help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duan, W. R.
Right arrow Articles by Jameson, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duan, W. R.
Right arrow Articles by Jameson, J. L.
Molecular Endocrinology 13 (8): 1338-1352
Copyright © 1999 by The Endocrine Society

Estradiol Suppresses Phosphorylation of Cyclic Adenosine 3',5'-Monophosphate Response Element Binding Protein (CREB) in the Pituitary: Evidence for Indirect Action via Gonadotropin-Releasing Hormone

W. Rachel Duan, Jennifer L. Shin and J. Larry Jameson

Division of Endocrinology, Metabolism, and Molecular Medicine Northwestern University Medical School Chicago, Illinois 60611


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estradiol acts on the hypothalamus and pituitary gland to modulate the synthesis and secretion of gonadotropins. We recently reported that GnRH-induced transcription of the human gonadotropin {alpha}-gene promoter is increased markedly in transfected pituitary cells derived from animals treated with estradiol. Because the cAMP response element binding (CREB) protein plays an important role in the transcriptional regulation of this promoter and is highly regulated by posttranslational phosphorylation, we hypothesized that it might serve as a target for estradiol-induced sensitivity to GnRH. In this study, we assessed the roles of estradiol and GnRH in the regulation of CREB phosphorylation in the rat pituitary. Using an antibody that specifically recognizes phosphorylated CREB (pCREB), we found that the pituitary content of pCREB was inversely related to the level of estradiol during the estrous cycle. Ovariectomy increased the level of pCREB, and treatment with estradiol for 10 days decreased the content of pCREB dramatically (93% inhibition). A similar reduction of pCREB was seen when ovariectomized rats were treated with a GnRH receptor antagonist for 10 days. This result indicates that the ovariectomy-induced increase in pCREB is GnRH-dependent. In {alpha}T3 gonadotrope cells, estradiol had no direct effect on CREB phosphorylation, whereas GnRH increased CREB phosphorylation 4- to 5-fold within 5 min. We conclude that estradiol inhibits CREB phosphorylation in the gonadotrope, probably by inhibiting GnRH production. The estradiol-induced decrease in CREB phosphorylation is proposed to lower basal {alpha}-promoter activity and increase its responsiveness to GnRH. (Molecular Endocrinology 13: 1338–1352, 1999)


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The secretion of LH and FSH by gonadotrope cells is controlled by a variety of hormones produced by the hypothalamus, pituitary gland, and gonads. GnRH, synthesized by neurons in the hypothalamus, plays a dominant role in gonadotropin regulation (1). Pulsatile release of GnRH is necessary for expression of the gonadotropin genes and for hormone secretion (2, 3, 4). Transcriptional activation of the gonadotropin subunit ({alpha}, LHß, and FSHß) genes is regulated differentially by GnRH pulse frequency (5, 6, 7, 8).

GnRH initiates intracellular signaling in gonadotropes by binding to its seven-transmembrane G protein-coupled receptor, activating phospholipase C and leading to the formation of inositol 1,4,5-triphosphate and diacylglycerol (9, 10, 11). Inositol 1,4,5-triphosphate causes the release of intracellular Ca2+, which, together with diacylglycerol, activates protein kinases (9, 10, 12). GnRH also activates other signaling pathways. The protein kinase C (PKC) pathway appears to play a central role in the transcriptional regulation of the {alpha}-promoter by GnRH (9, 10, 11, 13). When {alpha}T3 cells are pretreated with phorbol-12-myristate-13-acetate to deplete PKC, GnRH stimulation of the {alpha}-promoter is inhibited (14, 15). PKC may also activate other kinases, such as mitogen-activated protein kinase (MAPK) (16, 17).

In addition to GnRH, steroids from the gonads regulate the synthesis and secretion of gonadotropins. The mechanisms of feedback regulation by sex steroids are complex and include effects at both the hypothalamic and pituitary levels. During the female reproductive cycle, estradiol secreted on diestrus is thought to stimulate GnRH secretion and potentiate the responsiveness of the pituitary gland to GnRH, providing part of the basis for the LH surge (18, 19, 20, 21, 22, 23). In addition to this positive feedback of estradiol during the reproductive cycle, chronic exposure to estradiol exerts an inhibitory effect. For example, ovariectomy increases, and estradiol replacement restrains, both LH pulse frequency and amplitude (24, 25, 26, 27, 28). In parallel, the mRNA levels of LHß and FSHß markedly increase after ovariectomy, and estrogen treatment suppresses gonadotropin mRNAs (29, 30, 31, 32).

Recently, we found that estradiol has profound effects on the degree of GnRH stimulation of human {alpha}-promoter activity in transfected pituitary cells (33). The basal activity of the {alpha}-promoter was consistently reduced in females compared with males. On the other hand, {alpha}-promoter activity was stimulated more than a 100-fold by GnRH in cells derived from female pituitaries, whereas only a 5- to 10-fold stimulation was seen in cells from males (33). Further studies indicated that these sex-specific differences in GnRH responsiveness are largely accounted for by estradiol, and not testosterone, since the chronic administration of estradiol to ovariectomized females or castrate males restored GnRH responsiveness and reduced the basal activity of the {alpha}-promoter (33). Although {alpha}-promoter activity is dramatically affected by estrogen, the mechanism of this effect is not clear. No high-affinity estrogen receptor-binding sites have been identified in the {alpha}-promoter (34), suggesting that estrogen regulation may involve other proteins, or that it may be indirect.

The regulatory elements in the human {alpha}-promoter have been well characterized (13, 35, 36). Several different regions of this promoter appear to be involved in GnRH responsiveness (13, 16, 37, 38). Deletions or mutations of sequences between -346 and -244 bp reduce, but do not eliminate, GnRH responsiveness (37, 38). This region includes binding sites for proteins that are regulated by the MAPK pathway, which is stimulated by GnRH (10, 16, 17, 38). Mutations in the two cAMP response elements (CREs), which provide binding sites for transcription factor CREB (CRE-binding protein) (13, 35), greatly reduce the basal activity of the {alpha}-promoter (39, 40, 41) and may also be involved in GnRH responsiveness. The role of the CREs in GnRH regulation has not been fully defined, however, because the activity of the promoter is greatly reduced by mutations of these sites. Because the CREs play a critical role in the regulation of the {alpha}-promoter, CREB is a potential candidate for regulation by GnRH signaling pathways. CREB contains several consensus phosphorylation sites for various kinases (42), and phosphorylation at serine 133 (Ser-133) is necessary for its transcriptional activation (43, 44, 45). Ser-133 can be phosphorylated by protein kinase A (46, 47), PKC (48), calcium calmodulin-dependent kinase (CaMK) II (49, 50), CaMKIV (51, 52), extracellular signal-regulated kinase (ERK), and p38 MAPK (53).

Estrogen has been reported to stimulate adenylate cyclase and cAMP-mediated gene transcription in human breast cancer cells, prostate cells, and rat uterine cells (54, 55, 56). Moreover, estrogen has been found to stimulate CREB phosphorylation at Ser-133 in rat brain (57, 58) and to enhance the expression of the neurotensin gene, which lacks estrogen response elements (EREs), but contains CREB recognition sites (59). Based on these findings, we hypothesized that CREB might be a key target for estradiol effects in gonadotrope cells and thereby modulate {alpha}-promoter activity. In the present study, we investigated the potential roles of estradiol and GnRH in the modulation of pituitary CREB phosphorylation in vitro and in vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Deletion of CREs and a Dominant Negative Mutant of CREB Represses Basal Activity and GnRH Responsiveness of the Human {alpha}-Promoter
Previously, we found a striking gender difference in the basal activity and GnRH responsiveness of the human {alpha}-promoter when it is introduced into pituitary cells from male or female rats (33). An example of this phenomenon is shown in Fig. 1AGo. When the -420{alpha}-Luc reporter gene was transfected into pituitary cells derived from male or randomly cycling female rats, basal {alpha}-promoter activity was 25% lower in the pituitary cells from females compared with males. However, cells from female rats showed a greater response to GnRH treatment (200-fold) in comparison to the GnRH response of male pituitary cells (10-fold) (Fig. 1AGo).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Sexual Dimorphism in {alpha}-Promoter Activity and Suppression by Deletion of CRE and Mutant CREB

A, Primary cultures of pituitary cells from adult male and random cycling female rats were transfected with -420{alpha}-Luc (15 µg/well). Six hours after transfection, cells were treated with or without GnRH (10 nM) for 24 h before measuring luciferase activity. Results are the mean ± SEM of triplicate transfections. B, Primary cultures of pituitary cells from randomly cycling female rats were transfected with -846{alpha}-Luc (10 µg/well) (Control) or -846{alpha}-luc{Delta}CRE ({Delta}CRE). Cells were treated with or without GnRH (10 nM) for 24 h before measuring luciferase activity. Results are the mean ± SEM of triplicate transfections. C, Primary cultures of pituitary cells from randomly cycling female rats were cotransfected with -846{alpha}-Luc (10 µg/well) together with either the pCMX expression vector (Control) (10 µg/well) or mutant CREB (mCREB) (10 µg/well) in which Ser-133 was changed to alanine. Cells were treated with or without GnRH (10 nM) for 24 h. Cells were then harvested and luciferase activity assays were performed. Values shown are the mean ± SEM of triplicate transfections. All transfections were repeated with similar results.

 
Because the activity of the {alpha}-promoter is strongly dependent on its CREs (13), we tested whether the deletion of the CREs or expression of a dominant negative mutant (Ser-133 Ala) of CREB (60) would alter basal activity and GnRH responsiveness of the {alpha}-promoter. Pituitary cells from randomly cycling female rats were transfected with -846{alpha}-Luc or -846{alpha}-Luc{Delta}CRE, in which both copies of CREs have been removed. Deletion of the CREs caused a marked reduction (62–82%) in basal expression and a 70–86% decrease in GnRH-induced activity of the {alpha}-promoter. However, the fold of induction by GnRH remained similar (Fig. 1BGo). Coexpression of the dominant negative form of CREB also markedly reduced basal {alpha}-promoter activity (80% inhibition) and almost eliminated GnRH responsiveness (Fig. 1CGo), whereas expression of wild-type CREB had no effect on {alpha}-promoter activity (data not shown). Similar results were obtained when the dominant negative CREB mutant was expressed in {alpha}T3 cells (data not shown).

Pituitary Phosphorylated CREB Content Varies during the Estrous Cycle
In view of the importance of the CREB for {alpha}-promoter activity, we hypothesized that changes in CREB phosphorylation might underlie the estrogen-dependent effects on basal and GnRH responsiveness of the {alpha}-promoter. As an initial effort to address this question, the amount of phosphorylated CREB (pCREB) was assessed in the pituitaries of male and female rats, and at different stages of the estrous cycle (Fig. 2Go). Pituitaries from three to four animals were homogenized and subjected to Western blot analysis using an antibody specific for the Ser-133-phosphorylated form of CREB. As a control, duplicate blots were analyzed in parallel with an antibody recognizing total CREB. The pituitary content of pCREB varied widely during the estrous cycle. pCREB was greatest at metestrus (120% of male) and diestrus (86% of male), but was much lower during proestrus (46% of male) and estrus (56% of male). The amount of total CREB remained relatively constant during the cycle and was used to normalize the level of phosphorylated CREB (pCREB/CREB). Thus, the level of pCREB in male rats was similar to that of metestrus and diestrus females, and the phosphorylation of CREB during the estrous cycle appears to vary inversely with estradiol levels (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Levels of pCREB in the Pituitary during the Estrous Cycle

Female rats were monitored daily to ascertain the stage of the estrous cycle and were killed between 0900 and 1100 h at the indicated times during the cycle. Anterior pituitary glands were isolated and homogenized. Western blot analyses were performed using duplicate blots that were probed with antibodies against pCREB or total CREB, respectively (upper panel). The percentage of pCREB relative to total CREB was determined using densitometry and is shown as the mean ± SEM (lower panel). The results are the average of four experiments with two independent batches of cycling rats. The level of pCREB/CREB in male rats is set at 100%. MET, Metestrus; DI, diestrus; PRO, proestrus; EST, estrus.

 
pCREB Is Present in Gonadotropes and Other Pituitary Cell Types
Double-label immunohistochemistry was used to determine whether pCREB is present in gonadotropes (Fig. 3Go). Pituitary glands were fixed in situ to minimize alterations in phosphorylation during tissue preparation. Using the LHß antibody, strong cytoplasmic staining was seen in a subset of cells (Fig. 3BGo). pCREB staining, of variable intensity, was seen in the nuclei of the majority of pituitary cells (Fig. 3DGo). Weak background cytoplasmic staining is seen in the absence of pCREB antibody (Fig. 3CGo). Colocalization of nuclear pCREB and cytoplasmic LHß was seen in the majority of LHß-positive cells (Fig. 3EGo). However, pCREB staining is also seen in LHß-negative cells, indicating that CREB is phosphorylated in both gonadotrope and nongonadotrope cells.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 3. Immunofluorescent Staining of LHß and pCREB in the Pituitary

Frozen sections of whole pituitaries from random cycling female rats were immunostained with primary antisera against either the rat LHß subunit or pCREB. Immunoreactivity was visualized with a fluorescein isothiocyanate-conjugated antibody to detect LHß (green), and/or a rhodamine-conjugated antibody to detect pCREB (red). A, Without anti-LHß. B, With anti-LHß. C, Without anti-pCREB. D, With anti-pCREB. E, With anti-LHß and anti-pCREB. (Magnification 400x)

 
Estradiol Down-Regulates Pituitary pCREB in Vivo
Rats were ovariectomized (Ovx) for 10 days and implanted with estradiol pellets for 3, 5, or 10 days to investigate the effect of estradiol on CREB phosphorylation in vivo. Total pituitary homogenates were subjected to Western blot analysis with anti-pCREB or anti-CREB antibodies (Fig. 4Go). As there was variability in the level of pCREB in different animals, we processed pituitaries individually. As shown in Fig. 4Go, replacement of estradiol decreased the level of pCREB in the pituitary dramatically, and pCREB was almost undetectable after 10 days of treatment. By comparison, the level of total CREB decreased only slightly. These results are quantitated in the bottom panel, in which the level of pCREB is adjusted for changes in total CREB. Compared with Ovx rats, estradiol decreased pCREB to 49%, 21%, and 7% after 3, 5, and 10 days, respectively.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. Estradiol Inhibits CREB Phosphorylation in the Rat Pituitary in Vivo

Rats, ovariectomized (OVX) for 10–12 days, were implanted with or without a 17ß-estradiol-filled SILASTIC capsule (5 mm in length). After 3, 5, or 10 days of implantation (n = 3/group), anterior pituitary glands were isolated and homogenized individually. Equal amounts of pituitary proteins were separated on SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB antibodies (upper panel). Each lane represents one animal. The relative amount of pCREB/CREB is shown as the mean ± SEM from three rats, and the results are normalized to the value in Ovx rats. Similar results were obtained in two other experiments.

 
A GnRH Receptor Antagonist Reduces the Level of pCREB in the Pituitary
Ovx rats were injected with the GnRH receptor antagonist, azaline B (61), or with sesame oil vehicle to determine whether GnRH input to the pituitary is required for the maintenance of CREB phosphorylation. Ten days after injection, rats were killed, and trunk blood was collected for LH and FSH assays to monitor the effectiveness of the GnRH receptor antagonist. Western blot analyses were performed with total pituitary homogenates using anti-pCREB and anti-CREB antibodies. Consistent with the previous experiments (Fig. 4Go), ovariectomy increased pCREB (Fig. 5Go). However, all four rats that received the GnRH receptor antagonist exhibited substantially reduced levels of pCREB (16% of Ovx), similar to the effect seen in the estradiol-treated rats. The amount of total CREB was not affected by administration of the antagonist. Serum levels of LH and FSH in azaline B-treated rats were lower than in the control group (Fig. 5Go), confirming that the azaline B injection was effective. These data suggest that GnRH input is required for ovariectomy-induced CREB phosphorylation. Because the effects of GnRH are mediated predominantly in gonadotrope cells, these findings also suggest that gonadotropes are a major target of estradiol-induced changes in CREB phosphorylation.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. Suppression of CREB Phosphorylation by a GnRH Receptor Antagonist in Vivo

Rats were ovariectomized (OVX) for 10–12 days and received the GnRH antagonist, azaline B (AZ) (400 µg sc/rat) or sesame oil. After 10 days, anterior pituitary glands were isolated and homogenized individually. Equal amounts of pituitary proteins were separated by SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB antibodies (upper panel). The relative amount of pCREB/CREB is shown as the mean ± SEM of three or four rats, and the results are normalized to the value in Ovx rats (middle panel). Similar results were obtained in another independent experiment. The bottom panel shows serum levels of LH and FSH determined by RIA. Each lane in the upper panel corresponds to the hormone values from a single animal in the bottom panel.

 
Estradiol-Induced Suppression of CREB Phosphorylation Is Reversible
Estradiol pellets were removed after a 7-day implantation, and rats were killed 4 days later (4 DAYS - estradiol) to assess whether CREB phosphorylation increases in response to withdrawal of estradiol. In parallel, another group of rats received either estradiol pellets alone (estradiol, 10 DAYS) or estradiol pellets together with azaline B (estradiol+AZ) for another 10 days to determine whether GnRH input is required for estradiol-mediated suppression of pCREB. In agreement with the previous observation, pCREB was strikingly reduced (12% of Ovx) in estradiol-treated rats. As controls for the hormone treatment, serum levels of estradiol were documented to increase, and LH and FSH levels were decreased after estradiol administration (Fig. 6Go). Withdrawal of estradiol, which is expected to increase GnRH output, increased serum LH and FSH (Fig. 6BGo). In association with these changes, the decreased levels of serum estradiol reversed the suppression of pCREB (70% of Ovx) (Fig. 6AGo). There was no significant difference in the level of pCREB between the estradiol-treated group (12% of Ovx) and the estradiol plus azaline B-treated group (10% of Ovx, Fig. 6Go), suggesting that estradiol does not have an additional inhibitory effect on pCREB. These results support the idea that the suppressive effect of estradiol on pCREB is indirect, probably resulting from inhibition of GnRH production.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Effect of Removing Estradiol on CREB Phosphorylation

Rats were ovariectomized (OVX) for 10–12 days and implanted with a 17ß-estradiol-filled (E2) SILASTIC capsule for 10 days (estradiol, 10 DAYS). In one group, Ovx rats received an estradiol pellet together with azaline B injection for 10 days (estradiol, AZ). In another group, estradiol pellets were removed after 7 days implantation and anterior pituitary glands were isolated 4 days after estradiol removal (estradiol, 4 DAYS-E2). Equal amounts of pituitary proteins were separated by SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB antibodies (upper panel of A). Each lane represents one animal. The relative amounts of pCREB/CREB are shown as the mean ± SEM of three rats and are normalized to the value in untreated Ovx rats. Panel B shows serum levels of LH, FSH, and estradiol determined by RIA. Values shown are the mean ± SEM of three rats. Similar results were obtained in another independent experiment.

 
GnRH Is Not Able to Reverse the Inhibitory Effect of Estradiol on CREB Phosphorylation in Vivo
Ovx rats were implanted with estradiol pellets for 10 days and treated with pusatile GnRH to assess whether exogenous GnRH could reverse estradiol-mediated suppression of pCREB. GnRH was administered either for a short period (every 30 min for 2 h) or a longer period (every hour for 6 h or 24 h). Under these conditions, the pulses of GnRH did not increase the level of pCREB in the presence of the estradiol pellet (Fig. 7Go). However, serum LH levels increased markedly after the administration of pulsatile GnRH, confirming that it stimulated gonadotropin secretion (Fig. 7Go).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 7. Effect of GnRH on CREB Phosphorylation in Estradiol-Treated Rats

Rats were ovariectomized (OVX) for 10–12 days and implanted with a 17ß-estradiol-filled (E2) SILASTIC capsule for 10 days. For the 2-h GnRH treatment, GnRH pulses (50 µg/pulse, every 30 min) were administered to the estradiol-treated rats intraperitoneally with the final dose being given by tail vein injection. For the 6- or 24-h GnRH treatments, rats were fitted with carotid arterial catheters and received hourly pulses of GnRH (100 ng/pulse). Anterior pituitary glands were isolated, and equal amounts of pituitary proteins were separated by SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB antibodies (upper panel). Each lane represents one animal. The relative amounts of pCREB/CREB are shown as the mean and range of two rats and are normalized to the value in untreated Ovx rats (middle panel). The bottom panel shows the serum level of LH determined by RIA. Values shown are the mean ± SEM of two rats.

 
Estradiol Does Not Alter CREB Phosphorylation or CREB-Mediated Transcription in Cell Cultures
Several different cell lines were used to explore the possibility of a direct effect of estradiol on CREB phosphorylation. {alpha}T3 gonadotrope cells were maintained in phenol red-free media with charcoal-stripped serum for 48 h and then treated with estradiol for various time intervals. Nuclear extracts were prepared and Western blot analyses were performed using anti-pCREB or anti-CREB antibodies. There was no effect of estradiol on CREB phosphorylation, or CREB content, when cells were treated with estradiol from 5 min to 4 h (Fig. 8AGo). Similar results were obtained with T47D estrogen-responsive breast cancer cells or primary cultures of pituitary cells (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 8. Effect of Estradiol on CREB Phosphorylation in {alpha}T3 Cells

A, {alpha}T3 cells were maintained in estrogen-depleted medium for at least 48 h. Cells were then treated with 1 nM estradiol for the indicated lengths of time. Duplicate blots of nuclear extracts were prepared and Western blot analyses were performed using antibodies against pCREB or total CREB (upper panel). The lower panel shows the quantification of the results (mean ± SEM) from three independent experiments. The fold change in the level of pCREB is normalized to the level in the absence of estradiol treatment. B, T47D cells were grown in estrogen-depleted medium for 5 days. Cells were cotransfected by electroporation with the GAL4-ER or the GAL4-CREB expression vector and a GAL4-responsive reporter gene, UAS-TK-Luc. Luciferase activity was determined 48 h after treatment with estradiol (1 nM) or 8-bromo-cAMP (1 mM). Results are the mean ± SEM of triplicate transfections.

 
As an additional strategy to detect direct effects of estradiol on CREB phosphorylation, reporter genes were introduced into T47D cells. GAL4-ER or GAL4-CREB were cotransfected with the UAS-TK-luciferase (UAS-TK-luc) reporter, and cells were treated with estradiol or 8-bromo-cAMP for 48 h. As expected, estradiol markedly increased GAL4-ER-dependent gene expression (Fig. 8BGo). In addition, cAMP stimulated GAL4-CREB activity (Fig. 8BGo). In contrast, estradiol failed to activate GAL4-CREB, consistent with the absence of an estradiol effect on pCREB protein levels in these cells.

GnRH Stimulates CREB Phosphorylation in Vitro
{alpha}T3 cells were treated with GnRH to examine whether it alters CREB phosphorylation in gonadotrope cells. GnRH increased the level of pCREB 4- to 5-fold within 5 min, and this level of phosphorylation was sustained for at least 4 h. The total amount of CREB was unchanged throughout this time course (Fig. 9Go). The lower band detected with the pCREB antibody in these cells may represent another b-Zip family member, or a degradation product of CREB. Similarly, GnRH increased CREB phosphorylation in 293 cells that were stably transfected with the GnRH receptor (data not shown). To determine whether long-term pretreatment with estradiol affects GnRH-induced CREB phosphorylation, {alpha}T3 cells were treated with estradiol for 5 days and then exposed to GnRH for 15 min. Pretreatment with estradiol for 5 days did not alter CREB phosphorylation in response to GnRH (data not shown).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 9. GnRH Stimulates CREB Phosphorylation in {alpha}T3 Cells

{alpha}T3 cells were grown in DMEM/F12 with 10% FBS and treated with GnRH (10 nM) for different time courses. Duplicate blots of nuclear extracts were prepared, and Western blot analyses were performed with anti-pCREB and anti-CREB antibodies (upper panel). The lower panel shows the fold changes in the level of pCREB/CREB (mean ± SEM from three independent experiments) normalized to the value in the absence of GnRH treatment.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogen has complex effects on the hypothalamic-pituitary axis. Estradiol, in combination with progesterone, exerts positive feedback to enhance gonadotropin synthesis and secretion (19, 24, 62, 63, 64). On the other hand, chronic treatment with estradiol suppresses pituitary gonadotropin mRNA levels and inhibits gonadotropin secretion (24, 26, 29, 30, 63, 65). Recently, we developed a model for examining the effects of estradiol on GnRH stimulation of the {alpha}-promoter after it has been transfected into primary cultures of pituitary cells. These experiments revealed that estradiol suppresses basal {alpha}-promoter expression, but it dramatically enhances GnRH responsiveness of the {alpha}-promoter (33). Several aspects of this model warrant comment. The effects of in vivo administration of estradiol persist in the pituitary cells, despite the fact that they are cultured in vitro for several days before the luciferase assays are performed. Treatment with estradiol in vitro did not alter {alpha}-promoter activity. Long-term (7–10 days) in vivo treatment was necessary to see the estradiol effect. This combination of observations led us to consider the possibility that estradiol treatment was altering the expression or activity of a factor involved with the modulation of pituitary sensitivity to GnRH. CREB phosphorylation was considered as a likely step in such a pathway, since CREB is known to be a critical factor involved in the regulation of {alpha}-promoter transcription.

When we began these studies, existing data suggested the possibility that estradiol might stimulate pituitary CREB phosphorylation or enhance GnRH-mediated CREB phosphorylation. For example, acute estradiol treatment (15–30 min) of Ovx rats rapidly enhances CREB phosphorylation in brain (57, 58, 59). Based on this observation, we tested whether CREB phosphorylation varied during the estrous cycle, anticipating that it might be greatest during proestrus, when estradiol levels are high. Unexpectedly, the level of pCREB in the pituitary was inversely related to estradiol during the estrous cycle. It was greatest in metestrus and diestrus, and lowest in proestrus. This inverse relationship between the level of estradiol and the level of pCREB was supported by the finding that pCREB was relatively high in males and increased in females after ovariectomy. Lastly, replacement of estradiol in Ovx rats caused a striking decrease in the level of pCREB. Interestingly, the reduction of pCREB required long-term treatment of at least 5 days, which is reminiscent of our previous findings using {alpha}-promoter activity as an indicator of the estradiol effect (33).

Based on the long time course required for the estradiol effect and the observation that estradiol reduces, rather than enhances, CREB phosphorylation, we considered the possibility that estradiol might act indirectly by inhibiting input from hypothalamic GnRH (24, 63). Azaline B, a competitive antagonist of the GnRH receptor (61), was used to test this hypothesis. Treatment with azaline B reduced pCREB in Ovx rats to a level that was similar to that seen in estradiol-treated rats. The serum levels of LH and FSH were also measured in these experiments to assess the effectiveness of the GnRH antagonist. Suppressed levels of LH and FSH were seen, as expected, except in one rat. It is notable that in the rat with higher levels of LH and FSH, and incomplete blockade by azaline B, there was a greater level of pCREB in the pituitary.

Removal of the estradiol pellet for 4 days increased the level of pCREB, and this effect paralleled the increase in serum LH and FSH. These findings strengthen the notion that the lower amount of pCREB in estradiol-treated rats is likely the result of reduced GnRH input. If this is true, then it should be possible to reverse the effect of estradiol treatment by the administration of exogenous GnRH. This experiment was attempted in two different protocols. First, GnRH was administered acutely (four pulses over 2 h) to estra-diol-treated rats, and CREB phosphorylation was determined 20 min after the last injection. Although LH and FSH levels increased dramatically after the injection of GnRH, the level of pCREB was not increased. In a second paradigm, pulsatile GnRH was administered hourly over a 6- or 24-h period, but again there was no change in the level of pCREB. These findings raise the possibility that estradiol might have additional direct effects on the pituitary. In fact, it has been reported that pulses of GnRH are unable to override the inhibitory effect of estradiol on {alpha}-subunit mRNA levels (66). Estradiol may alter the production of other hypothalamic factors that are required for GnRH-dependent CREB phosphorylation. Alternatively, and perhaps most likely, longer treatment with pulsatile GnRH, or the use of different pulse frequencies, may be required to prime pituitary responses to GnRH (67, 68).

It is intriguing that in a transgenic mouse model in which there is overexpression of the LHß subunit gene and increased estradiol levels, endogenous LHß gene expression is responsive to steroid feedback, whereas the {alpha}-subunit gene is resistant to estradiol feedback and to regulation by GnRH (69). The level of CREB in the pituitaries of these mice is increased dramatically (69). Our finding that pCREB plays a critical role in the regulation of the {alpha}-promoter activity by GnRH and estradiol may relate to these findings. The persistently higher level of CREB in these transgenic mice may contribute to a state of GnRH- and estradiol-independent expression of the {alpha}-promoter.

The observation that the GnRH antagonist, azaline B, substantially reduces pCREB in the pituitary argues that much of the pCREB detected in these experiments is derived from GnRH-responsive cells. It is somewhat surprising that estradiol and azaline B have such pronounced effects on the level of pCREB in whole pituitaries since the gonadotropes comprise only about 14% of pituitary cells (70, 71). CREB is a ubiquitously expressed protein and CREB phosphorylation has been documented in somatotropes (60, 72) and lactotropes (73, 74). In experiments using double-label immunocytochemistry (LHß and pCREB), we found that pCREB is present in both gonadotrope and nongonadotrope cell types in the pituitary. It is possible that estradiol has direct effects on several pituitary cell types. In addition, GnRH receptors have been found on cells other than gonadotropes (75, 76), raising the possibility that CREB phosphorylation in some of these cells might be GnRH dependent. GnRH has also been demonstrated to act indirectly on nongonadotrope cells (77). It is also possible that gonadotropes comprise a population of cells that are particularly responsive to changes in CREB phosphorylation. Further studies of dynamic changes in phosphorylation with double- label immunohistochemical analysis in specific cell types will be necessary to address this issue.

Consistent with the in vivo data suggesting that estradiol is acting indirectly, via GnRH, to modulate the state of CREB phosphorylation, we did not observe direct effects of estradiol on CREB phosphorylation in vitro. For example, treatment of {alpha}T3 cells with estradiol from 5 min to 4 h did not change the level of pCREB. Similar results were seen in primary cultures of pituitary cells (data not shown). Furthermore, transient transfection experiments with estrogen-responsive T47D cells confirmed the lack of a direct stimulatory effect of estradiol on CREB phosphorylation. These findings raise the possibility that some of the acute estradiol effects in the brain (57, 58, 59) might also be indirect, perhaps reflecting the release of neurotransmitters that in turn alter the state of CREB phosphorylation (78, 79, 80, 81).

In light of data suggesting that GnRH input is critical for estradiol-induced changes in pCREB, we used {alpha}T3 gonadotrope cells to further explore the direct phosphorylation of CREB by GnRH. As expected, GnRH stimulated CREB phosphorylation by 4- to 5-fold within 5 min. Although the PKC and calcium pathways, among others, have been shown to mediate many of the downstream effects of GnRH (9, 10), it remains to be determined which of the many potential signaling pathways that are involved in CREB phosphorylation (46, 48, 49, 50, 51, 52, 53) might be affected by GnRH.

These results emphasize the importance of identifying other transcription factors and DNA sequences in the {alpha}-promoter that are regulated by GnRH. In our experience, these experiments are difficult to interpret in {alpha}T3 cells because GnRH treatment of these cells stimulates the activity of most reporter genes, including many control promoters that are not expected to be GnRH responsive (our unpublished data). For this reason, we performed analyses of GnRH responsiveness in primary cultures of pituitary cells, even though transfection efficiency and the level of expression is relatively low. In these cells, GnRH stimulates the {alpha}-promoter, but it does not activate control promoters (33). Mutation of the CREs in the {alpha}-promoter greatly reduced basal activity, as expected. However, it was still possible to detect GnRH responsiveness, indicating that the CREs are not essential for at least part of the GnRH response. However, because basal activity is greatly reduced by the CRE deletion, the absolute level of promoter activity after GnRH stimulation is greatly diminished. These findings underscore the importance of distinguishing effects on basal and GnRH-stimulated activity. In contrast, a dominant negative mutant of CREB blocks both basal activity and GnRH responsiveness. The more potent inhibition by mutant CREB in comparison to deletion of the CREs raises the possibility that the mutant transcription factor exerts a more general effect to impair the assembly of an active transcription complex. Clearly, additional studies are needed to further localize GnRH response elements in this promoter and to characterize cognate transcription factors at these sites.

In conjunction with previous data, these findings suggest that multiple transcription factors and regulatory elements may be involved in GnRH regulation of the {alpha}-promoter (13, 37, 38). As noted above, GnRH activates several limbs of the MAPK cascade as well as the protein kinase C- and calcium-signaling pathways. Similar to the findings with the CRE mutations, inhibition of the MAPK pathway greatly reduces the basal activity of the {alpha}-promoter with little effect on the degree of GnRH stimulation (15, 16, 38). Therefore, it seems likely that GnRH signaling to the {alpha}-promoter is redundant, perhaps involving several different transcription factors that are modified by GnRH-induced kinase pathways. It also appears that transcription factors involved in the GnRH response may be coupled to basal expression of the promoter. For example, several pathways might converge on CREB to establish a "basal" level of expression that can be modulated further by GnRH or other hormonal signals that stimulate kinase pathways. In this respect, it is interesting to note the inverse relationship between estradiol suppression of basal promoter activity and the apparent enhancement of GnRH responsiveness (e.g. female pituitary cells) (15, 33). One explanation for this phenomenon is that estradiol suppresses GnRH input, leading to decreased CREB phosphorylation and reduced basal promoter activity. In this context, restoration of GnRH input in vivo may exert its greatest effect on basal promoter activity, with the consequence that fold-stimulation by subsequent administration of GnRH in vitro is reduced.

In conclusion, we find that the chronic administration of estradiol in Ovx rats produces an inhibitory effect on CREB phosphorylation in the pituitary. Estradiol inhibition of CREB phosphorylation appears to be mediated indirectly by a decrease in GnRH production in the hypothalamus. GnRH directly stimulates CREB phosphorylation at Ser-133 in gonadotrope cells. Based on these findings, we postulate that the estradiol-induced decrease in pCREB lowers {alpha}-promoter activity and accounts for the relatively low level of basal promoter activity in females (33). In addition, the reduced basal level of CREB phosphorylation may sensitize the pituitary to GnRH, as there would be more CREB phosphorylation sites available to respond to the GnRH signal.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animal Models
All surgical and experimental procedures were conducted in accordance with the policies of Northwestern University’s Animal Care and Use Committee. Male and female Sprague Dawley rats (Charles River Laboratories, Inc., Wilmington, MA) (200–225 g) were housed in a controlled environment (temperature 24–26 C) with a 14-h light, 10-h dark cycle, and free access to tap water and standard laboratory chow. Estrous cyclicity was monitored by daily examination of vaginal cytology. Only animals exhibiting two consecutive 4-day estrous cycles were used in the experiments.

Rats were Ovx bilaterally 10–12 days before the experiments involving the effect of estradiol on CREB phosphorylation. Animals were lightly anesthetized with metofane and received 17ß-estradiol-filled SILASTIC implants subcutaneously (Dow Corning Corp., Midland, MI; id, 0.062 inches; od, 0.125 inches; 5 mm in length) for 3, 5, or 10 days. In one group of rats, estradiol capsules were removed after 7 days of implantation to assess the reversibility of the estrogen effects. In this case, rats were killed 4 days after the removal of estradiol.

In estradiol-treated rats, GnRH pulses (50 µg/pulse) were given every 30 min ip for 2 h and by tail vein injection (the last pulse). In addition, estradiol-treated rats were anesthetized and a catheter was inserted into the right carotid artery and connected to an infusion pump. GnRH pulses (100 ng/pulse every hour) were administered manually through carotid arterial catheters for 6 or 24 h. LH and FSH levels were measured by obtaining serum samples 20 min after the last GnRH injection.

In the experiments that involved the GnRH receptor antagonist, rats were ovariectomized bilaterally for 10–12 days and the antagonist, azaline B, was injected once (400 µg sc/rat in 0.2 ml sesame oil) (61). The control group received sesame oil only. Rats were killed 10 days after azaline B treatment. Azaline B was also given to a group of animals that received estradiol pellets on the same day. Rats were killed by decapitation. Anterior pituitary glands were rapidly removed and frozen with dry ice. Blood was collected for subsequent measurements of LH, FSH, and estradiol by RIA.

Immunocytochemistry
Random cycling female rats were anesthetized with sodium pentobarbitol (50 mg/ml; 60 mg/kg of body weight) and perfused with 600 ml 4% paraformaldehyde solution at room temperature for 1 h. The pituitaries were immediately removed and placed in 4% paraformaldehyde solution for 1 h at 4 C, and then transferred to 30% sucrose in 0.01 M sodium phosphate buffer overnight at 4 C. The tissues were embedded in mounting media optimum cutting temperature compound (Tissue Tek II, Miles, Elkhart, IN) and quickly frozen in dry ice-acetone. Cryostat sections (5 µm) were mounted on vectabond-coated slides and stored at -70 C. For immunocytochemistry, slides were equilibrated at room temperature, and then washed three times with cold washing buffer (0.01 M TBS with 0.4% Triton X-100) for 15 min each. Before incubation with primary antibody, the slides were blocked with 10% normal goat serum (in 0.01 M TBS buffer with 1% BSA, 0.4% TX-100) for 1 h at room temperature. The guinea pig antirat LHß primary antibody (NIDDK, AFP-22238790GPOLHB) was preincubated with control tissue (cerebral cortex from the same rat at 4 C for 1 h) to reduce nonspecific binding of the antibody. Slides were then incubated with the anti-LHß antibody (1:1000) and/or rabbit antirat pCREB antibody (1:100) (Upstate Biotechnology, Inc., Lake Placid, NY) in a 0.01 M TBS buffer containing 1% goat serum, 1% BSA, and 0.5% Triton X-100 for 1.5 h at room temperature. Slides were rinsed through six changes of cold washing buffer for 1 h at room temperature. Immunoreactivity was subsequently detected using fluorescein isothiocyanate-conjugated goat antiguinea pig antibody (Sigma Chemical Co., St. Louis, MO) to detect LHß, and rhodamine-conjugated goat antirabbit antibody (Pierce Chemical Co., Rockford, IL) to detect pCREB, both diluted to 1:200 in a TBS buffer containing 1% goat serum, 1% BSA, and 0.4% Triton X-100. Sections were washed four times for 1 h each with cold washing buffer and dried in a vacuum dessicator for 15 min. Drops of aqueous mounting media (Mowiol, DAKO Corp., Carpinteria, CA) were used to mount the coverslips, which were sealed with clear nail polish and allowed to dry for 15 min. Single or double-labeled cells (gonadotropes and pCREB containing cells) were photographed after single or double exposures using a Fluorescent Axiokop microscope (Carl Zeiss, Thornwood, NY) and Ektachrome 400 daylight film.

Tissue and Cell Cultures, Transfections, and Luciferase Assays
Pituitary glands were excised from male and random cycling female rats. The anterior lobes were cut into 15–20 small pieces. Fragments were rinsed twice in incomplete PBS (2.7 mM KCl, 1.2 mM K2HPO4, 138 mM NaCl, and 8.1 mM Na2HPO4, pH 7.1), digested for two 15-min periods in a solution containing 0.125% trypsin (TRLS, Worthington Biochemical Corp., Freehold, NJ) in PBS, followed by a 2-min digestion in a solution containing 10 U/ml deoxyribonuclease I (Sigma Chemical Co.). Cells were then incubated for 10 min in a 0.125% collagenase solution (type IV, Sigma Chemical Co.) before being dispersed mechanically by pipetting. Cells were resuspended in DMEM with 10% FBS, 100 U/ml penicillin, 50 µg/ml streptomycin, and 2.5 µg/ml Fungizone (Biologos, Naperville, IL), and then plated in 24-well dishes. After recovery for 40 h in DMEM with 1% FBS, cells were transfected with 10–20 µg/well DNA using the calcium phosphate precipitation technique (33). The {alpha}-Luc reporter gene contains either 846 or 420 bp of 5'-flanking sequence and 44 bp of exon 1 of the human glycoprotein {alpha}-subunit gene linked to the firefly luciferase gene in the plasmid pA3 luc. In the -846{alpha}-Luc{Delta}CRE construct, both copies of the CRE (TGACGTCATGGTAAAAATTGACGTCA) were removed and substituted with a SpeI site (ACTAGT). The DNA sequence was confirmed by sequencing. The cells were also cotransfected with the -846{alpha}-Luc and either wild-type human CREB or mutant CREB in which Ser-133 was substituted with alanine (kindly provided by Dr. Jeffrey Leiden, University of Chicago). As a control, cells were also transfected with the -846{alpha}-Luc and the empty expression vector pCMX. Cells were exposed to the DNA precipitate for 6 h. After 24-h treatment with or without 10 nM GnRH analog (Des-Gly10, [D-Ala6] GnRH ethylamide; Sigma Chemical Co.; hereafter referred to as GnRH), cells were harvested for luciferase assays by adding 0.5 ml/well lysis buffer [1% Triton X-100 in 25 mM glycylglycine buffer, 15 mM MgSO4, 4 mM EGTA, and 1 mM dithiothreitol (DTT), pH 7.8]. Luciferase assays were performed by adding 0.3 ml cell extract to 0.4 ml luciferase buffer (25 mM glycylglycine, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, 16 mM potassium phosphate, and 2 mM ATP, pH 7.8). The reactions were performed at room temperature using an AutoLumat LB 953 luminometer (EG&G Instruments, Oak Ridge, TN). Luciferase activity was determined by measuring the light emitted during the initial 30 sec of the reaction. The values are expressed in relative light units.

{alpha}T3 cells were grown to about 80% confluency in DMEM/F12 with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin in 10-cm plates. In experiments that involved estrogen, cells were maintained in estrogen-depleted medium for at least 48 h. 17ß-estradiol (1 nM, Sigma Chemical Co.) or GnRH (10 nM) was added to cells for various time intervals. Cells were washed with ice-cold PBS and harvested with 5 ml PBS+ (PBS, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride and 1 mM DTT). Nuclear extracts were prepared by the Shapiro method (82) modified by the addition of a protease inhibitor, Complete (Roche Molecular Biochemicals, Indianapolis, IN) and 25 mM NaF.

T47D cells were maintained in RPMI 1640 medium supplemented with 10% FBS, nonessential amino acids, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. Cells were switched to an estrogen-depleted medium containing charcoal-stripped serum and no phenol red 5 days before transfection by electroporation with a single pulse at 300 V and 960 µfarads. Cells in 12-well plates were transfected with 1 µg UAS-TK-luc (containing two copies of GAL4 recognition sequence, UAS, upstream of TK) and 0.25 µg GAL4-ER (containing the GAL4 DNA-binding domain and the human estrogen receptor EF domains) or GAL4-CREB (containing the GAL4 DNA-binding domain and the human CREB transactivation domain). After exposure to 17ß-estradiol (1 nM) or 8-bromo-cAMP (1 mM, Sigma Chemical Co.) for 48 h, cells were harvested for luciferase assays as described above.

Western Blot Analysis
Anterior pituitaries were homogenized in a solution (0.9 M NaCl, 50 mM Na2HPO4, 2.5 mM EDTA, 20 mM NaF, 1 mM phenylmethylsulfonyl fluoride, and 50 mM HEPES-Tris, pH 7.4) containing the complete protease inhibitor cocktail (Roche Molecular Biochemicals). Equal amounts of total pituitary homogenate proteins (30 µg) or nuclear extracts (15 µg) were resolved by 10% SDS-PAGE and transferred onto nitrocellulose filters. In each experiment, duplicate membranes were prepared. The membranes were incubated with 3% nonfat milk in PBS for 1.5 h and then incubated overnight at 4 C with rabbit polyclonal antibodies against either total CREB or Ser-133-phosphorylated CREB (Upstate Biotechnology, Inc., Lake Placid, NY). Immunoreactive proteins were detected using an antirabbit horseradish peroxidase-conjugated antibody and the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Arlington Heights, IL). Bands were detected with Kodak (Rochester, NY) X-Omat film and quantitated using a GS-700 Imaging Densitometer (Bio-Rad Laboratories, Inc., Hercules, CA).


    ACKNOWLEDGMENTS
 
We thank Richard P. Blye for providing the GnRH receptor antagonist, azaline B; Brigitte G. Mann for RIAs; Masafumi Ito for Gal4-ER; Jeff Leiden for mutant CREB; James B. Young and Eun Jig Lee for technical assistance in tail vein injection and carotid arterial catheterization; and Jeffrey Weiss and Teresa K. Woodruff for helpful comments and suggestions.


    FOOTNOTES
 
Address requests for reprints to: J. Larry Jameson, M.D., Ph.D., Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, Tarry 15–709, 303 East Chicago Avenue, Chicago, Illinois 60611-3008.

This work was conducted as a part of the National Cooperative Program on Infertility Research and was supported by NIH Grants U54-HD-29164 and RO3 HD-36391. RIAs were performed by the P30 RIA core facility (NIH Grant HD-28048). Rachel Duan is a recipient of NIH Fellowship Award HD-08311 and Jennifer Shin received a summer fellowship grant from The Endocrine Society.

Received for publication December 15, 1998. Revision received April 21, 1999. Accepted for publication May 3, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Schally A, Arimura A, Kastin A 1973 Hypothalamic regulatory hormones. Science 179:341–350[Abstract/Free Full Text]
  2. Crowley WF, Filicori M, Spratt DI, Santoro NF 1985 The physiology of gonadotropin-releasing hormone (GnRH) secretion in men and women. Recent Prog Horm Res 41:473–531
  3. Clarke IJ, Cummins JT 1982 The temporal relationship between gonadotropin-releasing hormone (GnRH) and luteinizing hormone (LH) secretion in ovariectomized ewes. Endocrinology 111:1737–1739[Abstract/Free Full Text]
  4. Marshall JC, Dalkin AC, Haisenleder DJ, Griffin ML, Kelch RP 1992 GnRH pulses–the regulators of human reproduction. Trans Am Clin Climatol Assoc 104:31–46[Medline]
  5. Marshall JC, Dalkin AC, Haisenleder DJ, Paul SJ, Ortolano GA, Kelch RP 1991 Gonadotropin-releasing hormone pulses: regulators of gonadotropin synthesis and ovulatory cycles. Recent Prog Horm Res 47:155–187
  6. Haisenleder DJ, Dalkin AC, Ortolano GA, Marshall JC, Shupnik MA 1991 A pulsatile gonadotropin-releasing hormone stimulus is required to increase transcription of the gonadotropin subunit genes: evidence for differential regulation of transcription by pulse frequency in vivo. Endocrinology 128:509–517[Abstract/Free Full Text]
  7. Haisenleder DJ, Dalkin AC, Marshall JC 1994 Regulation of gonadotropin gene expression. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 1793–1813
  8. Weiss J, Jameson JL, Burrin JM, Crowley Jr WF 1990 Divergent responses of gonadotropin subunit messenger RNAs to continuous versus pulsatile gonadotropin- releasing hormone in vitro. Mol Endocrinol 4:557–564[Abstract/Free Full Text]
  9. Stojilkovic SS, Catt KJ 1995 Expression and signal transduction pathways of gonadotropin-releasing hormone receptors. Recent Prog Horm Res 50:161–205
  10. Naor Z, Harris D, Shacham S 1998 Mechanism of GnRH receptor signaling: combinatorial cross-talk of Ca2+ and protein kinase C. Front Neuroendocrinol 19:1–19[CrossRef][Medline]
  11. Conn PM, Janovick JA, Stanislaus D, Kuphal D, Jennes L 1995 Molecular and cellular bases of gonadotropin-releasing hormone action in the pituitary and central nervous system. Vitam Horm 50:151–214[Medline]
  12. Andrews WV, Hansen JR, Janovick JA, Conn PM 1990 Gonadotropin-releasing hormone modulation of protein kinase-C activity in perifused anterior pituitary cell cultures. Endocrinology 127:2393–2399[Abstract/Free Full Text]
  13. Albanese C, Colin IM, Crowley WF, Ito M, Pestell RG, Weiss J, Jameson JL 1996 The gonadotropin genes: evolution of distinct mechanisms for hormonal control. Recent Prog Horm Res 51:23–58
  14. Kay TW, Chedrese PJ, Jameson JL 1994 Gonadotropin-releasing hormone causes transcriptional stimulation followed by desensitization of the glycoprotein hormone alpha promoter in transfected {alpha}T3 gonadotrope cells. Endocrinology 134:568–573[Abstract/Free Full Text]
  15. Colin IM, Jameson JL 1998 Estradiol sensitization of rat pituitary cells to GnRH: involvement of protein kinase C- and calcium-dependent signaling pathways. Endocrinology 139:3796–3802[Abstract/Free Full Text]
  16. Sundaresan S, Colin IM, Pestell RG, Jameson JL 1996 Stimulation of mitogen-activated protein kinase by gonadotropin-releasing hormone: evidence for the involvement of protein kinase C. Endocrinology 137:304–311[Abstract]
  17. Reiss N, Llevi LN, Shacham S, Harris D, Seger R, Naor Z 1997 Mechanism of mitogen-activated protein kinase activation by gonadotropin-releasing hormone in the pituitary of {alpha}T3–1 cell line: differential roles of calcium and protein kinase C. Endocrinology 138:1673–1682[Abstract/Free Full Text]
  18. Evans NP, Dahl GE, Mauger D, Karsch FJ 1995 Estradiol induces both qualitative and quantitative changes in the pattern of gonadotropin-releasing hormone secretion during the presurge period in the ewe. Endocrinology 136:1603–1609[Abstract]
  19. Speight A, Popkin R, Watts AG, Fink G 1981 Oestradiol-17ß increases pituitary responsiveness by a mechanism that involves the release and the priming effect of luteinizing hormone releasing factor. J Endocrinol 88:301–308[Abstract/Free Full Text]
  20. Keye Jr WR, Jaffe RB 1975 Strength-duration characteristics of estrogen effects on gonadotropin response to gonadotropin-releasing hormone in women. I. Effects of varying duration of estradiol administration. J Clin Endocrinol Metab 41:1003–1008[Abstract/Free Full Text]
  21. Yen SS, Tsai CC, Naftolin F, Vandenberg G, Ajabor L 1972 Pulsatile patterns of gonadotropin release in subjects with and without ovarian function. J Clin Endocrinol Metab 34:671–675[Abstract/Free Full Text]
  22. Knobil E 1980 The neuroendocrine control of the menstrual cycle. Recent Prog Horm Res 36:53–88
  23. Liu JH, Yen SS 1983 Induction of midcycle gonadotropin surge by ovarian steroids in women: a critical evaluation. J Clin Endocrinol Metab 57:797–802[Abstract/Free Full Text]
  24. Sarkar DK, Fink G 1980 Luteinizing hormone releasing factor in pituitary stalk plasma from long-term ovariectomized rats: effects of steroids. J Endocrinol 86:511–524[Abstract/Free Full Text]
  25. Leipheimer RE, Bona-Gallo A, Gallo RV 1984 The influence of progesterone and estradiol on the acute changes in pulsatile luteinizing hormone release induced by ovariectomy on diestrus day 1 in the rat. Endocrinology 114:1605–1612[Abstract/Free Full Text]
  26. Leipheimer RE, Bona-Gallo A, Gallo RV 1986 Influence of estradiol and progesterone on pulsatile LH secretion in 8-day ovariectomized rats. Neuroendocrinology 43: 300–307
  27. Higuchi T, Kawakami M 1982 Changes in the characteristics of pulsatile luteinizing hormone secretion during the oestrous cycle and after ovariectomy and oestrogen treatment in female rats. J Endocrinol 94:177–182[Abstract/Free Full Text]
  28. Evans NP, Dahl GE, Glover BH, Karsch FJ 1994 Central regulation of pulsatile gonadotropin-releasing hormone (GnRH) secretion by estradiol during the period leading up to the preovulatory GnRH surge in the ewe. Endocrinology 134:1806–1811[Abstract/Free Full Text]
  29. Shupnik MA, Gharib SD, Chin WW 1988 Estrogen suppresses rat gonadotropin gene transcription in vivo. Endocrinology 122:1842–1846[Abstract/Free Full Text]
  30. Nilson JH, Nejedlik MT, Virgin JB, Crowder ME, Nett TM 1983 Expression of {alpha} subunit and luteinizing hormone ß genes in the ovine anterior pituitary. Estradiol suppresses accumulation of mRNAS for both {alpha} subunit and luteinizing hormone ß. J Biol Chem 258:12087–12090[Abstract/Free Full Text]
  31. Mercer JE, Clements JA, Funder JW, Clarke IJ 1989 Regulation of follicle-stimulating hormone beta and common {alpha}-subunit messenger ribonucleic acid by gonadotropin-releasing hormone and estrogen in the sheep pituitary. Neuroendocrinology 50:321–326[CrossRef][Medline]
  32. Counis R, Corbani M, Jutisz M 1983 Estradiol regulates mRNAs encoding precursors to rat lutropin (LH) and follitropin (FSH) subunits. Biochem Biophys Res Commun 114:65–72[CrossRef][Medline]
  33. Colin IM, Bauer-Dantoin AC, Sundaresan S, Kopp P, Jameson JL 1996 Sexually dimorphic transcriptional responses to gonadotropin-releasing hormone require chronic in vivo exposure to estradiol. Endocrinology 137:2300–2307[Abstract]
  34. Keri RA, Andersen B, Kennedy GC, Hamernik DL, Clay CM, Brace AD, Nett TM, Notides AC, Nilson JH 1991 Estradiol inhibits transcription of the human glycoprotein hormone {alpha}-subunit gene despite the absence of a high affinity binding site for estrogen receptor. Mol Endocrinol 5:725–733[Abstract/Free Full Text]
  35. Jameson JL, Hollenberg AN 1993 Regulation of chorionic gonadotropin gene expression. Endocr Rev 14:203–221[Abstract/Free Full Text]
  36. Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A, Nilson JH 1987 Cyclic AMP regulation of the human glycoprotein hormone {alpha}-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad Sci USA 84:2198–2202[Abstract/Free Full Text]
  37. Kay TW, Jameson JL 1992 Identification of a gonadotropin-releasing hormone-responsive region in the glycoprotein hormone {alpha}-subunit promoter. Mol Endocrinol 6:1767–1773[Abstract/Free Full Text]
  38. Roberson MS, Misra-Press A, Laurance ME, Stork PJ, Maurer RA 1995 A role for mitogen-activated protein kinase in mediating activation of the glycoprotein hormone {alpha}-subunit promoter by gonadotropin-releasing hormone. Mol Cell Biol 15:3531–3539[Abstract/Free Full Text]
  39. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue- specific enhancer of the human glycoprotein hormone {alpha}-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  40. Deutsch PJ, Jameson JL, Habener JF 1987 Cyclic AMP responsiveness of human gonadotropin-{alpha} gene transcription is directed by a repeated 18-base pair enhancer. {alpha}-Promoter receptivity to the enhancer confers cell-preferential expression. J Biol Chem 262: 12169–12174
  41. Andersen B, Kennedy GC, Hamernik DL, Bokar JA, Bohinski R, Nilson JH 1990 Amplification of the transcriptional signal mediated by the tandem cAMP response elements of the glycoprotein hormone {alpha}-subunit gene occurs through several distinct mechanisms. Mol Endocrinol 4:573–582[Abstract/Free Full Text]
  42. Gonzalez GA, Yamamoto KK, Fischer WH, Karr D, Menzel P, Biggs Wd, Vale WW, Montminy MR 1989 A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence. Nature 337:749–752[CrossRef][Medline]
  43. Brindle PK, Montminy MR 1992 The CREB family of transcription activators. Curr Opin Genet Dev 2:199–204[CrossRef][Medline]
  44. Alberts AS, Arias J, Hagiwara M, Montminy MR, Feramisco JR 1994 Recombinant cyclic AMP response element binding protein (CREB) phosphorylated on Ser-133 is transcriptionally active upon its introduction into fibroblast nuclei. J Biol Chem 269:7623–7630[Abstract/Free Full Text]
  45. Yamamoto KK, Gonzalez GA, Biggs III WH, Montminy MR 1988 Phosphorylation-induced binding and transcriptional efficacy of nuclear factor CREB. Nature 334:494–498[CrossRef][Medline]
  46. Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675–680[CrossRef][Medline]
  47. Gonzalez GA, Menzel P, Leonard J, Fischer WH, Montminy MR 1991 Characterization of motifs which are critical for activity of the cyclic AMP-responsive transcription factor CREB. Mol Cell Biol 11:1306–1312[Abstract/Free Full Text]
  48. Xie H, Rothstein TL 1995 Protein kinase C mediates activation of nuclear cAMP response element-binding protein (CREB) in B lymphocytes stimulated through surface Ig. J Immunol 154:1717–1723[Abstract]
  49. Sheng M, Thompson MA, Greenberg ME 1991 CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252:1427–1430[Abstract/Free Full Text]
  50. Dash PK, Karl KA, Colicos MA, Prywes R, Kandel ER 1991 cAMP response element-binding protein is activated by Ca2+/calmodulin- as well as cAMP-dependent protein kinase. Proc Natl Acad Sci USA 88:5061–5065[Abstract/Free Full Text]
  51. Sun P, Enslen H, Myung PS, Maurer RA 1994 Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Genes Dev 8:2527–2539[Abstract/Free Full Text]
  52. Matthews RP, Guthrie CR, Wailes LM, Zhao X, Means AR, McKnight GS 1994 Calcium/calmodulin-dependent protein kinase types II and IV differentially regulate CREB-dependent gene expression. Mol Cell Biol 14:6107–6116[Abstract/Free Full Text]
  53. Xing J, Kornhauser JM, Xia Z, Thiele EA, Greenberg ME 1998 Nerve growth factor activates extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways to stimulate CREB serine 133 phosphorylation. Mol Cell Biol 18:1946–1955[Abstract/Free Full Text]
  54. Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. Proc Natl Acad Sci USA 91:8517–8521[Abstract/Free Full Text]
  55. Nakhla AM, Khan MS, Romas NP, Rosner W 1994 Estradiol causes the rapid accumulation of cAMP in human prostate. Proc Natl Acad Sci USA 91:5402–5405[Abstract/Free Full Text]
  56. Szego CM, Davis JS 1967 Adenosine 3',5'-monophosphate in rat uterus: acute elevation by estrogen. Proc Natl Acad Sci USA 58:1711–1718[Free Full Text]
  57. Gu G, Rojo AA, Zee MC, Yu J, Simerly RB 1996 Hormonal regulation of CREB phosphorylation in the anteroventral periventricular nucleus. J Neurosci 16:3035–3044[Abstract/Free Full Text]
  58. Zhou Y, Watters JJ, Dorsa DM 1996 Estrogen rapidly induces the phosphorylation of the cAMP response element binding protein in rat brain. Endocrinology 137:2163–2166[Abstract]
  59. Watters JJ, Dorsa DM 1998 Transcriptional effects of estrogen on neuronal neurotensin gene expression involve cAMP/protein kinase A-dependent signaling mechanisms. J Neurosci 18:6672–6680[Abstract/Free Full Text]
  60. Struthers RS, Vale WW, Arias C, Sawchenko PE, Montminy MR 1991 Somatotroph hypoplasia and dwarfism in transgenic mice expressing a non-phosphorylatable CREB mutant. Nature 350:622–624[CrossRef][Medline]
  61. Campen CA, Lai MT, Kraft P, Kirchner T, Phillips A, Hahn DW, Rivier J 1995 Potent pituitary-gonadal axis suppression and extremely low anaphylactoid activity of a new gonadotropin releasing hormone (GnRH) receptor antagonist "azaline B." Biochem Pharmacol 49:1313–1321[CrossRef][Medline]
  62. Bronson FH, Vom Saal FS 1979 Control of the preovulatory release of luteinizing hormone by steroids in the mouse. Endocrinology 104:1247–1255[Abstract/Free Full Text]
  63. Herbison AE 1998 Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocr Rev 19:302–330[Abstract/Free Full Text]
  64. Levine JE 1997 New concepts of the neuroendocrine regulation of gonadotropin surges in rats. Biol Reprod 56:293–302[Abstract]
  65. Mercer JE, Clements JA, Funder JW, Clarke IJ 1989 Regulation of follicle-stimulating hormone b- and a-subunit messenger ribonucleic acid by gonadotropin-releasing hormone and estrogen in the sheep pituitary. Neuroendocrinology 50:321–326
  66. Nett TM, Flores JA, Carnevali F, Kile JP 1990 Evidence for a direct negative effect of estradiol at the level of the pituitary gland in sheep. Biol Reprod 43:554–558[Abstract]
  67. Marshall JC, Kelch RP 1986 Gonadotropin-releasing hormone: role of pulsatile secretion in the regulation of reproduction. N Engl J Med 315:1459–1468[Medline]
  68. Kamel F, Balz JA, Kubajak CL, Schneider VA 1987 Effects of luteinizing hormone (LH)-releasing hormone pulse amplitude and frequency on LH secretion by perifused rat anterior pituitary cells. Endocrinology 120:1644–1650[Abstract/Free Full Text]
  69. Abbud R, Ameduri R, Nilson J, Chronic hypersecretion in transgenic mice alters the profile of gene expression in gonadotropes. Program of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998 (Abstract), p 339
  70. Childs G 1984 Fluidity of gonadotropin storage in cycling female rats. In: McKerns K, Naor Z (eds) Hormonal Control of the Hypothalamo-Pituitary-Gonadal Axis. Plenum Press, New York, pp 181–198
  71. Fellmann D, Bresson JL, Clavequin MC, Bugnon C 1982 Quantitative immunocytochemical studies on the gonadotrophs isolated from the pituitary of the male rat. Cell Tissue Res 224:137–144[CrossRef][Medline]
  72. Bertherat J 1997 Nuclear effects of the cAMP pathway activation in somatotrophs. Horm Res 47:245–250[Medline]
  73. Keech CA, Jackson SM, Siddiqui SK, Ocran KW, Gutierrez-Hartmann A 1992 Cyclic adenosine 3',5'-monophosphate activation of the rat prolactin promoter is restricted to the pituitary-specific cell type. Mol Endocrinol 6:2059–2070[Abstract/Free Full Text]
  74. Coleman DT, Chen X, Sassaroli M, Bancroft C 1996 Pituitary adenylate cyclase-activating polypeptide regulates prolactin promoter activity via a protein kinase A-mediated pathway that is independent of the transcriptional pathway employed by thyrotropin-releasing hormone. Endocrinology 137:1276–1285[Abstract]
  75. Childs GV 1990 Localization of gonadotropin-releasing hormone receptors. Methods Enzymol 184:395–404[Medline]
  76. Childs GV, Unabia G, Miller BT 1994 Cytochemical detection of gonadotropin-releasing hormone-binding sites on rat pituitary cells with luteinizing hormone, follicle-stimulating hormone, and growth hormone antigens during diestrous up-regulation. Endocrinology 134:1943–1951[Abstract/Free Full Text]
  77. Denef C, Andries M 1983 Evidence for paracrine interaction between gonadotrophs and lactotrophs in pituitary cell aggregates. Endocrinology 112:813–822[Abstract/Free Full Text]
  78. Bito H, Deisseroth K, Tsien RW 1996 CREB phosphorylation and dephosphorylation: a Ca(2+)- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87:1203–1214[CrossRef][Medline]
  79. Panickar KS, Guan G, King MA, Rajakumar G, Simpkins JW 1997 17ß-Estradiol attenuates CREB decline in the rat hippocampus following seizure. J Neurobiol 33:961–967[CrossRef][Medline]
  80. Deisseroth K, Bito H, Tsien RW 1996 Signaling from synapse to nucleus: postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic plasticity. Neuron 16:89–101[CrossRef][Medline]
  81. Murphy DD, Segal M 1997 Morphological plasticity of dendritic spines in central neurons is mediated by activation of cAMP response element binding protein. Proc Natl Acad Sci USA 94:1482–1487[Abstract/Free Full Text]
  82. Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47–55[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson
GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems
Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Sasson, S. H. Luu, V. G. Thackray, and P. L. Mellon
Glucocorticoids Induce Human Glycoprotein Hormone {alpha}-Subunit Gene Expression in the Gonadotrope
Endocrinology, July 1, 2008; 149(7): 3643 - 3655.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly
Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs
J. Endocrinol., March 1, 2008; 196(3): 497 - 507.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Kowase, H. E. Walsh, D. S. Darling, and M. A. Shupnik
Estrogen Enhances Gonadotropin-Releasing Hormone-Stimulated Transcription of the Luteinizing Hormone Subunit Promoters via Altered Expression of Stimulatory and Suppressive Transcription Factors
Endocrinology, December 1, 2007; 148(12): 6083 - 6091.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Shafiee-Kermani, S.-o. Han, and W. L. Miller
Chronic Gonadotropin-Releasing Hormone Inhibits Activin Induction of the Ovine Follicle-Stimulating Hormone {beta}-Subunit: Involvement of 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein and Nitric Oxide Synthase Type I
Endocrinology, July 1, 2007; 148(7): 3346 - 3355.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Galmiche, N. Richard, S. Corvaisier, and M.-L. Kottler
The Expression of Aromatase in Gonadotropes Is Regulated by Estradiol and Gonadotropin-Releasing Hormone in a Manner that Differs from the Regulation of Luteinizing Hormone
Endocrinology, September 1, 2006; 147(9): 4234 - 4244.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. J. Westphal and A. F. Seasholtz
Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
L L Burger, D J Haisenleder, A C Dalkin, and J C Marshall
Regulation of gonadotropin subunit gene transcription
J. Mol. Endocrinol., December 1, 2004; 33(3): 559 - 584.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Ishikawa, E. J. Lee, and J. L. Jameson
Nonhomologous End-Joining Ligation Transfers DNA Regulatory Elements between Cointroduced Plasmids
Mol. Cell. Biol., October 1, 2004; 24(19): 8323 - 8331.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Hestiantoro and D. F. Swaab
Changes in Estrogen Receptor-{alpha} and -{beta} in the Infundibular Nucleus of the Human Hypothalamus Are Related to the Occurrence of Alzheimer's Disease Neuropathology
J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1912 - 1925.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. B. Speert, S. J. MCClennen, and A. F. Seasholtz
Sexually Dimorphic Expression of Corticotropin-Releasing Hormone-Binding Protein in the Mouse Pituitary
Endocrinology, December 1, 2002; 143(12): 4730 - 4741.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. R. Duan, M. Ito, Y. Park, E. T. Maizels, M. Hunzicker-Dunn, and J. L. Jameson
GnRH Regulates Early Growth Response Protein 1 Transcription Through Multiple Promoter Elements
Mol. Endocrinol., February 1, 2002; 16(2): 221 - 233.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Curtin, S. Jenkins, N. Farmer, A. C. Anderson, D. J. Haisenleder, E. Rissman, E. M. Wilson, and M. A. Shupnik
Androgen Suppression of GnRH-Stimulated Rat LH{beta} Gene Transcription Occurs Through Sp1 Sites in the Distal GnRH-Responsive Promoter Region
Mol. Endocrinol., November 1, 2001; 15(11): 1906 - 1917.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. M. Thway and M. W. Wolfe
Epidermal Growth Factor Regulation of Equine Glycoprotein Hormone {{alpha}} Subunit Expression in Trophoblast Cells
Biol Reprod, July 1, 2001; 65(1): 197 - 203.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. L. Heckert
Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element
Mol. Endocrinol., May 1, 2001; 15(5): 704 - 715.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
W.-X. Gu, P. H. Stern, L. D. Madison, and G.-G. Du
Mutual Up-Regulation of Thyroid Hormone and Parathyroid Hormone Receptors in Rat Osteoblastic Osteosarcoma 17/2.8 Cells
Endocrinology, January 1, 2001; 142(1): 157 - 164.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M.-L. Kottler, S. Chauvin, N. Lahlou, C. E. Harris, C. J. Johnston, J.-P. Lagarde, P. Bouchard, N. R. Farid, and R. Counis
A New Compound Heterozygous Mutation of the Gonadotropin-Releasing Hormone Receptor (L314X, Q106R) in a Woman with Complete Hypogonadotropic Hypogonadism: Chronic Estrogen Administration Amplifies the Gonadotropin Defect
J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3002 - 3008.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duan, W. R.
Right arrow Articles by Jameson, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duan, W. R.
Right arrow Articles by Jameson, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals