In contrast to a TR{alpha}/RXR{alpha} heterodimer, the OR1/RXR{alpha} heterodimer was able to recruit the GST-fused SRC-1 fragment, but not the GST portion alone (data not shown), in the absence of added ligand. This recruitment was not affected by a point mutation in the AF-2 motif of RXR{alpha}, but was completely abolished by the corresponding mutation in H12 of OR1.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Constructs Used in This Study

A, Schematic representation of the nuclear receptor accessory proteins and protein fragments used in this study. Numbers refer to amino acid positions. Black bars, Nuclear receptor-interaction motifs; shaded areas, nuclear receptor interaction domains according to Ref. 46. The depicted constructs were used as indicated for transient transfections (T), pull-down assays (PD), and EMSAs. B, C-terminal amino acid sequences of RXR{alpha}, OR1, and corresponding H12-mutant variants used in this study.

 


View larger version (60K):
[in this window]
[in a new window]
 
Figure 2. Recruitment of SRC-1 by DNA-Bound TR{alpha}/RXR{alpha} and OR1/RXR{alpha}-Heterodimers

Receptor proteins were allowed to bind to a DR4-containing radiolabeled probe in the absence or presence of receptor ligands and bacterially expressed and purified GST-fused SRC-iad fragment, and the formed complexes were analyzed by EMSA. RXR{alpha} homodimers do not recognize the DR4-probe (data not shown). A, Binding of SRC-iad (2.5 µg) to in vitro translated OR1/RXR{alpha} and TR{alpha}/RXR{alpha} in the absence or presence of added specific ligands (spec.lig.) and effect of mutation of the AF-2 motifs of RXR{alpha} and OR1 for SRC-iad recruitment by the corresponding heterodimer. B, Titration experiment to dissect the roles of 9cRA, 22(R)-HC, and the AF-2 motif of RXR{alpha} in recruitment of SRC-iad by the OR1/RXR{alpha} heterodimer. C, Comparison of interaction of increasing amounts of SRC-iad (0.45 µg, 1.35 µg, 4.5 µg) with DNA-bound GAL4-OR1 homodimers from in vitro translates (iv-tr.) and effect of addition of 22(R)-HC. D, Interaction of SRC-iad (4.5 µg) with DR4-bound heterodimers of OR1 and RXR{alpha} expressed in and purified from E. coli. 9c, 9cRA; 22R, 22(R)-HC.

 
In this initial experiment, relatively high amounts of purified SRC-iad protein were employed, and no effect of ligand addition could be observed. However, when we performed a titration experiment starting at very low concentrations of SRC-iad (Fig. 2BGo), a clear enhancement of SRC interaction by addition of 9cRA could be observed (lanes 1–6 vs. 7–12). Strikingly, this ligand effect was lost when the RXR{alpha} H12 mutant was employed (lanes 25–36). Somewhat unexpectedly, we were not able to observe any enhancement of SRC-iad interaction with the OR1/RXR{alpha} heterodimer by addition of its activator and proposed ligand 22(R)-HC (lanes 13–24). However, a ligand effect on SRC recruitment by OR1 could be demonstrated on a GAL4-OR1 dimer (Fig. 2CGo), which is not preactivated by dimerization. The enhancement of OR1 interaction with SRC-iad upon addition of 22(R)-HC indicates that this metabolite is indeed an OR1-ligand.

Interaction of SRC-1 with the DNA-Bound OR1/RXR{alpha} Heterodimer Is Ligand Independent
Recruitment of SRC-1 by the OR1/RXR{alpha} heterodimer in the absence of added ligand was in line with the described dimerization-induced activation of OR1 by interaction with RXR{alpha}. However, since the presence of nuclear receptor ligands in the in vitro translation system cannot be excluded, interaction of the OR1/RXR{alpha} heterodimer with SRC-1 was further investigated using His6-tagged receptor proteins overexpressed in and purified from E. coli. As shown in Fig. 2DGo, SRC-iad interacted with the DR4-bound OR1/RXR{alpha}-{Delta}N heterodimer in the absence of added ligand. Since this system is highly unlikely to contain any steroid-like components, this result confirms that the OR1/RXR{alpha} heterodimer can recruit SRC-1 in a ligand-independent fashion. The interaction could be further enhanced by the RXR ligand, 9cRA, but, again, no enhancement by addition of 22(R)-HC was observed on the dimerization-activated complex.

Recruitment of SRC-1 in Vitro Is Triggered by Dimerization of OR1 with RXR{alpha}
To be able to further dissect the effect of dimerization on recruitment of SRC-1, we employed a GST-fusion protein pull-down assay. First, we tested the interaction of SRC-1 with the GST-fused LBDs of both receptors in the absence or presence of their respective activators. As illustrated in Fig. 3AGo, in vitro translated and radiolabeled SRC-1 (aa 1–1061) shows no significant constitutive interaction with either of the unliganded LBDs and no interaction at all with the GST-fusion moiety. In contrast, interaction is strongly enhanced upon addition of 9cRA or 22(R)-HC with the respective receptor LBD, indicating that SRC-1 can be recruited to both heterodimer partners by ligand activation. Thus, this result confirms that 22(R)-HC can act as a direct ligand to OR1 and independently of RXR{alpha} heterodimerization. While mutation of the AF-2 motif of OR1 abolished ligand enhancement of SRC-1 interaction, the corresponding RXR{alpha} mutant still retained some 9cRA responsiveness, indicating that this mutant is leaky toward both ligand binding and activation.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. In Vitro Interaction of Radiolabeled SRC-1 with Sepharose-Bound GST Fusion Variants of Receptor LBDs

Twenty percent of the amount of radiolabeled protein corresponding to the input used for one lane is given as a control (20% inp.). vh., Vehicle (DMSO); 9cR, 9cRA; 22R, 22(R)-HC. A, Interaction of SRC-1 with individual wild-type and H12-mutant LBDs and effects of addition of specific activators. B, Effect of receptor LBD heterodimerization on recruitment of SRC-1. After binding to glutathione-Sepharose, GST-fused LBDs were saturated with His6-fused RXR-LBD (lanes 11–14, 16, and 19), RXRm-LBD (lane 15), or mock-treated (lanes 1–8, 17, 18, and 20–22) and washed before addition of radiolabeled SRC-1.

 
To obtain a matrix to study the effect of heterodimerization on interaction with SRC-1, we devised an extended GST pull-down assay. We first bound GST-fused OR1-LBD to glutathione-Sepharose and subsequently saturated it with His6-tagged RXR-LBD or RXRm-LBD where indicated (Fig. 3BGo). (Note that SRC-1 recruitment by RXRm + 9cRA is lost due to the additional washing step involved in this procedure.) In this setup, it can be shown that SRC-1 is bound far more efficiently by OR1-LBD dimerized with RXR-LBD than by the individual LBDs (lane 11 vs. lanes 1 and 5). Great care was taken to use equivalent amounts of GST-fused proteins as bait, and the effect was observed in several independent experiments and even when more free than heterodimerized OR1 was offered. The experiment thus demonstrates that coactivator recruitment can indeed be triggered by the third mode of activation, heterodimerization. As an important control, this effect is not observed for the heterodimer of TR and RXR{alpha} (lane 19). In conclusion, SRC-1 displays the characteristics predicted for a molecular mediator of dimerization-induced activation of the OR1/RXR{alpha} complex.

In this extended pull-down assay, both 9cRA and 22(R)-HC enhance recruitment of SRC-1 by the heterodimer (lanes 11–14), demonstrating that both ligands can further activate the complex. In agreement with our previous observations (28), mutation of the RXR{alpha}-AF-2 does not affect the dimerization-activated state (lane 15), while it is sensitive to mutation of the AF-2 motif of OR1 (lane 16). This result is not due to impaired heterodimerization since neither mutation had a visible effect on heterodimer-LBD recruitment as judged by Coomassie staining (data not shown).

RIP140 Interacts with OR1 and RXR{alpha} in Vitro
We next tested the activation dependency of OR1/RXR{alpha} interaction with another coregulatory protein, the human RIP140 (43, 53). Significant constitutive interaction with a 728-amino acid carboxy-terminal portion of hRIP140 (RIP140-{Delta}N, see Fig. 1Go) is found for the unliganded receptor LBDs in the pull-down assay (Fig. 4AGo, lanes 3 and 7). This can be enhanced only moderately by addition of the respective ligands (lanes 4 and 8). As for SRC-1, interaction of RIP140-{Delta}N with the OR1/RXR{alpha} heterodimer (lane 9) is stronger than for the individual LBDs. However, the observed increase is weaker, and, given the background of constitutive interaction, the increased interaction might be explained by cooperativity of binding alone or by the recruitment of one molecule of RIP140-{Delta}N per heterodimer partner and might therefore not be activation triggered. Mutation of the AF-2s of either receptor has no clear effect on RIP140-{Delta}N interaction in the combinations tested (lanes 10 and 11). Finally, the notion that the presentation of two LBDs in itself leads to increased enhanced binding of RIP140-{Delta}N is supported by the fact that it also occurs upon TR{alpha} dimerization with RXR{alpha} (lanes 13–15), corresponding to a nonactivated receptor state.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 4. Interaction of Fragments of RIP140 with OR1 and RXR{alpha}

A, Interaction of radiolabeled RIP140-{Delta}N with individual (lanes 3–8, 13, and 14) or heterodimeric (lanes 9–11 and 15) wild-type and H12-mutant GST-fused receptor LBDs and effects of addition of specific activators. The experiment was performed as described for Fig. 3BGo. vh., Vehicle (DMSO); 9cR, 9cRA; 22R, 22(R)-HC. B, Mobility of DNA-bound in vitro translated OR1/RXR{alpha} heterodimers in the presence of increasing amounts of His10-RIP140-iad, and effect of mutation of the AF-2 motifs of the heterodimer partners. Receptor proteins were allowed to bind to a DR4-containing radiolabeled probe in the absence or presence of receptor ligands and bacterially expressed and purified, His10-tagged RIP140-iad fragment (0.05 µg, 0.15 µg, 0.5 µg), and the formed complexes were analyzed by EMSA.

 
We next tested the interaction of a somewhat smaller, His10-tagged fragment of RIP140 (RIP140-iad, see Fig. 1Go), which had been expressed in and purified from E. coli, with the DNA-bound OR1/RXR{alpha} heterodimer (Fig. 4BGo). In the absence of added ligand, a slight supershift upon addition of RIP140-iad is observed (lanes 1–4; cf. also lanes 8 and 9). In comparison, in the presence of 9cRA a similar supershift is observed already with lower amounts of RIP140-iad and its migration further slowed in a dose-dependent manner (lanes 5–7). While the reasons for this gradual supershift remain to be analyzed further, a possible explanation is that two molecules of RIP140-iad bind to the 9cRA-activated OR1/RXR{alpha} heterodimer. In the presence of limiting amounts of RIP140-iad, fluctuation between ternary and quaternary complexes might cause smearing.

The experiment was extended to examine the effects of H12 mutations as well (lanes 8–13). Mutation of the AF-2 motif of RXR{alpha} leads to a loss of the additional supershift, while mutation of H12 of OR1 abolishes interaction with RIP140-iad, establishing that both H12 receptor domains play a role in interaction with RIP140. It should be noted that the fragment of RIP140 used here was smaller than the one used in the pull-down assay, containing only two instead of four nuclear receptor-interaction motifs (46) (cf. Fig 1AGo), which could explain the observed difference in sensitivity for mutation of H12 of RXR{alpha}.

Binding of RIP140 Interferes with SRC-1 Recruitment by OR1/RXR{alpha}
Since both SRC-1 and RIP140 can bind to the 9cRA-activated OR1/RXR{alpha} heterodimer, we asked whether the interaction can take place simultaneously, or if binding of one factor prevents interaction with the other. First, we performed an SRC-1 pulldown with the dimerized, liganded, or unliganded OR1/RXR{alpha} LBDs in the absence or presence of excess purified His10-RIP140-iad (Fig. 5AGo). In all three activation states, RIP140-iad clearly reduced heterodimer interaction with SRC-1, indicating that binding of RIP140 vs. SRC-1 is competitive. Second, in an EMSA (Fig. 5BGo), His10-RIP140-iad delayed the recruitment of GST-SRC-iad in the 9cRA-activated state (lanes 10–14 vs. 15–19) and possibly weakly in the absence of added ligand (lanes 7–9 vs. 2–4). However, it should be kept in mind that the strong 9cRA sensitivity of RIP140-iad observed here is most likely due to the fact that this is only a short fragment of RIP140. Slower complexes that might contain both RIP140-iad and SRC-iad were not observed. Taken together, the results suggest that interaction of OR1/RXR{alpha} with RIP140 and SRC-1 is mutually exclusive.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Binding of RIP140 Interferes with SRC-1 Recruitment by OR1/RXR{alpha}

A, Inhibition of binding of radiolabeled SRC-1 to OR1/RXR{alpha} LBD-heterodimers by addition of His10-tagged RIP140-iad expressed and purified from E. coli. A Coomassie-stained gel illustrating the amount of proteins present in the Sepharose-bound bait is shown below. B, Effect of recruitment of GST-fused SRC-iad (0.1 µg, 0.3 µg, 1 µg, 3 µg) by OR1/RXR{alpha} in the absence or presence of His10-tagged RIP140-iad (2.2 µg).

 
SRC-1 Can Mediate Constitutive Transcriptional Activation by OR1/RXR{alpha}
The physical interaction of SRC-1 with heterodimerized or ligand-activated OR1/RXR{alpha} observed in in vitro experiments suggests a role of SRC-1 as a mediator of transcriptional activation by the complex of these receptors. In transient transfection experiments in CV1 cells employing OR1 and RXR{alpha} and a 3xDR4-TK-luciferase reporter, cotransfection of a plasmid encoding SRC-1 (aa 1–1061) did not yield enhanced constitutive transactivation (data not shown). To test the idea that this could be due to the presence of saturating endogenous amounts of proteins of the SRC-1 class, we used a truncated version of SRC-1 comprising only a nuclear receptor interaction domain (aa 216–394), which can be expected to act as a dominant negative interactor. Indeed, cotransfection of a construct expressing this fragment of SRC-1 efficiently interfered with activation by OR1/RXR{alpha} (Fig. 6AGo). The rather high basal activity of the 3xDR4-TK-luciferase reporter remained largely unaffected, indicating that the observed effect was due to interaction of the nuclear receptor interaction domain of SRC-1 with OR1/RXR{alpha} and not other factors acting on the promoter employed. Conversely, the transcriptional enhancement by OR1/RXR{alpha} that was affected by cotransfection of the dominant negative SRC-1 fragment could be restored by additional coexpression of excess amounts of SRC-1 (Fig. 6BGo). Thus, SRC-1 cannot only interact with the OR1/RXR{alpha} heterodimer but can also functionally mediate dimerization-induced activation by this nuclear receptor heterodimer in intact cells.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. SRC-iad Can Interfere with and SRC-1 Can Mediate Transcriptional Activation by OR1/RXR{alpha} in Vivo

CV-1 cells were transfected with control vector or OR1 and RXR{alpha} expression plasmid and reporter 3xDR4-TK-LUC as well as expression plasmids for SRC-iad and SRC-1 where indicated. Luciferase activity was determined 36 h after transfection; the values given are means from three independent experiments; bars indicate SEs. A, Cotransfection of SRC-iad inhibits activation by the OR1/RXR{alpha}-heterodimer. The individual experiments were standardized for the value obtained for cotransfection of OR1 and RXR{alpha} without SRC-1. B, Overexpression of SRC-1 can overcome the dominant negative effect of SRC-iad. Fold activation obtained for OR1/RXR{alpha} over empty expression vector (control) is given.

 
Role of the AF2-Domains in Activation by the OR1/RXR{alpha} Heterodimer
As described above, mutation of the AF-2 motif of OR1 abolishes ligand-dependent and dimerization-induced recruitment of SRC-1 in the pull-down experiment. Accordingly, the mutation also eliminates SRC-1 interaction with the heterodimer in the EMSA, even in the presence of both ligands. In a transient transfection experiment (Fig. 7AGo), cotransfection of the corresponding OR1 mutant with RXR{alpha} and a 3xDR4-TK-LUC reporter not only completely abolished dimerization-induced activation and 22(R)-HC-enhanced activation but also affected 9cRA-dependent transactivation. Taken together, and taking into account our previous data obtained with GAL4-chimeric receptor variants (28), the results show that mutation of H12 of OR1 abolishes ligand inducibility of OR1 as well as dimerization-induced activation of the heterodimeric complex and, additionally, affects the 9cRA responsiveness of RXR{alpha}.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Effect of H12 Point Mutants on Transcriptional Activation by OR1/RXR{alpha} in Transfected Cells

Transfections were performed in CV1-cells and cells grown in the absence or presence of the activators indicated for 24 h after transfection. Relative luciferase activities are given as means from three independent experiments; bars represent SEs. A, Effect of point mutation of the AF-2 motif of OR1 on transcriptional activation by OR1/RXR{alpha} from a 3xDR4-TK-LUC reporter. B, 9cRA-induced transcriptional activities obtained for H12 mutated variants of RXR{alpha} cotransfected with the reporter 3xDR1-TK-LUC. C, Point mutated variants of a GAL4-RXRlbd fusion retain the potential for 9cRA-induced transcriptional activation from the reporter 4xUAS-TK-LUC.

 
We have shown earlier that a carboxy-terminal deletion into the AF-2 motif of RXR{alpha} abolishes the 9cRA-responsiveness of the OR1/RXR{alpha} complex but leaves dimerization-induced activation unaffected (28). This seemed to be in conflict with reports that a complex of the OR1 paralog LXR{alpha} with an H12 point-mutated variant of RXR{alpha} (L455A, E456A, here referred to as RXR-le) retained 9cRA inducibility, which was interpreted to indicate that the 9cRA-response of the heterodimer is mediated by the activation function of LXR{alpha} (54). We therefore decided to analyze the different mutant variants in comparison. In a transient cotransfection assay (Fig. 7BGo), both RXR-ml and RXR-le displayed residual 9cRA responsiveness on a 3xDR1-TK-LUC reporter, while the deletion variant RXR{Delta} was silent. When tested as GAL4-fusion variants of RXR{alpha} (Fig. 7CGo), the point mutants displayed a clear 9cRA-response (see also Ref. 54) and thus proved to be leaky with regard to 9cRA-activation. The observed adverse effects of these point mutations on transactivation from the DR1 element (Ref. 54 and Fig. 7BGo) might be due to a reduction in homodimerization efficiency or other functions of RXR{alpha} specifically required for transactivation from a DR1.

Judging from the activity obtained with the GAL4-chimera, mutant RXR-ml is somewhat more stringent than mutant RXR-le and was therefore used for all other experiments described here. In the pull-down assay, mutation of the AF-2 motif of RXR{alpha} reduced, but did not abolish, 9cRA-dependent recruitment of SRC-1, again indicating that the mutation is leaky, and had no effect on its dimerization-induced recruitment. However, 9cRA-enhanced interaction of the OR1/RXRml heterodimeric complex with the SRC-iad or RIP140-iad fragments in EMSA could no longer be observed.

Taken together, the results are in line with our previous conclusions that 9cRA induction, but not dimerization-induced activation, is dependent on an intact H12 in RXR{alpha}, while dimerization-induced activation is eliminated by mutations in H12 of OR1.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have earlier described dimerization-induced activation as a novel mechanism of activation observed for the heterodimer of OR1 and RXR{alpha} and proposed the dimerization-induced occurrence of a conformational change in the LBD, similar to that otherwise obtained upon ligand binding, as the underlying mechanism. Since ligand-induced transactivation by nuclear receptors has recently been shown to be mediated by direct interaction with certain coactivator proteins, we have in the present work addressed the idea that dimerization-induced activation of OR1 upon interaction with RXR{alpha} might lead to the recruitment of such factors as well. Here, we demonstrate that in vitro interaction with the nuclear receptor coactivator SRC-1 is indeed triggered by dimerization of OR1 with RXR{alpha}, with roles for the AF-2 motifs of OR1 and RXR{alpha} as predicted by our previous studies (28). The identification of the SRC-1 coactivator as a dimerization-induced interactor of OR1/RXR{alpha} provides a molecular basis for the concept of dimerization-induced activation and, despite contrary reports (55), strongly supports the notion that dimerization-induced activation is indeed a ligand-independent event.

As reported before for nuclear receptors (e.g. Refs. 42, 56, 57, 58), we show that SRC-1 is recruited to glutathione-Sepharose-bound GST fusions of both RXR{alpha}- and OR1-LBD in an activator-dependent fashion. The experiment provides strong evidence for direct interaction of the activator employed, 22(R)-HC, with the OR1-LBD, indicating that it is not only an activator but indeed a ligand to OR1 and that its binding to OR1 is independent of RXR{alpha}. As a central result for this study, the pull-down experiments demonstrated that while SRC-1 is unable to interact efficiently with nonactivated OR1- or RXR{alpha}-LBD, it is readily recruited by the heterodimerized LBDs. The fact that this is not observed for a heterodimer of RXR{alpha}- and TR{alpha}-LBDs rules out the possibility that this is a general, merely synergistic, effect of weak binding to two heterodimerized nuclear receptor LBDs. In agreement with previous observations from transient transfection studies that dimerization-activated OR1/RXR{alpha}-heterodimer can be superactivated by either ligand (Ref. 28 and our unpublished results), both 9cRA and 22(R)-HC additionally enhanced recruitment of SRC-1 by dimerized OR1/RXR{alpha}.

Similar results showing interaction of the DNA-bound OR1/RXR{alpha} heterodimer with SRC-1 in the absence of added ligand were obtained in EMSA studies, although 22(R)-HC-enhanced recruitment could only be demonstrated when a homodimeric GAL4-OR1 fusion variant was employed. OR1 expressed in and purified from E. coli was additionally employed to confirm the conclusion from the pull-down assay that, in contrast to a TR{alpha}/RXR{alpha} heterodimer, a heterodimer of purified OR1 and RXR{alpha} is activated with respect to interaction with SRC-1 in a system devoid of potential sources of OR1 or RXR{alpha} ligands. It should be noted that the EMSA experiments involved the central nuclear receptor interaction domain of SRC-1 only (cf. Fig. 1AGo).

In both pull-down and EMSA assays, the roles of the carboxy-terminal AF-2 motifs of the partner receptors for SRC-1-interaction triggered by the three modes of activation were in close agreement with our observations from previous transfection studies (28). Ligand-induced SRC-1-interaction was affected by mutations in H12 of the respective liganded receptor, while dimerization-induced interaction was dependent on an intact H12 of OR1 but not of RXR{alpha}.

In transient transfection studies, the occurrence of dimerization-induced activation by OR1/RXR{alpha} from a DR4-containing reporter in the absence of cotransfected SRC-1 or other nuclear receptor coactivators indicated that such coactivators are constitutively expressed in the cells. It was therefore not surprising that cotransfection of SRC-1 did not yield any further transcriptional activation. Instead, we employed a dominant negative variant of SRC-1 (SRC-iad, containing an nuclear receptor-interaction domain but no transcriptional activation domain), which efficiently interfered with OR1/RXR{alpha}-mediated transcriptional activation, suggesting an interaction of SRC-iad with OR1/RXR{alpha} that blocks interaction of the heterodimer with endogenous nuclear receptor coactivators. Subsequently, by titrating in functional SRC-1 to compete with dominant negative SRC-iad for OR1/RXR{alpha} interaction, transactivation by the complex was regained. Thus, SRC-1 can act as a molecular mediator of dimerization-induced transcriptional activation by the OR1/RXR{alpha} heterodimer.

The precise role of a second nuclear receptor-interacting protein employed in this work, RIP140, in transcriptional regulation by nuclear receptors remains to be resolved. While there are several reports that it can act as a nuclear receptor coactivator (53, 59, 60) and that nuclear receptor interaction is dependent on ligand and an intact AF-2 motif (43, 56, 61), other studies in mammalian cell systems (43) and in yeast (45, 62) failed to demonstrate any transcriptional enhancement effect. Moreover, negative effects of RIP140 on transcriptional activation have also been reported (43, 62, 63). A model has recently been put forward according to which RIP140 indirectly regulates nuclear receptor AF-2 activity by competition for coactivators such as SRC-1 (45). In view of the fact that RIP140 seems to share a number of interaction characteristics with SRC-1, including a common interaction motif (46), we were interested in its ability to interact with the different activated states of the OR1/RXR{alpha} heterodimer.

In our studies, RIP140 displayed OR1/RXR{alpha} interaction characteristics that were distinct from those of SRC-1. First, the pull-down assay revealed that RIP140 (aa 431-1158) is able to interact with OR1, RXR{alpha}, and TR{alpha} in their nonactivated states and that ligand activation plays only a minor role for RIP140 recruitment under these conditions. Second, in the pull-down assay, interaction was unaffected by mutation of the AF-2 motif of either OR1 or RXR{alpha}, supporting the notion that RIP140 interaction with these nuclear receptors is not strictly activation dependent and involves other nuclear receptor structural features apart from this motif. However, the EMSA, in which a shorter portion of RIP140 (RIP140-iad) had to be employed, due to technical limitations of protein expression in E. coli, illustrated a contribution of receptor activation to RIP140 recruitment. A constitutive supershift of the DR4-bound OR1/RXR{alpha} heterodimer upon addition of RIP140-iad could be shown to be dependent on the AF-2 motif of OR1 but not RXR{alpha}. Moreover, addition of 9cRA resulted in a complex of further decreased mobility, which was RXR{alpha}-AF-2 dependent. The latter observation also indicates that the heterodimer can be activated in at least two steps with respect to RIP140 interaction and raises the interesting possibility that two molecules of RIP140 might be recruited by a fully activated receptor. It should be pointed out, however, that wild-type RIP140 contains at least two nuclear receptor interaction domains (53), only one of which was studied here (cf. Fig 1AGo), and which in a natural situation might bind simultaneously to one or two receptor LBDs.

Our in vitro studies indicate that binding of fragments of RIP140 and SRC-1 to an OR1/RXR{alpha} heterodimer is mutually exclusive and that the two factors therefore compete for binding, which is in line with the model proposed by Treuter et al. (45) based on studies on RXR{alpha}/PPAR (peroxisome proliferator-activated receptor)-heterodimers. As discussed above, the competing factors SRC-1 and RIP140 display rather different sensitivity toward dimerization and ligand activation, and it therefore seems likely that the OR1/RXR{alpha}-heterodimer will differentially recruit these two (and other) coregulators depending on its specific activation state.

The OR1/RLD-1 heterodimer with RXR{alpha} is the only nuclear receptor complex known to date that can be activated in three different ways, by two classes of ligands from different metabolic pathways and in a ligand-independent fashion. Thus, its net transcriptional potential will, on the one hand, depend on the occurrence of dimerization-induced activation (the exact prerequisites of which remain unresolved) and the availability of ligand. On the other hand, transcriptional activation and ligand sensitivity will be governed by the relative availability of coregulatory factors supporting or inhibiting transcriptional activation by the OR1/RXR{alpha} heterodimer in its respective activation state. For example, the nuclear receptor coactivator SRC-1 interacts with the OR1/RXR{alpha}-complex in all three activation states, and more strongly when activated by both dimerization and ligand. However, in the presence of RIP140, which appears to be a much weaker coactivator if a coactivator at all (43, 45), the two factors will compete for binding to the dimerization-activated heterodimer. Upon ligand addition, binding of RIP140 appears to be enhanced to a much lesser extent than that of SRC-1, leading to an alteration in the balance of binding of the two factors in favor of SRC-1. Thus, in the presence of sufficient amounts of RIP140, the relative effect of ligand- vs. dimerization-activation would be enhanced. Similarly, different corepressors might require different activation signals for displacement and thereby suppress coactivator recruitment by one pathway until they are released upon activation by another. In fact, the nuclear receptor corepressors, N-CoR (64) and SMRT (65), can be recruited by the OR1-LBD in vitro equally efficiently as by TR{alpha}-LBD (our unpublished results). The relative expression levels of both receptors and coregulators are therefore likely to regulate signaling via OR1 and RXR in a highly complex fashion.

Indeed, such mechanisms might account for the fact that in transient transfection studies in which LXR{alpha} mediates 9cRA-induction of transcriptional activation due to low endogenous amounts of RXR, constitutive activation is only observed upon RXR{alpha} cotransfection (23, 24, 54), which results in a higher number of LXR{alpha}/RXR{alpha}-heterodimers for which coregulators would have to compete. In the rat, OR1 is a ubiquitously expressed nuclear receptor (20, 21), while expression of its paralog LXR{alpha} is more restricted (22, 23), but little is known so far about the role and regulation of expression levels of these two nuclear receptors. Different paralogous variants of RXR show different tissue-specific expression patterns (66), but since RXR serves as a heterodimerization partner for a large number of nuclear receptors, its relative availability cannot be concluded from expression levels alone.

As a side aspect of this study, we have obtained data relevant to previous reports on allosteric effects in OR1/RXR{alpha} heterodimerization. In the case of OR1/RXR{alpha}, dimerization leads to allosteric activation of one partner (28). A related variant of allosteric control, the "phantom ligand effect" (67), has been described in which ligand binding by one heterodimer partner (RXR{alpha}) leads to transcriptional activation mediated by the AF-2 motif of the other (RAR{alpha}). Similarly, it was proposed for a heterodimer of the OR1 paralog LXR{alpha} with RXR{alpha} that the 9cRA-response is dependent not on H12 of RXR{alpha} itself, but of the partner LXR{alpha} (55). This conflicted with our own conclusions (28) that the AF-2 motif of RXR{alpha} is required for retinoid signaling in RXR{alpha} heterodimers with a rat LXR{alpha}-homolog (RLD-1) or OR1. In the present study, we have shown in transient transfections that the RXR{alpha}-AF-2 point mutant used in the study on LXR{alpha} (55) is leaky with respect to 9cRA-dependent transcriptional activation by RXR{alpha}-homodimers and is thus not a stringent tool with which to exclude a role of RXR{alpha}-AF-2 in heterodimers with LXR{alpha}/OR1. A second argument for the attribution of 9cRA-induced activation to the AF-2 of LXR{alpha}/OR1 is the observation (54) that its mutation abolishes 9cRA-induced transcriptional activation by the RXR{alpha}-heterodimer (see also Ref. 28 and this study). In accordance with this, we have shown here that OR1-H12 mutation also abolishes 9cRA-induction of binding of an SRC-1 fragment to DR4-bound OR1/RXR{alpha} in an EMSA. However, the adverse effect of LXR{alpha}-/OR1-H12 mutation on the 9cRA-responsiveness of RXR{alpha} is reminiscent of the abolition of RXR{alpha} ligand permissiveness upon heterodimerization with the retinoic acid receptor (RAR{alpha}) (Refs. 15, 16 ; see also Ref. 17). This provides the alternative explanation that the OR1-AF-2 does not itself mediate 9cRA-induction of the heterodimer, but that an OR1-H12 mutant adventitiously resembles RAR{alpha} in that it imposes a conformation upon RXR{alpha} in which RXR{alpha} is nonpermissive for activation by its retinoid ligand. In summary, the question of whether LXR{alpha}/OR1 is activated upon 9cRA-binding to RXR{alpha} remains unresolved. However, in view of the fact that the dimerization-activated OR1/RXR{alpha}-complex can be superactivated by either ligand (Ref. 28 and our unpublished results) and that activation by both ligands is more than additive (24), it seems unlikely that the OR1-H12 should mediate activation by all three signals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
Vectors for in Vitro Coupled Transcription/Translation and Cell Transfection Studies
For in vitro translation, rat OR1 (21) and rat RXR{alpha} (68) were expressed from a slightly modified vector pGEM-3Z (Promega Corp., Madison, WI) containing the complete open reading frame preceded by an improved Kozak region. Receptor expression in CV-1 cells was from vector pCMV5. GAL4-OR1, GAL4-OR{Delta}, and GAL4-RXR have been described previously (28). All H12-mutants (see Fig. 1BGo) were obtained by PCR, and sequences of resultant clones were confirmed by sequencing. pmT-TR{alpha} was a gift of Stefan Nilsson (KaroBio, Huddinge, Sweden).

pCMV5-SRC-1 was derived from a gift of B.W. O’Malley (i.e. as described in Ref. 42 but in vector pCMV5). pCMV5-SRC-iad comprised a fragment thereof encoding amino acids 216–394, fused in-frame to an initiator codon and ha-epitope as in pBK-CMV-ha. hRIP140-{Delta}N was encoded by a DNA fragment isolated in the laboratory in a yeast two-hybrid screen using PPAR{alpha}-LBD as a bait against a human liver cDNA library (45) and expressed from pBK-CMV-ha, which contains the sequence GATCCGCCGCCACCATGGATTACCCATACGACGTCCCAGACTACGCTCAGATCTCCGAATT-CGC GC inserted into BamHI/XhoI, providing an initiator codon and a favorable surrounding sequence as well as encoding a hemagglutinin epitope (ha, underlined). pBK-CMV-ha-RIP140-{Delta}N comprised amino acids 431-1158 of human RIP140 (43).

UASx4-TK-LUC has been described previously (19). 3xDR4-TK-LUC and 3xDR1-TK-LUC contained three copies of the sequences GACCGTTCTGGGTCACGAAAGGTCA- AGCGC and GACCGTTCTAAAGGTCAAAGGTCAAGTGGC, respectively, in vector Rsr-TK-LUC. Rsr-TK-LUC is a derivative of pGL3-Basic (Promega Corp.) containing an RsrII site before HindIII in the polylinker, and a HindIII/BglII fragment of the TK-promoter of UASx4-TK-LUC cloned into HindIII/NcoI.

Plasmids for Protein Overexpression in E. coli
GST-fusion proteins were expressed from pGEX-4T (Pharmacia Biotech, Piscataway, NJ), His6-fusion proteins (except full-length OR1, RXR-{Delta}N; see below) were expressed from modified pET-15b, and the His10-RIP140-iad fusion were expressed from pET-19b (both Novagen, Madison, WI). pET-RXR-lbd comprised amino acids 203–467 of rat RXR{alpha} (see Fig. 1BGo for the mutant). The fragment used for pGEX-SRC-iad was as described above. pET-RIP140-iad comprised amino acids 747-1158 of human RIP140.

His6-tagged full-length OR1 was expressed from modified pET-3a (Novagen) that encoded the sequence MHHHHHHIEGR preceding OR1. His6-tagged RXR-{Delta}N was expressed accordingly, but lacked codons 11–111 of RXR{alpha}.

All vector constructs were made by PCR-based amplification of the respective fragments including introduction of convenient restriction sites, and subsequent assembly; the PCR-derived sequence parts were then either replaced by template material or confirmed by sequencing.

Transfection and Preparation of Cell Extracts
CV-1 cells were split into plates of 3.6 mm diameter to achieve approximate confluency at the time of harvest. DMEM was used containing 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37 C in 5% CO2. After 24 h, cells were transfected with DOTAP (Boehringer Mannheim, Indianapolis, IN) according to the instructions provided by the supplier; transfection mixes contained 200 ng of corresponding constructs in expression vector pCMV-5 (if not indicated otherwise) and 1 µg of the respective TK-LUC reporter. Twelve hours later, the medium was exchanged for fresh medium with or without inducers. 9cRA was used at 0.1 µM, T3 was used at 1 µM final concentration, and corresponding controls received an equal amount of solvent. Cells were harvested at 36 h after transfection; results are given as means of three independent experiments.

EMSA
The oligonucleotide probe (GACCGTTCTGGGTCACGAAAGGTCAAGCGC/GTCGCGCTTGACCTTTCGTGACCCAGAACG for OR1 or TR{alpha} with RXR{alpha}; AGCTTACTAGTTCGGAGGACAGTCCTCCGTCTAGAGCT/CTAGACGGA- GGACTGTCCTCCGAACTAGTA for GAL4-chimera) was labeled using DNA polymerase Klenow fragment and [{alpha}-32P]dCTP and purified on Sephadex G-50 NICK columns (Pharmacia Biotech). Binding mixes contained 1–4 µl of in vitro translated protein (T7-TNT coupled transcription/translation system, Promega Corp.) as well as appropriate additives [final concentration 50 mM KCl, 5 mM MgCl2, 20 mM HEPES, pH 7.5, 200 µg/ml BSA, 4 mM spermidine, 8% glycerol, 50 µg/ml poly(dI-dC)·poly(dI-dC), 75 µg/ml salmon sperm DNA; additionally 20 µM ZnCl2 for UAS-binding, 1 mM EDTA, 1 mM dithiothreitol (DTT), and 0.01% Triton X-100 for DR4-binding]. Candidate interacting proteins and ligands or solvent were added where indicated (1/20 volume 9cRA in dimethylsulfoxide (DMSO) to yield 50 µM, 1/20 volume 22(R)-HC to yield 250 µM, 1/20 volume T3 in PBS to yield 50 µM). After 20 min preincubation on ice, approximately 10 fmol (20,000 cpm) labeled probe were added. Five percent polyacrylamide gels were prepared and run in 0.25x TBE (22.5 mM Tris-borate, 0.5 mM EDTA).

Expression and Purification of GST- and His-Tagged Proteins
E. coli BL21(DE3)LysS cells carrying the appropriate expression vectors (except pET-3a-His6-OR1, pET-3a-His6-RXR-{Delta}N, see below) were grown at 30 C in LB-medium containing 0.5% casamino acids, 0.5% glucose, 100 µg/ml ampicillin, and 34 µg/ml chloramphenicol until they reached an OD600 = 0.5, and were then induced with 1 mM isopropylß-D-thioglactopyranoside for 100 min. Cells were harvested by centrifugation and frozen on dry ice and then thawed in 12 ml STE (10 mM Tris/HCl pH 8.8, 150 mM NaCl, 1 mM EDTA) with 0.2 mM PMSF and 1 mM DTT freshly added. Lysozyme (0.1 mg/ml) was added, and lysis was allowed to occur under rotation at 4 C for 20 min. After addition of 2.1 ml 10% sarkosyl and 100 µl 0.5 M EDTA, the lysate was homogenized by drawing it into a syringe using needles with a diameter of 1.2 mm (twice) and 0.6 mm (twice) and pulse sonicated three times for 20 sec at medium intensity and 40% duty cycle. The homogenates were then centrifuged at 24,000 x g for 20 min at 4 C, and the supernatants were frozen and stored at -80 C. Note that for preparation of His-tagged proteins, DTT and EDTA were omitted and the final concentration of sarkosyl was reduced to 1%. His-tagged proteins were purified on TALON affinity resin (CLONTECH Laboratories, Inc., Palo Alto, CA), and GST-tagged proteins were purified on glutathione-Sepharose 4B (Pharmacia Biotech) in batch procedure according to the instructions provided by the suppliers. Purity and stability of the purified proteins were determined by SDS-PAGE analysis and subsequent Coomassie blue staining. Protein concentrations were determined by Bradford-assay (Bio-Rad Laboratories, Inc., Richmond, CA).

For His6-OR1 and His6-RXR-{Delta}N, the transformed bacterial cells were grown in M9 minimal medium containing 1% casamino acids, 0.002% thiamin B1, 300 µg/ml ampicillin, and 72 µg/ml chloramphenicol until they reached an approximate OD600 = 0.6, and then induced with 1 mM isopropylß-D-thioglactopyranoside and harvested after 2–3 h. Cell pellets were resuspended in buffer A (20 mM Tris/HCl, pH 8.0, 100 mM NaCl, 1 mM PMSF) and broken in a French Press. Cell debris was sedimented by 15 min centrifugation at 16.000 x g, and the supernatant was applied on a TALON affinity column (CLONTECH Laboratories, Inc.) run on a Biological Chromatography System (Bio-Rad Laboratories, Inc.). The column was washed with 5–10 mM imidazole, and the protein was eluted in a linear imidazole gradient (0–500 mM imidazole in buffer A). Fractions were analyzed on a protein gel, and pure fractions were combined, ammonium precipitated, and dialyzed against 20 mM Tris/HCl, pH 8.0, 100 mM KCl, 50% glycerol, 1 mM PMSF before storage at -80 C.

In Vitro Protein-Protein Interaction Assay (GST Pull-Down)
Sepharose beads were pretreated according to the instructions of the manufacturer. GST-fusion proteins were bound to glutathione-Sepharose for 2 or more hours at 4 C under rotation (100 µl extract, 10–20 µl beads per sample) and subsequently washed three times in pull-down buffer (PDB: 50 mM KPi, pH 7.4, 100 mM NaCl, 1 mM MgCl2, 10% glycerol, 0.1% Tween 20). For studies on heterodimeric receptor LBDs, 25 µg purified His6-tagged RXR-LBD were added to the loaded beads and allowed to bind for 1 h or longer at 4 C under rotation. The supernatant was then replaced by 200 µl PDB + 1.5% BSA (fraction V, Sigma Chemical Co., St. Louis, MO). For the competition experiment, 50 µg of purified His10-tagged RIP140-iad were allowed to prebind to the dimers for 45 min at this stage. One to 3 µl of in vitro translates (TNT-coupled transcription/translation system, Promega Corp.) of the constructs to be analyzed were then added per sample and incubated for about 2 h as before. At the same time, ligand or corresponding solvent was added where indicated (1/100 volume; 9cRA in DMSO to yield 10 µM, 22(R)-HC in DMSO to yield 50 µM, or 10 µM T3 in PBS to yield 10 µM). Finally, samples were washed three times in PDB, and the beads were collected by centrifugation, boiled for 5 min in a total volume of 60 µl 1x SDS-PAGE buffer and one fourth were subjected to SDS-PAGE. Equal protein loads were confirmed by Coomassie staining before autoradiography.


    ACKNOWLEDGMENTS
 
We thank B. W. O’Malley (Baylor University, Houston, TX) for the kind gift of pBK-CMV-SRC-1, and Stefan Nilsson (KaroBio, Huddinge, Sweden) for pmT-TR{alpha}.


    FOOTNOTES
 
Address requests for reprints to: Franziska Wiebel, Eberhard-Karls-Universität Tübingen, Institut für Zellbiologie, Abteilung Molekularbiologie, Auf der Morgenstelle 15, 72076 Tübingen, Germany.

This study was supported by Grant 13X-2819 from the Swedish Medical Research Council .

1 Current address: Eberhard-Karls-Universität Tübingen, Institut für Zellbiologie, Abteilung Molekularbiologie, Auf der Morgenstelle 15, 72076 Tübingen, Germany. Back

2 Current address: University of Oslo, Department of Biochemistry, P.O. Box 1041 Blindern, N-0317 Oslo, Norway. Back

Received for publication June 22, 1998. Revision received March 12, 1999. Accepted for publication March 16, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Gronemeyer H, Laudet V 1995 Transcription factors 3: nuclear receptors. Protein Profile 2:1173–1308[Medline]
  2. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  3. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  4. Parker MG, White R 1996 Nuclear receptors spring into action. Nat Struct Biol 3:113–115[CrossRef][Medline]
  5. Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D, Gronemeyer H 1996 A canonical structure for the ligand-binding domain of nuclear receptors. Nat Struct Biol 3:87–94[CrossRef][Medline]
  6. Baniahmad A, Leng X, Burris TP, Tsai SY, Tsai MJ, O’Malley BW 1995 The tau 4 activation domain of the thyroid hormone receptor is required for release of a putative corepressor(s) necessary for transcriptional silencing. Mol Cell Biol 15:76–86[Abstract]
  7. Barettino D, Vivanco Ruiz MM, Stunnenberg HG 1994 Characterization of the ligand-dependent transactivation domain of thyroid hormone receptor. EMBO J 13:3039–3049[Medline]
  8. Durand B, Saunders M, Gaudon C, Roy B, Losson R, Chambon P 1994 Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoic acid receptor: presence of a conserved autonomous constitutive activating domain and influence of the nature of the response element on AF-2 activity. EMBO J 13:5370–5382[Medline]
  9. Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
  10. Allan GF, Leng X, Tsai SY, Weigel NL, Edwards DP, Tsai MJ, O’Malley BW 1992 Hormone and antihormone induce distinct conformational changes which are central to steroid receptor activation. J Biol Chem 267:19513–19520[Abstract/Free Full Text]
  11. Berger J, Bailey P, Biswas C, Cullinan CA, Doebber TW, Hayes NS, Saperstein R, Smith RG, Leibowitz MD 1996 Thiazolidinediones produce a conformational change in peroxisomal proliferator-activated receptor-{gamma}: binding and activation correlate with antidiabetic actions in db/db mice. Endocrinology 137:4189–4195[Abstract]
  12. Keidel S, LeMotte P, Apfel C 1994 Different agonist- and antagonist-induced conformational changes in retinoic acid receptors analyzed by protease mapping. Mol Cell Biol 14:287–298[Abstract/Free Full Text]
  13. Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-{gamma} ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  14. Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD, Fletterick RJ 1995 A structural role for hormone in the thyroid hormone receptor. Nature 378:690–697[CrossRef][Medline]
  15. Forman BM, Umesono K, Chen J, Evans RM 1995 Unique response pathways are established by allosteric interactions among nuclear hormone receptors. Cell 81:541–550[CrossRef][Medline]
  16. Kurokawa R, DiRenzo J, Boehm M, Sugarman J, Gloss B, Rosenfeld MG, Heyman RA, Glass CK 1994 Regulation of retinoid signalling by receptor polarity and allosteric control of ligand binding. Nature 371:528–531[CrossRef][Medline]
  17. Vivat V, Zechel C, Wurtz JM, Bourguet W, Kagechika H, Umemiya H, Shudo K, Moras D, Gronemeyer H, Chambon P 1997 A mutation mimicking ligand-induced conformational change yields a constitutive RXR that senses allosteric effects in heterodimers. EMBO J 16:5697–5709[CrossRef][Medline]
  18. Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD, McKeown M, Cherbas P, Evans RM 1993 Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366:476–479[CrossRef][Medline]
  19. Shinar DM, Endo N, Rutledge SJ, Vogel R, Rodan GA, Schmidt A 1994 NER, a new member of the gene family encoding the human steroid hormone nuclear receptor. Gene 147:273–276[CrossRef][Medline]
  20. Song C, Kokontis JM, Hiipakka RA, Liao S 1994 Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. Proc Natl Acad Sci USA 91:10809–10813[Abstract/Free Full Text]
  21. Teboul M, Enmark E, Li Q, Wikström AC, Pelto-Huikko M, Gustafsson J-Å 1995 OR-1, a member of the nuclear receptor superfamily that interacts with the 9-cis-retinoic acid receptor. Proc Natl Acad Sci USA 92:2096–2100[Abstract/Free Full Text]
  22. Apfel R, Benbrook D, Lernhardt E, Ortiz MA, Salbert G, Pfahl M 1994 A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormone receptor subfamily. Mol Cell Biol 14:7025–7035[Abstract/Free Full Text]
  23. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ 1995 LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 9:1033–1045[Abstract/Free Full Text]
  24. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ 1996 An oxysterol signalling pathway mediated by the nuclear receptor LXR{alpha}. Nature 383:728–731[CrossRef][Medline]
  25. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su J-L, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM 1997 Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 272:3137–3140[Abstract/Free Full Text]
  26. Peet DJ, Janowski BA, Mangelsdorf DJ 1998 The LXRs—a new class of oxysterol receptors. Curr Opin Genet Dev 8:571–575[CrossRef][Medline]
  27. Peet DJ, Turley SD, Ma WZ, Janowski BA, Lobaccaro JMA, Hammer RE, Mangelsdorf DJ 1998 Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR-{alpha}. Cell 93:693–704[CrossRef][Medline]
  28. Wiebel FF, Gustafsson J-Å 1997 Heterodimeric interaction between retinoid X receptor {alpha} and orphan nuclear receptor OR1 reveals dimerization-induced activation as a novel mechanism of nuclear receptor activation. Mol Cell Biol 17:3977–3986[Abstract]
  29. Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, Moore DD 1994 A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol Cell Biol 14:1544–1551[Abstract/Free Full Text]
  30. Choi HS, Chung M, Tzameli I, Simha D, Lee YK, Seol W, Moore DD 1997 Differential transactivation by two isoforms of the orphan nuclear hormone receptor CAR. J Biol Chem 272:23565–23571[Abstract/Free Full Text]
  31. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor coactivators. Curr Opin Cell Biol 9:222–232[CrossRef][Medline]
  32. Horwitz KB, Jackson TA, Rain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  33. Fondell JD, Brunel F, Hisatake K, Roeder RG 1996 Unliganded thyroid hormone receptor alpha can target TATA-binding protein for transcriptional repression. Mol Cell Biol 16:281–287[Abstract]
  34. Lala DS, Mukherjee R, Schulman IG, Canan Koch SS, Dardashti LJ, Nadzan AM, Croston GE, Evans RM, Heyman RA 1996 Activation of specific RXR heterodimers by an antagonist of RXR homodimers. Nature 383:450–453[CrossRef][Medline]
  35. McEwan IJ, Gustafsson J-Å 1997 Interaction of the human androgen receptor transactivation function with the general transcription factor TFIIF. Proc Natl Acad Sci USA 94:8485–8490[Abstract/Free Full Text]
  36. Bannister AJ, Kouzarides T 1996 The CBP co-activator is a histone acetyltransferase. Nature 384:641–643[CrossRef][Medline]
  37. Chen HW, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  38. Heinzel T, Lavinsky RM, Mullen TM, Söderström M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43–48[CrossRef][Medline]
  39. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, msin3a, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  40. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  41. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou JX, Mizzen CA, McKenna NJ, Oñate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  42. Oñate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  43. Cavaillès V, Dauvois S, L’Horset F, Lopez G, Hoare S, Kushner PJ, Parker MG 1995 Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J 14:3741–3751[Medline]
  44. Smith CL, Oñate SA, Tsai MJ, O’Malley BW 1996 CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptor-dependent transcription. Proc Natl Acad Sci USA 93:8884–8888[Abstract/Free Full Text]
  45. Treuter E, Albrektsen T, Johansson L, Leers J, Gustafsson J-Å 1998 A regulatory role for RIP140 in nuclear receptor activation. Mol Endocrinol 12:864–881[Abstract/Free Full Text]
  46. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  47. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  48. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  49. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  50. Voegel JJ, Heine MJ, Zechel C, Chambon P, Grone-meyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  51. Voegel JJ, Heine MJS, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J 17:507–519[CrossRef][Medline]
  52. Yao TP, Ku G, Zhou N, Scully R, Livingston DM 1996 The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc Natl Acad Sci USA 93:10626–10631[Abstract/Free Full Text]
  53. L'Horset F, Dauvois S, Heery DM, Cavaillès V, Parker MG 1996 RIP140 interacts with multiple nuclear receptors by means of two distinct sites. Mol Cell Biol 16:6029–6036[Abstract]
  54. Willy PJ, Mangelsdorf DJ 1997 Unique requirements for retinoid-dependent transcriptional activation by the orphan receptor LXR. Genes Dev 11:289–298[Abstract/Free Full Text]
  55. Forman BM, Ruan B, Chen J, Schroepfer Jr GJ, Evans RM 1997 The orphan nuclear receptor LXR{alpha} is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci USA 94:10588–10593[Abstract/Free Full Text]
  56. Collingwood TN, Rajanayagam O, Adams M, Wagner R, Cavaillès V, Kalkhoven E, Matthews C, Nyström E, Stenlöf K, Lindstedt G, Tisell L, Fletterick RJ, Parker MG, Chatterjee VK 1997 A natural transactivation mutation in the thyroid hormone beta receptor: impaired interaction with putative transcriptional mediators. Proc Natl Acad Sci USA 94:248–253[Abstract/Free Full Text]
  57. DiRenzo J, Söderström M, Kurokawa R, Ogliastro MH, Ricote M, Ingrey S, Hörlein A, Rosenfeld MG, Glass CK 1997 Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid x receptor heterodimers with ligands, coactivators, and corepressors. Mol Cell Biol 17:2166–2176[Abstract]
  58. Henttu PM, Kalkhoven E, Parker MG 1997 AF-2 activity and recruitment of steroid receptor coactivator 1 to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol Cell Biol 17:1832–1839[Abstract]
  59. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  60. Joyeux A, Cavaillès V, Balaguer P, Nicolas JC 1997 RIP140 enhances nuclear receptor-dependent transcription in vivo in yeast. Mol Endocrinol 11:193–202[Abstract/Free Full Text]
  61. Masuyama H, Brownfield CM, Starnaud R, Macdonald PN 1997 Evidence For ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol Endocrinol 11:1507–1517[Abstract/Free Full Text]
  62. Lee CH, Chinpaisal C, Wei LN 1998 Cloning and characterization of mouse RIP140, a corepressor for nuclear orphan receptor TR2. Mol Cell Biol 18:6745–6755[Abstract/Free Full Text]
  63. Chuang FM, West BL, Baxter JD, Schaufele F 1997 Activities in Pit-1 determine whether receptor interacting protein 140 activates or inhibits Pit-1 nuclear receptor transcriptional synergy. Mol Endocrinol 11:1332–1341[Abstract/Free Full Text]
  64. Hörlein AJ, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Söderström M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  65. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  66. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  67. Schulman IG, Li C, Schwabe JW, Evans RM 1997 The phantom ligand effect: allosteric control of transcription by the retinoid X receptor. Genes Dev 11:299–308[Abstract/Free Full Text]
  68. Gearing KL, Göttlicher M, Teboul M, Widmark E, Gustafsson J-Å 1993 Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci USA 90:1440–1444[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
C. J Delvecchio and J. P Capone
Protein kinase C {alpha} modulates liver X receptor {alpha} transactivation
J. Endocrinol., April 1, 2008; 197(1): 121 - 130.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Talukdar, S. Bhatnagar, S. Dridi, and F. B. Hillgartner
Chenodeoxycholic acid suppresses the activation of acetyl-coenzyme A carboxylase-{alpha} gene transcription by the liver X receptor agonist T0-901317
J. Lipid Res., December 1, 2007; 48(12): 2647 - 2663.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Talukdar and F. B. Hillgartner
The mechanism mediating the activation of acetyl-coenzyme A carboxylase-{alpha} gene transcription by the liver X receptor agonist T0-901317
J. Lipid Res., November 1, 2006; 47(11): 2451 - 2461.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Yang, J. G. McDonald, A. Patel, Y. Zhang, M. Umetani, F. Xu, E. J. Westover, D. F. Covey, D. J. Mangelsdorf, J. C. Cohen, et al.
Sterol Intermediates from Cholesterol Biosynthetic Pathway as Liver X Receptor Ligands
J. Biol. Chem., September 22, 2006; 281(38): 27816 - 27826.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Huuskonen, P. E. Fielding, and C. J. Fielding
Role of p160 Coactivator Complex in the Activation of Liver X Receptor
Arterioscler. Thromb. Vasc. Biol., April 1, 2004; 24(4): 703 - 708.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. W. Bull, K. R. Steffensen, J. Leers, and J. J. Rafter
Activation of PPAR {gamma} in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR {gamma}
Carcinogenesis, November 1, 2003; 24(11): 1717 - 1722.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Hall, C.-y. Chang, and D. P. McDonnell
Development of Peptide Antagonists That Target Estrogen Receptor {beta}-Coactivator Interactions
Mol. Endocrinol., December 1, 2000; 14(12): 2010 - 2023.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. Luo, C.-p. Liang, and A. R. Tall
The Orphan Nuclear Receptor LRH-1 Potentiates the Sterol-mediated Induction of the Human CETP Gene by Liver X Receptor
J. Biol. Chem., June 29, 2001; 276(27): 24767 - 24773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wiebel, F. F.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wiebel, F. F.
Right arrow Articles by Gustafsson, J.-A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals