Molecular Endocrinology 13 (7): 1207-1217
Copyright © 1999 by The Endocrine Society
Functional Analysis of the Mouse ICER (Inducible cAMP Early Repressor) Promoter: Evidence for a Protein That Blocks Calcium Responsiveness of the CAREs (cAMP Autoregulatory Elements)
Darcy A. Krueger,
Dailing Mao,
Elizabeth A. Warner and
Diane R. Dowd
E. A. Doisy Department of Biochemistry and Molecular
Biology Saint Louis University Health Sciences Center St.
Louis, Missouri 63104
 |
ABSTRACT
|
|---|
Although Ca2+ and cAMP
mediate their effects through distinct pathways, both signals converge
upon the phosphorylation of the cAMP response element (CRE) binding
protein, CREB, thereby activating transcription of CRE-regulated genes.
In WEHI7.2 thymocytes, cAMP increases the expression of the inducible
cAMP early repressor (ICER) gene through CRE-like elements, known as
cAMP autoregulatory elements (CAREs). Because
Ca2+- and cAMP-mediated transcription converge
in WEHI7.2 thymocytes, we examined the effect of
Ca2+ fluxes on the expression of the ICER gene
in these cells. Despite the presence of multiple CAREs within its
promoter, ICER gene transcription was not activated by
Ca2+. Moreover, Ca2+
attenuated the stimulatory effect of cAMP on ICER expression. Transient
expression of reporter constructs demonstrated that when these CAREs
were placed in a different DNA promoter context, the elements became
responsive to Ca2+. Detailed studies using
chimeric promoter constructs to map the region responsible for blocking
the transcriptional response to Ca2+ indicated
that a small portion of the ICER promoter was necessary for the effect.
Southwestern blot analysis identified a 83-kDa nuclear protein that
bound specifically to that region. The relative binding activity of the
factor to the ICER promoter and mutant promoter sequences correlated
with an inhibition of Ca2+-activated gene
expression in WEHI7.2 cells. These data suggest that the factor
functions as a putative Ca2+-activated
repressor of CREB/CRE-mediated transcription. Thus, depending on the
surrounding context in which the CRE is located, CREs of individual
genes can be regulated separately by Ca2+ and
cAMP despite the convergence of these two signaling pathways.
 |
INTRODUCTION
|
|---|
Many extracellular signals, such as hormones and cytokines,
selectively alter transcription of target genes to effect dramatic
changes in cellular differentiation, function, and survival. As second
messengers, Ca2+ and cAMP act through distinct
intracellular pathways to relay signals from surface receptors to
nuclear proteins which, in turn, regulate transcription of selected
target genes. An important transcriptional activator associated with
both Ca2+ and cAMP-dependent signals in various cell types
is the cAMP response-element (CRE) binding protein (CREB). CREB belongs
to the basic region/leucine zipper (bZIP) transcription family and
binds to specific DNA-regulatory regions known as CREs (1, 2). CREB is
phosphorylated in response to increases in cAMP or Ca2+.
The cAMP-dependent protein kinase A (PKA) mediates phosphorylation of
CREB in response to increases in intracellular levels of cAMP.
Ca2+-mediated phosphorylation may occur via either
Ca2+/calmodulin-dependent kinases (CaMKs) (3, 4) or a
mitogen-activated protein kinase pathway (5). The
phosphorylation is essential for CREB activation of CRE-mediated
transcription of Ca2+ and cAMP-responsive genes (6).
Previously, we demonstrated that CREB phosphorylation and CRE-dependent
transcriptional activity significantly increase when either
Ca2+ or cAMP is elevated in the WEHI7.2 murine thymoma cell
line (7). Thus, in thymocytes, cAMP and Ca2+ signaling
pathways converge to coordinately regulate gene expression through the
activation of CREB.
In a recent analysis of immediate-early gene expression in WEHI7.2
cells, we observed that an alternatively spliced isoform of the cAMP
response element modulator (CREM) gene, the inducible cAMP early
repressor (ICER), was dramatically up-regulated by treatment with
forskolin, an activator of adenylate cyclase (8). The ICER promoter
contains four CRE-like elements known as cAMP-autoregulatory elements
(CAREs) (9). Two of these CAREs, CARE3 and CARE4, are identical to
known CREs from other cAMP-regulated genes, and they are the only CAREs
of the ICER promoter that confer cAMP responsiveness to heterologous
reporter constructs in WEHI7.2 cells (8). Given that cAMP- and
Ca2+-mediated signals converge upon the phosphorylation and
activation of CREB in WEHI7.2 thymocytes, these data predict that the
ICER promoter would also be regulated by Ca2+ via these
same two CAREs (i.e. CARE3 and CARE4). We report here the
unexpected findings that expression of the endogenous ICER gene was
unaffected by Ca2+ fluxes in the WEHI7.2 cells. Moreover,
Ca2+ blocked the stimulatory effect of cAMP on ICER gene
expression. We have identified a protein that specifically binds to the
ICER promoter, and the relative binding activity of the factor to the
ICER promoter and mutant promoter sequences correlated with an
inhibition of Ca2+-activated gene expression in WEHI7.2
thymocytes. The differential regulation of a response element in
varying contexts suggests that the sequence-specific binding of a
repressor molecule allows distinct promoters to discriminate between
two seemingly convergent signaling pathways.
 |
RESULTS
|
|---|
Endogenous ICER Expression Is Unaffected by Elevated Intracellular
Ca2+
Previous work from our laboratory demonstrated that in WEHI7.2
cells, forskolin treatment induces transcription of the ICER gene
through two CRE-like elements (CARE3/4) (8). Because CREB is activated
in WEHI7.2 cells by cAMP and Ca2+, we wanted to determine
whether Ca2+ regulates ICER expression through its CAREs.
WEHI7.2 thymocytes were treated with thapsigargin to cause the release
of Ca2+ from the endoplasmic reticulum and thus activate
Ca2+-mediated transcriptional processes. At various times
after thapsigargin addition, mRNA was isolated and the expression of
the ICER gene was analyzed by Northern blot (Fig. 1
). Surprisingly, thapsigargin was unable
to activate ICER transcription at every time point examined. In fact,
when the steady state levels of the ICER transcript were normalized to
actin, they remained constant. This is in marked contrast to the
effects with cAMP, whereby regulation of the ICER gene occurs within
1.5 h of forskolin addition and is maximal at 3.5 h (8). To
ensure that Ca2+-dependent signaling pathways required for
transcriptional activation were functional in these cells, we also
examined expression of the Ca2+/cAMP-inducible gene
c-fos (8, 10, 11, 12). In contrast to ICER, a rapid
calcium-induced increase in steady-state levels of c-fos
mRNA was observed after 20 min of treatment with thapsigargin and
reached a maximal 21-fold increase within 1 h. The magnitude of
c-fos induction by calcium was similar to cAMP-induced
expression (8); however, maximal induction occurred slightly earlier
with forskolin treatment (20 min) than with thapsigargin treatment (1
h). The ability of the ICER gene to respond to cAMP but not
Ca2+ suggests that there may be a regulatory mechanism
responsible for specifically restricting activated transcription of the
ICER gene when Ca2+ becomes elevated.

View larger version (91K):
[in this window]
[in a new window]
|
Figure 1. Endogenous ICER and c-fos mRNA
Levels Are Differentially Affected by Ca2+ Fluxes in
WEHI7.2 Thymocytes
WEHI7.2 cells were treated with 0.04 µM thapsigargin for
the indicated times. mRNA was isolated and 3 µg were subjected to
Northern blot analysis. The resulting blot was sequentially hybridized
with radiolabeled probes for CREM , c-fos, and
-actin (for normalization). The CREM probe detects transcripts
encoding all known isoforms of CREM and ICER.
|
|
Ca2+ Fluxes Attenuate cAMP-Dependent
Transcription of the ICER Gene
Our previous work in WEHI7.2 cells demonstrated the convergence of
Ca2+- and cAMP-mediated signaling pathways on the
phosphorylation and activation of CREB (7). Moreover, the effect of two
pathways is additive or synergistic in activating transcription of some
CRE-containing promoters (7, 11). Although expression of the ICER gene
was not induced by Ca2+, we were interested in determining
whether Ca2+ modulates the response to cAMP. To test this,
WEHI7.2 thymocytes were treated with thapsigargin, forskolin, and a
combination of the two agents and mRNA analyzed by Northern blot
analysis (Fig. 2A
). After 20 min of
treatment, forskolin and thapsigargin each caused an increase in the
steady-state levels of c-fos mRNA (6-fold and 4-fold,
respectively). Cotreatment with the agents led to an additive 9-fold
increase in c-fos mRNA levels. There was no increase in ICER
expression at this early time. After 3 h, c-fos levels
remained elevated with forskolin treatment leading to a 1.5-fold
increase in mRNA and a 9-fold increase with thapsigargin. Cotreatment
resulted in a synergistic 45-fold increase in c-fos mRNA. As
expected, forskolin treatment for 3 h resulted in an increase in
ICER mRNA, while thapsigargin treatment did not alter the expression of
ICER. In contrast to c-fos, cotreatment with thapsigargin
and forskolin resulted in the attenuation of forskolin-induced ICER
expression, reducing the response 68% from 5-fold with forskolin alone
to 1.6-fold with both agents. The ability of thapsigargin to block the
forskolin-dependent increase in ICER expression suggests that a
Ca2+-dependent event may inhibit the responsiveness of the
ICER promoter to cAMP-activated CREB.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2. Ca2+ Attenuates cAMP-Activated
Transcription of the ICER Promoter in WEHI7.2 Thymocytes
A, Northern blot analysis of ICER and c-fos mRNA levels
in cells treated with 10 µM forskolin (F), 0.06
µM thapsigargin (T), or a combination of the two agents
(F/T). At the indicated times, mRNA was isolated and subjected to
Northern blot analysis. The blot was probed sequentially with CREM ,
c-fos, or -actin (for normalization). B, Transient
expression studies analyzing the effect of Ca2+ and cAMP on
ICER promoter activity. WEHI7.2 cells were transfected by lipofection
with the ICER-CAT reporter construct. After treatment for 6 h with
0.06 µM thapsigargin (T), 10 µM forskolin
(F), or a combination of the agents (F/T), cell extracts were harvested
and assayed for CAT activity. Fold induction is relative to
vehicle-treated cells ± SEM (n = 6).
|
|
The negative effect of Ca2+ on cAMP-stimulated
expression of ICER was verified in transient expression studies (Fig. 2B
). An ICER-CAT reporter vector, encoding the chloramphenicol
acetyltransferase (CAT) gene under the control of the ICER native
promoter and approximately 400 bp of 5'-flanking sequence, was used for
these studies (8). Similar to what was observed with endogenous ICER
expression, thapsigargin led to an 83% reduction in forskolin-mediated
CAT activity, from 33-fold stimulation with forskolin alone to 5.7-fold
stimulation with the two agents together. The construct was relatively
unresponsive to thapsigargin, demonstrating only a 1.6-fold increase in
CAT activity under these conditions. Thus, both Northern blot analysis
and transient expression analysis of the ICER promoter indicate that
Ca2+ fluxes attenuate cAMP-induced expression of the ICER
gene.
The CARE3/4 Region of the ICER Promoter Confers Unresponsiveness to
Ca2+-Induced Transcription
While the CRE/CARE sequences from both the c-fos
and ICER promoters provide cAMP-dependent regulation, only
c-fos was regulated in a Ca2+-dependent fashion.
These data suggest that specific regions or sequences of the ICER
promoter may be responsible for preventing
Ca2+/CREB-dependent activation of the CAREs. To identify
the region(s) of the ICER promoter responsible for this effect,
transient transfections were performed with heterologous CAT reporter
vectors containing the native ICER promoter or containing promoter
fragments upstream to the minimal thymidine kinase (tk) promoter (Fig. 3A
). The native ICER promoter, containing
CAREs 14, was responsive to cAMP, demonstrating a 21.7-fold increase
in CAT activity in forskolin-treated cells (Fig. 3B
). In contrast, the
native promoter was minimally responsive to treatment with
thapsigargin, demonstrating only a 2.6-fold increase in
Ca2+-dependent reporter gene expression. Likewise, a
heterologous construct driven by the tk promoter and the cluster of
four CAREs (icerCARE14tkCAT) demonstrated a response
similar to that of the native promoter (16.8-fold activation by cAMP
and 2.7-fold activation by Ca2+). Although CARE1/2 is not
responsive to cAMP in WEHI7.2 cells, it augments the response of
CARE3/4 to forskolin (8). Removal of CARE1/2 in the
icerCARE3/4tkCAT construct resulted in a 70% decrease
(5.1-fold activation) in cAMP-induced CAT activity but had no effect on
the response to thapsigargin (2.6-fold activation). In contrast to the
ICER promoter elements, a CAT reporter construct containing two copies
of the CRE from the human glycoprotein hormone
-subunit
(
-gph) promoter (gphCRE(2)tkCAT) was
responsive to both Ca2+ and cAMP (12.6- and 19.7-fold
induction, respectively), in agreement with that previously described
(7). These results indicate that CAREs of the ICER promoter appear to
be differentially responsive to cAMP and Ca2+, providing
evidence that individual genes can discriminate between
Ca2+- and cAMP-signaling pathways. Furthermore, the
inability of thapsigargin to induce transcription from the CARE3/4
promoter fragment suggests that the regulatory sequences of the ICER
gene responsible for preventing Ca2+-induced transcription
are contained within this minimal promoter region.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 3. cAMP- and Ca2+-Mediated Transcriptional
Activation of CRE/CARE-Containing Promoter Sequences
A, Schematic representation of CAT reporter constructs containing
promoter sequences from the ICER and gph promoters. B,
Transient expression studies analyzing ICER promoter activity. WEHI7.2
cells were transfected by lipofection with ICER-CAT,
icerCARE14tkCAT, icerCARE3/4tkCAT, or
gphCRE(2 )tkCAT reporter constructs, after which cells
were treated with 0.04 µM thapsigargin (solid
bars) or 5 µM forskolin (striped
bars) for 16 h. Cell extracts were then harvested and
assayed for CAT activity. Fold induction is relative to vehicle-treated
cells ± SEM (n 3).
|
|
The Responsiveness of CRE/CAREs to Calcium Is Independent of the
Spacing between Elements and the Sequence of the Elements
The gphCRE(2)tkCAT and icerCARE3/4tkCAT
constructs are both regulated by cAMP but respond differently to
Ca2+. These constructs differ in three ways: 1) the
sequence of the CREs/CAREs; 2) the relative distance between response
elements; and 3) the unique sequences surrounding each element. We
constructed reporter vectors containing mutated promoter sequences to
determine which of these differences is responsible for conveying
differential CARE regulation by cAMP and Ca2+. The
gphCRE(2)tkCAT construct contains two consensus CREs with
the palindromic sequence TGACGTCA in the context of the human
-gph promoter (13, 14, 15). In comparison, only one of the
ICER elements, CARE3, is a consensus CRE. The second, CARE4, differs by
a single base with the sequence TGATGTCA. This variant
sequence is identical to the naturally occurring CRE in the bovine and
rat
-gph promoters (16). Because differences in DNA
sequence may alter relative binding affinity of transcription factors
and thereby differentially activate transcription, we hypothesized that
the relative unresponsiveness of the ICER gene may be due to the
variant sequence of CARE4. To test this possibility, the sequence
of the second consensus CRE of gphCRE(2)tkCAT was mutated to
be identical to that of CARE4 [gphCRE/CARE4tkCAT (n =
15)] and assayed for cAMP- and Ca2+-inducible expression
as before (Fig. 4
). Compared with
gphCRE(2)tkCAT, mutation of the second CRE in the
gphCRE/CARE4tkCAT (n = 15) construct did not cause a
significant change in reporter activity by either Ca2+
[16.0-fold increase for gphCRE/CARE4 vs.
12.6-fold for gphCRE(2)] or cAMP (13.4 vs.
19.7). Thus, the unique sequence of CARE4 is unlikely to be responsible
for preventing ICER gene expression in response to Ca2+ in
WEHI7.2 thymocytes.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 4. Ca2+-Associated CRE Repression Is
Independent of the Spacing between Elements and the Sequence of the CRE
A, Sequence of promoter variants cloned into the ptkCAT reporter
vector. gphCRE/CARE4 (n = 15) tkCAT is similar to
gphCRE(2 )tkCAT except that the second CRE has been
modified to be identical to icerCARE4. The spacing
between the two enhancer elements then was progressively shortened to
10, 6, and 3 residues as depicted. CRE/CARE sequences are
outlined. B, Transient expression studies analyzing the
transcriptional activity of sequence and spacing mutants of
gphCRE(2 )tkCAT. WEHI7.2 cells were transfected by
lipofection with the indicated reporter construct. Cells were then
treated with 0.04 µM thapsigargin (solid
bars) or 5 µM forskolin (striped
bars) for 16 h, after which cell extracts were harvested
and assayed for CAT reporter activity. Fold induction is relative to
vehicle-treated cells ± SEM (n 3).
|
|
Although the gphCRE/CARE4tkCAT (n = 15) and
icerCARE3/4tkCAT constructs both contain two tandemly
arranged CREs, the spacing between individual elements differs in that
the
-gph CREs are separated by 15 residues compared with
3 residues between the ICER CAREs. To determine whether the spacing
between elements is important for modulating Ca2+-inducible
gene expression, the number of nucleotides between the two CREs of
gphCRE/CARE4tkCAT was systematically reduced to 10, 6, and 3
bp by removing residues centrally located between the CREs (Fig. 4
).
Interestingly, Ca2+-induced transcription was enhanced when
spacing was reduced to 10 or 6 residues, suggesting that optimal
spacing between CREs can promote transcriptional activation. This
enhancement of CRE-dependent transcription induced by Ca2+
was not observed when the spacing between elements was reduced to 3 bp
in the gphCRE/CARE4 (n = 3) construct. However, the
gphCRE/CARE4tkCAT (n = 3) construct did retain
substantial responsiveness to both cAMP and Ca2+ (8.6-fold
activation by cAMP and 9.5-fold activation by Ca2+),
suggesting that CRE spacing is unlikely to be a major factor in
limiting activation of the ICER gene when Ca2+ becomes
elevated in WEHI7.2 cells.
Sequences That Flank CARE4 Are Responsible for Limiting ICER
Inducibility by Ca2+
Neither the sequence of CARE4 nor the spacing interval between
elements was responsible for the observed unresponsiveness of the ICER
promoter to Ca2+-activated transcription. Therefore, we
hypothesized that the actual sequence of promoter regions immediately
adjacent to the ICER CAREs must be important for modulating
transcriptional activation. Thus, if any region of the ICER promoter
were responsible for blocking Ca2+ responsiveness, it would
be expected to repress Ca2+-activated transcription when
incorporated into gphCRE/CARE4 (n = 3).
Alternatively, if a region of the
-gph promoter
is absolutely required to enhance Ca2+-mediated
transcription, then the incorporation of this region into
icerCARE3/4 would be expected to result in a construct that
is transcriptionally responsive to Ca2+. To
identify which flanking sequences were responsible for
regulating Ca2+-activated transcription, mutant promoter
fragments were generated in which flanking sequences of
icerCARE3/4 (denoted 5' to 3' as d, e, and f; Fig. 5
) were interchanged with corresponding
regions from gphCRE/CARE4 (n = 3) (denoted 5' to 3' as
A, B, and C). In transient expression studies with thapsigargin-treated
WEHI7.2 cells, the most 5'-flanking sequences were dispensable for the
differential response to Ca2+. Mutation of ABC to dBC had
no effect on the response to Ca2+ (9.5-fold and 12.6-fold
activation, respectively). Likewise both def and Aef were relatively
unresponsive to Ca2+ (2.6-fold and 2.7-fold, respectively).
These results suggest that the middle and most 3'-sequences flanking
the CRE/CAREs are responsible for dictating the response level of these
constructs to thapsigargin. As predicted, mutation of ABC to ABf
resulted in a 54% decrease in activity (9.5- to 4.4-fold induction,
respectively), while there was no difference in cAMP-stimulated CAT
activity. While mutation of ABC to AeC only modestly reduced the
response from 9.5- to 8.0-fold induction, when e and f were both
present in the Aef construct, the inhibitory effect was additive
(2.7-fold induction in CAT activity). Forskolin treatment resulted in
the same level of CAT activity for the AeC and Aef reporter constructs,
suggesting that both of these constructs can be activated by CREB when
the DNA context is permissive.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 5. Sequences Flanking the CRE/CAREs Determine the
Relative Responsiveness to Ca2+
A, Schematic representation of chimeric ptkCAT reporter vectors.
Flanking and intervening sequences from gphCRE/CARE4
(n=3) (regions A, B, C) were systematically exchanged with
corresponding sequences of icerCARE3/4 (regions d, e, f;
see Materials and Methods). B, Transient expression
studies analyzing Ca2+- and cAMP-inducibility of the
chimeric reporter vectors. ptkCAT reporter constructs containing
chimeric gphCRE/CARE4 (n = 3) and
icerCARE3/4 promoter inserts were transfected into
WEHI7.2 cells by lipofection. After treatment with 0.04
µM thapsigargin (solid bars) or 5
µM forskolin (striped bars) for 1416 h,
cell extracts were harvested and assayed for CAT activity. Fold
induction is relative to vehicle-treated cells ± SEM
(n 3).
|
|
The prediction that the sequences flanking CARE4 determine the level of
Ca2+-responsiveness was supported by the converse set of
mutations. Mutation of the 3'-sequence of def to deC more than doubled
thapsigargin-induced CAT reporter activity from 2.6- to 5.9-fold.
Although mutation of the middle region alone was ineffective at
modifying the response (dBf demonstrated a 1.8-fold induction in
Ca2+-regulated activity), the combination of regions B and
C in dBC resulted in a synergistic 12.5-fold induction in CAT reporter
gene expression. While there was a 7-fold difference in
Ca2+-mediated regulation of dBC and dBf, there was only a
1.3-fold difference in their regulation by cAMP. These results
demonstrate that either the sequences immediately flanking both sides
of CARE4 (regions e and f) are important for repressing
Ca2+-induced transcription of the ICER gene, or that
regions B and C of gphCRE/CARE4 (n = 3) are required
for enhancing the response to Ca2+ in WEHI7.2
thymocytes.
Sequences Flanking CARE4 Are Responsible for the Differential
Binding of an 83-kDa Protein
Having determined that the middle and 3'-regions of the ICER
promoter (regions e and f) were responsible for inhibiting
Ca2+/CRE-dependent transcription, we reasoned that these
ICER sequences are required for the binding of a transcriptional
repressor, or that the corresponding regions in the
-gph
promoter (regions B and C) are necessary for the binding of a
transcriptional activator. To distinguish between these possibilities,
Southwestern analysis was employed to determine whether a factor or
factors could differentially bind to the
-gph or ICER
promoter and thereby regulate Ca2+/CRE-dependent
transcription (Fig. 6
). WEHI7.2 nuclear
extracts were separated by SDS-PAGE, transferred to polyvinylidene
fluoride (PVDF) membrane, and renatured. The gph/ICER
chimeric promoter fragments depicted in Fig. 5A
were radiolabeled and
used as DNA probes to detect nuclear proteins that could bind to either
the gph or ICER sequences. There were multiple proteins that
recognized all of the CRE/CARE-containing chimeric promoter fragments,
two of which were verified by immunoblotting to be CREB and ATF-2 (data
not shown) and have been shown previously to bind CREs with high
affinity (17). However, a single protein with an apparent molecular
mass of 83 kDa bound specifically to icerCARE3/4
(def) but not gphCRE/CARE4 (n = 3) (ABC). More
importantly, the relative ability of each chimeric promoter fragment to
bind the 83-kDa factor correlated with their ability to prevent
Ca2+/CRE-dependent transcription in thapsigargin-treated
WEHI7.2 thymocytes (Fig. 5B
). Thus, the 83-kDa protein had a high
binding activity when probed with chimeras that were relatively
unresponsive to Ca2+ (def and Aef), and it did not bind to
chimeras that demonstrated the highest level of Ca2+
responsiveness (ABC and dBC). The chimeras that were intermediate in
Ca2+-mediated transcriptional activity (Abf, AeC, dBC, and
deC) showed a moderate level of binding by the protein. The strong
correlation between binding of the 83-kDa protein and
transcriptional unresponsiveness of icerCARE3/4 to
thapsigargin is highly suggestive that this nuclear factor is
responsible for repressing Ca2+-induced, CRE-dependent gene
expression in WEHI7.2 thymocytes in a promoter-specific fashion. There
was no evidence for the existence of an activator protein that bound
exclusively to the Ca2+-responsive sequences.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 6. Southwestern Blot Analysis of WEHI7.2 Nuclear
Extracts
Twenty micrograms of WEHI7.2 nuclear extract were separated by
SDS-PAGE, transferred to Immobilon membrane, and renatured. The blots
were probed with radiolabeled gphCRE/CARE4 (n = 3) or
icerCARE3/4 chimeric promoter fragments described in
Fig. 4 . A single protein with an apparent molecular mass of 83 kDa
(asterisk) was identified that only bound sequences from
icerCARE3/4. Other CRE-binding proteins, CREB and ATF-2,
were identified by Western blot (data not shown) and are indicated.
Thapsigargin-induced reporter activity (from Fig. 5 ) is shown
above each lane to demonstrate that DNA binding by the
83-kDa protein strongly correlated with the magnitude of
Ca2+-associated CRE repression. Lane 9 contained
supernatant from 20 µg of WEHI7.2 nuclear extract that was incubated
at 65 C for 10 min, after which precipitated proteins were removed by
centrifugation. Lanes 8 and 9 were probed with def
(icerCARE3/4). Shown is a representative experiment.
|
|
To further characterize this factor, we examined the sensitivity of
this factor to heat denaturation. Many members of the CREB/ATF family
of transcriptional regulators are resilient to heat denaturation (18).
WEHI7.2 nuclear extracts were heat denatured, after which precipitated
proteins were removed by centrifugation and discarded. The
heat-resistant, soluble fraction was separated by SDS-PAGE and analyzed
by Southwestern blot using the icerCARE3/4 fragment as a
probe (Fig. 6
, lane 9). Significant levels of CREB and ATF-2 were
detected after heat denaturation, consistent with previous reports
(18). However, the 83-kDa protein was no longer detected after heat
denaturation, suggesting that the characteristics of this protein may
be different from the CREB/ATF family.
To address the question of how the 83-kDa protein might function to
differentially regulate transcription, we examined the effect of
forskolin and thapsigargin treatment on the DNA-binding activity of
this factor. WEHI7.2 cells were treated with thapsigargin or forskolin
for 20 min, after which nuclear extracts were isolated and analyzed by
Southwestern blot (Fig. 7
). The blot was
probed with two sets of chimeric promoter fragments. One set
represented sequences that were responsive Ca2+ and did not
bind the factor (ABC and dBC) and one set that was unresponsive to
Ca2+ and bound the factor (Aef and def). Thapsigargin
treatment (T) did not alter the binding activity of the 83-kDa protein
with any of the probes used. Forskolin treatment (F) modestly increased
the binding activity of this factor when the calcium-unresponsive Aef
or def sequences were used as probes. The factor remained unable to
bind to ABC or dBC under these conditions.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 7. cAMP and Ca2+ Do Not Notably Alter the
Binding Activity of the 83-kDa Protein
WEHI7.2 thymocytes were treated for 20 min with 0.06 µM
thapsigargin (T), 10 µM forskolin (F), or vehicle (O),
after which nuclear extracts were prepared and subjected to
Southwestern blot analysis as described in Materials and
Methods. Baculovirus-expressed recombinant CREB (C) was used as
a control and migrates at an apparent molecular mass of 4547 kDa (8 ).
The resulting blot was probed with the indicated chimeric promoter
fragments (schematically represented in Fig. 5A ). The 83-kDa protein is
denoted by the asterisk.
|
|
The correlation between binding of the 83-kDa protein and
unresponsiveness to Ca2+/CRE-mediated transcription
prompted us to examine expression of this factor in other cell types to
determine whether its expression is cell type specific. Nuclear
extracts from ROS17/2.8 rat osteosarcoma cells, HeLa human cervical
carcinoma cells, primary rat liver cells, and COS7 monkey kidney cells
were assayed by Southwestern blot using def sequences as the probe
(Fig. 8
). Significant levels of the
83-kDa protein were detected in every cell type examined. Thus, the
83-kDa factor appears to be widely expressed in many different cell
types and mammalian species.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 8. The 83-kDa Protein Is Present in Multiple Cell
Types
Nuclear extracts (20 µg protein) were separated by SDS-PAGE and
visualized by Southwestern blot analysis using radiolabeled
icerCARE3/4 as probe. Lane 1, WEHI7.2 murine thymoma
cells; lane 2, ROS17/2.8 rat osteosarcoma cells; lane 3, HeLa human
cervical carcinoma cells; lane 4, primary rat liver cells; lane 5, COS7
monkey kidney cells. The 83-kDa protein is denoted by the
asterisk.
|
|
 |
DISCUSSION
|
|---|
CRE-dependent transcription is mediated by members of the CREB/ATF
family of bZIP transcription factors that can be activated through
either Ca2+- or cAMP-mediated pathways (1, 2, 4, 5). We
reported previously on the convergence of cAMP- and
Ca2+-induced gene expression in WEHI7.2 thymocytes and
demonstrated that both agents lead to the phosphorylation of CREB and
subsequent activation of CRE-mediated transcription (7). Further
studies demonstrated that the steady-state level of ICER mRNA in
WEHI7.2 cells is increased after treatment with the cAMP-elevating
agent forskolin (8). This response is dependent upon CARE3/4 in the
ICER promoter. In the present report, we extended our examination of
Ca2+-regulated gene expression in WEHI7.2 cells and showed
that, despite having multiple CRE-like sequences in its promoter, the
ICER gene is not responsive to Ca2+. This would suggest
that the CAREs of the ICER promoter are unique in that they are
responsive to cAMP but not Ca2+. These results are in
agreement with Folco and Koren (19), who demonstrated that
depolarization had no effect on ICER mRNA levels in pituitary
GH3 cells and primary cardiocytes; however, the authors did
not examine the phosphorylation state of CREB in these cells under the
same conditions. Our results expand these observations and indicate
that CRE responsiveness to Ca2+ and cAMP can be
differentially regulated by the genetic context in which a CRE is
located, despite the fact that these two signaling pathways converge to
phosphorylate and activate CREB in these cells.
Other reports have described differences in Ca2+
responsiveness of CRE-linked gene expression attributable to
cell-specific differences in Ca2+-signaling pathways that
occur upstream of promoter activation. For example, Matthews et
al. (20) found that JEG-3 choriocarcinoma cells, which fail to
express CaMK IV, were unable to activate CREB or CRE-dependent
transcription in a Ca2+-dependent manner. Expression of
CaMK IV in these cells restored responsiveness. WEHI7.2 thymocytes
differ from JEG-3 cells in that CaMK IV is expressed in these cells
(our unpublished observations). Moreover, CREB is readily
phosphorylated and CRE-dependent transcription is activated when
Ca2+ becomes elevated in WEHI7.2 cells (7). Thus, an
alternative regulatory mechanism must be responsible for the
differences in CRE-dependent transcription in WEHI7.2 thymocytes.
Ca2+ might also differentially activate
Ca2+-responsive genes through complex promoters containing
multiple Ca2+-inducible regulatory elements. For example,
the c-fos promoter contains two distinct elements, the serum
response element (SRE) and the CRE, which both function to promote
Ca2+-regulated transcription of the c-fos gene
(21, 22, 23, 24). Hardingham et al. (25) reported that in pituitary
AtT20 cells, increases in cytoplasmic Ca2+ signal through
the activation of proteins that bind to the SRE, while nuclear
Ca2+ signals are required for activation through CREB
binding to the CRE (25). Deisseroth et al. (26) also
demonstrated that calcium flux acts both in the cytoplasm and the
nucleus to differentially activate transcription factors and gene
expression (26). It is possible that thapsigargin is activating
multiple Ca2+-dependent pathways in WEHI7.2 cells, as well.
However, in identifying minimal CRE-containing promoter fragments that
mimic the native promoter but do not contain binding sites for other
known factors, we were able to focus on the ability of CREB to activate
identical CREs located in different genetic contexts. Thus, the
contextual sequences in which a CRE exists provide another level of
regulation whereby convergent signals (Ca2+- and
cAMP-mediated activation of CREB) can lead to different transcriptional
responses.
We have identified by Southwestern blot analysis an 83-kDa protein that
is expressed in multiple cell types and binds to the CARE3/4 region of
the ICER promoter in a sequence-specific manner. Unlike many members of
the CREB/ATF family that are heat-stable (18), this protein is
sensitive to heat denaturation, and Western blot analysis confirms this
protein is distinct from CREB and ATF-2. This protein did not bind to
the gphCRE/CARE4 (n = 3) promoter fragment, a fragment
that confers Ca2+ responsiveness to a heterologous reporter
construct in WEHI7.2 cells. Moreover, binding was observed only with
the chimeric promoter constructs that were transcriptionally
unresponsive to Ca2+. Thus, the binding activity positively
correlated with the observed repression of Ca2+-mediated
transcription. These data suggest that the 83-kDa protein may function
as a sequence-specific repressor of Ca2+-induced
CRE-dependent transcription at the ICER promoter. The relative binding
activity of this factor to the chimeric gph/ICER promoter
constructs suggests that sequences that flank both sides of
icerCARE4 are important for maximal DNA binding and full
repressor activity. Comparison of icerCARE3/4 sequences with
DNA binding sites of known transcription factors failed to indicate any
likely candidates that might be the 83-kDa factor we have
identified.
The mechanism by which the CRE-associated repressor specifically blocks
Ca2+-induced ICER expression is unclear. Because CREB is
rapidly phosphorylated by cAMP and calcium, any model to explain the
differential regulation would presuppose the constitutive expression of
a responsible factor whose activity is regulated by one or both agents.
We propose four models by which such differential regulation could
occur in these cells: 1) Ca2+ inhibits ICER transcription
by increasing the DNA-binding affinity of a repressor and interferes
with CREB-mediated transcription of the ICER promoter. The repressor
could be activated directly by a calcium-dependent posttranslational
modification such as phosphorylation. An example of this is the
Ca2+-dependent repression of the PTH gene mediated by the
redox factor protein REF-1. Phosphorylation of REF-1 occurs in response
to increased extracellular Ca2+ and causes an increase in
the binding affinity to REF-1 inhibitory regulatory sequences in
promoter regions of specific genes (27). 2) The repressor might be
complexed in an inactive state and released from the complex by a
calcium-dependent event. This event would not increase the binding
affinity of the repressor; it would simply allow the repressor to be
freely available for binding to a DNA response element and
subsequently, to repress transcription. 3) The 83-kDa protein is a
transcriptional activator whose ability to induce CRE-linked gene
expression is regulated by cAMP but not Ca2+. This could
occur through the phosphorylation and activation of the factor by PKA
but not a CaMK IV (or another kinase activated in a calcium-dependent
pathway). The inactive protein would compete with CREB for binding to
the CARE4 region, thereby causing a reduction in
Ca2+/CREB-mediated transcription. Ca2+/CREB
could partially activate transcription of ICER by binding only to
CARE3. In the presence of cAMP, however, PKA-mediated activation of
both CREB (bound to CARE3) and the 83-kDa factor (bound to CARE4 and
flanking sequences) would allow for full activation of the ICER gene.
4) The repressor is constitutively bound to the ICER promoter, and cAMP
signals derepress ICER gene transcription by decreasing its binding,
thereby allowing activated CREB to induce transcription. Calcium would
be incapable of releasing repression. The Wilms tumor suppressor
(WT1) is a transcriptional repressor thought to function in a similar
fashion. Elevations in cAMP cause PKA to phosphorylate WT1, thereby
reducing its ability to bind WT-1 regulatory elements and repress
transcription (28, 29).
Our results suggest that the second model may be responsible for
differential regulation. First, cAMP-mediated transcription of ICER is
attenuated by Ca2+ (Fig. 2
), even though CREB is
phosphorylated under these conditions and capable of inducing
expression of other CRE-containing promoters (Fig. 2
and Ref. 7). This
would argue in favor of a calcium-dependent event repressing
CREB-mediated transcription (models 1 and 2). Second, treatment with
thapsigargin does not affect the binding activity of the 83-kDa protein
in a Southwestern blot. Because the first step of the Southwestern blot
is the denaturation and separation of proteins by SDS-PAGE, a
calcium-dependent release of the repressor from an inactive complex
(model 2) would not be detected by this assay. This is consistent with
our data and would argue against a calcium-dependent increase in
binding affinity (model 1). Determining the precise mechanism by which
Ca2+ blocks CREB-mediated transcription of the ICER gene
will provide fertile grounds for future research.
The Ca2+-mediated inhibition of CREB/CRE-dependent
transcription demonstrated by the ICER CAREs suggests that promoter
sequences can discriminate between converging cAMP and Ca2+
signals depending on the surrounding context in which the CRE is
located. This ability to respond differently could be an important
mechanism by which target genes are selectively activated by dissimilar
extracellular signals that utilize Ca2+ or cAMP as
intracellular second messengers. Further characterization and
identification of the 83-kDa protein may provide further insight into
the mechanism by which differential regulation of an element
occurs.
 |
MATERIALS AND METHODS
|
|---|
Materials
Thapsigargin was purchased from Alexis/LC Laboratories (San
Diego, CA), dissolved in dimethylsulfoxide, and stored at -80 C.
Forskolin was purchased from Sigma (St. Louis, MO),
dissolved in ethanol, and stored at -20 C.
Cell Culture
Murine WEHI7.2 thymoma cells were grown at 37 C, 6%
CO2, and 90% humidity in DMEM containing 10% calf bovine
serum, 0.063 g/liter penicillin, and 0.1 g/liter streptomycin.
Northern Blot Analysis
Northern blot analysis was performed as previously described
(8).
Construction of Reporter Plasmids
ptkCAT, CRE(2)tkCAT, ICER-CAT, CARE14tkCAT, and
CARE3/4tkCAT reporter plasmids have been described previously (8, 13).
These reporter constructs have been identified with gph and
icer subscripts in the present study to distinguish between
the genetic contexts of the CRE/CAREs. Briefly, ICER-CAT contains the
full ICER promoter inserted immediately upstream to the CAT reporter
gene. icerCARE14tkCAT and icerCARE3/4tkCAT
contain promoter fragments limited to the CARE14 and CARE3/4 regions
of the ICER promoter, respectively, inserted upstream to the minimal
thymidine kinase (tk) promoter and CAT gene of ptkCAT. The control
plasmid, gphCRE(2)-tkCAT, contains tandem CREs from the
human
-gph promoter inserted into ptkCAT.
gphCRE/CARE4 (n = 15), gphCRE/CARE4 (n
= 10), gphCRE/CARE4 (n = 6), and
gphCRE/CARE4 (n = 3) mutant promoters were constructed
with complimentary DNA oligonucleotides (Life Technologies, Inc., Gaithersburg, MD) corresponding to the listed sequence in
Fig. 4A
. These were then ligated into the ptkCAT vector. Chimeric
gphCRE/CARE4 (n = 3) and icerCARE3/4
promoter fragments were generated by Klenow extension of a 3'-reverse
primer (CGCCGGATCC) annealed to the following sense-strand
oligonucleotides:
ABf =
GACTCTAGAGGATCTAAATTGACGTCATATTGAT-GTCAGTGCTCGGATCCGGCG
AeC =
GACTCTAGAGGATCTAAATTGACGTCACTGTGA-TGTCATGGTAAGGATCCGGCG
Aef =
GACTCTAGAGGATCTAAATTGACGTCACTGTGA-TGTCAGTGCTCGGATCCGGCG
dBC =
GACTCTAGAGGATCGCTGGTGACGTCATATTG-ATGTCATGGTAAGGATCCGGCG
dBf =
GACTCTAGAGGATCGCTGGTGACGTCATATTG-ATGTCAGTGCTCGGATCCGGCG
deC =
GACTCTAGAGGATCGCTGGTGACGTCACTGTG-ATGTCATGGTAAGGATCCGGCG
Chimeric promoter fragments were then digested with BamHI
and XbaI and cloned into ptkCAT as before. The sequence of
all constructs was confirmed using Sequenase 2.0 (United States Biochemical Corp., Cleveland, OH) as directed by the
manufacturer.
Transient Reporter Expression Assays
WEHI7.2 cells were transfected by lipofection as described (8)
and treated with thapsigargin, forskolin, or a combination of the two
agents to induce CAT reporter gene expression. After incubation for the
indicated times, cell extracts were prepared and assayed for CAT
activity as described (30).
Southwestern Blot Analysis
WEHI7.2, HeLa, ROS17/2.8, and COS7 nuclear extracts were
prepared by the method of Shapiro et al. (31). Extracts from
WEHI7.2 cells used for experiments depicted in Figs. 6
and 7
were
prepared in the presence of phosphatase inhibitors (50 mM
NaF, 1 mM Na3VO4, and 5
mM ß-glycerophosphate). Rat liver nuclear extracts were
prepared by the method of Lichtsteiner et al. (32).
Twenty micrograms of protein were subjected to electrophoresis through
a 10% SDS-polyacrylamide gel and transferred overnight at 4 C to
Immobilon PVDF membrane (Millipore Corp., Bedford, MA).
For the heat-denatured sample, 20 µg of extract were incubated at 65
C for 10 min, after which precipitated proteins were removed by
centrifugation at 4 C and the remaining soluble proteins were subjected
to electrophoresis. Southwestern blotting was performed similar to the
method described by Hoeffler et al. (33). Briefly, after
transfer to PVDF membrane, proteins were renatured at room temperature
for 2 h with gentle agitation in 5% dry milk dissolved in TNE-50
renaturation buffer (10 mM Tris/HCl, pH 7.5, 50
mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol), after which the membrane was cut into individual
strips and probed with radiolabeled double-stranded DNA promoter
fragments. Hybridization was carried out at room temperature for 3
h in TNE-50 containing 10 µg/ml poly dI·dC competitor DNA
(Roche Molecular Biochemicals, Indianapolis, IN) and
106 cpm/ml probe. Blots were then rinsed in TNE-50 and
autoradiographed.
 |
ACKNOWLEDGMENTS
|
|---|
We acknowledge Drs. Pamela Mellon for graciously providing the
ptkCAT and pCRE(2)tkCAT reporter plasmids, Paolo Sassone-Corsi for
the CREM
cDNA, and Ali Shilatifard and Paul MacDonald for nuclear
extracts.
 |
FOOTNOTES
|
|---|
Address requests for reprints to authors current address: Diane R.
Dowd, Ph.D., Department of Pharmacology, Case Western Reserve
University, 10900 Euclid Avenue, Cleveland, Ohio 44106-4965.
This work was supported by NIH Grant AI-35910 (to D.R.D.).
Received for publication November 11, 1998.
Revision received April 5, 1999.
Accepted for publication April 7, 1999.
 |
REFERENCES
|
|---|
-
Montminy MR, Bilezikjian LM 1987 Binding of a nuclear
protein to the cyclic-AMP response element of the somatostatin gene.
Nature 328:175178[CrossRef][Medline]
-
Hoeffler JP, Meyer TE, Yun Y, Jameson JL, Habener JF 1988 Cyclic AMP-responsive DNA-binding protein: structure based on a cloned
placental cDNA. Science 242:14301433[Abstract/Free Full Text]
-
Sheng M, Thompson MA, Greenberg ME 1991 CREB: A
Ca2+-regulated transcription factor phosphorylated by
calmodulin-dependent kinases. Science 252:14271430[Abstract/Free Full Text]
-
Dash PK, Karl KA, Colicos MA, Prywes R, Kandel ER 1991 cAMP
response element-binding protein is activated by
Ca2+/calmodulin- as well as cAMP-dependent protein kinase.
Proc Natl Acad Sci USA 88:50615065[Abstract/Free Full Text]
-
Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G,
Deloulme JC, Chan G, Storm DR 1998 Cross talk between ERK and PKA is
required for Ca2+ stimulation of CREB-dependent
transcription and ERK nuclear translocation. Neuron 21:869883[CrossRef][Medline]
-
Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates
somatostatin gene transcription by phosphorylation of CREB at serine
133. Cell 59:675680[CrossRef][Medline]
-
Dowd DR, Ryerse JS, MacDonald PN, Miesfeld RL, Kamradt MC 1997 Crosstalk during Ca2+-, cAMP-, and
glucocorticoid-induced gene expression in lymphocytes. Mol Cell
Endocrinol 128:2937[CrossRef][Medline]
-
Mao D, Warner EA, Gurwitch SA, Dowd DR 1998 Differential
regulation and transcriptional control of immediate early gene
expression in forskolin-treated WEHI7.2 thymoma cells. Mol Endocrinol 12:492503[Abstract/Free Full Text]
-
Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative
promoter directs the expression of ICER, an early response repressor.
Cell 75:875886[CrossRef][Medline]
-
Morgan JI, Curran T 1986 Role of ion flux in the control of
c-fos expression. Nature 322:552555[CrossRef][Medline]
-
Sheng M, McFadden G, Greenberg ME 1990 Membrane depolorization
and calcium induce c-fos transcription via phosphorylation
of transcription factor CREB. Neuron 4:571582[CrossRef][Medline]
-
Qi XM, Simonson M, Distelhorst CW 1997 Bcl-2 inhibits
c-fos induction by calcium. Oncogene 15:284953[CrossRef][Medline]
-
Steger DJ, Altschmied J, Buscher M, Mellon PL 1991 Evolution
of placenta-specific gene expression: comparison of the equine and
human gonadotropin
-subunit genes. Mol Endocrinol 5:243255[Abstract/Free Full Text]
-
Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A, Nilson
JH 1987 Cyclic AMP regulation of the human glycoprotien hormone
-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad
Sci USA 84:21982202[Abstract/Free Full Text]
-
Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific
enhancer of the human glycoprotein hormone
-subunit gene: dependence
on cyclic AMP-inducible elements. Mol Cell Biol 7:39944002[Abstract/Free Full Text]
-
Drust DS, Troccoli NM, Jameson JL 1991 Binding specificity of
cyclic adenosine 3',5'-monophosphate-responsive element (CRE)-binding
proteins and activating transcription factors to naturally occurring
CRE sequence variants. Mol Endocrinol 5:15411551[Abstract/Free Full Text]
-
Benbrook DM, Jones NC 1994 Different binding specificities and
transactivation of variant CREs by CREB complexes. Nucleic Acids Res 22:14639[Abstract/Free Full Text]
-
Hoeffler JP, Lustbader JW, Chen C-Y 1991 Identification of
multiple nuclear factors that interact with cyclic adenosine
3',5'-monophosphate response element-binding protein and activating
transcription factor-2 by protein-protein interactions. Mol Endocrinol 5:256266[Abstract/Free Full Text]
-
Folco EJ, Koren G 1997 Degradation of the inducible cAMP early
repressor (ICER) by the ubiquitin-proteasome pathway. Biochem J 328:3743
-
Matthews RP, Guthrie CR, Wailes LM, Zhao X, Means A, McKnight
GS 1994 Calcium/calmodulin-dependent protein kinase types II and IV
differentially regulate CREB-dependent gene expression. Mol Cell Biol 14:61076116[Abstract/Free Full Text]
-
Sassone-Corsi P, Visvader J, Ferland L, Mellon PL, Verma IM 1988 Induction of proto-oncogene fos transcription through
the adenylate cyclase pathway: characterization of a cAMP-responsive
element. Genes Dev 2:15291538[Abstract/Free Full Text]
-
Sheng M, Dougan ST, McFadden G, Greenberg ME 1988 Calcium and
growth factor pathways of c-fos transcriptional activation
require distinct upstream regulatory sequences. Mol Cell Biol 8:27872796[Abstract/Free Full Text]
-
Bading H, Ginty DD, Greenberg ME 1993 Regulation of gene
expression in hippocampal neurons by distinct calcium signaling
pathways. Science 260:181186[Abstract/Free Full Text]
-
Ghosh A, Ginty DD, Bading H, Greenberg ME 1994 Calcium
regulation of gene expression in neuronal cells. J Neurobiol 25:294303[CrossRef][Medline]
-
Hardingham GE, Chawla S, Johnson CM, Bading H 1997 Distinct
functions of nuclear and cytoplasmic calcium in the control of gene
expression. Nature 385:260265[CrossRef][Medline]
-
Deisseroth K, Bito H, Tsien RW 1996 Signaling from synapse to
nucleus: postsynaptic CREB phosphorylation during multiple forms of
hippocampal synaptic plasticity. Neuron 16:89101[CrossRef][Medline]
-
Okazaki T, Chung U-I, Nishishita T, Ebisu S, Usuda S, Mishiro
S, Xanthoudakis S, Igarashi T, Ogata E 1994 A redox factor protein,
REF1, is involved in negative gene regulation by extracellular calcium.
J Biol Chem 269:2785527862[Abstract/Free Full Text]
-
Ye Y, Raychaudhuri B, Gurney A, Campbell CE, Williams BRG 1996 Regulation of WT1 by phosphorylation: inhibition of DNA binding,
alteration of transcriptional activity and cellular translocation. EMBO
J 15:56065615[Medline]
-
Sakamoto Y, Yoshida M, Semba K, Hunter T 1997 Inhibition of
the DNA-binding and transcriptional repression activity of the Wilms
tumor gene product, WT1, by cAMP-dependent protein kinase-mediated
phosphorylation of Ser-365 and Ser-393 in the zinc finger domain.
Oncogene 15:20012012[CrossRef][Medline]
-
Rouet P, Raguenez G, Salier J-P 1992 Optimized assays for
quantifying transient expressions of co-transfected ß-galactosidase
and CAT reporter genes. Biotechniques 13:700701[Medline]
-
Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A
high-efficiency HeLa cell nuclear transcription extract. DNA 7:4755[Medline]
-
Lichtsteiner S, Wuarin J, Schibler U 1987 The interplay of
DNA-binding proteins on the promoter of the mouse albumin gene. Cell 51:963973[CrossRef][Medline]
-
Hoeffler JP, Meyer TE, Waeber G, Habener JF 1990 Multiple
adenosine 3',5'-monophosphate response element DNA-binding proteins
generated by gene diversification and alternative exon splicing. Mol
Endocrinol 4:920930[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A. Inada, Y. Hamamoto, Y. Tsuura, J.-i. Miyazaki, S. Toyokuni, Y. Ihara, K. Nagai, Y. Yamada, S. Bonner-Weir, and Y. Seino
Overexpression of Inducible Cyclic AMP Early Repressor Inhibits Transactivation of Genes and Cell Proliferation in Pancreatic {beta} Cells
Mol. Cell. Biol.,
April 1, 2004;
24(7):
2831 - 2841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Mead, T. R. Hughes, S. A. Irvine, N. N. Singh, and D. P. Ramji
Interferon-gamma Stimulates the Expression of the Inducible cAMP Early Repressor in Macrophages through the Activation of Casein Kinase 2. A POTENTIALLY NOVEL PATHWAY FOR INTERFERON-gamma -MEDIATED INHIBITION OF GENE TRANSCRIPTION
J. Biol. Chem.,
May 9, 2003;
278(20):
17741 - 17751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Thommesen, E. Hofsli, R. H. Paulssen, M. W. Anthonsen, and A. Lagreid
Molecular mechanisms involved in gastrin-mediated regulation of cAMP-responsive promoter elements
Am J Physiol Endocrinol Metab,
December 1, 2001;
281(6):
E1316 - E1325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Krueger, E. A. Warner, and D. R. Dowd
Involvement of Thyrotroph Embryonic Factor in Calcium-mediated Regulation of Gene Expression
J. Biol. Chem.,
May 5, 2000;
275(19):
14524 - 14531.
[Abstract]
[Full Text]
[PDF]
|
 |
|