| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Animal Science Reproductive Biology Program University of Wyoming Laramie, Wyoming 82071
| ABSTRACT |
|---|
|
|
|---|
(IFN-
) during
early pregnancy. The bovine (b) ISG17 cDNA shares 30% identity
with a tandem ubiquitin repeat and 70% identity with human (h) ISG15.
The present experiments were designed to sequence the bISG17 gene,
compare general structure with the hISG15 gene, and to identify
transcription factors that were induced by IFN-
in bovine
endometrial (BEND) cells. The promoter of the bISG17 gene was similar
to the hISG15 gene in placement of a tandem IFN-stimulatory response
element (ISRE) at position -90, but unique in the presence of three
additional ISREs at positions -123, -332, and -525. IFN-
(25
nM) induced nuclear proteins in BEND cells that
interacted with a tandem bISG17 ISRE in electrophoretic mobility shift
assay (EMSA). IFN-regulatory factor-1 (IRF-1) bound to this ISRE based
upon supershift EMSA using antiserum against IRF-1. IFN-
activated
STAT-1 (signal transducer and activator of transcription-1) and -2 by
0.5 h, and IRF-1 by 2 h in BEND cells. It is concluded that
the bISG17 gene is similar to the hISG15 gene, retains an ISRE that
interacts with IRF-1, and is possibly induced initially by the
STATs and later by IRF-1 in response to IFN-
during early
pregnancy. | INTRODUCTION |
|---|
|
|
|---|
(PGF) must be
circumvented during early pregnancy (1). Otherwise, the corpus luteum
regresses in response to PGF and progesterone declines, resulting in
early embryonic mortality. Pregnancy is established in ruminants
through actions of interferon-
(IFN-
) on the endometrium (1, 2, 3).
IFN-
is released by the expanding blastocyst, binds to an
endometrial receptor, and alters the pattern of uterine secretion of
PGF. This results in rescue of the corpus luteum and continued
production of progesterone. Because IFN-
indirectly blocks the lytic
action of PGF on the corpus luteum, it has been called an
"antiluteolysin." The antiluteolytic mechanism of action of IFN-
(1, 2) includes inhibition of estradiol receptors, reduction of
oxytocin receptor, activation of a cyclooxygenase inhibitor, and a
shift in the PGs to favor PGE2, a luteotropin, over PGF, a
luteolysin.
In addition to regulating release of PGF, IFN-
induces several
uterine proteins (2, 4, 5). The function of these proteins during early
pregnancy remains elusive with the exception of a 17-kDa bovine
ubiquitin homolog. This protein was originally called ubiquitin
cross-reactive protein, or UCRP, because it shared epitopes with
ubiquitin and cross-reacted with antiserum against ubiquitin in Western
blots (6).
Conjugation of ubiquitin to proteins is accomplished through an
isopeptide bond between the carboxyl glycine of ubiquitin and primary
amines on target proteins (7, 8). Proteins conjugated to ubiquitin are
processed through an ATP-dependent 26 S multicatalytic proteasome
pathway in which targeted proteins are degraded and ubiquitin is
recycled (9). The hypothesis that bovine (b) UCRP conjugated to
endometrial proteins was recently examined (10). It was demonstrated
that conjugation of UCRP was distinct from conjugation of ubiquitin to
endometrial proteins (10). Also, conjugation of bUCRP to endometrial
proteins was induced by pregnancy and IFN-
, whereas conjugation of
ubiquitin to endometrial proteins was not.
Cloning of the bUCRP cDNA and analysis of inferred amino acid sequence
revealed 70% identity with a human member of the IFN-stimulated gene
(ISG) family that encoded a 15-kDa protein (ISG15), and 30% identity
with a tandem bovine ubiquitin repeat (11). Both IFN-
and IFN-
induced bUCRP mRNA and protein in bovine endometrial cells (6, 12, 13).
Because the bUCRP gene belongs to the ISG family and encodes a 17-kDa
protein, we have renamed the protein ISG17 to follow nomenclature
developed for human ISG15 (14) and ISG54 (15).
IFNs are immunomodulatory proteins that have diverse cellular effects depending on cell lineage and stage of differentiation (16). IFNs bind to transmembrane receptors, activate janus kinase (Jak) or tyrosine kinase (Tyk), and stimulate rapid activation of gene expression (17). Signal transducers and activators of transcription (STATs) are cytoplasmic transcription factors that are phosphorylated by Jaks and interact as hetero- or homodimers to regulate transcription of genes. It has been suggested that STATs mediate early genomic responses to IFNs (17). IFN-regulatory factor-1 (IRF-1), a transcription factor, is induced by the STATs, phosphorylated, and might mediate distal responses to IFNs (18).
The bISG17 gene may be used to examine signal transduction in the
endometrium in response to IFN-
(13). bISG17 differs significantly
in processing and primary structure when compared with hISG15. Another
major difference between hISG15 and bISG17 is the apparent widespread
expression of hISG15 in several cell lines and tissues (19). Northern
blots revealed that expression of the bISG17 gene was restricted to
endometrium from pregnant cows or to endometrium from nonpregnant cows
that had been treated in vitro with recombinant
bovine (rb) IFN-
or rbIFN-
(12). While the role of hISG15
may be general to many cell types, transcription of the bISG17 gene
appears to be a specific response to IFN-
in the uterine endometrium
during early pregnancy in the cow (12). Thus, the objectives of the
present experiments were to isolate and sequence the bISG17 gene,
compare structure and organization with the hISG15 gene, and determine
whether STAT-1, STAT-2, IRF-1, and IRF-2 transcription factors were
induced by IFN-
and implicated in regulating the bISG17 gene.
| RESULTS |
|---|
|
|
|---|
|
Initial sequencing with standard primers revealed that the promoter and most of the coding sequences were contained in pDP8. Consequently, this plasmid was used to generate nested deletions by partial exonuclease III digestion and was sequenced in its entirety. All sequences were confirmed by overlapping clones and, where necessary, by using internal primers. The 3'-end of the coding sequence and the downstream noncoding sequences were sequenced from plasmid pDP7 using standard primers.
The sequence of the bISG17 gene and its promoter, including 1,180 bp
upstream of the transcription start site, is shown in Fig. 2
. The GenBank accession number is
AF069133. The gene contains a putative TATA box element (TATTAAA) at
position -29 relative to the mRNA cap site and a possible inverted
CAAT-box element at position -130. The mRNA cap site is followed by
the 5'-noncoding sequences and the initiation codon. Immediately after
the initiation codon is a 437-bp intron followed by the remainder of
the coding sequences and the 3'-nontranslated sequences that were
identical to those described for the bISG17 cDNA (11).
|
I and IFN-
genes (20), is found no less
than 17 times in both orientations in the region between -170 and
-1060. In addition, a CREB-like sequence is at position -48 to -41.
The general structure of the coding regions is similar between the
bISG17 and hISG15 (14) genes with an intron immediately after the
initiation codon. The coding regions shared 68% sequence identity as
reported previously (11). Both genes retained a tandem overlapping ISRE
approximately 50 bp upstream of the TATA box (Fig. 2B
Determination of the Transcription Start Site
The mRNA cap site for the bISG17 gene was determined by primer
extension analysis of total endometrial RNA that was isolated from cows
on day 18 of pregnancy (Fig. 2C
). Total endometrial RNA from a cow on
day 18 of the estrous cycle served as a control. An oligonucleotide
primer was chosen to hybridize to the mRNA at a position that was 15 bp
upstream of the ATG initiation codon based on the bISG17 cDNA sequence
(11). Primer extension was completed using two methods. The long,
high-salt hybridization conditions yielded two major transcription
start sites. The shorter, lower-salt hybridization conditions yielded
four major start sites. Use of a second oligonucleotide primer
(GCCAGGCTCTCTGCAGACAC) that ended 36 bp upstream of the initiation
codon confirmed these results (not shown). Although these results may
represent multiple transcription start sites, the first G nucleotide in
the series has been designated as position 1 because the corresponding
band is the darkest in the long hybridization experiment. No
transcripts were detected by either method in total RNA from the
endometrium collected on day 18 of the estrous cycle.
EMSA
The tandem ISRE in the bISG17 gene was almost identical to the
tandem ISRE of the hISG15 gene (14). Only one nucleotide differed
between the two sequences: a G to an A interchange in the variable part
of the hISRE consensus sequence (Fig. 2B
). The bISG17 tandem ISRE was
synthesized, radiolabeled, and used as a probe in EMSA using nuclear
extracts from IFN-treated bovine endometrial (BEND) cells.
Radiolabeled oligonucleotide incubated in the absence of nuclear
extracts had the fastest electrophoretic mobility (Fig. 3A
). Constitutive interaction of the ISRE
with nuclear extracts was noted in both control and IFN-treated BEND
cells. During the 2-h period, this faster migrating constitutive band
was up-regulated after incubation with IFN-
or IFN-
. Nuclear
extracts from cells treated with either IFN-
or IFN-
for 2 h
also had one unique slower migrating band that was not found in
controls. At the level of sensitivity of this analysis, there appeared
to be no difference in nuclear proteins that were bound to the ISRE
enhancer in response to the two IFNs tested.
|
was specific, as demonstrated in Fig. 3B
Western Blot Analysis of STATs and IRF-1
Nuclear extracts were collected at several times after treatment
of BEND cells with 25 nM rbIFN-
or rbIFN-
and Western
blotted using antibodies against STAT-1, STAT-2, and IRF-1. It was
assumed in these experiments that translocation of these transcription
factors to the nucleus required phosphorylation and that detection in
the nucleus represented activation of these transcription factors.
Representative Western blots showing detection of STAT-1, STAT-2, and
IRF-1 in BEND cells may be found in Fig. 4A
. Quantitation of these blots revealed
that both IFNs activated STAT-1 (Fig. 4B
) and STAT-2 (Fig. 4C
) in BEND
cells within 0.5 h, and IRF-1 within 2 h (Fig. 4D
). Induction
of IRF-1 required a longer incubation time (2 h) with the IFNs when
compared with induction of the STATs. More than one nuclear protein
immunoreacted with antiserum against IRF-1.
|
|
induction of STATs followed
by induction of IRF-1, an experiment was conducted to determine whether
activation of these transcription factors required translation of new
proteins. In this experiment, a protease inhibitor cocktail was
included in all reagents while BEND cell extracts were being prepared.
Treatment of BEND cells with 25 nM rbIFN-
effectively
induced STAT-1 and STAT-2 within 30 min (Fig. 5B
. Again, even in the presence of protease
inhibitors, several bands of protein immunoreacted with the antiserum
against IRF-1, which is in agreement with results presented in Fig. 4
. However, treatment with cycloheximide inhibited induction of
IRF-1 in response to IFN-
. We interpret these data to mean that the
STATs are constitutively present and are induced through
phosphorylation to enter the nucleus and interact with response
elements on genes. One of the genes that is induced by the STATs is the
IRF-1 gene.
Electrophoretic Mobility Supershift Analysis
Incubation of nuclear extracts with antiserum
against IRF-1 caused a supershift in banding pattern, which was most
pronounced in BEND cell nuclear proteins that were collected at 2
h after treatment with IFN-
(Fig. 6
).
These data are interpreted to mean that IRF-1 is one of the nuclear
proteins that interacts with the ISRE of the bISG17 gene in response to
IFN-
. Because treatment of nuclear extracts with nonimmune serum had
no effect on shifting bands, it is concluded that the supershifted band
was specific to an IRF-1/ISRE complex when antibody against IRF-1 was
used. Attempts to cause supershift of bands when using antiserum
against STAT-1 and STAT-2 failed (not shown).
|
| DISCUSSION |
|---|
|
|
|---|
induces transcription of the ISG17 gene (12) and
conjugation of ISG17 to cytosolic uterine proteins (10). Uterine ISG17
resembles hISG15 in structure (11) and function (10) in that both are
homologs of ubiquitin. Based on Southern genomic blots, one major ISG17
gene was identified in the present experiments. The frequency of
detection of the ISG17 gene in the bovine genomic library
(i.e. 1 in 1,000,000) supports this conclusion. Other minor
hybridizing bands on Southern genomic blots may represent genes that
are related, but probably are not ubiquitin genes because the ISG17
probe does not hybridize with ubiquitin mRNA (12). Use of the hISG15
cDNA as a probe in bovine genomic Southern blots and use of the bISG17
cDNA probe in human genomic Southern blots failed even under
nonstringent hybridizing conditions (not shown). Because only one major bISG17 gene was identified, it appears likely that bISG17 is the counterpart to hISG15. The general organization of hISG15 and bISG17 genes is the same. Both genes contain a single intron after the initiation codon. Coding sequences of the bISG17 gene are identical to those described in the cDNA (11). The most significant retention in primary structure between bISG17 (11), hISG15 (14, 21), and ubiquitin (22) are the C-terminal Leu-Arg-Gly-Gly amino acids that have been shown to be involved with conjugation to intracellular proteins.
The bISG17 gene encodes unique amino acids when compared with hISG15. First, it appears to be processed differently than hISG15. The stop codon (TAG) in bISG17 immediately follows nucleotides encoding Leu-Arg-Gly-Gly, yielding a mature protein that is 17 kDa in size. In contrast, hISG15 has a stop codon that is downstream from this sequence (14, 23). Pre-hISG15 (17 kDa) undergoes a posttranslational modification that removes C-terminal amino acids to yield the mature protein (15 kDa) terminating in Leu-Arg-Gly-Gly (24, 25). Three cysteines exist in bISG17 (11), compared with only one cysteine in hISG15 (14). If disulfide bridges are formed in bISG17, they could greatly affect function, because of a very different tertiary structure when compared with hISG15. The presence of a free sulfhydryl group on the odd Cys in bISG17 and on the single Cys in hISG15 may also interact with targeted proteins or form homologous dimers.
The hISG15 promoter contains a functional tandem ISRE at -113 to -94 relative to the mRNA cap site, but little is known about sequences that are upstream of this tandem ISRE (14). In the present experiments, the mRNA cap site in the bISG17 gene was identified using two methods. The TATA box (TATTAAA) was located in the bISG17 gene at position -29 from the putative cap site. The promoter of the bISG17 gene was similar to the hISG15 gene promoter in the placement of a conserved tandem ISRE at position -92. However, three additional putative ISREs were present in the bISG17 gene at positions -123, -332, and -525.
The IFNs interact with transmembrane receptors that are associated with
tyrosine kinases such as Jaks and Tyks. In addition to exhibiting
preference for ligand, receptors sort intracellular responses through
activating Jaks and Tyks, which then phosphorylate at least six STAT
transcription factors (17). Mobility shift assay in the present
experiments revealed that nuclear proteins induced by rbIFN-
interacted with the tandem bISG17 ISRE. One slower migrating band was
induced by rbIFN-
.
IFN-
induced appearance of STAT-1, STAT-2, and IRF-1 in nuclear
proteins extracted from BEND cells. The inhibitory IRF-2 transcription
factor was not found in nuclear extracts collected after treatment with
IFN-
at times examined in the present experiment. The temporal
relationship between appearance of STAT-1 and STAT-2 (0.5 h) and IRF-1
(2 h) in BEND cells is consistent with induction of these nuclear
proteins in other cells by other type 1 IFNs (26, 27, 28). The STATs are
activated within minutes of IFN treatment. Phosphorylation of
cytoplasmic STATs initiates translocation to the nucleus, formation of
transcriptional complexes, and induction of secondary transcription
factors called the IRFs. The induction of IRF-1 was blocked with
cycloheximide treatment in the present experiments, whereas induction
of STATs was not affected. Thus, it is concluded that a primary role of
the STATs is to induce the IRF-1 gene, which then, through IRF-1,
activates the bISG17 gene.
Currently, no evidence exists to suggest that STATs interact with the
bISG17 ISRE in BEND cells. In the present experiments, attempts to
supershift STAT/ISRE complexes with anti-STAT-antibodies failed even
when nuclear extracts collected after culture for 0.5, 1, or 2 h
with IFN-
were used (not shown). However, because the STATs interact
with DNA as hetero- or homodimers, it is not known if the epitopes that
are recognized by the antibodies are inaccessible because of formation
of dimers. Antibody against IRF-1 caused a supershift of the BEND cell
nuclear extract/ISRE complex, suggesting that IRF-1 interacts with the
bISG17 ISRE.
Each member of the IRF family has distinct roles in diverse systems
such as regulation of cell growth, signal transduction induced by
cytokines, response to pathogens, and hematopoetic development (29).
The IRF family now consists of 10 members that include IRFs 17, ISG
factor 3
, IFN consensus sequence binding protein, and viral IRF
(29). The IRF-7 mRNA exists in at least three splice variants (30, 31).
The induction of several immunoreacting IRF-1 bands on Western blots in
response to IFN-
was unexpected and is a new finding. Because the
STATs appeared as distinct bands with appropriate molecular masses,
proteolysis does not appear to occur when the nuclear extracts are
prepared. Regardless, the proteins that immunoreacted with antibody
against IRF-1 were present even when nuclear extracts were isolated in
the presence of a mixture of protease inhibitors. The smallest
immunoreacting IRF-1 signal corresponds to the expected molecular mass
of murine and hIRF-1. A single 2-kb murine IRF-1 mRNA encodes an IRF-1
protein (37 kDa) that does not have N-glycosylation sites (32).
However, human IRF-1 has eight CKII phosphorylation sites (29).
Heterogeneity in phosphorylation might explain the upper Mr
bands that immunoreacted with antibody against IRF-1. Preadsorption of
anti-IRF-1 antibody using IRF-1 peptide effectively blocked detection
of all but one immunoreacting band on Western blots. Proteins that were
blocked from detection probably represent IRF-1 isoforms or
IRF-1-related proteins. The single band that was not blocked by
preadsorption of antibody with IRF-1 peptide also is interesting
because it immunoreacts with anti-IRF-1 antibody, is absent when
secondary antibody is deleted, and is induced by IFN-
in a manner
that is identical to the other immunoreacting bands.
IRF-2 was not detected in BEND cell extracts after 0.5, 1, or 2 h
after treatment with IFN-
. IRF-2 is considered an antagonist to
IRF-1 because it is a negative regulator of genes that are activated by
IRF-1 (29). Presumably, IRF-2 acts as a competitive antagonist because
it has the same DNA binding specificity as IRF-1 and competes for the
same binding site (33). Thus, it has been proposed that ISGs are either
activated or inhibited based on the ratio of IRF-1 to IRF-2. In the
present experiments, the ratio of these two transcription factors
favors activation of bISG17 promoter within times examined.
One major gene that encodes bISG17 was isolated. This gene is
probably the counterpart to the hISG15 gene, but it encodes a protein
that is larger than hISG15 and contains several mutations in functional
amino acid residues. Both proteins have been shown to function as
ubiquitin homologs by conjugating to cytosolic proteins. The fate of
proteins that are conjugated to bISG17 remains to be determined, but
may not be related to rapid degradation through the proteasome. The
promoters for these genes are similar, but reported herein is the
presence of three additional putative ISREs in the bISG17 gene. That
these are functional ISREs remains to be determined using site-directed
mutagenesis and deletion analysis. By using the new BEND cell line,
Western blot, and EMSA, we have demonstrated that IFN-
induces
phosphorylation of STAT-1 and STAT-2, which then induce IRF-1. IRF-1
was implicated in interacting with the bISG17 ISRE through EMSA
supershift assay. Because the STATs were not shown to interact with
this ISRE, we suspect that IRF-1 is the direct activator of
transcription of the bISG17 gene. Termination of signal transduction
will be the focus of future experiments and might involve
ubiquitination of the STATs (34) and subsequent induction of IRF-2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Southern Blotting
Calf Thymus DNA (10 µg) (Sigma Chemical Co.) was
digested to completion with BamHI, EcoRI,
HindIII, PstI, SmaI, or
SacI. The DNA digest was loaded onto a 0.75% agarose gel in
TAE (40 mM Tris-acetate, 1 mM EDTA) and
separated electrophoretically at 20 V overnight. The DNA fragments were
transferred to nylon membranes (0.2 µm, Nytran+; Schleicher & Schuell, Inc., Keene, NH), dried, fixed by baking at 80 C, and
hybridized with random primer-labeled bISG17 cDNA (11).
Prehybridization, hybridization, and washing procedures were identical
to those described when the bovine genomic library was screened.
Southern blots were exposed to x-ray film (Fuji RX; Fisher Scientific) for 12 days.
Library Screening
A
GEM-11 bovine genomic library constructed from sperm DNA
(Promega Corp.) was screened (20) using radiolabeled
bISG17 cDNA as a probe (11). Approximately 106 plaques were
plated with Escherichia coli Y1090 at 25,000 plaque-forming
units (pfu) per 150-mm plate. Plaques were transferred to
Biotrans nylon membranes (0.45-µm pore size) (ICN Biomedicals, Inc.; Irvine, CA), denatured with 0.5
N NaOH and 1.5 M NaCl, neutralized with 0.5
M Tris-HCl (pH 7.5) and 1.5 M NaCl, and washed
twice with 2x SSC (where 1x SSC is 0.15 M NaCl, 15
mM sodium citrate). Membranes were baked (2 h, 80 C),
prehybridized (3 h; 50% formamide, 5x SSC, 0.05 M sodium
phosphate, 5x Denhardts solution, 0.1% SDS, 0.1 mg/ml salmon sperm
DNA), hybridized (18 h), washed three times (15 min: 2x SSC/0.1% SDS,
1x SSC/0.1%SDS, 0.1x SSC/0.1% SDS) (42 C), and placed on Fuji RX
film (Fisher Scientific) for 24 h. One positive
plaque was identified.
After two rounds of plaque purification, phage were purified using the Wizard Lambda DNA purification system (Promega Corp.), and the insert was excised by digestion with SacI. The phage insert was found to contain internal SacI sites and yielded two restriction fragments, 2.0 and 3.4 kb, that reacted with the bISG17 cDNA probe on Southern blots. These fragments were gel purified and subcloned into pBluescript SK- (Stratagene; La Jolla, CA). The plasmids containing 3.4- and 2.0-kb inserts were designated pDP7 and pDP8, respectively.
DNA Sequencing
Dideoxy sequencing was carried out with standard forward and
reverse M13 primers using Sequenase (Amersham). The pDP7
clone contained the 3'-end of the bISG17 gene from the SacI
site known to exist at position 416 of the bISG17 cDNA (11). This clone
was sequenced through the polyadenylation site. The pDP8 clone
contained nucleotides that were upstream from position 416 of the
bISG17 cDNA and was sequenced in its entirety using nested deletions
created by the Erase-a-base system (Promega Corp.) and
four additional primers at positions -260, -160, 595, and 751
(relative to putative cap site).
Identification of the mRNA Cap Site Using Primer
Extension
Endometrium was collected from a cow on day 18 of the estrous
cycle (negative control) and pregnancy. This day of pregnancy was
selected to represent a time during which the bISG17 gene is
transcribed at high levels (12). Total RNA was extracted from
endometrial tissue using Tri reagent (Molecular Research Center, Inc.; Cincinnati, OH) as described previously (12). RNA (20
µg) was combined with 105 cpm of end-labeled
oligonucleotide primer (CACCATGGCCGTGGGTTCTGG) that was selected to end
15 bases upstream of the initiation codon. Two primer extension methods
were used. In the first, longer-hybridization method (35), RNA and
end-labeled oligonucleotide were dissolved in 30 µl hybridization
buffer (3 M NaCl, 0.5 M HEPES, pH 7.5, 1
mM EDTA), incubated at 85 C for 10 min, and then incubated
for 8 h at 30 C. After ethanol precipitation, the primed RNA was
dissolved in 10 mM Tris-HCl, pH 9.0, 50 mM KCl,
1 mM deoxynucleoside triphosphates, 10
mM MgCl2, and 40 U of RNAsin (Promega Corp.). MMLV (mouse Moloney leukemia virus) reverse
transcriptase (200 U, Gibco BRL; Bethesda, MD) was added,
and the mixture was incubated at 37 C for 1 h. Ribonuclease (10
µg; Promega Corp.) and EDTA (final concentration of 25
mM) were added, and the incubation was continued for
another 30 min. The extension product was extracted once with
phenol-chloroform-isoamyl alcohol (25:24:1), ethanol precipitated, and
dissolved in 10 µl sequencing gel loading buffer (10 mM
EDTA, 95% formamide, 0.1% bromphenol blue, 0.1% xylene cyanol). The
samples were heated to 95 C for 5 min.
In the second, shorter-hybridization method (36), the RNA/primer precipitate was dissolved in 10 µl buffer containing 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 1 mM deoxynucleoside triphosphates, 10 mM MgCl2, 10 mM dithiothreitol (DTT), 0.5 mM spermidine, heated to 60 C for 20 min, and then cooled to room temperature over 10 min. MMLV (mouse Moloney leukemia virus) reverse transcriptase (40.5 U; 6 mM sodium pyrophosphate) was added, and the mixture was incubated at 37 C for 30 min. The reaction was halted by adding 20 µl of sequencing gel loading buffer as described above and heating to 90 C for 10 min. Primer extension products were analyzed on a 6% sequencing gel next to a dideoxy sequencing ladder to identify the exact length of the products.
Cell Culture
A bovine endometrial cell line called BEND cells (13) was
cultured in medium consisting of 40% MEM (Sigma Chemical Co.), 40% Hams F-12, 10% FCS (heat inactivated), 10% horse
serum (heat inactivated), 1% ABAM (antibiotic antimycotic solution,
Sigma Chemical Co.) and insulin (0.2 U/ml). Cells
(2 x 106) were plated into 75-cm2 flasks
(Corning, Cambridge, MA) at 37 C under 5%
CO2. After reaching approximately 90% confluence, cells
were cultured with 0 or 25 nM rbIFN-
or rbIFN-
for
times specified in serum-free medium. Where appropriate, cycloheximide
(50 µg/ml) (37) and rbIFN-
(25 nM) were added.
Nuclear Extracts
Nuclear extracts were prepared by a modification of the method
of Saatcioglu et al. (38). When designated, a protease
inhibitor cocktail (leupeptin, 0.6 U/ml; pepstatin, 1 U/ml; aprotinin,
10 U/ml; phenylmethylsulfonyl fluoride, 1 mM; and EDTA, 1
mM) was added to all buffers after the initial harvesting
of BEND cells. Cultured BEND cells were rinsed twice, harvested (4 C)
in 10 mM HEPES (pH 7.5), and pelleted (1700 x
g). Cell pellets were resuspended in 5 vol of 10
mM HEPES (pH 7.5), incubated on ice for 10 min, and
pelleted again. Cells were resuspended in 2 vol of 3 mM
MgCl2, 1 mM DTT, 25 mM HEPES (pH
7.5), 0.3% (vol/vol) NP40, and broken with 15 strokes in a Dounce
homogenizer (tight pestle). The homogenate was centrifuged immediately
for 20 sec in an Eppendorf (Brinkman Instruments, Inc.,
Westbury, NY) microcentrifuge (12,000 x g). The
crude nuclear pellet was suspended in 2 vol of 0.1 M KCl, 1
mM DTT, 25 mM HEPES, pH 7.5. The nuclei were
lysed by the addition of sufficient 2 M KCl to make the
solution 0.4 M and were mixed gently at 4 C for 15 min. The
lysate was adjusted to 20% in glycerol (vol/vol) and centrifuged
(12,000 x g) for 15 min at 4 C. The supernatant was
assayed for protein concentration by Coomassie Blue assay
(Bio-Rad Laboratories, Inc., Hercules, CA), aliquoted, and
stored at -80 C.
EMSA
Nuclear extracts (5 µg) were incubated with approximately
20,000 cpm (20 fmol) of an end-labeled, double-stranded ISRE
oligonucleotide (GGGAAAAGGAAACCGAAACT; based on sequence of bISG17
promoter) in the presence of 1 µg of poly(dI-dC)·poly(dI-dC)
(Sigma Chemical Co.) in a final volume of 10 µl as
described previously (38). Binding reactions were completed in 25
mM HEPES, pH 7.5, 1 mM EDTA, 0.7 mM
DTT, 100 mM KCl, and 10% glycerol at room temperature for
10 min. Samples were layered onto 6% polyacrylamide gels
(acrylamide/bisacrylamide ratio of 19:1) in a buffer of 20
mM Tris, 20 mM HEPES, 1 mM EDTA, pH
8.0, and electrophoresed at 100 V for 90 min at room temperature. Gels
were fixed briefly in 50% (vol/vol) ethanol, 7% (vol/vol) acetic acid
and transferred to 3MM paper (Whatman, Clifton, NJ) dried,
and autoradiographed. For competition experiments, unlabeled
double-stranded ISRE was added to standard binding reaction at
approximately 1-, 10-, and 100-fold molar excess (0.03 pmol, 0.3 pmol,
and 3 pmol) over the 32P-labeled ISRE.
For antibody-based supershift assay (39), all of the standard sample components were combined and incubated at room temperature for 5 min. Anti-IRF-1, STAT-1, or STAT-2 antibodies (1 µg, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or nonimmune rabbit IgG (1 µg) were added, and the incubation was continued for an additional 15 min before samples were loaded on 4% nondenaturing one-dimensional PAGE gels.
Radiolabeling of Probes
The bISG17 cDNA for Southern blots was labeled with
[
-32P] dCTP using a random primer procedure
(Boehringer Mannheim, Indianapolis, IN). Oligonucleotides
for primer extension assays and mobility shift assays were end labeled
with [
-32P]ATP by polynucleotide kinase using standard
procedures (35). End-labeled oligonucleotides for mobility shift assays
were annealed with a 10-fold excess of the complementary, unlabeled
strand to assure that all label was contained in double-stranded
DNA.
Western Blots
Western blots were performed as described previously (4, 7, 12).
Nuclear extracts (4 µg per lane) were separated on 7.5%
SDS-polyacrylamide gels, transferred to nitrocellulose, and detected
with primary antibody against human STAT-1 (E-23), human STAT-2 (C-20),
human IRF-1 (C-20), or human IRF-2 (C-19) (Santa Cruz Biotechnology, Inc.). Primary antibodies were diluted to 1.0
µg/nl. The second antibody was an antirabbit IgG alkaline
phosphatase conjugate (1:5000; Promega Corp.).
Preadsorption of Antibody against IRF-1
Nuclear extracts were prepared from BEND cells that were
incubated with 25 nM rbIFN-
for 2 h. Extracted
proteins were separated using one-dimensional-PAGE and Western blotted
as described above with anti-IRF-1 antibody that was preadsorbed (1 h,
25 C with 1:0, 1:1, or 1:10 molar excess of IRF-1 peptide (Santa Cruz Biotechnology, Inc.). The control in which primary antibody
was deleted from the Western blot reaction was included to determine
whether second detecting antibody immunoreacted nonspecifically.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This research was supported by NIH Grant R29 HD-32475.
Received for publication May 29, 1998. Revision received January 11, 1999. Accepted for publication March 16, 1999.
| REFERENCES |
|---|
|
|
|---|
: a novel
pregnancy recognition signal. Am J Reprod Immunol 37:412420
action in the uterus during early
pregnancy. J Reprod Fertil [Suppl 54], in press
induce conjugation of bovine ubiquitin
cross-reactive protein to cytosolic uterine proteins. Biol Reprod 58:898904
. Biol Reprod 59:293297
II possess distinct 5'-promoter and 3'-flanking
sequences. J Biol Chem 266:30603066
promotes transient phosphorylation of STAT-1 protein in
endometrium. Biol Reprod 54[Suppl 1]:450 (Abstract)
induces phosphorylation and nuclear translocation of
STAT-1, -2, and -3 in endometrial epithelial cells. Biol Reprod
58[Suppl 1]:214 (Abstract)
. Biol Reprod 58:11541162
-activated
STAT1 by the ubiquitin-proteasome pathway. Science 273:17171719
4, the major protein of herpes
simplex virus type 1, is stably and specifically associated with
promoter-regulatory domains of
genes and of selected other viral
genes. Proc Natl Acad Sci USA 83:32183222This article has been cited by other articles:
![]() |
J. F. Oliveira, L. E. Henkes, R. L. Ashley, S. H. Purcell, N. P. Smirnova, D. N. R. Veeramachaneni, R. V. Anthony, and T. R. Hansen Expression of Interferon (IFN)-Stimulated Genes in Extrauterine Tissues during Early Pregnancy in Sheep Is the Consequence of Endocrine IFN-{tau} Release from the Uterine Vein Endocrinology, March 1, 2008; 149(3): 1252 - 1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Song, F. W Bazer, and T. E Spencer Pregnancy and interferon tau regulate RSAD2 and IFIH1 expression in the ovine uterus Reproduction, January 1, 2007; 133(1): 285 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Han, K. J Austin, L. A Rempel, and T. R Hansen Low blood ISG15 mRNA and progesterone levels are predictive of non-pregnant dairy cows. J. Endocrinol., November 1, 2006; 191(2): 505 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Joyce, F. J. White, R. C. Burghardt, J. J. Muniz, T. E. Spencer, F. W. Bazer, and G. A. Johnson Interferon Stimulated Gene 15 Conjugates to Endometrial Cytosolic Proteins and Is Expressed at the Uterine-Placental Interface throughout Pregnancy in Sheep Endocrinology, February 1, 2005; 146(2): 675 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guzeloglu, F. Michel, and W. W. Thatcher Differential Effects of Interferon-{tau} on the Prostaglandin Synthetic Pathway in Bovine Endometrial Cells Treated with Phorbol Ester J Dairy Sci, July 1, 2004; 87(7): 2032 - 2041. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guzeloglu, P. Subramaniam, F. Michel, and W. W. Thatcher Interferon-{tau} Induces Degradation of Prostaglandin H Synthase-2 Messenger RNA in Bovine Endometrial Cells Through a Transcription-Dependent Mechanism Biol Reprod, July 1, 2004; 71(1): 170 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Austin, A. L. Carr, J. K. Pru, C. E. Hearne, E. L. George, E. L. Belden, and T. R. Hansen Localization of ISG15 and Conjugated Proteins in Bovine Endometrium Using Immunohistochemistry and Electron Microscopy Endocrinology, February 1, 2004; 145(2): 967 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Austin, B. M. Bany, E. L. Belden, L. A. Rempel, J. C. Cross, and T. R. Hansen Interferon-Stimulated Gene-15 (Isg15) Expression Is Up-Regulated in the Mouse Uterus in Response to the Implanting Conceptus Endocrinology, July 1, 2003; 144(7): 3107 - 3113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Pru, K. J. Austin, A. L. Haas, and T. R. Hansen Pregnancy and Interferon-{tau} Upregulate Gene Expression of Members of the 1-8 Family in the Bovine Uterus Biol Reprod, November 1, 2001; 65(5): 1471 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Choi, G. A. Johnson, R. C. Burghardt, L. R. Berghman, M. M. Joyce, K. M. Taylor, M. David Stewart, F. W. Bazer, and T. E. Spencer Interferon Regulatory Factor-Two Restricts Expression of Interferon-Stimulated Genes to the Endometrial Stroma and Glandular Epithelium of the Ovine Uterus Biol Reprod, October 1, 2001; 65(4): 1038 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-A. G. W. Fleming, Y. Choi, G. A. Johnson, T. E. Spencer, and F. W. Bazer Cloning of the Ovine Estrogen Receptor-{{alpha}} Promoter and Functional Regulation by Ovine Interferon-{{tau}} Endocrinology, July 1, 2001; 142(7): 2879 - 2887. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Pru, B. R. Rueda, K. J. Austin, W. W. Thatcher, A. Guzeloglu, and T. R. Hansen Interferon-Tau Suppresses Prostaglandin F2{{alpha}} Secretion Independently of the Mitogen-Activated Protein Kinase and Nuclear Factor {{kappa}} B Pathways Biol Reprod, March 1, 2001; 64(3): 965 - 973. [Abstract] [Full Text] |
||||
![]() |
M. Binelli, P. Subramaniam, T. Diaz, G. A. Johnson, T. R. Hansen, L. Badinga, and W. W. Thatcher Bovine Interferon-{{tau}} Stimulates the Janus Kinase-Signal Transducer and Activator of Transcription Pathway in Bovine Endometrial Epithelial Cells Biol Reprod, February 1, 2001; 64(2): 654 - 665. [Abstract] [Full Text] |
||||
![]() |
D. M. Stewart, G. A. Johnson, C. A. Vyhlidal, R. C. Burghardt, S. H. Safe, L.-Y. Yu-Lee, F. W. Bazer, and T. E. Spencer Interferon-{{tau}} Activates Multiple Signal Transducer and Activator of Transcription Proteins and Has Complex Effects on Interferon-Responsive Gene Transcription in Ovine Endometrial Epithelial Cells Endocrinology, January 1, 2001; 142(1): 98 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Binelli, A. Guzeloglu, L. Badinga, D. R. Arnold, J. Sirois, T. R. Hansen, and W. W. Thatcher Interferon-{tau} Modulates Phorbol Ester-Induced Production of Prostaglandin and Expression of Cyclooxygenase-2 and Phospholipase-A2 from Bovine Endometrial Cells Biol Reprod, August 1, 2000; 63(2): 417 - 424. [Abstract] [Full Text] |
||||
![]() |
J. K. Pru, K. J. Austin, D. J. Perry, A. M. Nighswonger, and T. R. Hansen Production, Purification, and Carboxy-Terminal Sequencing of Bioactive Recombinant Bovine Interferon-Stimulated Gene Product 17 Biol Reprod, August 1, 2000; 63(2): 619 - 628. [Abstract] [Full Text] |
||||
![]() |
H. Saito, Y. Morita, M. Fujimoto, M. Narazaki, T. Naka, and T. Kishimoto IFN Regulatory Factor-1-Mediated Transcriptional Activation of Mouse STAT-Induced STAT Inhibitor-1 Gene Promoter by IFN-{gamma} J. Immunol., June 1, 2000; 164(11): 5833 - 5843. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Johnson, T. E. Spencer, R. C. Burghardt, M. M. Joyce, and F. W. Bazer Interferon-Tau and Progesterone Regulate Ubiquitin Cross-Reactive Protein Expression in the Ovine Uterus Biol Reprod, March 1, 2000; 62(3): 622 - 627. [Abstract] [Full Text] |
||||
![]() |
C. Bebington, F.J. Doherty, and S.D. Fleming Ubiquitin cross-reactive protein gene expression is increased in decidualized endometrial stromal cells at the initiation of pregnancy Mol. Hum. Reprod., October 1, 1999; 5(10): 966 - 972. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |