help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krueger, D. A.
Right arrow Articles by Dowd, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krueger, D. A.
Right arrow Articles by Dowd, D. R.
Molecular Endocrinology 13 (7): 1207-1217
Copyright © 1999 by The Endocrine Society

Functional Analysis of the Mouse ICER (Inducible cAMP Early Repressor) Promoter: Evidence for a Protein That Blocks Calcium Responsiveness of the CAREs (cAMP Autoregulatory Elements)

Darcy A. Krueger, Dailing Mao, Elizabeth A. Warner and Diane R. Dowd

E. A. Doisy Department of Biochemistry and Molecular Biology Saint Louis University Health Sciences Center St. Louis, Missouri 63104


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although Ca2+ and cAMP mediate their effects through distinct pathways, both signals converge upon the phosphorylation of the cAMP response element (CRE) binding protein, CREB, thereby activating transcription of CRE-regulated genes. In WEHI7.2 thymocytes, cAMP increases the expression of the inducible cAMP early repressor (ICER) gene through CRE-like elements, known as cAMP autoregulatory elements (CAREs). Because Ca2+- and cAMP-mediated transcription converge in WEHI7.2 thymocytes, we examined the effect of Ca2+ fluxes on the expression of the ICER gene in these cells. Despite the presence of multiple CAREs within its promoter, ICER gene transcription was not activated by Ca2+. Moreover, Ca2+ attenuated the stimulatory effect of cAMP on ICER expression. Transient expression of reporter constructs demonstrated that when these CAREs were placed in a different DNA promoter context, the elements became responsive to Ca2+. Detailed studies using chimeric promoter constructs to map the region responsible for blocking the transcriptional response to Ca2+ indicated that a small portion of the ICER promoter was necessary for the effect. Southwestern blot analysis identified a 83-kDa nuclear protein that bound specifically to that region. The relative binding activity of the factor to the ICER promoter and mutant promoter sequences correlated with an inhibition of Ca2+-activated gene expression in WEHI7.2 cells. These data suggest that the factor functions as a putative Ca2+-activated repressor of CREB/CRE-mediated transcription. Thus, depending on the surrounding context in which the CRE is located, CREs of individual genes can be regulated separately by Ca2+ and cAMP despite the convergence of these two signaling pathways.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Many extracellular signals, such as hormones and cytokines, selectively alter transcription of target genes to effect dramatic changes in cellular differentiation, function, and survival. As second messengers, Ca2+ and cAMP act through distinct intracellular pathways to relay signals from surface receptors to nuclear proteins which, in turn, regulate transcription of selected target genes. An important transcriptional activator associated with both Ca2+ and cAMP-dependent signals in various cell types is the cAMP response-element (CRE) binding protein (CREB). CREB belongs to the basic region/leucine zipper (bZIP) transcription family and binds to specific DNA-regulatory regions known as CREs (1, 2). CREB is phosphorylated in response to increases in cAMP or Ca2+. The cAMP-dependent protein kinase A (PKA) mediates phosphorylation of CREB in response to increases in intracellular levels of cAMP. Ca2+-mediated phosphorylation may occur via either Ca2+/calmodulin-dependent kinases (CaMKs) (3, 4) or a mitogen-activated protein kinase pathway (5). The phosphorylation is essential for CREB activation of CRE-mediated transcription of Ca2+ and cAMP-responsive genes (6). Previously, we demonstrated that CREB phosphorylation and CRE-dependent transcriptional activity significantly increase when either Ca2+ or cAMP is elevated in the WEHI7.2 murine thymoma cell line (7). Thus, in thymocytes, cAMP and Ca2+ signaling pathways converge to coordinately regulate gene expression through the activation of CREB.

In a recent analysis of immediate-early gene expression in WEHI7.2 cells, we observed that an alternatively spliced isoform of the cAMP response element modulator (CREM) gene, the inducible cAMP early repressor (ICER), was dramatically up-regulated by treatment with forskolin, an activator of adenylate cyclase (8). The ICER promoter contains four CRE-like elements known as cAMP-autoregulatory elements (CAREs) (9). Two of these CAREs, CARE3 and CARE4, are identical to known CREs from other cAMP-regulated genes, and they are the only CAREs of the ICER promoter that confer cAMP responsiveness to heterologous reporter constructs in WEHI7.2 cells (8). Given that cAMP- and Ca2+-mediated signals converge upon the phosphorylation and activation of CREB in WEHI7.2 thymocytes, these data predict that the ICER promoter would also be regulated by Ca2+ via these same two CAREs (i.e. CARE3 and CARE4). We report here the unexpected findings that expression of the endogenous ICER gene was unaffected by Ca2+ fluxes in the WEHI7.2 cells. Moreover, Ca2+ blocked the stimulatory effect of cAMP on ICER gene expression. We have identified a protein that specifically binds to the ICER promoter, and the relative binding activity of the factor to the ICER promoter and mutant promoter sequences correlated with an inhibition of Ca2+-activated gene expression in WEHI7.2 thymocytes. The differential regulation of a response element in varying contexts suggests that the sequence-specific binding of a repressor molecule allows distinct promoters to discriminate between two seemingly convergent signaling pathways.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Endogenous ICER Expression Is Unaffected by Elevated Intracellular Ca2+
Previous work from our laboratory demonstrated that in WEHI7.2 cells, forskolin treatment induces transcription of the ICER gene through two CRE-like elements (CARE3/4) (8). Because CREB is activated in WEHI7.2 cells by cAMP and Ca2+, we wanted to determine whether Ca2+ regulates ICER expression through its CAREs. WEHI7.2 thymocytes were treated with thapsigargin to cause the release of Ca2+ from the endoplasmic reticulum and thus activate Ca2+-mediated transcriptional processes. At various times after thapsigargin addition, mRNA was isolated and the expression of the ICER gene was analyzed by Northern blot (Fig. 1Go). Surprisingly, thapsigargin was unable to activate ICER transcription at every time point examined. In fact, when the steady state levels of the ICER transcript were normalized to actin, they remained constant. This is in marked contrast to the effects with cAMP, whereby regulation of the ICER gene occurs within 1.5 h of forskolin addition and is maximal at 3.5 h (8). To ensure that Ca2+-dependent signaling pathways required for transcriptional activation were functional in these cells, we also examined expression of the Ca2+/cAMP-inducible gene c-fos (8, 10, 11, 12). In contrast to ICER, a rapid calcium-induced increase in steady-state levels of c-fos mRNA was observed after 20 min of treatment with thapsigargin and reached a maximal 21-fold increase within 1 h. The magnitude of c-fos induction by calcium was similar to cAMP-induced expression (8); however, maximal induction occurred slightly earlier with forskolin treatment (20 min) than with thapsigargin treatment (1 h). The ability of the ICER gene to respond to cAMP but not Ca2+ suggests that there may be a regulatory mechanism responsible for specifically restricting activated transcription of the ICER gene when Ca2+ becomes elevated.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 1. Endogenous ICER and c-fos mRNA Levels Are Differentially Affected by Ca2+ Fluxes in WEHI7.2 Thymocytes

WEHI7.2 cells were treated with 0.04 µM thapsigargin for the indicated times. mRNA was isolated and 3 µg were subjected to Northern blot analysis. The resulting blot was sequentially hybridized with radiolabeled probes for CREM{alpha}, c-fos, and {gamma}-actin (for normalization). The CREM probe detects transcripts encoding all known isoforms of CREM and ICER.

 
Ca2+ Fluxes Attenuate cAMP-Dependent Transcription of the ICER Gene
Our previous work in WEHI7.2 cells demonstrated the convergence of Ca2+- and cAMP-mediated signaling pathways on the phosphorylation and activation of CREB (7). Moreover, the effect of two pathways is additive or synergistic in activating transcription of some CRE-containing promoters (7, 11). Although expression of the ICER gene was not induced by Ca2+, we were interested in determining whether Ca2+ modulates the response to cAMP. To test this, WEHI7.2 thymocytes were treated with thapsigargin, forskolin, and a combination of the two agents and mRNA analyzed by Northern blot analysis (Fig. 2AGo). After 20 min of treatment, forskolin and thapsigargin each caused an increase in the steady-state levels of c-fos mRNA (6-fold and 4-fold, respectively). Cotreatment with the agents led to an additive 9-fold increase in c-fos mRNA levels. There was no increase in ICER expression at this early time. After 3 h, c-fos levels remained elevated with forskolin treatment leading to a 1.5-fold increase in mRNA and a 9-fold increase with thapsigargin. Cotreatment resulted in a synergistic 45-fold increase in c-fos mRNA. As expected, forskolin treatment for 3 h resulted in an increase in ICER mRNA, while thapsigargin treatment did not alter the expression of ICER. In contrast to c-fos, cotreatment with thapsigargin and forskolin resulted in the attenuation of forskolin-induced ICER expression, reducing the response 68% from 5-fold with forskolin alone to 1.6-fold with both agents. The ability of thapsigargin to block the forskolin-dependent increase in ICER expression suggests that a Ca2+-dependent event may inhibit the responsiveness of the ICER promoter to cAMP-activated CREB.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Ca2+ Attenuates cAMP-Activated Transcription of the ICER Promoter in WEHI7.2 Thymocytes

A, Northern blot analysis of ICER and c-fos mRNA levels in cells treated with 10 µM forskolin (F), 0.06 µM thapsigargin (T), or a combination of the two agents (F/T). At the indicated times, mRNA was isolated and subjected to Northern blot analysis. The blot was probed sequentially with CREM{alpha}, c-fos, or {gamma}-actin (for normalization). B, Transient expression studies analyzing the effect of Ca2+ and cAMP on ICER promoter activity. WEHI7.2 cells were transfected by lipofection with the ICER-CAT reporter construct. After treatment for 6 h with 0.06 µM thapsigargin (T), 10 µM forskolin (F), or a combination of the agents (F/T), cell extracts were harvested and assayed for CAT activity. Fold induction is relative to vehicle-treated cells ± SEM (n = 6).

 
The negative effect of Ca2+ on cAMP-stimulated expression of ICER was verified in transient expression studies (Fig. 2BGo). An ICER-CAT reporter vector, encoding the chloramphenicol acetyltransferase (CAT) gene under the control of the ICER native promoter and approximately 400 bp of 5'-flanking sequence, was used for these studies (8). Similar to what was observed with endogenous ICER expression, thapsigargin led to an 83% reduction in forskolin-mediated CAT activity, from 33-fold stimulation with forskolin alone to 5.7-fold stimulation with the two agents together. The construct was relatively unresponsive to thapsigargin, demonstrating only a 1.6-fold increase in CAT activity under these conditions. Thus, both Northern blot analysis and transient expression analysis of the ICER promoter indicate that Ca2+ fluxes attenuate cAMP-induced expression of the ICER gene.

The CARE3/4 Region of the ICER Promoter Confers Unresponsiveness to Ca2+-Induced Transcription
While the CRE/CARE sequences from both the c-fos and ICER promoters provide cAMP-dependent regulation, only c-fos was regulated in a Ca2+-dependent fashion. These data suggest that specific regions or sequences of the ICER promoter may be responsible for preventing Ca2+/CREB-dependent activation of the CAREs. To identify the region(s) of the ICER promoter responsible for this effect, transient transfections were performed with heterologous CAT reporter vectors containing the native ICER promoter or containing promoter fragments upstream to the minimal thymidine kinase (tk) promoter (Fig. 3AGo). The native ICER promoter, containing CAREs 1–4, was responsive to cAMP, demonstrating a 21.7-fold increase in CAT activity in forskolin-treated cells (Fig. 3BGo). In contrast, the native promoter was minimally responsive to treatment with thapsigargin, demonstrating only a 2.6-fold increase in Ca2+-dependent reporter gene expression. Likewise, a heterologous construct driven by the tk promoter and the cluster of four CAREs (icerCARE1–4tkCAT) demonstrated a response similar to that of the native promoter (16.8-fold activation by cAMP and 2.7-fold activation by Ca2+). Although CARE1/2 is not responsive to cAMP in WEHI7.2 cells, it augments the response of CARE3/4 to forskolin (8). Removal of CARE1/2 in the icerCARE3/4tkCAT construct resulted in a 70% decrease (5.1-fold activation) in cAMP-induced CAT activity but had no effect on the response to thapsigargin (2.6-fold activation). In contrast to the ICER promoter elements, a CAT reporter construct containing two copies of the CRE from the human glycoprotein hormone {alpha}-subunit ({alpha}-gph) promoter (gphCRE(2)tkCAT) was responsive to both Ca2+ and cAMP (12.6- and 19.7-fold induction, respectively), in agreement with that previously described (7). These results indicate that CAREs of the ICER promoter appear to be differentially responsive to cAMP and Ca2+, providing evidence that individual genes can discriminate between Ca2+- and cAMP-signaling pathways. Furthermore, the inability of thapsigargin to induce transcription from the CARE3/4 promoter fragment suggests that the regulatory sequences of the ICER gene responsible for preventing Ca2+-induced transcription are contained within this minimal promoter region.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. cAMP- and Ca2+-Mediated Transcriptional Activation of CRE/CARE-Containing Promoter Sequences

A, Schematic representation of CAT reporter constructs containing promoter sequences from the ICER and gph promoters. B, Transient expression studies analyzing ICER promoter activity. WEHI7.2 cells were transfected by lipofection with ICER-CAT, icerCARE1–4tkCAT, icerCARE3/4tkCAT, or gphCRE(2 )tkCAT reporter constructs, after which cells were treated with 0.04 µM thapsigargin (solid bars) or 5 µM forskolin (striped bars) for 16 h. Cell extracts were then harvested and assayed for CAT activity. Fold induction is relative to vehicle-treated cells ± SEM (n >= 3).

 
The Responsiveness of CRE/CAREs to Calcium Is Independent of the Spacing between Elements and the Sequence of the Elements
The gphCRE(2)tkCAT and icerCARE3/4tkCAT constructs are both regulated by cAMP but respond differently to Ca2+. These constructs differ in three ways: 1) the sequence of the CREs/CAREs; 2) the relative distance between response elements; and 3) the unique sequences surrounding each element. We constructed reporter vectors containing mutated promoter sequences to determine which of these differences is responsible for conveying differential CARE regulation by cAMP and Ca2+. The gphCRE(2)tkCAT construct contains two consensus CREs with the palindromic sequence TGACGTCA in the context of the human {alpha}-gph promoter (13, 14, 15). In comparison, only one of the ICER elements, CARE3, is a consensus CRE. The second, CARE4, differs by a single base with the sequence TGATGTCA. This variant sequence is identical to the naturally occurring CRE in the bovine and rat {alpha}-gph promoters (16). Because differences in DNA sequence may alter relative binding affinity of transcription factors and thereby differentially activate transcription, we hypothesized that the relative unresponsiveness of the ICER gene may be due to the variant sequence of CARE4. To test this possibility, the sequence of the second consensus CRE of gphCRE(2)tkCAT was mutated to be identical to that of CARE4 [gphCRE/CARE4tkCAT (n = 15)] and assayed for cAMP- and Ca2+-inducible expression as before (Fig. 4Go). Compared with gphCRE(2)tkCAT, mutation of the second CRE in the gphCRE/CARE4tkCAT (n = 15) construct did not cause a significant change in reporter activity by either Ca2+ [16.0-fold increase for gphCRE/CARE4 vs. 12.6-fold for gphCRE(2)] or cAMP (13.4 vs. 19.7). Thus, the unique sequence of CARE4 is unlikely to be responsible for preventing ICER gene expression in response to Ca2+ in WEHI7.2 thymocytes.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Ca2+-Associated CRE Repression Is Independent of the Spacing between Elements and the Sequence of the CRE

A, Sequence of promoter variants cloned into the ptkCAT reporter vector. gphCRE/CARE4 (n = 15) tkCAT is similar to gphCRE(2 )tkCAT except that the second CRE has been modified to be identical to icerCARE4. The spacing between the two enhancer elements then was progressively shortened to 10, 6, and 3 residues as depicted. CRE/CARE sequences are outlined. B, Transient expression studies analyzing the transcriptional activity of sequence and spacing mutants of gphCRE(2 )tkCAT. WEHI7.2 cells were transfected by lipofection with the indicated reporter construct. Cells were then treated with 0.04 µM thapsigargin (solid bars) or 5 µM forskolin (striped bars) for 16 h, after which cell extracts were harvested and assayed for CAT reporter activity. Fold induction is relative to vehicle-treated cells ± SEM (n >= 3).

 
Although the gphCRE/CARE4tkCAT (n = 15) and icerCARE3/4tkCAT constructs both contain two tandemly arranged CREs, the spacing between individual elements differs in that the {alpha}-gph CREs are separated by 15 residues compared with 3 residues between the ICER CAREs. To determine whether the spacing between elements is important for modulating Ca2+-inducible gene expression, the number of nucleotides between the two CREs of gphCRE/CARE4tkCAT was systematically reduced to 10, 6, and 3 bp by removing residues centrally located between the CREs (Fig. 4Go). Interestingly, Ca2+-induced transcription was enhanced when spacing was reduced to 10 or 6 residues, suggesting that optimal spacing between CREs can promote transcriptional activation. This enhancement of CRE-dependent transcription induced by Ca2+ was not observed when the spacing between elements was reduced to 3 bp in the gphCRE/CARE4 (n = 3) construct. However, the gphCRE/CARE4tkCAT (n = 3) construct did retain substantial responsiveness to both cAMP and Ca2+ (8.6-fold activation by cAMP and 9.5-fold activation by Ca2+), suggesting that CRE spacing is unlikely to be a major factor in limiting activation of the ICER gene when Ca2+ becomes elevated in WEHI7.2 cells.

Sequences That Flank CARE4 Are Responsible for Limiting ICER Inducibility by Ca2+
Neither the sequence of CARE4 nor the spacing interval between elements was responsible for the observed unresponsiveness of the ICER promoter to Ca2+-activated transcription. Therefore, we hypothesized that the actual sequence of promoter regions immediately adjacent to the ICER CAREs must be important for modulating transcriptional activation. Thus, if any region of the ICER promoter were responsible for blocking Ca2+ responsiveness, it would be expected to repress Ca2+-activated transcription when incorporated into gphCRE/CARE4 (n = 3). Alternatively, if a region of the {alpha}-gph promoter is absolutely required to enhance Ca2+-mediated transcription, then the incorporation of this region into icerCARE3/4 would be expected to result in a construct that is transcriptionally responsive to Ca2+. To identify which flanking sequences were responsible for regulating Ca2+-activated transcription, mutant promoter fragments were generated in which flanking sequences of icerCARE3/4 (denoted 5' to 3' as d, e, and f; Fig. 5Go) were interchanged with corresponding regions from gphCRE/CARE4 (n = 3) (denoted 5' to 3' as A, B, and C). In transient expression studies with thapsigargin-treated WEHI7.2 cells, the most 5'-flanking sequences were dispensable for the differential response to Ca2+. Mutation of ABC to dBC had no effect on the response to Ca2+ (9.5-fold and 12.6-fold activation, respectively). Likewise both def and Aef were relatively unresponsive to Ca2+ (2.6-fold and 2.7-fold, respectively). These results suggest that the middle and most 3'-sequences flanking the CRE/CAREs are responsible for dictating the response level of these constructs to thapsigargin. As predicted, mutation of ABC to ABf resulted in a 54% decrease in activity (9.5- to 4.4-fold induction, respectively), while there was no difference in cAMP-stimulated CAT activity. While mutation of ABC to AeC only modestly reduced the response from 9.5- to 8.0-fold induction, when e and f were both present in the Aef construct, the inhibitory effect was additive (2.7-fold induction in CAT activity). Forskolin treatment resulted in the same level of CAT activity for the AeC and Aef reporter constructs, suggesting that both of these constructs can be activated by CREB when the DNA context is permissive.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 5. Sequences Flanking the CRE/CAREs Determine the Relative Responsiveness to Ca2+

A, Schematic representation of chimeric ptkCAT reporter vectors. Flanking and intervening sequences from gphCRE/CARE4 (n=3) (regions A, B, C) were systematically exchanged with corresponding sequences of icerCARE3/4 (regions d, e, f; see Materials and Methods). B, Transient expression studies analyzing Ca2+- and cAMP-inducibility of the chimeric reporter vectors. ptkCAT reporter constructs containing chimeric gphCRE/CARE4 (n = 3) and icerCARE3/4 promoter inserts were transfected into WEHI7.2 cells by lipofection. After treatment with 0.04 µM thapsigargin (solid bars) or 5 µM forskolin (striped bars) for 14–16 h, cell extracts were harvested and assayed for CAT activity. Fold induction is relative to vehicle-treated cells ± SEM (n >= 3).

 
The prediction that the sequences flanking CARE4 determine the level of Ca2+-responsiveness was supported by the converse set of mutations. Mutation of the 3'-sequence of def to deC more than doubled thapsigargin-induced CAT reporter activity from 2.6- to 5.9-fold. Although mutation of the middle region alone was ineffective at modifying the response (dBf demonstrated a 1.8-fold induction in Ca2+-regulated activity), the combination of regions B and C in dBC resulted in a synergistic 12.5-fold induction in CAT reporter gene expression. While there was a 7-fold difference in Ca2+-mediated regulation of dBC and dBf, there was only a 1.3-fold difference in their regulation by cAMP. These results demonstrate that either the sequences immediately flanking both sides of CARE4 (regions e and f) are important for repressing Ca2+-induced transcription of the ICER gene, or that regions B and C of gphCRE/CARE4 (n = 3) are required for enhancing the response to Ca2+ in WEHI7.2 thymocytes.

Sequences Flanking CARE4 Are Responsible for the Differential Binding of an 83-kDa Protein
Having determined that the middle and 3'-regions of the ICER promoter (regions e and f) were responsible for inhibiting Ca2+/CRE-dependent transcription, we reasoned that these ICER sequences are required for the binding of a transcriptional repressor, or that the corresponding regions in the {alpha}-gph promoter (regions B and C) are necessary for the binding of a transcriptional activator. To distinguish between these possibilities, Southwestern analysis was employed to determine whether a factor or factors could differentially bind to the {alpha}-gph or ICER promoter and thereby regulate Ca2+/CRE-dependent transcription (Fig. 6Go). WEHI7.2 nuclear extracts were separated by SDS-PAGE, transferred to polyvinylidene fluoride (PVDF) membrane, and renatured. The gph/ICER chimeric promoter fragments depicted in Fig. 5AGo were radiolabeled and used as DNA probes to detect nuclear proteins that could bind to either the gph or ICER sequences. There were multiple proteins that recognized all of the CRE/CARE-containing chimeric promoter fragments, two of which were verified by immunoblotting to be CREB and ATF-2 (data not shown) and have been shown previously to bind CREs with high affinity (17). However, a single protein with an apparent molecular mass of 83 kDa bound specifically to icerCARE3/4 (def) but not gphCRE/CARE4 (n = 3) (ABC). More importantly, the relative ability of each chimeric promoter fragment to bind the 83-kDa factor correlated with their ability to prevent Ca2+/CRE-dependent transcription in thapsigargin-treated WEHI7.2 thymocytes (Fig. 5BGo). Thus, the 83-kDa protein had a high binding activity when probed with chimeras that were relatively unresponsive to Ca2+ (def and Aef), and it did not bind to chimeras that demonstrated the highest level of Ca2+ responsiveness (ABC and dBC). The chimeras that were intermediate in Ca2+-mediated transcriptional activity (Abf, AeC, dBC, and deC) showed a moderate level of binding by the protein. The strong correlation between binding of the 83-kDa protein and transcriptional unresponsiveness of icerCARE3/4 to thapsigargin is highly suggestive that this nuclear factor is responsible for repressing Ca2+-induced, CRE-dependent gene expression in WEHI7.2 thymocytes in a promoter-specific fashion. There was no evidence for the existence of an activator protein that bound exclusively to the Ca2+-responsive sequences.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Southwestern Blot Analysis of WEHI7.2 Nuclear Extracts

Twenty micrograms of WEHI7.2 nuclear extract were separated by SDS-PAGE, transferred to Immobilon membrane, and renatured. The blots were probed with radiolabeled gphCRE/CARE4 (n = 3) or icerCARE3/4 chimeric promoter fragments described in Fig. 4Go. A single protein with an apparent molecular mass of 83 kDa (asterisk) was identified that only bound sequences from icerCARE3/4. Other CRE-binding proteins, CREB and ATF-2, were identified by Western blot (data not shown) and are indicated. Thapsigargin-induced reporter activity (from Fig. 5Go) is shown above each lane to demonstrate that DNA binding by the 83-kDa protein strongly correlated with the magnitude of Ca2+-associated CRE repression. Lane 9 contained supernatant from 20 µg of WEHI7.2 nuclear extract that was incubated at 65 C for 10 min, after which precipitated proteins were removed by centrifugation. Lanes 8 and 9 were probed with def (icerCARE3/4). Shown is a representative experiment.

 
To further characterize this factor, we examined the sensitivity of this factor to heat denaturation. Many members of the CREB/ATF family of transcriptional regulators are resilient to heat denaturation (18). WEHI7.2 nuclear extracts were heat denatured, after which precipitated proteins were removed by centrifugation and discarded. The heat-resistant, soluble fraction was separated by SDS-PAGE and analyzed by Southwestern blot using the icerCARE3/4 fragment as a probe (Fig. 6Go, lane 9). Significant levels of CREB and ATF-2 were detected after heat denaturation, consistent with previous reports (18). However, the 83-kDa protein was no longer detected after heat denaturation, suggesting that the characteristics of this protein may be different from the CREB/ATF family.

To address the question of how the 83-kDa protein might function to differentially regulate transcription, we examined the effect of forskolin and thapsigargin treatment on the DNA-binding activity of this factor. WEHI7.2 cells were treated with thapsigargin or forskolin for 20 min, after which nuclear extracts were isolated and analyzed by Southwestern blot (Fig. 7Go). The blot was probed with two sets of chimeric promoter fragments. One set represented sequences that were responsive Ca2+ and did not bind the factor (ABC and dBC) and one set that was unresponsive to Ca2+ and bound the factor (Aef and def). Thapsigargin treatment (T) did not alter the binding activity of the 83-kDa protein with any of the probes used. Forskolin treatment (F) modestly increased the binding activity of this factor when the calcium-unresponsive Aef or def sequences were used as probes. The factor remained unable to bind to ABC or dBC under these conditions.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 7. cAMP and Ca2+ Do Not Notably Alter the Binding Activity of the 83-kDa Protein

WEHI7.2 thymocytes were treated for 20 min with 0.06 µM thapsigargin (T), 10 µM forskolin (F), or vehicle (O), after which nuclear extracts were prepared and subjected to Southwestern blot analysis as described in Materials and Methods. Baculovirus-expressed recombinant CREB (C) was used as a control and migrates at an apparent molecular mass of 45–47 kDa (8 ). The resulting blot was probed with the indicated chimeric promoter fragments (schematically represented in Fig. 5AGo). The 83-kDa protein is denoted by the asterisk.

 
The correlation between binding of the 83-kDa protein and unresponsiveness to Ca2+/CRE-mediated transcription prompted us to examine expression of this factor in other cell types to determine whether its expression is cell type specific. Nuclear extracts from ROS17/2.8 rat osteosarcoma cells, HeLa human cervical carcinoma cells, primary rat liver cells, and COS7 monkey kidney cells were assayed by Southwestern blot using def sequences as the probe (Fig. 8Go). Significant levels of the 83-kDa protein were detected in every cell type examined. Thus, the 83-kDa factor appears to be widely expressed in many different cell types and mammalian species.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 8. The 83-kDa Protein Is Present in Multiple Cell Types

Nuclear extracts (20 µg protein) were separated by SDS-PAGE and visualized by Southwestern blot analysis using radiolabeled icerCARE3/4 as probe. Lane 1, WEHI7.2 murine thymoma cells; lane 2, ROS17/2.8 rat osteosarcoma cells; lane 3, HeLa human cervical carcinoma cells; lane 4, primary rat liver cells; lane 5, COS7 monkey kidney cells. The 83-kDa protein is denoted by the asterisk.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CRE-dependent transcription is mediated by members of the CREB/ATF family of bZIP transcription factors that can be activated through either Ca2+- or cAMP-mediated pathways (1, 2, 4, 5). We reported previously on the convergence of cAMP- and Ca2+-induced gene expression in WEHI7.2 thymocytes and demonstrated that both agents lead to the phosphorylation of CREB and subsequent activation of CRE-mediated transcription (7). Further studies demonstrated that the steady-state level of ICER mRNA in WEHI7.2 cells is increased after treatment with the cAMP-elevating agent forskolin (8). This response is dependent upon CARE3/4 in the ICER promoter. In the present report, we extended our examination of Ca2+-regulated gene expression in WEHI7.2 cells and showed that, despite having multiple CRE-like sequences in its promoter, the ICER gene is not responsive to Ca2+. This would suggest that the CAREs of the ICER promoter are unique in that they are responsive to cAMP but not Ca2+. These results are in agreement with Folco and Koren (19), who demonstrated that depolarization had no effect on ICER mRNA levels in pituitary GH3 cells and primary cardiocytes; however, the authors did not examine the phosphorylation state of CREB in these cells under the same conditions. Our results expand these observations and indicate that CRE responsiveness to Ca2+ and cAMP can be differentially regulated by the genetic context in which a CRE is located, despite the fact that these two signaling pathways converge to phosphorylate and activate CREB in these cells.

Other reports have described differences in Ca2+ responsiveness of CRE-linked gene expression attributable to cell-specific differences in Ca2+-signaling pathways that occur upstream of promoter activation. For example, Matthews et al. (20) found that JEG-3 choriocarcinoma cells, which fail to express CaMK IV, were unable to activate CREB or CRE-dependent transcription in a Ca2+-dependent manner. Expression of CaMK IV in these cells restored responsiveness. WEHI7.2 thymocytes differ from JEG-3 cells in that CaMK IV is expressed in these cells (our unpublished observations). Moreover, CREB is readily phosphorylated and CRE-dependent transcription is activated when Ca2+ becomes elevated in WEHI7.2 cells (7). Thus, an alternative regulatory mechanism must be responsible for the differences in CRE-dependent transcription in WEHI7.2 thymocytes.

Ca2+ might also differentially activate Ca2+-responsive genes through complex promoters containing multiple Ca2+-inducible regulatory elements. For example, the c-fos promoter contains two distinct elements, the serum response element (SRE) and the CRE, which both function to promote Ca2+-regulated transcription of the c-fos gene (21, 22, 23, 24). Hardingham et al. (25) reported that in pituitary AtT20 cells, increases in cytoplasmic Ca2+ signal through the activation of proteins that bind to the SRE, while nuclear Ca2+ signals are required for activation through CREB binding to the CRE (25). Deisseroth et al. (26) also demonstrated that calcium flux acts both in the cytoplasm and the nucleus to differentially activate transcription factors and gene expression (26). It is possible that thapsigargin is activating multiple Ca2+-dependent pathways in WEHI7.2 cells, as well. However, in identifying minimal CRE-containing promoter fragments that mimic the native promoter but do not contain binding sites for other known factors, we were able to focus on the ability of CREB to activate identical CREs located in different genetic contexts. Thus, the contextual sequences in which a CRE exists provide another level of regulation whereby convergent signals (Ca2+- and cAMP-mediated activation of CREB) can lead to different transcriptional responses.

We have identified by Southwestern blot analysis an 83-kDa protein that is expressed in multiple cell types and binds to the CARE3/4 region of the ICER promoter in a sequence-specific manner. Unlike many members of the CREB/ATF family that are heat-stable (18), this protein is sensitive to heat denaturation, and Western blot analysis confirms this protein is distinct from CREB and ATF-2. This protein did not bind to the gphCRE/CARE4 (n = 3) promoter fragment, a fragment that confers Ca2+ responsiveness to a heterologous reporter construct in WEHI7.2 cells. Moreover, binding was observed only with the chimeric promoter constructs that were transcriptionally unresponsive to Ca2+. Thus, the binding activity positively correlated with the observed repression of Ca2+-mediated transcription. These data suggest that the 83-kDa protein may function as a sequence-specific repressor of Ca2+-induced CRE-dependent transcription at the ICER promoter. The relative binding activity of this factor to the chimeric gph/ICER promoter constructs suggests that sequences that flank both sides of icerCARE4 are important for maximal DNA binding and full repressor activity. Comparison of icerCARE3/4 sequences with DNA binding sites of known transcription factors failed to indicate any likely candidates that might be the 83-kDa factor we have identified.

The mechanism by which the CRE-associated repressor specifically blocks Ca2+-induced ICER expression is unclear. Because CREB is rapidly phosphorylated by cAMP and calcium, any model to explain the differential regulation would presuppose the constitutive expression of a responsible factor whose activity is regulated by one or both agents. We propose four models by which such differential regulation could occur in these cells: 1) Ca2+ inhibits ICER transcription by increasing the DNA-binding affinity of a repressor and interferes with CREB-mediated transcription of the ICER promoter. The repressor could be activated directly by a calcium-dependent posttranslational modification such as phosphorylation. An example of this is the Ca2+-dependent repression of the PTH gene mediated by the redox factor protein REF-1. Phosphorylation of REF-1 occurs in response to increased extracellular Ca2+ and causes an increase in the binding affinity to REF-1 inhibitory regulatory sequences in promoter regions of specific genes (27). 2) The repressor might be complexed in an inactive state and released from the complex by a calcium-dependent event. This event would not increase the binding affinity of the repressor; it would simply allow the repressor to be freely available for binding to a DNA response element and subsequently, to repress transcription. 3) The 83-kDa protein is a transcriptional activator whose ability to induce CRE-linked gene expression is regulated by cAMP but not Ca2+. This could occur through the phosphorylation and activation of the factor by PKA but not a CaMK IV (or another kinase activated in a calcium-dependent pathway). The inactive protein would compete with CREB for binding to the CARE4 region, thereby causing a reduction in Ca2+/CREB-mediated transcription. Ca2+/CREB could partially activate transcription of ICER by binding only to CARE3. In the presence of cAMP, however, PKA-mediated activation of both CREB (bound to CARE3) and the 83-kDa factor (bound to CARE4 and flanking sequences) would allow for full activation of the ICER gene. 4) The repressor is constitutively bound to the ICER promoter, and cAMP signals derepress ICER gene transcription by decreasing its binding, thereby allowing activated CREB to induce transcription. Calcium would be incapable of releasing repression. The Wilm’s tumor suppressor (WT1) is a transcriptional repressor thought to function in a similar fashion. Elevations in cAMP cause PKA to phosphorylate WT1, thereby reducing its ability to bind WT-1 regulatory elements and repress transcription (28, 29).

Our results suggest that the second model may be responsible for differential regulation. First, cAMP-mediated transcription of ICER is attenuated by Ca2+ (Fig. 2Go), even though CREB is phosphorylated under these conditions and capable of inducing expression of other CRE-containing promoters (Fig. 2Go and Ref. 7). This would argue in favor of a calcium-dependent event repressing CREB-mediated transcription (models 1 and 2). Second, treatment with thapsigargin does not affect the binding activity of the 83-kDa protein in a Southwestern blot. Because the first step of the Southwestern blot is the denaturation and separation of proteins by SDS-PAGE, a calcium-dependent release of the repressor from an inactive complex (model 2) would not be detected by this assay. This is consistent with our data and would argue against a calcium-dependent increase in binding affinity (model 1). Determining the precise mechanism by which Ca2+ blocks CREB-mediated transcription of the ICER gene will provide fertile grounds for future research.

The Ca2+-mediated inhibition of CREB/CRE-dependent transcription demonstrated by the ICER CAREs suggests that promoter sequences can discriminate between converging cAMP and Ca2+ signals depending on the surrounding context in which the CRE is located. This ability to respond differently could be an important mechanism by which target genes are selectively activated by dissimilar extracellular signals that utilize Ca2+ or cAMP as intracellular second messengers. Further characterization and identification of the 83-kDa protein may provide further insight into the mechanism by which differential regulation of an element occurs.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Thapsigargin was purchased from Alexis/LC Laboratories (San Diego, CA), dissolved in dimethylsulfoxide, and stored at -80 C. Forskolin was purchased from Sigma (St. Louis, MO), dissolved in ethanol, and stored at -20 C.

Cell Culture
Murine WEHI7.2 thymoma cells were grown at 37 C, 6% CO2, and 90% humidity in DMEM containing 10% calf bovine serum, 0.063 g/liter penicillin, and 0.1 g/liter streptomycin.

Northern Blot Analysis
Northern blot analysis was performed as previously described (8).

Construction of Reporter Plasmids
ptkCAT, CRE(2)tkCAT, ICER-CAT, CARE1–4tkCAT, and CARE3/4tkCAT reporter plasmids have been described previously (8, 13). These reporter constructs have been identified with gph and icer subscripts in the present study to distinguish between the genetic contexts of the CRE/CAREs. Briefly, ICER-CAT contains the full ICER promoter inserted immediately upstream to the CAT reporter gene. icerCARE1–4tkCAT and icerCARE3/4tkCAT contain promoter fragments limited to the CARE1–4 and CARE3/4 regions of the ICER promoter, respectively, inserted upstream to the minimal thymidine kinase (tk) promoter and CAT gene of ptkCAT. The control plasmid, gphCRE(2)-tkCAT, contains tandem CREs from the human {alpha}-gph promoter inserted into ptkCAT. gphCRE/CARE4 (n = 15), gphCRE/CARE4 (n = 10), gphCRE/CARE4 (n = 6), and gphCRE/CARE4 (n = 3) mutant promoters were constructed with complimentary DNA oligonucleotides (Life Technologies, Inc., Gaithersburg, MD) corresponding to the listed sequence in Fig. 4AGo. These were then ligated into the ptkCAT vector. Chimeric gphCRE/CARE4 (n = 3) and icerCARE3/4 promoter fragments were generated by Klenow extension of a 3'-reverse primer (CGCCGGATCC) annealed to the following sense-strand oligonucleotides:

ABf = GACTCTAGAGGATCTAAATTGACGTCATATTGAT-GTCAGTGCTCGGATCCGGCG

AeC = GACTCTAGAGGATCTAAATTGACGTCACTGTGA-TGTCATGGTAAGGATCCGGCG

Aef = GACTCTAGAGGATCTAAATTGACGTCACTGTGA-TGTCAGTGCTCGGATCCGGCG

dBC = GACTCTAGAGGATCGCTGGTGACGTCATATTG-ATGTCATGGTAAGGATCCGGCG

dBf = GACTCTAGAGGATCGCTGGTGACGTCATATTG-ATGTCAGTGCTCGGATCCGGCG

deC = GACTCTAGAGGATCGCTGGTGACGTCACTGTG-ATGTCATGGTAAGGATCCGGCG

Chimeric promoter fragments were then digested with BamHI and XbaI and cloned into ptkCAT as before. The sequence of all constructs was confirmed using Sequenase 2.0 (United States Biochemical Corp., Cleveland, OH) as directed by the manufacturer.

Transient Reporter Expression Assays
WEHI7.2 cells were transfected by lipofection as described (8) and treated with thapsigargin, forskolin, or a combination of the two agents to induce CAT reporter gene expression. After incubation for the indicated times, cell extracts were prepared and assayed for CAT activity as described (30).

Southwestern Blot Analysis
WEHI7.2, HeLa, ROS17/2.8, and COS7 nuclear extracts were prepared by the method of Shapiro et al. (31). Extracts from WEHI7.2 cells used for experiments depicted in Figs. 6Go and 7Go were prepared in the presence of phosphatase inhibitors (50 mM NaF, 1 mM Na3VO4, and 5 mM ß-glycerophosphate). Rat liver nuclear extracts were prepared by the method of Lichtsteiner et al. (32). Twenty micrograms of protein were subjected to electrophoresis through a 10% SDS-polyacrylamide gel and transferred overnight at 4 C to Immobilon PVDF membrane (Millipore Corp., Bedford, MA). For the heat-denatured sample, 20 µg of extract were incubated at 65 C for 10 min, after which precipitated proteins were removed by centrifugation at 4 C and the remaining soluble proteins were subjected to electrophoresis. Southwestern blotting was performed similar to the method described by Hoeffler et al. (33). Briefly, after transfer to PVDF membrane, proteins were renatured at room temperature for 2 h with gentle agitation in 5% dry milk dissolved in TNE-50 renaturation buffer (10 mM Tris/HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol), after which the membrane was cut into individual strips and probed with radiolabeled double-stranded DNA promoter fragments. Hybridization was carried out at room temperature for 3 h in TNE-50 containing 10 µg/ml poly dI·dC competitor DNA (Roche Molecular Biochemicals, Indianapolis, IN) and 106 cpm/ml probe. Blots were then rinsed in TNE-50 and autoradiographed.


    ACKNOWLEDGMENTS
 
We acknowledge Drs. Pamela Mellon for graciously providing the ptkCAT and pCRE(2)tkCAT reporter plasmids, Paolo Sassone-Corsi for the CREM{alpha} cDNA, and Ali Shilatifard and Paul MacDonald for nuclear extracts.


    FOOTNOTES
 
Address requests for reprints to author’s current address: Diane R. Dowd, Ph.D., Department of Pharmacology, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, Ohio 44106-4965.

This work was supported by NIH Grant AI-35910 (to D.R.D.).

Received for publication November 11, 1998. Revision received April 5, 1999. Accepted for publication April 7, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Montminy MR, Bilezikjian LM 1987 Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature 328:175–178[CrossRef][Medline]
  2. Hoeffler JP, Meyer TE, Yun Y, Jameson JL, Habener JF 1988 Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242:1430–1433[Abstract/Free Full Text]
  3. Sheng M, Thompson MA, Greenberg ME 1991 CREB: A Ca2+-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252:1427–1430[Abstract/Free Full Text]
  4. Dash PK, Karl KA, Colicos MA, Prywes R, Kandel ER 1991 cAMP response element-binding protein is activated by Ca2+/calmodulin- as well as cAMP-dependent protein kinase. Proc Natl Acad Sci USA 88:5061–5065[Abstract/Free Full Text]
  5. Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme JC, Chan G, Storm DR 1998 Cross talk between ERK and PKA is required for Ca2+ stimulation of CREB-dependent transcription and ERK nuclear translocation. Neuron 21:869–883[CrossRef][Medline]
  6. Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675–680[CrossRef][Medline]
  7. Dowd DR, Ryerse JS, MacDonald PN, Miesfeld RL, Kamradt MC 1997 Crosstalk during Ca2+-, cAMP-, and glucocorticoid-induced gene expression in lymphocytes. Mol Cell Endocrinol 128:29–37[CrossRef][Medline]
  8. Mao D, Warner EA, Gurwitch SA, Dowd DR 1998 Differential regulation and transcriptional control of immediate early gene expression in forskolin-treated WEHI7.2 thymoma cells. Mol Endocrinol 12:492–503[Abstract/Free Full Text]
  9. Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor. Cell 75:875–886[CrossRef][Medline]
  10. Morgan JI, Curran T 1986 Role of ion flux in the control of c-fos expression. Nature 322:552–555[CrossRef][Medline]
  11. Sheng M, McFadden G, Greenberg ME 1990 Membrane depolorization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4:571–582[CrossRef][Medline]
  12. Qi XM, Simonson M, Distelhorst CW 1997 Bcl-2 inhibits c-fos induction by calcium. Oncogene 15:2849–53[CrossRef][Medline]
  13. Steger DJ, Altschmied J, Buscher M, Mellon PL 1991 Evolution of placenta-specific gene expression: comparison of the equine and human gonadotropin {alpha}-subunit genes. Mol Endocrinol 5:243–255[Abstract]
  14. Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A, Nilson JH 1987 Cyclic AMP regulation of the human glycoprotien hormone {alpha}-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad Sci USA 84:2198–2202[Abstract/Free Full Text]
  15. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific enhancer of the human glycoprotein hormone {alpha}-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  16. Drust DS, Troccoli NM, Jameson JL 1991 Binding specificity of cyclic adenosine 3',5'-monophosphate-responsive element (CRE)-binding proteins and activating transcription factors to naturally occurring CRE sequence variants. Mol Endocrinol 5:1541–1551[Abstract]
  17. Benbrook DM, Jones NC 1994 Different binding specificities and transactivation of variant CRE’s by CREB complexes. Nucleic Acids Res 22:1463–9[Abstract/Free Full Text]
  18. Hoeffler JP, Lustbader JW, Chen C-Y 1991 Identification of multiple nuclear factors that interact with cyclic adenosine 3',5'-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions. Mol Endocrinol 5:256–266[Abstract]
  19. Folco EJ, Koren G 1997 Degradation of the inducible cAMP early repressor (ICER) by the ubiquitin-proteasome pathway. Biochem J 328:37–43
  20. Matthews RP, Guthrie CR, Wailes LM, Zhao X, Means A, McKnight GS 1994 Calcium/calmodulin-dependent protein kinase types II and IV differentially regulate CREB-dependent gene expression. Mol Cell Biol 14:6107–6116[Abstract/Free Full Text]
  21. Sassone-Corsi P, Visvader J, Ferland L, Mellon PL, Verma IM 1988 Induction of proto-oncogene fos transcription through the adenylate cyclase pathway: characterization of a cAMP-responsive element. Genes Dev 2:1529–1538[Abstract/Free Full Text]
  22. Sheng M, Dougan ST, McFadden G, Greenberg ME 1988 Calcium and growth factor pathways of c-fos transcriptional activation require distinct upstream regulatory sequences. Mol Cell Biol 8:2787–2796[Abstract/Free Full Text]
  23. Bading H, Ginty DD, Greenberg ME 1993 Regulation of gene expression in hippocampal neurons by distinct calcium signaling pathways. Science 260:181–186[Abstract/Free Full Text]
  24. Ghosh A, Ginty DD, Bading H, Greenberg ME 1994 Calcium regulation of gene expression in neuronal cells. J Neurobiol 25:294–303[CrossRef][Medline]
  25. Hardingham GE, Chawla S, Johnson CM, Bading H 1997 Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression. Nature 385:260–265[CrossRef][Medline]
  26. Deisseroth K, Bito H, Tsien RW 1996 Signaling from synapse to nucleus: postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic plasticity. Neuron 16:89–101[CrossRef][Medline]
  27. Okazaki T, Chung U-I, Nishishita T, Ebisu S, Usuda S, Mishiro S, Xanthoudakis S, Igarashi T, Ogata E 1994 A redox factor protein, REF1, is involved in negative gene regulation by extracellular calcium. J Biol Chem 269:27855–27862[Abstract/Free Full Text]
  28. Ye Y, Raychaudhuri B, Gurney A, Campbell CE, Williams BRG 1996 Regulation of WT1 by phosphorylation: inhibition of DNA binding, alteration of transcriptional activity and cellular translocation. EMBO J 15:5606–5615[Medline]
  29. Sakamoto Y, Yoshida M, Semba K, Hunter T 1997 Inhibition of the DNA-binding and transcriptional repression activity of the Wilms’ tumor gene product, WT1, by cAMP-dependent protein kinase-mediated phosphorylation of Ser-365 and Ser-393 in the zinc finger domain. Oncogene 15:2001–2012[CrossRef][Medline]
  30. Rouet P, Raguenez G, Salier J-P 1992 Optimized assays for quantifying transient expressions of co-transfected ß-galactosidase and CAT reporter genes. Biotechniques 13:700–701[Medline]
  31. Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47–55[Medline]
  32. Lichtsteiner S, Wuarin J, Schibler U 1987 The interplay of DNA-binding proteins on the promoter of the mouse albumin gene. Cell 51:963–973[CrossRef][Medline]
  33. Hoeffler JP, Meyer TE, Waeber G, Habener JF 1990 Multiple adenosine 3',5'-monophosphate response element DNA-binding proteins generated by gene diversification and alternative exon splicing. Mol Endocrinol 4:920–930[Abstract]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Inada, Y. Hamamoto, Y. Tsuura, J.-i. Miyazaki, S. Toyokuni, Y. Ihara, K. Nagai, Y. Yamada, S. Bonner-Weir, and Y. Seino
Overexpression of Inducible Cyclic AMP Early Repressor Inhibits Transactivation of Genes and Cell Proliferation in Pancreatic {beta} Cells
Mol. Cell. Biol., April 1, 2004; 24(7): 2831 - 2841.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Mead, T. R. Hughes, S. A. Irvine, N. N. Singh, and D. P. Ramji
Interferon-gamma Stimulates the Expression of the Inducible cAMP Early Repressor in Macrophages through the Activation of Casein Kinase 2. A POTENTIALLY NOVEL PATHWAY FOR INTERFERON-gamma -MEDIATED INHIBITION OF GENE TRANSCRIPTION
J. Biol. Chem., May 9, 2003; 278(20): 17741 - 17751.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Thommesen, E. Hofsli, R. H. Paulssen, M. W. Anthonsen, and A. Lagreid
Molecular mechanisms involved in gastrin-mediated regulation of cAMP-responsive promoter elements
Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1316 - E1325.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Krueger, E. A. Warner, and D. R. Dowd
Involvement of Thyrotroph Embryonic Factor in Calcium-mediated Regulation of Gene Expression
J. Biol. Chem., May 5, 2000; 275(19): 14524 - 14531.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krueger, D. A.
Right arrow Articles by Dowd, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krueger, D. A.
Right arrow Articles by Dowd, D. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals