| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology, Metabolism, and Molecular Medicine Northwestern University Medical School Chicago, Illinois 60611
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-gene promoter is increased
markedly in transfected pituitary cells derived from animals treated
with estradiol. Because the cAMP response element binding (CREB)
protein plays an important role in the transcriptional regulation of
this promoter and is highly regulated by posttranslational
phosphorylation, we hypothesized that it might serve as a target for
estradiol-induced sensitivity to GnRH. In this study, we assessed the
roles of estradiol and GnRH in the regulation of CREB phosphorylation
in the rat pituitary. Using an antibody that specifically recognizes
phosphorylated CREB (pCREB), we found that the pituitary content of
pCREB was inversely related to the level of estradiol during the
estrous cycle. Ovariectomy increased the level of pCREB, and treatment
with estradiol for 10 days decreased the content of pCREB dramatically
(93% inhibition). A similar reduction of pCREB was seen when
ovariectomized rats were treated with a GnRH receptor antagonist for 10
days. This result indicates that the ovariectomy-induced increase in
pCREB is GnRH-dependent. In T3 gonadotrope cells,
estradiol had no direct effect on CREB phosphorylation, whereas GnRH
increased CREB phosphorylation 4- to 5-fold within 5 min. We conclude
that estradiol inhibits CREB phosphorylation in the gonadotrope,
probably by inhibiting GnRH production. The estradiol-induced decrease
in CREB phosphorylation is proposed to lower basal
-promoter activity and increase its responsiveness to
GnRH. (Molecular Endocrinology 13: 1338–1352, 1999) |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, LHß, and FSHß) genes is regulated differentially by
GnRH pulse frequency (5, 6, 7, 8).
GnRH initiates intracellular signaling in gonadotropes by binding to
its seven-transmembrane G protein-coupled receptor, activating
phospholipase C and leading to the formation of inositol
1,4,5-triphosphate and diacylglycerol (9, 10, 11). Inositol
1,4,5-triphosphate causes the release of intracellular
Ca2+, which, together with diacylglycerol, activates
protein kinases (9, 10, 12). GnRH also activates other signaling
pathways. The protein kinase C (PKC) pathway appears to play a central
role in the transcriptional regulation of the -promoter by GnRH
(9, 10, 11, 13). When T3 cells are pretreated with
phorbol-12-myristate-13-acetate to deplete PKC, GnRH stimulation
of the -promoter is inhibited (14, 15). PKC may also activate other
kinases, such as mitogen-activated protein kinase (MAPK) (16, 17).
In addition to GnRH, steroids from the gonads regulate the synthesis and secretion of gonadotropins. The mechanisms of feedback regulation by sex steroids are complex and include effects at both the hypothalamic and pituitary levels. During the female reproductive cycle, estradiol secreted on diestrus is thought to stimulate GnRH secretion and potentiate the responsiveness of the pituitary gland to GnRH, providing part of the basis for the LH surge (18, 19, 20, 21, 22, 23). In addition to this positive feedback of estradiol during the reproductive cycle, chronic exposure to estradiol exerts an inhibitory effect. For example, ovariectomy increases, and estradiol replacement restrains, both LH pulse frequency and amplitude (24, 25, 26, 27, 28). In parallel, the mRNA levels of LHß and FSHß markedly increase after ovariectomy, and estrogen treatment suppresses gonadotropin mRNAs (29, 30, 31, 32).
Recently, we found that estradiol has profound effects on the degree of
GnRH stimulation of human -promoter activity in transfected
pituitary cells (33). The basal activity of the -promoter was
consistently reduced in females compared with males. On the other hand,
-promoter activity was stimulated more than a 100-fold by GnRH in
cells derived from female pituitaries, whereas only a 5- to 10-fold
stimulation was seen in cells from males (33). Further studies
indicated that these sex-specific differences in GnRH responsiveness
are largely accounted for by estradiol, and not testosterone, since the
chronic administration of estradiol to ovariectomized females or
castrate males restored GnRH responsiveness and reduced the basal
activity of the -promoter (33). Although -promoter activity is
dramatically affected by estrogen, the mechanism of this effect is not
clear. No high-affinity estrogen receptor-binding sites have been
identified in the -promoter (34), suggesting that estrogen
regulation may involve other proteins, or that it may be indirect.
The regulatory elements in the human -promoter have been well
characterized (13, 35, 36). Several different regions of this promoter
appear to be involved in GnRH responsiveness (13, 16, 37, 38).
Deletions or mutations of sequences between -346 and -244 bp reduce,
but do not eliminate, GnRH responsiveness (37, 38). This region
includes binding sites for proteins that are regulated by the MAPK
pathway, which is stimulated by GnRH (10, 16, 17, 38). Mutations in the
two cAMP response elements (CREs), which provide binding sites for
transcription factor CREB (CRE-binding protein) (13, 35),
greatly reduce the basal activity of the -promoter (39, 40, 41) and may
also be involved in GnRH responsiveness. The role of the CREs in GnRH
regulation has not been fully defined, however, because the activity of
the promoter is greatly reduced by mutations of these sites. Because
the CREs play a critical role in the regulation of the -promoter,
CREB is a potential candidate for regulation by GnRH signaling
pathways. CREB contains several consensus phosphorylation sites for
various kinases (42), and phosphorylation at serine 133 (Ser-133) is
necessary for its transcriptional activation (43, 44, 45). Ser-133 can be
phosphorylated by protein kinase A (46, 47), PKC (48), calcium
calmodulin-dependent kinase (CaMK) II (49, 50), CaMKIV (51, 52),
extracellular signal-regulated kinase (ERK), and p38 MAPK (53).
Estrogen has been reported to stimulate adenylate cyclase and
cAMP-mediated gene transcription in human breast cancer cells, prostate
cells, and rat uterine cells (54, 55, 56). Moreover, estrogen has been
found to stimulate CREB phosphorylation at Ser-133 in rat brain (57, 58) and to enhance the expression of the neurotensin gene, which lacks
estrogen response elements (EREs), but contains CREB recognition sites
(59). Based on these findings, we hypothesized that CREB might be a key
target for estradiol effects in gonadotrope cells and thereby modulate
-promoter activity. In the present study, we investigated the
potential roles of estradiol and GnRH in the modulation of pituitary
CREB phosphorylation in vitro and in vivo.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-Promoter-promoter when it is
introduced into pituitary cells from male or female rats (33). An
example of this phenomenon is shown in Fig. 1A
. When the -420-Luc reporter
gene was transfected into pituitary cells derived from male or randomly
cycling female rats, basal -promoter activity was 25% lower in the
pituitary cells from females compared with males. However, cells from
female rats showed a greater response to GnRH treatment (200-fold) in
comparison to the GnRH response of male pituitary cells (10-fold) (Fig. 1A).
|
-promoter is strongly dependent on its
CREs (13), we tested whether the deletion of the CREs or expression of
a dominant negative mutant (Ser-133 Ala) of CREB (60) would alter basal
activity and GnRH responsiveness of the -promoter. Pituitary cells
from randomly cycling female rats were transfected with -846-Luc or
-846-Luc
CRE, in which both copies of CREs have been removed.
Deletion of the CREs caused a marked reduction (62–82%) in basal
expression and a 70–86% decrease in GnRH-induced activity of the
-promoter. However, the fold of induction by GnRH remained similar
(Fig. 1B
). Coexpression of the dominant negative form of CREB
also markedly reduced basal -promoter activity (80% inhibition) and
almost eliminated GnRH responsiveness (Fig. 1C), whereas expression of
wild-type CREB had no effect on -promoter activity (data not shown).
Similar results were obtained when the dominant negative CREB mutant
was expressed in T3 cells (data not shown).
Pituitary Phosphorylated CREB Content Varies during the Estrous
Cycle
In view of the importance of the CREB for -promoter activity,
we hypothesized that changes in CREB phosphorylation might underlie the
estrogen-dependent effects on basal and GnRH responsiveness of the
-promoter. As an initial effort to address this question, the amount
of phosphorylated CREB (pCREB) was assessed in the pituitaries of male
and female rats, and at different stages of the estrous cycle (Fig. 2). Pituitaries from three to four
animals were homogenized and subjected to Western blot analysis using
an antibody specific for the Ser-133-phosphorylated form of CREB. As a
control, duplicate blots were analyzed in parallel with an antibody
recognizing total CREB. The pituitary content of pCREB varied widely
during the estrous cycle. pCREB was greatest at metestrus (120% of
male) and diestrus (86% of male), but was much lower during proestrus
(46% of male) and estrus (56% of male). The amount of total CREB
remained relatively constant during the cycle and was used to normalize
the level of phosphorylated CREB (pCREB/CREB). Thus, the level of pCREB
in male rats was similar to that of metestrus and diestrus females, and
the phosphorylation of CREB during the estrous cycle appears to vary
inversely with estradiol levels (data not shown).
|
). Pituitary glands were fixed in
situ to minimize alterations in phosphorylation during tissue
preparation. Using the LHß antibody, strong cytoplasmic staining was
seen in a subset of cells (Fig. 3B). pCREB staining, of variable
intensity, was seen in the nuclei of the majority of pituitary cells
(Fig. 3D). Weak background cytoplasmic staining is seen in the absence
of pCREB antibody (Fig. 3C). Colocalization of nuclear pCREB and
cytoplasmic LHß was seen in the majority of LHß-positive cells
(Fig. 3E). However, pCREB staining is also seen in LHß-negative
cells, indicating that CREB is phosphorylated in both gonadotrope and
nongonadotrope cells.
|
). As there
was variability in the level of pCREB in different animals, we
processed pituitaries individually. As shown in Fig. 4, replacement of
estradiol decreased the level of pCREB in the pituitary dramatically,
and pCREB was almost undetectable after 10 days of treatment. By
comparison, the level of total CREB decreased only slightly. These
results are quantitated in the bottom panel, in which the
level of pCREB is adjusted for changes in total CREB. Compared with Ovx
rats, estradiol decreased pCREB to 49%, 21%, and 7% after 3, 5, and
10 days, respectively.
|
),
ovariectomy increased pCREB (Fig. 5).
However, all four rats that received the GnRH receptor antagonist
exhibited substantially reduced levels of pCREB (16% of Ovx), similar
to the effect seen in the estradiol-treated rats. The amount of total
CREB was not affected by administration of the antagonist. Serum levels
of LH and FSH in azaline B-treated rats were lower than in the control
group (Fig. 5), confirming that the azaline B injection was effective.
These data suggest that GnRH input is required for ovariectomy-induced
CREB phosphorylation. Because the effects of GnRH are mediated
predominantly in gonadotrope cells, these findings also suggest that
gonadotropes are a major target of estradiol-induced changes in CREB
phosphorylation.
|
). Withdrawal of estradiol, which is
expected to increase GnRH output, increased serum LH and FSH (Fig. 6B).
In association with these changes, the decreased levels of serum
estradiol reversed the suppression of pCREB (70% of Ovx) (Fig. 6A).
There was no significant difference in the level of pCREB between the
estradiol-treated group (12% of Ovx) and the estradiol plus azaline
B-treated group (10% of Ovx, Fig. 6), suggesting that estradiol does
not have an additional inhibitory effect on pCREB. These results
support the idea that the suppressive effect of estradiol on pCREB is
indirect, probably resulting from inhibition of GnRH production.
|
).
However, serum LH levels increased markedly after the administration of
pulsatile GnRH, confirming that it stimulated gonadotropin secretion
(Fig. 7).
|
T3 gonadotrope cells were maintained in phenol
red-free media with charcoal-stripped serum for 48 h and then
treated with estradiol for various time intervals. Nuclear extracts
were prepared and Western blot analyses were performed using anti-pCREB
or anti-CREB antibodies. There was no effect of estradiol on CREB
phosphorylation, or CREB content, when cells were treated with
estradiol from 5 min to 4 h (Fig. 8A). Similar results were obtained with
T47D estrogen-responsive breast cancer cells or primary cultures of
pituitary cells (data not shown).
|
). In
addition, cAMP stimulated GAL4-CREB activity (Fig. 8B). In contrast,
estradiol failed to activate GAL4-CREB, consistent with the absence of
an estradiol effect on pCREB protein levels in these cells.
GnRH Stimulates CREB Phosphorylation in Vitro
T3 cells were treated with GnRH to examine whether it alters
CREB phosphorylation in gonadotrope cells. GnRH increased the level of
pCREB 4- to 5-fold within 5 min, and this level of phosphorylation was
sustained for at least 4 h. The total amount of CREB was unchanged
throughout this time course (Fig. 9). The
lower band detected with the pCREB antibody in these cells may
represent another b-Zip family member, or a degradation product of
CREB. Similarly, GnRH increased CREB phosphorylation in 293 cells that
were stably transfected with the GnRH receptor (data not shown). To
determine whether long-term pretreatment with estradiol affects
GnRH-induced CREB phosphorylation, T3 cells were treated with
estradiol for 5 days and then exposed to GnRH for 15 min. Pretreatment
with estradiol for 5 days did not alter CREB phosphorylation in
response to GnRH (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-promoter
after it has been transfected into primary cultures of pituitary cells.
These experiments revealed that estradiol suppresses basal -promoter
expression, but it dramatically enhances GnRH responsiveness of the
-promoter (33). Several aspects of this model warrant comment. The
effects of in vivo administration of estradiol persist in
the pituitary cells, despite the fact that they are cultured in
vitro for several days before the luciferase assays are performed.
Treatment with estradiol in vitro did not alter -promoter
activity. Long-term (7–10 days) in vivo treatment was
necessary to see the estradiol effect. This combination of observations
led us to consider the possibility that estradiol treatment was
altering the expression or activity of a factor involved with the
modulation of pituitary sensitivity to GnRH. CREB phosphorylation was
considered as a likely step in such a pathway, since CREB is known to
be a critical factor involved in the regulation of -promoter
transcription.
When we began these studies, existing data suggested the possibility
that estradiol might stimulate pituitary CREB phosphorylation or
enhance GnRH-mediated CREB phosphorylation. For example, acute
estradiol treatment (15–30 min) of Ovx rats rapidly enhances CREB
phosphorylation in brain (57, 58, 59). Based on this observation, we tested
whether CREB phosphorylation varied during the estrous cycle,
anticipating that it might be greatest during proestrus, when estradiol
levels are high. Unexpectedly, the level of pCREB in the pituitary was
inversely related to estradiol during the estrous cycle. It was
greatest in metestrus and diestrus, and lowest in proestrus. This
inverse relationship between the level of estradiol and the level of
pCREB was supported by the finding that pCREB was relatively high in
males and increased in females after ovariectomy. Lastly, replacement
of estradiol in Ovx rats caused a striking decrease in the level of
pCREB. Interestingly, the reduction of pCREB required long-term
treatment of at least 5 days, which is reminiscent of our previous
findings using -promoter activity as an indicator of the estradiol
effect (33).
Based on the long time course required for the estradiol effect and the observation that estradiol reduces, rather than enhances, CREB phosphorylation, we considered the possibility that estradiol might act indirectly by inhibiting input from hypothalamic GnRH (24, 63). Azaline B, a competitive antagonist of the GnRH receptor (61), was used to test this hypothesis. Treatment with azaline B reduced pCREB in Ovx rats to a level that was similar to that seen in estradiol-treated rats. The serum levels of LH and FSH were also measured in these experiments to assess the effectiveness of the GnRH antagonist. Suppressed levels of LH and FSH were seen, as expected, except in one rat. It is notable that in the rat with higher levels of LH and FSH, and incomplete blockade by azaline B, there was a greater level of pCREB in the pituitary.
Removal of the estradiol pellet for 4 days increased the level of
pCREB, and this effect paralleled the increase in serum LH and FSH.
These findings strengthen the notion that the lower amount of pCREB in
estradiol-treated rats is likely the result of reduced GnRH input. If
this is true, then it should be possible to reverse the effect of
estradiol treatment by the administration of exogenous GnRH. This
experiment was attempted in two different protocols. First, GnRH was
administered acutely (four pulses over 2 h) to
estra-diol-treated rats, and CREB phosphorylation was determined 20
min after the last injection. Although LH and FSH levels increased
dramatically after the injection of GnRH, the level of pCREB was not
increased. In a second paradigm, pulsatile GnRH was administered hourly
over a 6- or 24-h period, but again there was no change in the level of
pCREB. These findings raise the possibility that estradiol might have
additional direct effects on the pituitary. In fact, it has been
reported that pulses of GnRH are unable to override the inhibitory
effect of estradiol on -subunit mRNA levels (66). Estradiol may
alter the production of other hypothalamic factors that are required
for GnRH-dependent CREB phosphorylation. Alternatively, and perhaps
most likely, longer treatment with pulsatile GnRH, or the use of
different pulse frequencies, may be required to prime pituitary
responses to GnRH (67, 68).
It is intriguing that in a transgenic mouse model in which there is
overexpression of the LHß subunit gene and increased estradiol
levels, endogenous LHß gene expression is responsive to steroid
feedback, whereas the -subunit gene is resistant to estradiol
feedback and to regulation by GnRH (69). The level of CREB in the
pituitaries of these mice is increased dramatically (69). Our finding
that pCREB plays a critical role in the regulation of the -promoter
activity by GnRH and estradiol may relate to these findings. The
persistently higher level of CREB in these transgenic mice may
contribute to a state of GnRH- and estradiol-independent expression of
the -promoter.
The observation that the GnRH antagonist, azaline B, substantially reduces pCREB in the pituitary argues that much of the pCREB detected in these experiments is derived from GnRH-responsive cells. It is somewhat surprising that estradiol and azaline B have such pronounced effects on the level of pCREB in whole pituitaries since the gonadotropes comprise only about 14% of pituitary cells (70, 71). CREB is a ubiquitously expressed protein and CREB phosphorylation has been documented in somatotropes (60, 72) and lactotropes (73, 74). In experiments using double-label immunocytochemistry (LHß and pCREB), we found that pCREB is present in both gonadotrope and nongonadotrope cell types in the pituitary. It is possible that estradiol has direct effects on several pituitary cell types. In addition, GnRH receptors have been found on cells other than gonadotropes (75, 76), raising the possibility that CREB phosphorylation in some of these cells might be GnRH dependent. GnRH has also been demonstrated to act indirectly on nongonadotrope cells (77). It is also possible that gonadotropes comprise a population of cells that are particularly responsive to changes in CREB phosphorylation. Further studies of dynamic changes in phosphorylation with double- label immunohistochemical analysis in specific cell types will be necessary to address this issue.
Consistent with the in vivo data suggesting that estradiol
is acting indirectly, via GnRH, to modulate the state of CREB
phosphorylation, we did not observe direct effects of estradiol on CREB
phosphorylation in vitro. For example, treatment of T3
cells with estradiol from 5 min to 4 h did not change the level of
pCREB. Similar results were seen in primary cultures of pituitary cells
(data not shown). Furthermore, transient transfection experiments with
estrogen-responsive T47D cells confirmed the lack of a direct
stimulatory effect of estradiol on CREB phosphorylation. These findings
raise the possibility that some of the acute estradiol effects in the
brain (57, 58, 59) might also be indirect, perhaps reflecting the release
of neurotransmitters that in turn alter the state of CREB
phosphorylation (78, 79, 80, 81).
In light of data suggesting that GnRH input is critical for
estradiol-induced changes in pCREB, we used T3 gonadotrope cells to
further explore the direct phosphorylation of CREB by GnRH. As
expected, GnRH stimulated CREB phosphorylation by 4- to 5-fold within 5
min. Although the PKC and calcium pathways, among others, have been
shown to mediate many of the downstream effects of GnRH (9, 10), it
remains to be determined which of the many potential signaling pathways
that are involved in CREB phosphorylation (46, 48, 49, 50, 51, 52, 53) might be
affected by GnRH.
These results emphasize the importance of identifying other
transcription factors and DNA sequences in the -promoter that are
regulated by GnRH. In our experience, these experiments are difficult
to interpret in T3 cells because GnRH treatment of these cells
stimulates the activity of most reporter genes, including many control
promoters that are not expected to be GnRH responsive (our
unpublished data). For this reason, we performed analyses of GnRH
responsiveness in primary cultures of pituitary cells, even though
transfection efficiency and the level of expression is relatively low.
In these cells, GnRH stimulates the -promoter, but it does not
activate control promoters (33). Mutation of the CREs in the
-promoter greatly reduced basal activity, as expected. However, it
was still possible to detect GnRH responsiveness, indicating that the
CREs are not essential for at least part of the GnRH response. However,
because basal activity is greatly reduced by the CRE deletion, the
absolute level of promoter activity after GnRH stimulation is greatly
diminished. These findings underscore the importance of distinguishing
effects on basal and GnRH-stimulated activity. In contrast, a dominant
negative mutant of CREB blocks both basal activity and GnRH
responsiveness. The more potent inhibition by mutant CREB in comparison
to deletion of the CREs raises the possibility that the mutant
transcription factor exerts a more general effect to impair the
assembly of an active transcription complex. Clearly, additional
studies are needed to further localize GnRH response elements in this
promoter and to characterize cognate transcription factors at these
sites.
In conjunction with previous data, these findings suggest that multiple
transcription factors and regulatory elements may be involved in GnRH
regulation of the -promoter (13, 37, 38). As noted above, GnRH
activates several limbs of the MAPK cascade as well as the protein
kinase C- and calcium-signaling pathways. Similar to the findings with
the CRE mutations, inhibition of the MAPK pathway greatly reduces the
basal activity of the -promoter with little effect on the degree of
GnRH stimulation (15, 16, 38). Therefore, it seems likely that GnRH
signaling to the -promoter is redundant, perhaps involving several
different transcription factors that are modified by GnRH-induced
kinase pathways. It also appears that transcription factors involved in
the GnRH response may be coupled to basal expression of the promoter.
For example, several pathways might converge on CREB to establish a
"basal" level of expression that can be modulated further by GnRH
or other hormonal signals that stimulate kinase pathways. In this
respect, it is interesting to note the inverse relationship between
estradiol suppression of basal promoter activity and the apparent
enhancement of GnRH responsiveness (e.g. female pituitary
cells) (15, 33). One explanation for this phenomenon is that estradiol
suppresses GnRH input, leading to decreased CREB phosphorylation and
reduced basal promoter activity. In this context, restoration of GnRH
input in vivo may exert its greatest effect on basal
promoter activity, with the consequence that fold-stimulation by
subsequent administration of GnRH in vitro is reduced.
In conclusion, we find that the chronic administration of estradiol in
Ovx rats produces an inhibitory effect on CREB phosphorylation in the
pituitary. Estradiol inhibition of CREB phosphorylation appears to be
mediated indirectly by a decrease in GnRH production in the
hypothalamus. GnRH directly stimulates CREB phosphorylation at Ser-133
in gonadotrope cells. Based on these findings, we postulate that the
estradiol-induced decrease in pCREB lowers -promoter activity and
accounts for the relatively low level of basal promoter activity in
females (33). In addition, the reduced basal level of CREB
phosphorylation may sensitize the pituitary to GnRH, as there would be
more CREB phosphorylation sites available to respond to the GnRH
signal.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Rats were Ovx bilaterally 10–12 days before the experiments involving the effect of estradiol on CREB phosphorylation. Animals were lightly anesthetized with metofane and received 17ß-estradiol-filled SILASTIC implants subcutaneously (Dow Corning Corp., Midland, MI; id, 0.062 inches; od, 0.125 inches; 5 mm in length) for 3, 5, or 10 days. In one group of rats, estradiol capsules were removed after 7 days of implantation to assess the reversibility of the estrogen effects. In this case, rats were killed 4 days after the removal of estradiol.
In estradiol-treated rats, GnRH pulses (50 µg/pulse) were given every 30 min ip for 2 h and by tail vein injection (the last pulse). In addition, estradiol-treated rats were anesthetized and a catheter was inserted into the right carotid artery and connected to an infusion pump. GnRH pulses (100 ng/pulse every hour) were administered manually through carotid arterial catheters for 6 or 24 h. LH and FSH levels were measured by obtaining serum samples 20 min after the last GnRH injection.
In the experiments that involved the GnRH receptor antagonist, rats were ovariectomized bilaterally for 10–12 days and the antagonist, azaline B, was injected once (400 µg sc/rat in 0.2 ml sesame oil) (61). The control group received sesame oil only. Rats were killed 10 days after azaline B treatment. Azaline B was also given to a group of animals that received estradiol pellets on the same day. Rats were killed by decapitation. Anterior pituitary glands were rapidly removed and frozen with dry ice. Blood was collected for subsequent measurements of LH, FSH, and estradiol by RIA.
Immunocytochemistry
Random cycling female rats were anesthetized with sodium
pentobarbitol (50 mg/ml; 60 mg/kg of body weight) and perfused with 600
ml 4% paraformaldehyde solution at room temperature for 1 h. The
pituitaries were immediately removed and placed in 4% paraformaldehyde
solution for 1 h at 4 C, and then transferred to 30% sucrose in
0.01 M sodium phosphate buffer overnight at 4 C. The
tissues were embedded in mounting media optimum cutting
temperature compound (Tissue Tek II, Miles, Elkhart, IN)
and quickly frozen in dry ice-acetone. Cryostat sections (5 µm) were
mounted on vectabond-coated slides and stored at -70 C. For
immunocytochemistry, slides were equilibrated at room temperature, and
then washed three times with cold washing buffer (0.01 M
TBS with 0.4% Triton X-100) for 15 min each. Before incubation with
primary antibody, the slides were blocked with 10% normal goat serum
(in 0.01 M TBS buffer with 1% BSA, 0.4% TX-100) for
1 h at room temperature. The guinea pig antirat LHß primary
antibody (NIDDK, AFP-22238790GPOLHB) was preincubated with control
tissue (cerebral cortex from the same rat at 4 C for 1 h) to
reduce nonspecific binding of the antibody. Slides were then incubated
with the anti-LHß antibody (1:1000) and/or rabbit antirat pCREB
antibody (1:100) (Upstate Biotechnology, Inc., Lake
Placid, NY) in a 0.01 M TBS buffer containing 1% goat
serum, 1% BSA, and 0.5% Triton X-100 for 1.5 h at room
temperature. Slides were rinsed through six changes of cold washing
buffer for 1 h at room temperature. Immunoreactivity was
subsequently detected using fluorescein isothiocyanate-conjugated goat
antiguinea pig antibody (Sigma Chemical Co., St. Louis,
MO) to detect LHß, and rhodamine-conjugated goat antirabbit antibody
(Pierce Chemical Co., Rockford, IL) to detect pCREB, both
diluted to 1:200 in a TBS buffer containing 1% goat serum, 1% BSA,
and 0.4% Triton X-100. Sections were washed four times for 1 h
each with cold washing buffer and dried in a vacuum dessicator for 15
min. Drops of aqueous mounting media (Mowiol, DAKO Corp., Carpinteria, CA) were used to mount the coverslips, which
were sealed with clear nail polish and allowed to dry for 15 min.
Single or double-labeled cells (gonadotropes and pCREB containing
cells) were photographed after single or double exposures using a
Fluorescent Axiokop microscope (Carl Zeiss, Thornwood, NY)
and Ektachrome 400 daylight film.
Tissue and Cell Cultures, Transfections, and Luciferase
Assays
Pituitary glands were excised from male and random cycling
female rats. The anterior lobes were cut into 15–20 small pieces.
Fragments were rinsed twice in incomplete PBS (2.7 mM KCl,
1.2 mM K2HPO4, 138 mM
NaCl, and 8.1 mM Na2HPO4, pH 7.1),
digested for two 15-min periods in a solution containing 0.125%
trypsin (TRLS, Worthington Biochemical Corp., Freehold,
NJ) in PBS, followed by a 2-min digestion in a solution containing 10
U/ml deoxyribonuclease I (Sigma Chemical Co.). Cells were
then incubated for 10 min in a 0.125% collagenase solution (type IV,
Sigma Chemical Co.) before being dispersed mechanically by
pipetting. Cells were resuspended in DMEM with 10% FBS, 100 U/ml
penicillin, 50 µg/ml streptomycin, and 2.5 µg/ml Fungizone
(Biologos, Naperville, IL), and then plated in 24-well dishes.
After recovery for 40 h in DMEM with 1% FBS, cells were
transfected with 10–20 µg/well DNA using the calcium phosphate
precipitation technique (33). The -Luc reporter gene contains either
846 or 420 bp of 5'-flanking sequence and 44 bp of exon 1 of the human
glycoprotein -subunit gene linked to the firefly luciferase gene in
the plasmid pA3 luc. In the -846-LucCRE construct, both copies
of the CRE (TGACGTCATGGTAAAAATTGACGTCA) were removed and substituted
with a SpeI site (ACTAGT). The DNA sequence was confirmed by
sequencing. The cells were also cotransfected with the -846-Luc and
either wild-type human CREB or mutant CREB in which Ser-133 was
substituted with alanine (kindly provided by Dr. Jeffrey Leiden,
University of Chicago). As a control, cells were also transfected with
the -846-Luc and the empty expression vector pCMX. Cells were
exposed to the DNA precipitate for 6 h. After 24-h treatment with
or without 10 nM GnRH analog (Des-Gly10,
[D-Ala6] GnRH ethylamide; Sigma Chemical Co.; hereafter referred to as GnRH), cells were
harvested for luciferase assays by adding 0.5 ml/well lysis buffer
[1% Triton X-100 in 25 mM glycylglycine buffer, 15
mM MgSO4, 4 mM EGTA, and 1
mM dithiothreitol (DTT), pH 7.8]. Luciferase assays were
performed by adding 0.3 ml cell extract to 0.4 ml luciferase buffer (25
mM glycylglycine, 15 mM MgSO4, 4
mM EGTA, 1 mM DTT, 16 mM potassium
phosphate, and 2 mM ATP, pH 7.8). The reactions were
performed at room temperature using an AutoLumat LB 953 luminometer
(EG&G Instruments, Oak Ridge, TN). Luciferase activity was determined
by measuring the light emitted during the initial 30 sec of the
reaction. The values are expressed in relative light units.
T3 cells were grown to about 80% confluency in DMEM/F12 with 10%
FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin in 10-cm plates.
In experiments that involved estrogen, cells were maintained in
estrogen-depleted medium for at least 48 h. 17ß-estradiol
(1 nM, Sigma Chemical Co.) or GnRH (10
nM) was added to cells for various time intervals. Cells
were washed with ice-cold PBS and harvested with 5 ml PBS+
(PBS, 1 mM EDTA and 1 mM phenylmethylsulfonyl
fluoride and 1 mM DTT). Nuclear extracts were prepared by
the Shapiro method (82) modified by the addition of a protease
inhibitor, Complete (Roche Molecular Biochemicals,
Indianapolis, IN) and 25 mM NaF.
T47D cells were maintained in RPMI 1640 medium supplemented with 10% FBS, nonessential amino acids, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. Cells were switched to an estrogen-depleted medium containing charcoal-stripped serum and no phenol red 5 days before transfection by electroporation with a single pulse at 300 V and 960 µfarads. Cells in 12-well plates were transfected with 1 µg UAS-TK-luc (containing two copies of GAL4 recognition sequence, UAS, upstream of TK) and 0.25 µg GAL4-ER (containing the GAL4 DNA-binding domain and the human estrogen receptor EF domains) or GAL4-CREB (containing the GAL4 DNA-binding domain and the human CREB transactivation domain). After exposure to 17ß-estradiol (1 nM) or 8-bromo-cAMP (1 mM, Sigma Chemical Co.) for 48 h, cells were harvested for luciferase assays as described above.
Western Blot Analysis
Anterior pituitaries were homogenized in a solution (0.9
M NaCl, 50 mM Na2HPO4,
2.5 mM EDTA, 20 mM NaF, 1 mM
phenylmethylsulfonyl fluoride, and 50 mM HEPES-Tris, pH
7.4) containing the complete protease inhibitor cocktail (Roche Molecular Biochemicals). Equal amounts of total pituitary
homogenate proteins (30 µg) or nuclear extracts (15 µg) were
resolved by 10% SDS-PAGE and transferred onto nitrocellulose filters.
In each experiment, duplicate membranes were prepared. The membranes
were incubated with 3% nonfat milk in PBS for 1.5 h and then
incubated overnight at 4 C with rabbit polyclonal antibodies against
either total CREB or Ser-133-phosphorylated CREB (Upstate Biotechnology, Inc., Lake Placid, NY). Immunoreactive proteins
were detected using an antirabbit horseradish peroxidase-conjugated
antibody and the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Arlington Heights, IL). Bands were detected
with Kodak (Rochester, NY) X-Omat film and quantitated
using a GS-700 Imaging Densitometer (Bio-Rad Laboratories, Inc., Hercules, CA).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
This work was conducted as a part of the National Cooperative Program on Infertility Research and was supported by NIH Grants U54-HD-29164 and RO3 HD-36391. RIAs were performed by the P30 RIA core facility (NIH Grant HD-28048). Rachel Duan is a recipient of NIH Fellowship Award HD-08311 and Jennifer Shin received a summer fellowship grant from The Endocrine Society.
Received for publication December 15, 1998. Revision received April 21, 1999. Accepted for publication May 3, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
T3 gonadotrope cells. Endocrinology 134:568–573T3–1 cell line:
differential roles of calcium and protein kinase C. Endocrinology 138:1673–1682 subunit and luteinizing hormone ß genes in the
ovine anterior pituitary. Estradiol suppresses accumulation of mRNAS
for both subunit and luteinizing hormone ß. J Biol Chem 258:12087–12090-subunit
messenger ribonucleic acid by gonadotropin-releasing hormone and
estrogen in the sheep pituitary. Neuroendocrinology 50:321–326[CrossRef][Medline]
-subunit gene
despite the absence of a high affinity binding site for estrogen
receptor. Mol Endocrinol 5:725–733-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad
Sci USA 84:2198–2202-subunit promoter. Mol Endocrinol 6:1767–1773-subunit promoter by
gonadotropin-releasing hormone. Mol Cell Biol 15:3531–3539[Abstract]
-subunit
gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002 gene transcription is directed
by a repeated 18-base pair enhancer. -Promoter receptivity to the
enhancer confers cell-preferential expression. J Biol Chem 262:
12169–12174
-subunit gene occurs through several distinct mechanisms. Mol
Endocrinol 4:573–582This article has been cited by other articles:
 |
|
 |
|
  C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Sasson, S. H. Luu, V. G. Thackray, and P. L. Mellon Glucocorticoids Induce Human Glycoprotein Hormone {alpha}-Subunit Gene Expression in the Gonadotrope Endocrinology, July 1, 2008; 149(7): 3643 - 3655. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs J. Endocrinol., March 1, 2008; 196(3): 497 - 507. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kowase, H. E. Walsh, D. S. Darling, and M. A. Shupnik Estrogen Enhances Gonadotropin-Releasing Hormone-Stimulated Transcription of the Luteinizing Hormone Subunit Promoters via Altered Expression of Stimulatory and Suppressive Transcription Factors Endocrinology, December 1, 2007; 148(12): 6083 - 6091. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Shafiee-Kermani, S.-o. Han, and W. L. Miller Chronic Gonadotropin-Releasing Hormone Inhibits Activin Induction of the Ovine Follicle-Stimulating Hormone {beta}-Subunit: Involvement of 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein and Nitric Oxide Synthase Type I Endocrinology, July 1, 2007; 148(7): 3346 - 3355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Galmiche, N. Richard, S. Corvaisier, and M.-L. Kottler The Expression of Aromatase in Gonadotropes Is Regulated by Estradiol and Gonadotropin-Releasing Hormone in a Manner that Differs from the Regulation of Luteinizing Hormone Endocrinology, September 1, 2006; 147(9): 4234 - 4244. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Westphal and A. F. Seasholtz Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L L Burger, D J Haisenleder, A C Dalkin, and J C Marshall Regulation of gonadotropin subunit gene transcription J. Mol. Endocrinol., December 1, 2004; 33(3): 559 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ishikawa, E. J. Lee, and J. L. Jameson Nonhomologous End-Joining Ligation Transfers DNA Regulatory Elements between Cointroduced Plasmids Mol. Cell. Biol., October 1, 2004; 24(19): 8323 - 8331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hestiantoro and D. F. Swaab Changes in Estrogen Receptor-{alpha} and -{beta} in the Infundibular Nucleus of the Human Hypothalamus Are Related to the Occurrence of Alzheimer's Disease Neuropathology J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1912 - 1925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Speert, S. J. MCClennen, and A. F. Seasholtz Sexually Dimorphic Expression of Corticotropin-Releasing Hormone-Binding Protein in the Mouse Pituitary Endocrinology, December 1, 2002; 143(12): 4730 - 4741. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. R. Duan, M. Ito, Y. Park, E. T. Maizels, M. Hunzicker-Dunn, and J. L. Jameson GnRH Regulates Early Growth Response Protein 1 Transcription Through Multiple Promoter Elements Mol. Endocrinol., February 1, 2002; 16(2): 221 - 233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Curtin, S. Jenkins, N. Farmer, A. C. Anderson, D. J. Haisenleder, E. Rissman, E. M. Wilson, and M. A. Shupnik Androgen Suppression of GnRH-Stimulated Rat LH{beta} Gene Transcription Occurs Through Sp1 Sites in the Distal GnRH-Responsive Promoter Region Mol. Endocrinol., November 1, 2001; 15(11): 1906 - 1917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Thway and M. W. Wolfe Epidermal Growth Factor Regulation of Equine Glycoprotein Hormone {{alpha}} Subunit Expression in Trophoblast Cells Biol Reprod, July 1, 2001; 65(1): 197 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. L. Heckert Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element Mol. Endocrinol., May 1, 2001; 15(5): 704 - 715. [Abstract] [Full Text]
|
|
|
|
|
|
W.-X. Gu, P. H. Stern, L. D. Madison, and G.-G. Du Mutual Up-Regulation of Thyroid Hormone and Parathyroid Hormone Receptors in Rat Osteoblastic Osteosarcoma 17/2.8 Cells Endocrinology, January 1, 2001; 142(1): 157 - 164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Kottler, S. Chauvin, N. Lahlou, C. E. Harris, C. J. Johnston, J.-P. Lagarde, P. Bouchard, N. R. Farid, and R. Counis A New Compound Heterozygous Mutation of the Gonadotropin-Releasing Hormone Receptor (L314X, Q106R) in a Woman with Complete Hypogonadotropic Hypogonadism: Chronic Estrogen Administration Amplifies the Gonadotropin Defect J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3002 - 3008. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
