help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, D. J.
Right arrow Articles by Hansen, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, D. J.
Right arrow Articles by Hansen, T. R.
Molecular Endocrinology 13 (7): 1197-1206
Copyright © 1999 by The Endocrine Society

Cloning of Interferon-Stimulated Gene 17: The Promoter and Nuclear Proteins That Regulate Transcription

David J. Perry, Kathy J. Austin and Thomas R. Hansen

Department of Animal Science Reproductive Biology Program University of Wyoming Laramie, Wyoming 82071


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A member of the interferon-stimulated gene (ISG) family encodes a 17-kDa ubiquitin homolog called ISG17 that is induced in the bovine uterine endometrium by interferon-{tau} (IFN-{tau}) during early pregnancy. The bovine (b) ISG17 cDNA shares 30% identity with a tandem ubiquitin repeat and 70% identity with human (h) ISG15. The present experiments were designed to sequence the bISG17 gene, compare general structure with the hISG15 gene, and to identify transcription factors that were induced by IFN-{tau} in bovine endometrial (BEND) cells. The promoter of the bISG17 gene was similar to the hISG15 gene in placement of a tandem IFN-stimulatory response element (ISRE) at position -90, but unique in the presence of three additional ISREs at positions -123, -332, and -525. IFN-{tau} (25 nM) induced nuclear proteins in BEND cells that interacted with a tandem bISG17 ISRE in electrophoretic mobility shift assay (EMSA). IFN-regulatory factor-1 (IRF-1) bound to this ISRE based upon supershift EMSA using antiserum against IRF-1. IFN-{tau} activated STAT-1 (signal transducer and activator of transcription-1) and -2 by 0.5 h, and IRF-1 by 2 h in BEND cells. It is concluded that the bISG17 gene is similar to the hISG15 gene, retains an ISRE that interacts with IRF-1, and is possibly induced initially by the STATs and later by IRF-1 in response to IFN-{tau} during early pregnancy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The lytic effects of prostaglandin F2{alpha} (PGF) must be circumvented during early pregnancy (1). Otherwise, the corpus luteum regresses in response to PGF and progesterone declines, resulting in early embryonic mortality. Pregnancy is established in ruminants through actions of interferon-{tau} (IFN-{tau}) on the endometrium (1, 2, 3). IFN-{tau} is released by the expanding blastocyst, binds to an endometrial receptor, and alters the pattern of uterine secretion of PGF. This results in rescue of the corpus luteum and continued production of progesterone. Because IFN-{tau} indirectly blocks the lytic action of PGF on the corpus luteum, it has been called an "antiluteolysin." The antiluteolytic mechanism of action of IFN-{tau} (1, 2) includes inhibition of estradiol receptors, reduction of oxytocin receptor, activation of a cyclooxygenase inhibitor, and a shift in the PGs to favor PGE2, a luteotropin, over PGF, a luteolysin.

In addition to regulating release of PGF, IFN-{tau} induces several uterine proteins (2, 4, 5). The function of these proteins during early pregnancy remains elusive with the exception of a 17-kDa bovine ubiquitin homolog. This protein was originally called ubiquitin cross-reactive protein, or UCRP, because it shared epitopes with ubiquitin and cross-reacted with antiserum against ubiquitin in Western blots (6).

Conjugation of ubiquitin to proteins is accomplished through an isopeptide bond between the carboxyl glycine of ubiquitin and primary amines on target proteins (7, 8). Proteins conjugated to ubiquitin are processed through an ATP-dependent 26 S multicatalytic proteasome pathway in which targeted proteins are degraded and ubiquitin is recycled (9). The hypothesis that bovine (b) UCRP conjugated to endometrial proteins was recently examined (10). It was demonstrated that conjugation of UCRP was distinct from conjugation of ubiquitin to endometrial proteins (10). Also, conjugation of bUCRP to endometrial proteins was induced by pregnancy and IFN-{tau}, whereas conjugation of ubiquitin to endometrial proteins was not.

Cloning of the bUCRP cDNA and analysis of inferred amino acid sequence revealed 70% identity with a human member of the IFN-stimulated gene (ISG) family that encoded a 15-kDa protein (ISG15), and 30% identity with a tandem bovine ubiquitin repeat (11). Both IFN-{alpha} and IFN-{tau} induced bUCRP mRNA and protein in bovine endometrial cells (6, 12, 13). Because the bUCRP gene belongs to the ISG family and encodes a 17-kDa protein, we have renamed the protein ISG17 to follow nomenclature developed for human ISG15 (14) and ISG54 (15).

IFNs are immunomodulatory proteins that have diverse cellular effects depending on cell lineage and stage of differentiation (16). IFNs bind to transmembrane receptors, activate janus kinase (Jak) or tyrosine kinase (Tyk), and stimulate rapid activation of gene expression (17). Signal transducers and activators of transcription (STATs) are cytoplasmic transcription factors that are phosphorylated by Jaks and interact as hetero- or homodimers to regulate transcription of genes. It has been suggested that STATs mediate early genomic responses to IFNs (17). IFN-regulatory factor-1 (IRF-1), a transcription factor, is induced by the STATs, phosphorylated, and might mediate distal responses to IFNs (18).

The bISG17 gene may be used to examine signal transduction in the endometrium in response to IFN-{tau} (13). bISG17 differs significantly in processing and primary structure when compared with hISG15. Another major difference between hISG15 and bISG17 is the apparent widespread expression of hISG15 in several cell lines and tissues (19). Northern blots revealed that expression of the bISG17 gene was restricted to endometrium from pregnant cows or to endometrium from nonpregnant cows that had been treated in vitro with recombinant bovine (rb) IFN-{tau} or rbIFN-{alpha} (12). While the role of hISG15 may be general to many cell types, transcription of the bISG17 gene appears to be a specific response to IFN-{tau} in the uterine endometrium during early pregnancy in the cow (12). Thus, the objectives of the present experiments were to isolate and sequence the bISG17 gene, compare structure and organization with the hISG15 gene, and determine whether STAT-1, STAT-2, IRF-1, and IRF-2 transcription factors were induced by IFN-{tau} and implicated in regulating the bISG17 gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Southern Blot Analysis
Calf thymus DNA was digested with restriction endonucleases and Southern blotted using the bISG17 cDNA (11) as a probe. Digestion of genomic DNA with enzymes that do not cleave the cDNA resulted in one major hybridizing band with other minor hybridizing bands (Fig. 1AGo). The major hybridizing band mostly disappeared after digestion of genomic DNA with PstI, SmaI, and SacI, which are known to cleave the bISG17 cDNA (11). Because two shorter hybridizing bands appeared after digestion with SacI, the data are interpreted to mean that a single major gene exists that encodes bISG17. The SacI fragments were approximately 3.4 and 2.0 kb in size. Even under nonstringent hybridizing conditions (i.e. 37 C), the bISG17 cDNA probe did not hybridize with human genomic DNA that was digested and Southern blotted as described for bovine genomic DNA (not shown).



View larger version (75K):
[in this window]
[in a new window]
 
Figure 1. Identification of the bISG17 Gene in Bovine Genomic DNA (A) and in Purified Phage (B) Using Southern Blot and a bISG17 cDNA Probe

In panel A, arrows indicate cleavage products using SacI, which is known to cleave the cDNA. In panel B, lane 1 represents ethidium bromide staining of SacI-digested phage that contains the bISG17 gene. Lane 2 represents Southern blot of SacI-digested phage using the bISG17 cDNA as a probe. bISG17 gene fragments that were subcloned into pBluescript SK are designated pDP7 and pDP8.

 
Isolation of the bISG17 Genomic Clone
A single phage was isolated and purified after screening 1 x 106 plaques from the bovine genomic library. Phage containing a 16-kb insert was digested with SacI and Southern blotted using radiolabeled bISG17 cDNA probe. Two SacI fragments hybridized with the bISG17 cDNA probe (Fig. 1BGo). These fragments were 3.4 and 2 kb in length and identical in size to those identified on genomic Southern blots after digestion with SacI. SacI fragments were gel purified, subcloned into pBluescript SK- and called pDP7 (3.4 kb) and pDP8 (2.0 kb).

Initial sequencing with standard primers revealed that the promoter and most of the coding sequences were contained in pDP8. Consequently, this plasmid was used to generate nested deletions by partial exonuclease III digestion and was sequenced in its entirety. All sequences were confirmed by overlapping clones and, where necessary, by using internal primers. The 3'-end of the coding sequence and the downstream noncoding sequences were sequenced from plasmid pDP7 using standard primers.

The sequence of the bISG17 gene and its promoter, including 1,180 bp upstream of the transcription start site, is shown in Fig. 2Go. The GenBank accession number is AF069133. The gene contains a putative TATA box element (TATTAAA) at position -29 relative to the mRNA cap site and a possible inverted CAAT-box element at position -130. The mRNA cap site is followed by the 5'-noncoding sequences and the initiation codon. Immediately after the initiation codon is a 437-bp intron followed by the remainder of the coding sequences and the 3'-nontranslated sequences that were identical to those described for the bISG17 cDNA (11).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Nucleotide and Deduced Amino Acid Sequence of the bISG17 Gene (A), Comparison with the hISG15 Promoter (B), and Identification of the mRNA Cap Site (C)

Fragments of the bISG17 gene (pDP7 and pDP8) were cloned into pBluescript SK- and sequenced. Protein coding sequences are indicated in upper case. ISREs are shown boxed in bold. The putative TATA box, inverted CAAT element, and polyadenylation signal are underlined. The potential CREB motif is boxed in bold italics and the GAAANN motifs are in bold. Numbering is in relation to the RNA transcription start site indicated by the boxed, italic g. Panel B shows nucleotide sequence homology between the promoters of bISG17 and hISG15. The two nucleotide sequences are aligned from -140 of the bISG17 gene through the first 17 nucleotides of the intron. Nucleotide identities are indicated by vertical lines. Arrows below the ISG15 sequence indicate insertions relative to the ISG17 sequence. The tandem ISRE and upstream ISREs are identified in bold underlined characters. The putative CREB element is bold and italicized. The mRNA cap site is indicated by the bold italic g, and the start of translation is indicated in upper case letters. Panel C shows primer extension analysis of the bISG17 mRNA cap site. Nucleotide sequence of the bISG17 gene using the primer is shown with nucleotides identified as G, A, T, and C. The longer (L) and shorter (S) hybridization methods are shown. Endometrial RNA from nonpregnant (NP) or pregnant (P) cows was used as template. The nucleotide sequence encoding the cap site is shown below the gel. Potential cap sites are shown with shorter arrows. The site designated as position +1 of the sequence is identified with the longest arrow because it was consistently the darkest signal using the L method and corresponded to one of the sites identified using the S method.

 
The promoter contains five putative IFN-stimulatory response elements (ISREs) at positions -525 to -513, -332 to -320, -123 to -111, and a pair of tandem, overlapping ISREs at position -92 to -74 (Fig. 2Go, A and B). The sequence motif GAAANN, which is found in the promoters of the IFN-{alpha}I and IFN-{tau} genes (20), is found no less than 17 times in both orientations in the region between -170 and -1060. In addition, a CREB-like sequence is at position -48 to -41. The general structure of the coding regions is similar between the bISG17 and hISG15 (14) genes with an intron immediately after the initiation codon. The coding regions shared 68% sequence identity as reported previously (11). Both genes retained a tandem overlapping ISRE approximately 50 bp upstream of the TATA box (Fig. 2BGo). The hISG15 gene has been sequenced to position -125 (Fig. 2BGo), whereas the bISG17 gene has been sequenced to position -1180 (Fig. 2AGo).

Determination of the Transcription Start Site
The mRNA cap site for the bISG17 gene was determined by primer extension analysis of total endometrial RNA that was isolated from cows on day 18 of pregnancy (Fig. 2CGo). Total endometrial RNA from a cow on day 18 of the estrous cycle served as a control. An oligonucleotide primer was chosen to hybridize to the mRNA at a position that was 15 bp upstream of the ATG initiation codon based on the bISG17 cDNA sequence (11). Primer extension was completed using two methods. The long, high-salt hybridization conditions yielded two major transcription start sites. The shorter, lower-salt hybridization conditions yielded four major start sites. Use of a second oligonucleotide primer (GCCAGGCTCTCTGCAGACAC) that ended 36 bp upstream of the initiation codon confirmed these results (not shown). Although these results may represent multiple transcription start sites, the first G nucleotide in the series has been designated as position 1 because the corresponding band is the darkest in the long hybridization experiment. No transcripts were detected by either method in total RNA from the endometrium collected on day 18 of the estrous cycle.

EMSA
The tandem ISRE in the bISG17 gene was almost identical to the tandem ISRE of the hISG15 gene (14). Only one nucleotide differed between the two sequences: a G to an A interchange in the variable part of the hISRE consensus sequence (Fig. 2BGo). The bISG17 tandem ISRE was synthesized, radiolabeled, and used as a probe in EMSA using nuclear extracts from IFN-treated bovine endometrial (BEND) cells.

Radiolabeled oligonucleotide incubated in the absence of nuclear extracts had the fastest electrophoretic mobility (Fig. 3AGo). Constitutive interaction of the ISRE with nuclear extracts was noted in both control and IFN-treated BEND cells. During the 2-h period, this faster migrating constitutive band was up-regulated after incubation with IFN-{alpha} or IFN-{tau}. Nuclear extracts from cells treated with either IFN-{alpha} or IFN-{tau} for 2 h also had one unique slower migrating band that was not found in controls. At the level of sensitivity of this analysis, there appeared to be no difference in nuclear proteins that were bound to the ISRE enhancer in response to the two IFNs tested.



View larger version (77K):
[in this window]
[in a new window]
 
Figure 3. EMSA of Nuclear Extracts from Control and IFN-Treated BEND Cells (Panel A) and Competition with Unlabeled ISRE (Panel B)

Nuclear extracts were isolated from BEND cells treated with 0 (C) or 25 nM IFN-{alpha} (A) or IFN-{tau} (T) as indicated. Five micrograms of extract were incubated with 20,000 cpm of labeled ISRE oligonucleotide (GGGAAAAGGAAACCGAAACT), separated on a nondenaturing 6% acrylamide gel, and autoradiographed. The bold arrow marks the migration of free oligonucleotide. The lighter arrow indicates a shifted band that appeared after IFN treatment. In panel B, EMSA was completed using nuclear extracts collected after 1 or 2 h culture with 25 nM rbIFN-{tau}. Nuclear extracts were incubated with radiolabeled ISRE in the absence or presence of 1-, 10-, or 100-fold molar excess of unlabeled ISRE.

 
Interaction of the radiolabeled ISRE with BEND cell nuclear extracts induced by IFN-{tau} was specific, as demonstrated in Fig. 3BGo. Coincubation with 10- and 100-fold molar excess of cold ISRE effectively blocked binding of nuclear proteins to the radiolabeled ISRE, as shown by a disappearance of both the faster migrating constitutive band and the slower migrating band that was induced by the IFNs.

Western Blot Analysis of STATs and IRF-1
Nuclear extracts were collected at several times after treatment of BEND cells with 25 nM rbIFN-{tau} or rbIFN-{alpha} and Western blotted using antibodies against STAT-1, STAT-2, and IRF-1. It was assumed in these experiments that translocation of these transcription factors to the nucleus required phosphorylation and that detection in the nucleus represented activation of these transcription factors. Representative Western blots showing detection of STAT-1, STAT-2, and IRF-1 in BEND cells may be found in Fig. 4AGo. Quantitation of these blots revealed that both IFNs activated STAT-1 (Fig. 4BGo) and STAT-2 (Fig. 4CGo) in BEND cells within 0.5 h, and IRF-1 within 2 h (Fig. 4DGo). Induction of IRF-1 required a longer incubation time (2 h) with the IFNs when compared with induction of the STATs. More than one nuclear protein immunoreacted with antiserum against IRF-1.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Detection of STAT-1 (91- and 84-kDa), STAT-2 (113-kDa), and IRF-1 (37-kDa) in BEND Cell Nuclear Extracts Using Western Blot

The immunoreacting band corresponding to the 37-kDa form of IRF-1 is shown with the arrow. BEND cells were incubated for 0, 0.5, or 2 h in the absence (C) or presence of 25 nM rbIFN-{alpha} (A) or rbIFN-{tau} (T). Nuclear extracts were isolated, separated (4 µg) on SDS polyacrylamide (7.5%) gels, transferred to nitrocellulose, and detected with antisera against STAT-1, STAT-2, or IRF-1. Western blots were quantitated using densitometry. Optical density was analyzed using protected t-test. Panels B, C, and D show quantitation of STAT-1, STAT-2, and IRF-1, respectively. All treatment means represent duplicate or triplicate determinations. Means identified with an asterisk differ from controls (P < 0.05).

 
Antibody against IRF-1 was preadsorbed with IRF-1 peptide to determine whether proteins immunoreacting with anti-IRF-1 antibody were immunospecific (Fig. 5AGo). Preadsorption of anti-IRF-1 antibody with IRF-1 peptide blocked Western blot detection of all but one immunoreacting band. This is interpreted to mean that all but one immunoreacting band immunoreacts specifically with antibody against IRF-1 and might represent isoforms of IRF-1. The failure to block detection of the single band, even after preadsorption using a 1:10 molar excess of peptide, is still interpreted to represent an immunospecific reaction. This is because this band does not appear when primary antibody is deleted from the Western blot reaction (i.e. control to determine whether secondary antibody immunoreacts nonspecifically).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. Detection of IRF-1 Is Immunospecific (A), and Induction of IRF-1 Requires Protein Synthesis (B)

In panel A, nuclear extracts were collected from BEND cells after 2 h culture with 25 nM rbIFN-{tau}. Proteins were loaded on one-dimensional PAGE gels and Western blotted using antiserum against IRF-1 that was preadsorbed with IRF-1 peptide in 1:0, 1:1, or 1:10 molar ratios. The control in which primary antibody was deleted from the Western blot reaction is shown (-1st). In panel B, inhibition of protein synthesis using cycloheximide had no effect on induction of STAT-1 and STAT-2, but inhibited induction of IRF-1 by rbIFN-{tau}. Nuclear extracts were collected from BEND cells cultured in the absence (C) or presence (T) of 25 nM rbIFN-{tau} and in the absence (Control) and presence of cycloheximide. STATs and IRFs were detected using Western blotting as described in Fig. 4Go.

 
Because of the temporal nature of IFN-{tau} induction of STATs followed by induction of IRF-1, an experiment was conducted to determine whether activation of these transcription factors required translation of new proteins. In this experiment, a protease inhibitor cocktail was included in all reagents while BEND cell extracts were being prepared. Treatment of BEND cells with 25 nM rbIFN-{tau} effectively induced STAT-1 and STAT-2 within 30 min (Fig. 5BGo). IRF-1 showed signs of induction by 1 h but was most strongly induced by 2 h after treatment with IFN-{tau}. Again, even in the presence of protease inhibitors, several bands of protein immunoreacted with the antiserum against IRF-1, which is in agreement with results presented in Fig. 4Go. Antibody against IRF-2 failed to immunoreact with nuclear proteins collected at times specified. Treatment of BEND cells with cycloheximide had no effect on induction of STAT-1 or STAT-2 by IFN-{tau}. However, treatment with cycloheximide inhibited induction of IRF-1 in response to IFN-{tau}. We interpret these data to mean that the STATs are constitutively present and are induced through phosphorylation to enter the nucleus and interact with response elements on genes. One of the genes that is induced by the STATs is the IRF-1 gene.

Electrophoretic Mobility Supershift Analysis
Incubation of nuclear extracts with antiserum against IRF-1 caused a supershift in banding pattern, which was most pronounced in BEND cell nuclear proteins that were collected at 2 h after treatment with IFN-{tau} (Fig. 6Go). These data are interpreted to mean that IRF-1 is one of the nuclear proteins that interacts with the ISRE of the bISG17 gene in response to IFN-{tau}. Because treatment of nuclear extracts with nonimmune serum had no effect on shifting bands, it is concluded that the supershifted band was specific to an IRF-1/ISRE complex when antibody against IRF-1 was used. Attempts to cause supershift of bands when using antiserum against STAT-1 and STAT-2 failed (not shown).



View larger version (115K):
[in this window]
[in a new window]
 
Figure 6. Electrophoretic Mobility Supershift Assay of Nuclear Extracts from BEND Cells Treated with 25 nM rbIFN-{tau}

After the initial binding reaction of extracts to the labeled ISRE, antibody against human IRF-1 was added, and the incubation was continued for an additional 15 min. The bound complexes were resolved using PAGE, and gels were dried and autoradiographed as described in Fig. 3Go. The lower arrow indicates the position of the presumptive IRF-1/ISRE complex; the upper arrow marks the supershifted antibody/IRF-1/ISRE complex. Culture times are indicated on the top of the gel. Incubations with nonimmune IgG (N) or with antibody against IRF-1 (I, immune) are designated.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
IFN-{tau} induces transcription of the ISG17 gene (12) and conjugation of ISG17 to cytosolic uterine proteins (10). Uterine ISG17 resembles hISG15 in structure (11) and function (10) in that both are homologs of ubiquitin. Based on Southern genomic blots, one major ISG17 gene was identified in the present experiments. The frequency of detection of the ISG17 gene in the bovine genomic library (i.e. 1 in 1,000,000) supports this conclusion. Other minor hybridizing bands on Southern genomic blots may represent genes that are related, but probably are not ubiquitin genes because the ISG17 probe does not hybridize with ubiquitin mRNA (12). Use of the hISG15 cDNA as a probe in bovine genomic Southern blots and use of the bISG17 cDNA probe in human genomic Southern blots failed even under nonstringent hybridizing conditions (not shown).

Because only one major bISG17 gene was identified, it appears likely that bISG17 is the counterpart to hISG15. The general organization of hISG15 and bISG17 genes is the same. Both genes contain a single intron after the initiation codon. Coding sequences of the bISG17 gene are identical to those described in the cDNA (11). The most significant retention in primary structure between bISG17 (11), hISG15 (14, 21), and ubiquitin (22) are the C-terminal Leu-Arg-Gly-Gly amino acids that have been shown to be involved with conjugation to intracellular proteins.

The bISG17 gene encodes unique amino acids when compared with hISG15. First, it appears to be processed differently than hISG15. The stop codon (TAG) in bISG17 immediately follows nucleotides encoding Leu-Arg-Gly-Gly, yielding a mature protein that is 17 kDa in size. In contrast, hISG15 has a stop codon that is downstream from this sequence (14, 23). Pre-hISG15 (17 kDa) undergoes a posttranslational modification that removes C-terminal amino acids to yield the mature protein (15 kDa) terminating in Leu-Arg-Gly-Gly (24, 25). Three cysteines exist in bISG17 (11), compared with only one cysteine in hISG15 (14). If disulfide bridges are formed in bISG17, they could greatly affect function, because of a very different tertiary structure when compared with hISG15. The presence of a free sulfhydryl group on the odd Cys in bISG17 and on the single Cys in hISG15 may also interact with targeted proteins or form homologous dimers.

The hISG15 promoter contains a functional tandem ISRE at -113 to -94 relative to the mRNA cap site, but little is known about sequences that are upstream of this tandem ISRE (14). In the present experiments, the mRNA cap site in the bISG17 gene was identified using two methods. The TATA box (TATTAAA) was located in the bISG17 gene at position -29 from the putative cap site. The promoter of the bISG17 gene was similar to the hISG15 gene promoter in the placement of a conserved tandem ISRE at position -92. However, three additional putative ISREs were present in the bISG17 gene at positions -123, -332, and -525.

The IFNs interact with transmembrane receptors that are associated with tyrosine kinases such as Jaks and Tyks. In addition to exhibiting preference for ligand, receptors sort intracellular responses through activating Jaks and Tyks, which then phosphorylate at least six STAT transcription factors (17). Mobility shift assay in the present experiments revealed that nuclear proteins induced by rbIFN-{tau} interacted with the tandem bISG17 ISRE. One slower migrating band was induced by rbIFN-{tau}.

IFN-{tau} induced appearance of STAT-1, STAT-2, and IRF-1 in nuclear proteins extracted from BEND cells. The inhibitory IRF-2 transcription factor was not found in nuclear extracts collected after treatment with IFN-{tau} at times examined in the present experiment. The temporal relationship between appearance of STAT-1 and STAT-2 (0.5 h) and IRF-1 (2 h) in BEND cells is consistent with induction of these nuclear proteins in other cells by other type 1 IFNs (26, 27, 28). The STATs are activated within minutes of IFN treatment. Phosphorylation of cytoplasmic STATs initiates translocation to the nucleus, formation of transcriptional complexes, and induction of secondary transcription factors called the IRFs. The induction of IRF-1 was blocked with cycloheximide treatment in the present experiments, whereas induction of STATs was not affected. Thus, it is concluded that a primary role of the STATs is to induce the IRF-1 gene, which then, through IRF-1, activates the bISG17 gene.

Currently, no evidence exists to suggest that STATs interact with the bISG17 ISRE in BEND cells. In the present experiments, attempts to supershift STAT/ISRE complexes with anti-STAT-antibodies failed even when nuclear extracts collected after culture for 0.5, 1, or 2 h with IFN-{tau} were used (not shown). However, because the STATs interact with DNA as hetero- or homodimers, it is not known if the epitopes that are recognized by the antibodies are inaccessible because of formation of dimers. Antibody against IRF-1 caused a supershift of the BEND cell nuclear extract/ISRE complex, suggesting that IRF-1 interacts with the bISG17 ISRE.

Each member of the IRF family has distinct roles in diverse systems such as regulation of cell growth, signal transduction induced by cytokines, response to pathogens, and hematopoetic development (29). The IRF family now consists of 10 members that include IRFs 1–7, ISG factor 3{gamma}, IFN consensus sequence binding protein, and viral IRF (29). The IRF-7 mRNA exists in at least three splice variants (30, 31). The induction of several immunoreacting IRF-1 bands on Western blots in response to IFN-{tau} was unexpected and is a new finding. Because the STATs appeared as distinct bands with appropriate molecular masses, proteolysis does not appear to occur when the nuclear extracts are prepared. Regardless, the proteins that immunoreacted with antibody against IRF-1 were present even when nuclear extracts were isolated in the presence of a mixture of protease inhibitors. The smallest immunoreacting IRF-1 signal corresponds to the expected molecular mass of murine and hIRF-1. A single 2-kb murine IRF-1 mRNA encodes an IRF-1 protein (37 kDa) that does not have N-glycosylation sites (32). However, human IRF-1 has eight CKII phosphorylation sites (29). Heterogeneity in phosphorylation might explain the upper Mr bands that immunoreacted with antibody against IRF-1. Preadsorption of anti-IRF-1 antibody using IRF-1 peptide effectively blocked detection of all but one immunoreacting band on Western blots. Proteins that were blocked from detection probably represent IRF-1 isoforms or IRF-1-related proteins. The single band that was not blocked by preadsorption of antibody with IRF-1 peptide also is interesting because it immunoreacts with anti-IRF-1 antibody, is absent when secondary antibody is deleted, and is induced by IFN-{tau} in a manner that is identical to the other immunoreacting bands.

IRF-2 was not detected in BEND cell extracts after 0.5, 1, or 2 h after treatment with IFN-{tau}. IRF-2 is considered an antagonist to IRF-1 because it is a negative regulator of genes that are activated by IRF-1 (29). Presumably, IRF-2 acts as a competitive antagonist because it has the same DNA binding specificity as IRF-1 and competes for the same binding site (33). Thus, it has been proposed that ISGs are either activated or inhibited based on the ratio of IRF-1 to IRF-2. In the present experiments, the ratio of these two transcription factors favors activation of bISG17 promoter within times examined.

One major gene that encodes bISG17 was isolated. This gene is probably the counterpart to the hISG15 gene, but it encodes a protein that is larger than hISG15 and contains several mutations in functional amino acid residues. Both proteins have been shown to function as ubiquitin homologs by conjugating to cytosolic proteins. The fate of proteins that are conjugated to bISG17 remains to be determined, but may not be related to rapid degradation through the proteasome. The promoters for these genes are similar, but reported herein is the presence of three additional putative ISREs in the bISG17 gene. That these are functional ISREs remains to be determined using site-directed mutagenesis and deletion analysis. By using the new BEND cell line, Western blot, and EMSA, we have demonstrated that IFN-{tau} induces phosphorylation of STAT-1 and STAT-2, which then induce IRF-1. IRF-1 was implicated in interacting with the bISG17 ISRE through EMSA supershift assay. Because the STATs were not shown to interact with this ISRE, we suspect that IRF-1 is the direct activator of transcription of the bISG17 gene. Termination of signal transduction will be the focus of future experiments and might involve ubiquitination of the STATs (34) and subsequent induction of IRF-2.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Restriction endonucleases were obtained from Promega Corp. (Madison, WI) or New England Biolabs, Inc. (Beverly, MA). Oligonucleotides for sequencing and primer extension experiments were synthesized by Life Technologies (Gaithersburg, MD). Radiolabeled nucleotides were obtained from New England Nuclear (Boston, MA) or Amersham (Arlington Heights, IL). All other chemicals were from Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific (Pittsburgh, PA) and were reagent grade or better.

Southern Blotting
Calf Thymus DNA (10 µg) (Sigma Chemical Co.) was digested to completion with BamHI, EcoRI, HindIII, PstI, SmaI, or SacI. The DNA digest was loaded onto a 0.75% agarose gel in TAE (40 mM Tris-acetate, 1 mM EDTA) and separated electrophoretically at 20 V overnight. The DNA fragments were transferred to nylon membranes (0.2 µm, Nytran+; Schleicher & Schuell, Inc., Keene, NH), dried, fixed by baking at 80 C, and hybridized with random primer-labeled bISG17 cDNA (11). Prehybridization, hybridization, and washing procedures were identical to those described when the bovine genomic library was screened. Southern blots were exposed to x-ray film (Fuji RX; Fisher Scientific) for 12 days.

Library Screening
A {lambda}GEM-11 bovine genomic library constructed from sperm DNA (Promega Corp.) was screened (20) using radiolabeled bISG17 cDNA as a probe (11). Approximately 106 plaques were plated with Escherichia coli Y1090 at 25,000 plaque-forming units (pfu) per 150-mm plate. Plaques were transferred to Biotrans nylon membranes (0.45-µm pore size) (ICN Biomedicals, Inc.; Irvine, CA), denatured with 0.5 N NaOH and 1.5 M NaCl, neutralized with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl, and washed twice with 2x SSC (where 1x SSC is 0.15 M NaCl, 15 mM sodium citrate). Membranes were baked (2 h, 80 C), prehybridized (3 h; 50% formamide, 5x SSC, 0.05 M sodium phosphate, 5x Denhardt’s solution, 0.1% SDS, 0.1 mg/ml salmon sperm DNA), hybridized (18 h), washed three times (15 min: 2x SSC/0.1% SDS, 1x SSC/0.1%SDS, 0.1x SSC/0.1% SDS) (42 C), and placed on Fuji RX film (Fisher Scientific) for 24 h. One positive plaque was identified.

After two rounds of plaque purification, phage were purified using the Wizard Lambda DNA purification system (Promega Corp.), and the insert was excised by digestion with SacI. The phage insert was found to contain internal SacI sites and yielded two restriction fragments, 2.0 and 3.4 kb, that reacted with the bISG17 cDNA probe on Southern blots. These fragments were gel purified and subcloned into pBluescript SK- (Stratagene; La Jolla, CA). The plasmids containing 3.4- and 2.0-kb inserts were designated pDP7 and pDP8, respectively.

DNA Sequencing
Dideoxy sequencing was carried out with standard forward and reverse M13 primers using Sequenase (Amersham). The pDP7 clone contained the 3'-end of the bISG17 gene from the SacI site known to exist at position 416 of the bISG17 cDNA (11). This clone was sequenced through the polyadenylation site. The pDP8 clone contained nucleotides that were upstream from position 416 of the bISG17 cDNA and was sequenced in its entirety using nested deletions created by the Erase-a-base system (Promega Corp.) and four additional primers at positions -260, -160, 595, and 751 (relative to putative cap site).

Identification of the mRNA Cap Site Using Primer Extension
Endometrium was collected from a cow on day 18 of the estrous cycle (negative control) and pregnancy. This day of pregnancy was selected to represent a time during which the bISG17 gene is transcribed at high levels (12). Total RNA was extracted from endometrial tissue using Tri reagent (Molecular Research Center, Inc.; Cincinnati, OH) as described previously (12). RNA (20 µg) was combined with 105 cpm of end-labeled oligonucleotide primer (CACCATGGCCGTGGGTTCTGG) that was selected to end 15 bases upstream of the initiation codon. Two primer extension methods were used. In the first, longer-hybridization method (35), RNA and end-labeled oligonucleotide were dissolved in 30 µl hybridization buffer (3 M NaCl, 0.5 M HEPES, pH 7.5, 1 mM EDTA), incubated at 85 C for 10 min, and then incubated for 8 h at 30 C. After ethanol precipitation, the primed RNA was dissolved in 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1 mM deoxynucleoside triphosphates, 10 mM MgCl2, and 40 U of RNAsin (Promega Corp.). MMLV (mouse Moloney leukemia virus) reverse transcriptase (200 U, Gibco BRL; Bethesda, MD) was added, and the mixture was incubated at 37 C for 1 h. Ribonuclease (10 µg; Promega Corp.) and EDTA (final concentration of 25 mM) were added, and the incubation was continued for another 30 min. The extension product was extracted once with phenol-chloroform-isoamyl alcohol (25:24:1), ethanol precipitated, and dissolved in 10 µl sequencing gel loading buffer (10 mM EDTA, 95% formamide, 0.1% bromphenol blue, 0.1% xylene cyanol). The samples were heated to 95 C for 5 min.

In the second, shorter-hybridization method (36), the RNA/primer precipitate was dissolved in 10 µl buffer containing 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 1 mM deoxynucleoside triphosphates, 10 mM MgCl2, 10 mM dithiothreitol (DTT), 0.5 mM spermidine, heated to 60 C for 20 min, and then cooled to room temperature over 10 min. MMLV (mouse Moloney leukemia virus) reverse transcriptase (40.5 U; 6 mM sodium pyrophosphate) was added, and the mixture was incubated at 37 C for 30 min. The reaction was halted by adding 20 µl of sequencing gel loading buffer as described above and heating to 90 C for 10 min. Primer extension products were analyzed on a 6% sequencing gel next to a dideoxy sequencing ladder to identify the exact length of the products.

Cell Culture
A bovine endometrial cell line called BEND cells (13) was cultured in medium consisting of 40% MEM (Sigma Chemical Co.), 40% Ham’s F-12, 10% FCS (heat inactivated), 10% horse serum (heat inactivated), 1% ABAM (antibiotic antimycotic solution, Sigma Chemical Co.) and insulin (0.2 U/ml). Cells (2 x 106) were plated into 75-cm2 flasks (Corning, Cambridge, MA) at 37 C under 5% CO2. After reaching approximately 90% confluence, cells were cultured with 0 or 25 nM rbIFN-{tau} or rbIFN-{alpha} for times specified in serum-free medium. Where appropriate, cycloheximide (50 µg/ml) (37) and rbIFN-{tau} (25 nM) were added.

Nuclear Extracts
Nuclear extracts were prepared by a modification of the method of Saatcioglu et al. (38). When designated, a protease inhibitor cocktail (leupeptin, 0.6 U/ml; pepstatin, 1 U/ml; aprotinin, 10 U/ml; phenylmethylsulfonyl fluoride, 1 mM; and EDTA, 1 mM) was added to all buffers after the initial harvesting of BEND cells. Cultured BEND cells were rinsed twice, harvested (4 C) in 10 mM HEPES (pH 7.5), and pelleted (1700 x g). Cell pellets were resuspended in 5 vol of 10 mM HEPES (pH 7.5), incubated on ice for 10 min, and pelleted again. Cells were resuspended in 2 vol of 3 mM MgCl2, 1 mM DTT, 25 mM HEPES (pH 7.5), 0.3% (vol/vol) NP40, and broken with 15 strokes in a Dounce homogenizer (tight pestle). The homogenate was centrifuged immediately for 20 sec in an Eppendorf (Brinkman Instruments, Inc., Westbury, NY) microcentrifuge (12,000 x g). The crude nuclear pellet was suspended in 2 vol of 0.1 M KCl, 1 mM DTT, 25 mM HEPES, pH 7.5. The nuclei were lysed by the addition of sufficient 2 M KCl to make the solution 0.4 M and were mixed gently at 4 C for 15 min. The lysate was adjusted to 20% in glycerol (vol/vol) and centrifuged (12,000 x g) for 15 min at 4 C. The supernatant was assayed for protein concentration by Coomassie Blue assay (Bio-Rad Laboratories, Inc., Hercules, CA), aliquoted, and stored at -80 C.

EMSA
Nuclear extracts (5 µg) were incubated with approximately 20,000 cpm (20 fmol) of an end-labeled, double-stranded ISRE oligonucleotide (GGGAAAAGGAAACCGAAACT; based on sequence of bISG17 promoter) in the presence of 1 µg of poly(dI-dC)·poly(dI-dC) (Sigma Chemical Co.) in a final volume of 10 µl as described previously (38). Binding reactions were completed in 25 mM HEPES, pH 7.5, 1 mM EDTA, 0.7 mM DTT, 100 mM KCl, and 10% glycerol at room temperature for 10 min. Samples were layered onto 6% polyacrylamide gels (acrylamide/bisacrylamide ratio of 19:1) in a buffer of 20 mM Tris, 20 mM HEPES, 1 mM EDTA, pH 8.0, and electrophoresed at 100 V for 90 min at room temperature. Gels were fixed briefly in 50% (vol/vol) ethanol, 7% (vol/vol) acetic acid and transferred to 3MM paper (Whatman, Clifton, NJ) dried, and autoradiographed. For competition experiments, unlabeled double-stranded ISRE was added to standard binding reaction at approximately 1-, 10-, and 100-fold molar excess (0.03 pmol, 0.3 pmol, and 3 pmol) over the 32P-labeled ISRE.

For antibody-based supershift assay (39), all of the standard sample components were combined and incubated at room temperature for 5 min. Anti-IRF-1, STAT-1, or STAT-2 antibodies (1 µg, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or nonimmune rabbit IgG (1 µg) were added, and the incubation was continued for an additional 15 min before samples were loaded on 4% nondenaturing one-dimensional PAGE gels.

Radiolabeling of Probes
The bISG17 cDNA for Southern blots was labeled with [{alpha}-32P] dCTP using a random primer procedure (Boehringer Mannheim, Indianapolis, IN). Oligonucleotides for primer extension assays and mobility shift assays were end labeled with [{gamma}-32P]ATP by polynucleotide kinase using standard procedures (35). End-labeled oligonucleotides for mobility shift assays were annealed with a 10-fold excess of the complementary, unlabeled strand to assure that all label was contained in double-stranded DNA.

Western Blots
Western blots were performed as described previously (4, 7, 12). Nuclear extracts (4 µg per lane) were separated on 7.5% SDS-polyacrylamide gels, transferred to nitrocellulose, and detected with primary antibody against human STAT-1 (E-23), human STAT-2 (C-20), human IRF-1 (C-20), or human IRF-2 (C-19) (Santa Cruz Biotechnology, Inc.). Primary antibodies were diluted to 1.0 µg/nl. The second antibody was an antirabbit IgG alkaline phosphatase conjugate (1:5000; Promega Corp.).

Preadsorption of Antibody against IRF-1
Nuclear extracts were prepared from BEND cells that were incubated with 25 nM rbIFN-{tau} for 2 h. Extracted proteins were separated using one-dimensional-PAGE and Western blotted as described above with anti-IRF-1 antibody that was preadsorbed (1 h, 25 C with 1:0, 1:1, or 1:10 molar excess of IRF-1 peptide (Santa Cruz Biotechnology, Inc.). The control in which primary antibody was deleted from the Western blot reaction was included to determine whether second detecting antibody immunoreacted nonspecifically.


    ACKNOWLEDGMENTS
 
The authors thank Dr. A. L. Haas (Medical College of Wisconsin, Milwaukee, WI) for the hISG15 cDNA, and Dr. R. M. Roberts (University of Missouri, Columbia, MO) for recombinant interferons.


    FOOTNOTES
 
Address requests for reprints to: Dr. Thomas R. Hansen, Department of Animal Science, University of Wyoming, Laramie, Wyoming 82071-3684.

This research was supported by NIH Grant R29 HD-32475.

Received for publication May 29, 1998. Revision received January 11, 1999. Accepted for publication March 16, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Thatcher WW, Meyer MD, Danet-Desnoyers G 1995 Maternal recognition of pregnancy. J Reprod Fertil Suppl 49:15–28[Medline]
  2. Bazer FW, Spencer TE, Ott TL 1997 Interferon {tau}: a novel pregnancy recognition signal. Am J Reprod Immunol 37:412–420
  3. Roberts RM, Malathy P-V, Hansen TR, Farin CE, Imakawa K 1990 Bovine conceptus secretory products involved in pregnancy recognition. J Anim Sci 68[Suppl 2]:28–38
  4. Godkin JD, Smith SE, Johnson RD, Dore JE 1997 The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. Am J Reprod Immunol 37:137–143
  5. Hansen TR, Austin KJ, Perry DJ, Pru JK, Teixeira MG, Johnson GA 1999 Mechanism of interferon-{tau} action in the uterus during early pregnancy. J Reprod Fertil [Suppl 54], in press
  6. Austin KJ, Ward SK, Teixeira MG, Dean VC, Moore DW, Hansen TR 1996 Ubiquitin cross-reactive protein is released by the bovine uterus in response to interferon during early pregnancy. Biol Reprod 54:600–606[Abstract]
  7. Hershko A, Ciechanover A 1992 The ubiquitin system for protein degradation. Annu Rev Biochem 61:761–807[CrossRef][Medline]
  8. Finley D, Chau V 1991 Ubiquitination. Annu Rev Cell Biol 7:25–69[CrossRef]
  9. Driscoll J, Goldberg AL 1990 The proteasome (multicatalytic protease) is a component of the 1500-kDa proteolytic complex which degrades ubiquitin-conjugated proteins. J Biol Chem 265:4789–4792[Abstract/Free Full Text]
  10. Johnson GA, Austin KJ, Van Kirk EA, Hansen TR 1998 Pregnancy and interferon-{tau} induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins. Biol Reprod 58:898–904[Abstract/Free Full Text]
  11. Austin KJ, Pru JK, Hansen TR 1996 Complementary deoxyribonucleic acid sequence encoding bovine ubiquitin cross-reactive protein: a comparison with ubiquitin and a 15-kDa ubiquitin homolog. Endocrine 5:191–197
  12. Hansen TR, Austin KJ, Johnson GA 1997 Transient ubiquitin cross-reactive protein gene expression in bovine endometrium. Endocrinology 138:5079–5082[Abstract/Free Full Text]
  13. Staggs KL, Austin KJ, Johnson GA, Teixeira MG, Talbott CT, Dooley VA, Hansen TR 1998 Complex induction of bovine uterine proteins by interferon-{tau}. Biol Reprod 59:293–297[Abstract/Free Full Text]
  14. Reich N, Evans B, Levy D, Fahey D, Knight Jr E, Darnell Jr JE 1987 Interferon-induced transcription of a gene encoding a 15-kDa protein depends on an upstream enhancer element. Proc Natl Acad Sci USA 84:6394–6398[Abstract/Free Full Text]
  15. Levy D, Larner A, Chaudhuri A, Babiss LE, Darnell Jr JE 1986 Interferon-simulated transcription: isolation of an inducible gene and identification of its regulatory region. Proc Natl Acad Sci USA 83:8929–8933[Abstract/Free Full Text]
  16. Pestka S, Langer JA, Zoon KC, Samuel CE 1987 Interferons and their actions. Annu Rev Biochem 56:727–777[CrossRef][Medline]
  17. Darnell Jr JE 1997 STATs and gene regulation. Science 277:1630–1635[Abstract/Free Full Text]
  18. Harada H, Takahashi E, Itoh S, Harada K, Hori TA, Taniguchi T 1994 Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol Cell Biol 14:1500–1509[Abstract/Free Full Text]
  19. Lowe J, Mcdermott H, Loeb K, Landon M, Haas AL, Mayer RJ 1995 Immunohistochemical localization of ubiquitin cross-reactive protein in human tissues. J Pathol 177:163–169[CrossRef][Medline]
  20. Hansen TR, Leaman DW, Cross JC, Mathialagan N, Bixby JA Roberts RM 1991 The genes for the trophoblast interferons and the related interferon {alpha}II possess distinct 5'-promoter and 3'-flanking sequences. J Biol Chem 266:3060–3066[Abstract/Free Full Text]
  21. Narasimhan J, Potter JL, Haas AL 1996 Conjugation of the 15-kDa interferon-induced ubiquitin homolog is distinct from that of ubiquitin. J Biol Chem 271:324–330[Abstract/Free Full Text]
  22. Wilkinson KD, Audhya TK 1981 Stimulation of ATP-dependent proteolysis requires ubiquitin with the COOH-terminal sequence Arg-Gly-Gly. J Biol Chem 256:9235–9241[Abstract/Free Full Text]
  23. Blomstrom DC, Fahey D, Kutny R, Korant BD, Knight Jr E 1986 Molecular characterization of the interferon-induced 15-kDa protein. J Biol Chem 261:8811–8816[Abstract/Free Full Text]
  24. Feltham N, Hillman Jr M, Cordova B, Fahey D, Larsen B, Blomstrom D, Knight Jr E 1989 A 15-kD interferon-induced protein and its 17-kD precursor: expression in Escherichia coli, purification, and characterization. J Interferon Res 9:493–507[Medline]
  25. Knight Jr E, Fahey D, Cordova B, Hillman M, Kutny R, Reich N, Blomstrom D 1988 A 15-kDa interferon-induced protein is derived by COOH-terminal processing of a 17-kDa precursor. J Biol Chem 263:4520–4522[Abstract/Free Full Text]
  26. Binelli M, Subramaniam PS, Thatcher WW 1996 Bovine interferon-{tau} promotes transient phosphorylation of STAT-1 protein in endometrium. Biol Reprod 54[Suppl 1]:450 (Abstract)
  27. Binelli M, Diaz T, Hansen TR, Thatcher WW 1998 Bovine interferon-{tau} induces phosphorylation and nuclear translocation of STAT-1, -2, and -3 in endometrial epithelial cells. Biol Reprod 58[Suppl 1]:214 (Abstract)
  28. Spencer TE, Ott TL, Bazer FW 1998 Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon {tau}. Biol Reprod 58:1154–1162[Abstract/Free Full Text]
  29. Nguyen H, Hiscott J, Pitha PM 1997 The growing family of interferon regulatory factors. Cytokine Growth Factor Rev 8:293–312[CrossRef][Medline]
  30. Zhang L, Pagano JS 1997 IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency. Mol Cell Biol 17:5748–5757[Abstract]
  31. Au W-C, Moore PA, LaFleur DW, Tombal B, Pitha PM 1998 Characterization of the interferon regulatory factor-7 and its potential role in the transcription activation of interferon A genes. J Biol Chem 273:29210–29217[Abstract/Free Full Text]
  32. Miyamoto M, Fujita T, Kimura Y, Maruyama M, Harada H, Sudo Y, Miyata T, Taniguchi T 1988 Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-ß gene regulatory elements. Cell 54:903–913[CrossRef][Medline]
  33. Tanaka N, Kawakami T, Taniguchi T 1993 Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system. Mol Cell Biol 13:4531–4538[Abstract/Free Full Text]
  34. Kim TK, Maniatis T 1996 Regulation of interferon-{gamma}-activated STAT1 by the ubiquitin-proteasome pathway. Science 273:1717–1719[Abstract/Free Full Text]
  35. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor Press, Cold Spring Harbor, NY, pp 7.79–7.83
  36. Doyle K 1996 Protocols and Applications Guide, ed. 3. Promega Corp, Madison, WI, pp 310–312
  37. Waring P 1990 DNA fragmentation induced in macrophages by gliotoxin does not require protein synthesis and is preceded by raised inositol triphosphate levels. J Biol Chem 265:14476–14480[Abstract/Free Full Text]
  38. Saatcioglu F, Perry DJ, Pasco DS, Fagan JB 1990 Aryl hydrocarbon (Ah) receptor DNA-binding activity: sequence specificity and Zn2+ requirement. J Biol Chem 265:9251–9258[Abstract/Free Full Text]
  39. Kristie TM, Roizman B 1986 {alpha}4, the major protein of herpes simplex virus type 1, is stably and specifically associated with promoter-regulatory domains of {alpha} genes and of selected other viral genes. Proc Natl Acad Sci USA 83:3218–3222[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. F. Oliveira, L. E. Henkes, R. L. Ashley, S. H. Purcell, N. P. Smirnova, D. N. R. Veeramachaneni, R. V. Anthony, and T. R. Hansen
Expression of Interferon (IFN)-Stimulated Genes in Extrauterine Tissues during Early Pregnancy in Sheep Is the Consequence of Endocrine IFN-{tau} Release from the Uterine Vein
Endocrinology, March 1, 2008; 149(3): 1252 - 1259.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
G. Song, F. W Bazer, and T. E Spencer
Pregnancy and interferon tau regulate RSAD2 and IFIH1 expression in the ovine uterus
Reproduction, January 1, 2007; 133(1): 285 - 295.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H. Han, K. J Austin, L. A Rempel, and T. R Hansen
Low blood ISG15 mRNA and progesterone levels are predictive of non-pregnant dairy cows.
J. Endocrinol., November 1, 2006; 191(2): 505 - 512.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. M. Joyce, F. J. White, R. C. Burghardt, J. J. Muniz, T. E. Spencer, F. W. Bazer, and G. A. Johnson
Interferon Stimulated Gene 15 Conjugates to Endometrial Cytosolic Proteins and Is Expressed at the Uterine-Placental Interface throughout Pregnancy in Sheep
Endocrinology, February 1, 2005; 146(2): 675 - 684.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
A. Guzeloglu, F. Michel, and W. W. Thatcher
Differential Effects of Interferon-{tau} on the Prostaglandin Synthetic Pathway in Bovine Endometrial Cells Treated with Phorbol Ester
J Dairy Sci, July 1, 2004; 87(7): 2032 - 2041.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Guzeloglu, P. Subramaniam, F. Michel, and W. W. Thatcher
Interferon-{tau} Induces Degradation of Prostaglandin H Synthase-2 Messenger RNA in Bovine Endometrial Cells Through a Transcription-Dependent Mechanism
Biol Reprod, July 1, 2004; 71(1): 170 - 176.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. J. Austin, A. L. Carr, J. K. Pru, C. E. Hearne, E. L. George, E. L. Belden, and T. R. Hansen
Localization of ISG15 and Conjugated Proteins in Bovine Endometrium Using Immunohistochemistry and Electron Microscopy
Endocrinology, February 1, 2004; 145(2): 967 - 975.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. J. Austin, B. M. Bany, E. L. Belden, L. A. Rempel, J. C. Cross, and T. R. Hansen
Interferon-Stimulated Gene-15 (Isg15) Expression Is Up-Regulated in the Mouse Uterus in Response to the Implanting Conceptus
Endocrinology, July 1, 2003; 144(7): 3107 - 3113.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. K. Pru, K. J. Austin, A. L. Haas, and T. R. Hansen
Pregnancy and Interferon-{tau} Upregulate Gene Expression of Members of the 1-8 Family in the Bovine Uterus
Biol Reprod, November 1, 2001; 65(5): 1471 - 1480.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Choi, G. A. Johnson, R. C. Burghardt, L. R. Berghman, M. M. Joyce, K. M. Taylor, M. David Stewart, F. W. Bazer, and T. E. Spencer
Interferon Regulatory Factor-Two Restricts Expression of Interferon-Stimulated Genes to the Endometrial Stroma and Glandular Epithelium of the Ovine Uterus
Biol Reprod, October 1, 2001; 65(4): 1038 - 1049.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J.-A. G. W. Fleming, Y. Choi, G. A. Johnson, T. E. Spencer, and F. W. Bazer
Cloning of the Ovine Estrogen Receptor-{{alpha}} Promoter and Functional Regulation by Ovine Interferon-{{tau}}
Endocrinology, July 1, 2001; 142(7): 2879 - 2887.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. K. Pru, B. R. Rueda, K. J. Austin, W. W. Thatcher, A. Guzeloglu, and T. R. Hansen
Interferon-Tau Suppresses Prostaglandin F2{{alpha}} Secretion Independently of the Mitogen-Activated Protein Kinase and Nuclear Factor {{kappa}} B Pathways
Biol Reprod, March 1, 2001; 64(3): 965 - 973.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
M. Binelli, P. Subramaniam, T. Diaz, G. A. Johnson, T. R. Hansen, L. Badinga, and W. W. Thatcher
Bovine Interferon-{{tau}} Stimulates the Janus Kinase-Signal Transducer and Activator of Transcription Pathway in Bovine Endometrial Epithelial Cells
Biol Reprod, February 1, 2001; 64(2): 654 - 665.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. M. Stewart, G. A. Johnson, C. A. Vyhlidal, R. C. Burghardt, S. H. Safe, L.-Y. Yu-Lee, F. W. Bazer, and T. E. Spencer
Interferon-{{tau}} Activates Multiple Signal Transducer and Activator of Transcription Proteins and Has Complex Effects on Interferon-Responsive Gene Transcription in Ovine Endometrial Epithelial Cells
Endocrinology, January 1, 2001; 142(1): 98 - 107.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Binelli, A. Guzeloglu, L. Badinga, D. R. Arnold, J. Sirois, T. R. Hansen, and W. W. Thatcher
Interferon-{tau} Modulates Phorbol Ester-Induced Production of Prostaglandin and Expression of Cyclooxygenase-2 and Phospholipase-A2 from Bovine Endometrial Cells
Biol Reprod, August 1, 2000; 63(2): 417 - 424.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
J. K. Pru, K. J. Austin, D. J. Perry, A. M. Nighswonger, and T. R. Hansen
Production, Purification, and Carboxy-Terminal Sequencing of Bioactive Recombinant Bovine Interferon-Stimulated Gene Product 17
Biol Reprod, August 1, 2000; 63(2): 619 - 628.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
H. Saito, Y. Morita, M. Fujimoto, M. Narazaki, T. Naka, and T. Kishimoto
IFN Regulatory Factor-1-Mediated Transcriptional Activation of Mouse STAT-Induced STAT Inhibitor-1 Gene Promoter by IFN-{gamma}
J. Immunol., June 1, 2000; 164(11): 5833 - 5843.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. A. Johnson, T. E. Spencer, R. C. Burghardt, M. M. Joyce, and F. W. Bazer
Interferon-Tau and Progesterone Regulate Ubiquitin Cross-Reactive Protein Expression in the Ovine Uterus
Biol Reprod, March 1, 2000; 62(3): 622 - 627.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
C. Bebington, F.J. Doherty, and S.D. Fleming
Ubiquitin cross-reactive protein gene expression is increased in decidualized endometrial stromal cells at the initiation of pregnancy
Mol. Hum. Reprod., October 1, 1999; 5(10): 966 - 972.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, D. J.
Right arrow Articles by Hansen, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, D. J.
Right arrow Articles by Hansen, T. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals