Molecular Endocrinology 13 (8): 1338-1352
Copyright © 1999 by The Endocrine Society
Estradiol Suppresses Phosphorylation of Cyclic Adenosine 3',5'-Monophosphate Response Element Binding Protein (CREB) in the Pituitary: Evidence for Indirect Action via Gonadotropin-Releasing Hormone
W. Rachel Duan,
Jennifer L. Shin and
J. Larry Jameson
Division of Endocrinology, Metabolism, and Molecular Medicine
Northwestern University Medical School Chicago, Illinois 60611
 |
ABSTRACT
|
|---|
Estradiol acts on the hypothalamus
and pituitary gland to modulate the synthesis and secretion of
gonadotropins. We recently reported that GnRH-induced transcription of
the human gonadotropin
-gene promoter is increased
markedly in transfected pituitary cells derived from animals treated
with estradiol. Because the cAMP response element binding (CREB)
protein plays an important role in the transcriptional regulation of
this promoter and is highly regulated by posttranslational
phosphorylation, we hypothesized that it might serve as a target for
estradiol-induced sensitivity to GnRH. In this study, we assessed the
roles of estradiol and GnRH in the regulation of CREB phosphorylation
in the rat pituitary. Using an antibody that specifically recognizes
phosphorylated CREB (pCREB), we found that the pituitary content of
pCREB was inversely related to the level of estradiol during the
estrous cycle. Ovariectomy increased the level of pCREB, and treatment
with estradiol for 10 days decreased the content of pCREB dramatically
(93% inhibition). A similar reduction of pCREB was seen when
ovariectomized rats were treated with a GnRH receptor antagonist for 10
days. This result indicates that the ovariectomy-induced increase in
pCREB is GnRH-dependent. In
T3 gonadotrope cells,
estradiol had no direct effect on CREB phosphorylation, whereas GnRH
increased CREB phosphorylation 4- to 5-fold within 5 min. We conclude
that estradiol inhibits CREB phosphorylation in the gonadotrope,
probably by inhibiting GnRH production. The estradiol-induced decrease
in CREB phosphorylation is proposed to lower basal
-promoter activity and increase its responsiveness to
GnRH. (Molecular Endocrinology 13: 13381352, 1999)
 |
INTRODUCTION
|
|---|
The secretion of LH and FSH by gonadotrope cells is controlled by
a variety of hormones produced by the hypothalamus, pituitary gland,
and gonads. GnRH, synthesized by neurons in the hypothalamus, plays a
dominant role in gonadotropin regulation (1). Pulsatile release of GnRH
is necessary for expression of the gonadotropin genes and for hormone
secretion (2, 3, 4). Transcriptional activation of the gonadotropin
subunit (
, LHß, and FSHß) genes is regulated differentially by
GnRH pulse frequency (5, 6, 7, 8).
GnRH initiates intracellular signaling in gonadotropes by binding to
its seven-transmembrane G protein-coupled receptor, activating
phospholipase C and leading to the formation of inositol
1,4,5-triphosphate and diacylglycerol (9, 10, 11). Inositol
1,4,5-triphosphate causes the release of intracellular
Ca2+, which, together with diacylglycerol, activates
protein kinases (9, 10, 12). GnRH also activates other signaling
pathways. The protein kinase C (PKC) pathway appears to play a central
role in the transcriptional regulation of the
-promoter by GnRH
(9, 10, 11, 13). When
T3 cells are pretreated with
phorbol-12-myristate-13-acetate to deplete PKC, GnRH stimulation
of the
-promoter is inhibited (14, 15). PKC may also activate other
kinases, such as mitogen-activated protein kinase (MAPK) (16, 17).
In addition to GnRH, steroids from the gonads regulate the synthesis
and secretion of gonadotropins. The mechanisms of feedback regulation
by sex steroids are complex and include effects at both the
hypothalamic and pituitary levels. During the female reproductive
cycle, estradiol secreted on diestrus is thought to stimulate
GnRH secretion and potentiate the responsiveness of the pituitary gland
to GnRH, providing part of the basis for the LH surge (18, 19, 20, 21, 22, 23). In
addition to this positive feedback of estradiol during the reproductive
cycle, chronic exposure to estradiol exerts an inhibitory effect. For
example, ovariectomy increases, and estradiol replacement restrains,
both LH pulse frequency and amplitude (24, 25, 26, 27, 28). In parallel, the mRNA
levels of LHß and FSHß markedly increase after ovariectomy, and
estrogen treatment suppresses gonadotropin mRNAs (29, 30, 31, 32).
Recently, we found that estradiol has profound effects on the degree of
GnRH stimulation of human
-promoter activity in transfected
pituitary cells (33). The basal activity of the
-promoter was
consistently reduced in females compared with males. On the other hand,
-promoter activity was stimulated more than a 100-fold by GnRH in
cells derived from female pituitaries, whereas only a 5- to 10-fold
stimulation was seen in cells from males (33). Further studies
indicated that these sex-specific differences in GnRH responsiveness
are largely accounted for by estradiol, and not testosterone, since the
chronic administration of estradiol to ovariectomized females or
castrate males restored GnRH responsiveness and reduced the basal
activity of the
-promoter (33). Although
-promoter activity is
dramatically affected by estrogen, the mechanism of this effect is not
clear. No high-affinity estrogen receptor-binding sites have been
identified in the
-promoter (34), suggesting that estrogen
regulation may involve other proteins, or that it may be indirect.
The regulatory elements in the human
-promoter have been well
characterized (13, 35, 36). Several different regions of this promoter
appear to be involved in GnRH responsiveness (13, 16, 37, 38).
Deletions or mutations of sequences between -346 and -244 bp reduce,
but do not eliminate, GnRH responsiveness (37, 38). This region
includes binding sites for proteins that are regulated by the MAPK
pathway, which is stimulated by GnRH (10, 16, 17, 38). Mutations in the
two cAMP response elements (CREs), which provide binding sites for
transcription factor CREB (CRE-binding protein) (13, 35),
greatly reduce the basal activity of the
-promoter (39, 40, 41) and may
also be involved in GnRH responsiveness. The role of the CREs in GnRH
regulation has not been fully defined, however, because the activity of
the promoter is greatly reduced by mutations of these sites. Because
the CREs play a critical role in the regulation of the
-promoter,
CREB is a potential candidate for regulation by GnRH signaling
pathways. CREB contains several consensus phosphorylation sites for
various kinases (42), and phosphorylation at serine 133 (Ser-133) is
necessary for its transcriptional activation (43, 44, 45). Ser-133 can be
phosphorylated by protein kinase A (46, 47), PKC (48), calcium
calmodulin-dependent kinase (CaMK) II (49, 50), CaMKIV (51, 52),
extracellular signal-regulated kinase (ERK), and p38 MAPK (53).
Estrogen has been reported to stimulate adenylate cyclase and
cAMP-mediated gene transcription in human breast cancer cells, prostate
cells, and rat uterine cells (54, 55, 56). Moreover, estrogen has been
found to stimulate CREB phosphorylation at Ser-133 in rat brain (57, 58) and to enhance the expression of the neurotensin gene, which lacks
estrogen response elements (EREs), but contains CREB recognition sites
(59). Based on these findings, we hypothesized that CREB might be a key
target for estradiol effects in gonadotrope cells and thereby modulate
-promoter activity. In the present study, we investigated the
potential roles of estradiol and GnRH in the modulation of pituitary
CREB phosphorylation in vitro and in vivo.
 |
RESULTS
|
|---|
Deletion of CREs and a Dominant Negative Mutant of CREB Represses
Basal Activity and GnRH Responsiveness of the Human
-Promoter
Previously, we found a striking gender difference in the basal
activity and GnRH responsiveness of the human
-promoter when it is
introduced into pituitary cells from male or female rats (33). An
example of this phenomenon is shown in Fig. 1A
. When the -420
-Luc reporter
gene was transfected into pituitary cells derived from male or randomly
cycling female rats, basal
-promoter activity was 25% lower in the
pituitary cells from females compared with males. However, cells from
female rats showed a greater response to GnRH treatment (200-fold) in
comparison to the GnRH response of male pituitary cells (10-fold) (Fig. 1A
).
Because the activity of the
-promoter is strongly dependent on its
CREs (13), we tested whether the deletion of the CREs or expression of
a dominant negative mutant (Ser-133 Ala) of CREB (60) would alter basal
activity and GnRH responsiveness of the
-promoter. Pituitary cells
from randomly cycling female rats were transfected with -846
-Luc or
-846
-Luc
CRE, in which both copies of CREs have been removed.
Deletion of the CREs caused a marked reduction (6282%) in basal
expression and a 7086% decrease in GnRH-induced activity of the
-promoter. However, the fold of induction by GnRH remained similar
(Fig. 1B
). Coexpression of the dominant negative form of CREB
also markedly reduced basal
-promoter activity (80% inhibition) and
almost eliminated GnRH responsiveness (Fig. 1C
), whereas expression of
wild-type CREB had no effect on
-promoter activity (data not shown).
Similar results were obtained when the dominant negative CREB mutant
was expressed in
T3 cells (data not shown).
Pituitary Phosphorylated CREB Content Varies during the Estrous
Cycle
In view of the importance of the CREB for
-promoter activity,
we hypothesized that changes in CREB phosphorylation might underlie the
estrogen-dependent effects on basal and GnRH responsiveness of the
-promoter. As an initial effort to address this question, the amount
of phosphorylated CREB (pCREB) was assessed in the pituitaries of male
and female rats, and at different stages of the estrous cycle (Fig. 2
). Pituitaries from three to four
animals were homogenized and subjected to Western blot analysis using
an antibody specific for the Ser-133-phosphorylated form of CREB. As a
control, duplicate blots were analyzed in parallel with an antibody
recognizing total CREB. The pituitary content of pCREB varied widely
during the estrous cycle. pCREB was greatest at metestrus (120% of
male) and diestrus (86% of male), but was much lower during proestrus
(46% of male) and estrus (56% of male). The amount of total CREB
remained relatively constant during the cycle and was used to normalize
the level of phosphorylated CREB (pCREB/CREB). Thus, the level of pCREB
in male rats was similar to that of metestrus and diestrus females, and
the phosphorylation of CREB during the estrous cycle appears to vary
inversely with estradiol levels (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 2. Levels of pCREB in the Pituitary during the Estrous
Cycle
Female rats were monitored daily to ascertain the stage of the estrous
cycle and were killed between 0900 and 1100 h at the indicated
times during the cycle. Anterior pituitary glands were isolated and
homogenized. Western blot analyses were performed using duplicate blots
that were probed with antibodies against pCREB or total CREB,
respectively (upper panel). The percentage of pCREB
relative to total CREB was determined using densitometry and is shown
as the mean ± SEM (lower panel). The
results are the average of four experiments with two independent
batches of cycling rats. The level of pCREB/CREB in male rats is set at
100%. MET, Metestrus; DI, diestrus; PRO, proestrus; EST,
estrus.
|
|
pCREB Is Present in Gonadotropes and Other Pituitary Cell Types
Double-label immunohistochemistry was used to determine whether
pCREB is present in gonadotropes (Fig. 3
). Pituitary glands were fixed in
situ to minimize alterations in phosphorylation during tissue
preparation. Using the LHß antibody, strong cytoplasmic staining was
seen in a subset of cells (Fig. 3B
). pCREB staining, of variable
intensity, was seen in the nuclei of the majority of pituitary cells
(Fig. 3D
). Weak background cytoplasmic staining is seen in the absence
of pCREB antibody (Fig. 3C
). Colocalization of nuclear pCREB and
cytoplasmic LHß was seen in the majority of LHß-positive cells
(Fig. 3E
). However, pCREB staining is also seen in LHß-negative
cells, indicating that CREB is phosphorylated in both gonadotrope and
nongonadotrope cells.

View larger version (91K):
[in this window]
[in a new window]
|
Figure 3. Immunofluorescent Staining of LHß and pCREB in
the Pituitary
Frozen sections of whole pituitaries from random cycling female rats
were immunostained with primary antisera against either the rat LHß
subunit or pCREB. Immunoreactivity was visualized with a fluorescein
isothiocyanate-conjugated antibody to detect LHß
(green), and/or a rhodamine-conjugated antibody to
detect pCREB (red). A, Without anti-LHß. B, With
anti-LHß. C, Without anti-pCREB. D, With anti-pCREB. E, With
anti-LHß and anti-pCREB. (Magnification 400x)
|
|
Estradiol Down-Regulates Pituitary pCREB in
Vivo
Rats were ovariectomized (Ovx) for 10 days and implanted with
estradiol pellets for 3, 5, or 10 days to investigate the effect of
estradiol on CREB phosphorylation in vivo. Total pituitary
homogenates were subjected to Western blot analysis with anti-pCREB or
anti-CREB antibodies (Fig. 4
). As there
was variability in the level of pCREB in different animals, we
processed pituitaries individually. As shown in Fig. 4
, replacement of
estradiol decreased the level of pCREB in the pituitary dramatically,
and pCREB was almost undetectable after 10 days of treatment. By
comparison, the level of total CREB decreased only slightly. These
results are quantitated in the bottom panel, in which the
level of pCREB is adjusted for changes in total CREB. Compared with Ovx
rats, estradiol decreased pCREB to 49%, 21%, and 7% after 3, 5, and
10 days, respectively.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 4. Estradiol Inhibits CREB Phosphorylation in the Rat
Pituitary in Vivo
Rats, ovariectomized (OVX) for 1012 days, were implanted with or
without a 17ß-estradiol-filled SILASTIC capsule (5 mm in length).
After 3, 5, or 10 days of implantation (n = 3/group), anterior
pituitary glands were isolated and homogenized individually. Equal
amounts of pituitary proteins were separated on SDS-PAGE and
immunoblotted with anti-pCREB and anti-CREB antibodies (upper
panel). Each lane represents one animal. The relative amount of
pCREB/CREB is shown as the mean ± SEM from three
rats, and the results are normalized to the value in Ovx rats. Similar
results were obtained in two other experiments.
|
|
A GnRH Receptor Antagonist Reduces the Level of pCREB in the
Pituitary
Ovx rats were injected with the GnRH receptor antagonist,
azaline B (61), or with sesame oil vehicle to determine whether GnRH
input to the pituitary is required for the maintenance of CREB
phosphorylation. Ten days after injection, rats were killed, and trunk
blood was collected for LH and FSH assays to monitor the effectiveness
of the GnRH receptor antagonist. Western blot analyses were performed
with total pituitary homogenates using anti-pCREB and anti-CREB
antibodies. Consistent with the previous experiments (Fig. 4
),
ovariectomy increased pCREB (Fig. 5
).
However, all four rats that received the GnRH receptor antagonist
exhibited substantially reduced levels of pCREB (16% of Ovx), similar
to the effect seen in the estradiol-treated rats. The amount of total
CREB was not affected by administration of the antagonist. Serum levels
of LH and FSH in azaline B-treated rats were lower than in the control
group (Fig. 5
), confirming that the azaline B injection was effective.
These data suggest that GnRH input is required for ovariectomy-induced
CREB phosphorylation. Because the effects of GnRH are mediated
predominantly in gonadotrope cells, these findings also suggest that
gonadotropes are a major target of estradiol-induced changes in CREB
phosphorylation.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5. Suppression of CREB Phosphorylation by a GnRH
Receptor Antagonist in Vivo
Rats were ovariectomized (OVX) for 1012 days and received the GnRH
antagonist, azaline B (AZ) (400 µg sc/rat) or sesame oil. After 10
days, anterior pituitary glands were isolated and homogenized
individually. Equal amounts of pituitary proteins were separated by
SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB antibodies
(upper panel). The relative amount of pCREB/CREB is
shown as the mean ± SEM of three or four rats, and
the results are normalized to the value in Ovx rats (middle
panel). Similar results were obtained in another independent
experiment. The bottom panel shows serum levels of LH
and FSH determined by RIA. Each lane in the upper panel
corresponds to the hormone values from a single animal in the
bottom panel.
|
|
Estradiol-Induced Suppression of CREB Phosphorylation Is
Reversible
Estradiol pellets were removed after a 7-day implantation, and
rats were killed 4 days later (4 DAYS - estradiol) to assess whether
CREB phosphorylation increases in response to withdrawal of estradiol.
In parallel, another group of rats received either estradiol pellets
alone (estradiol, 10 DAYS) or estradiol pellets together with
azaline B (estradiol+AZ) for another 10 days to determine whether GnRH
input is required for estradiol-mediated suppression of pCREB. In
agreement with the previous observation, pCREB was strikingly reduced
(12% of Ovx) in estradiol-treated rats. As controls for the hormone
treatment, serum levels of estradiol were documented to increase, and
LH and FSH levels were decreased after estradiol administration (Fig. 6
). Withdrawal of estradiol, which is
expected to increase GnRH output, increased serum LH and FSH (Fig. 6B
).
In association with these changes, the decreased levels of serum
estradiol reversed the suppression of pCREB (70% of Ovx) (Fig. 6A
).
There was no significant difference in the level of pCREB between the
estradiol-treated group (12% of Ovx) and the estradiol plus azaline
B-treated group (10% of Ovx, Fig. 6
), suggesting that estradiol does
not have an additional inhibitory effect on pCREB. These results
support the idea that the suppressive effect of estradiol on pCREB is
indirect, probably resulting from inhibition of GnRH production.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 6. Effect of Removing Estradiol on CREB
Phosphorylation
Rats were ovariectomized (OVX) for 1012 days and implanted with a
17ß-estradiol-filled (E2) SILASTIC capsule for 10 days
(estradiol, 10 DAYS). In one group, Ovx rats received an estradiol
pellet together with azaline B injection for 10 days (estradiol, AZ).
In another group, estradiol pellets were removed after 7 days
implantation and anterior pituitary glands were isolated 4 days after
estradiol removal (estradiol, 4 DAYS-E2). Equal amounts of
pituitary proteins were separated by SDS-PAGE and immunoblotted with
anti-pCREB and anti-CREB antibodies (upper panel of A).
Each lane represents one animal. The relative amounts of pCREB/CREB are
shown as the mean ± SEM of three rats and are
normalized to the value in untreated Ovx rats. Panel B shows serum
levels of LH, FSH, and estradiol determined by RIA. Values shown are
the mean ± SEM of three rats. Similar results were
obtained in another independent experiment.
|
|
GnRH Is Not Able to Reverse the Inhibitory Effect of Estradiol on
CREB Phosphorylation in Vivo
Ovx rats were implanted with estradiol pellets for 10 days and
treated with pusatile GnRH to assess whether exogenous GnRH could
reverse estradiol-mediated suppression of pCREB. GnRH was administered
either for a short period (every 30 min for 2 h) or a longer
period (every hour for 6 h or 24 h). Under these conditions,
the pulses of GnRH did not increase the level of pCREB in the presence
of the estradiol pellet (Fig. 7
).
However, serum LH levels increased markedly after the administration of
pulsatile GnRH, confirming that it stimulated gonadotropin secretion
(Fig. 7
).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Effect of GnRH on CREB Phosphorylation in
Estradiol-Treated Rats
Rats were ovariectomized (OVX) for 1012 days and implanted with a
17ß-estradiol-filled (E2) SILASTIC capsule for 10 days.
For the 2-h GnRH treatment, GnRH pulses (50 µg/pulse, every 30 min)
were administered to the estradiol-treated rats intraperitoneally with
the final dose being given by tail vein injection. For the 6- or 24-h
GnRH treatments, rats were fitted with carotid arterial catheters and
received hourly pulses of GnRH (100 ng/pulse). Anterior pituitary
glands were isolated, and equal amounts of pituitary proteins were
separated by SDS-PAGE and immunoblotted with anti-pCREB and anti-CREB
antibodies (upper panel). Each lane represents one
animal. The relative amounts of pCREB/CREB are shown as the mean and
range of two rats and are normalized to the value in untreated Ovx rats
(middle panel). The bottom panel shows
the serum level of LH determined by RIA. Values shown are the mean
± SEM of two rats.
|
|
Estradiol Does Not Alter CREB Phosphorylation or CREB-Mediated
Transcription in Cell Cultures
Several different cell lines were used to explore the
possibility of a direct effect of estradiol on CREB
phosphorylation.
T3 gonadotrope cells were maintained in phenol
red-free media with charcoal-stripped serum for 48 h and then
treated with estradiol for various time intervals. Nuclear extracts
were prepared and Western blot analyses were performed using anti-pCREB
or anti-CREB antibodies. There was no effect of estradiol on CREB
phosphorylation, or CREB content, when cells were treated with
estradiol from 5 min to 4 h (Fig. 8A
). Similar results were obtained with
T47D estrogen-responsive breast cancer cells or primary cultures of
pituitary cells (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 8. Effect of Estradiol on CREB Phosphorylation in
T3 Cells
A, T3 cells were maintained in estrogen-depleted medium for at least
48 h. Cells were then treated with 1 nM estradiol for
the indicated lengths of time. Duplicate blots of nuclear extracts were
prepared and Western blot analyses were performed using antibodies
against pCREB or total CREB (upper panel). The
lower panel shows the quantification of the results
(mean ± SEM) from three independent experiments. The
fold change in the level of pCREB is normalized to the level in the
absence of estradiol treatment. B, T47D cells were grown in
estrogen-depleted medium for 5 days. Cells were cotransfected by
electroporation with the GAL4-ER or the GAL4-CREB expression vector and
a GAL4-responsive reporter gene, UAS-TK-Luc. Luciferase activity was
determined 48 h after treatment with estradiol (1 nM)
or 8-bromo-cAMP (1 mM). Results are the mean ±
SEM of triplicate transfections.
|
|
As an additional strategy to detect direct effects of estradiol
on CREB phosphorylation, reporter genes were introduced into T47D
cells. GAL4-ER or GAL4-CREB were cotransfected with the
UAS-TK-luciferase (UAS-TK-luc) reporter, and cells were treated
with estradiol or 8-bromo-cAMP for 48 h. As expected, estradiol
markedly increased GAL4-ER-dependent gene expression (Fig. 8B
). In
addition, cAMP stimulated GAL4-CREB activity (Fig. 8B
). In contrast,
estradiol failed to activate GAL4-CREB, consistent with the absence of
an estradiol effect on pCREB protein levels in these cells.
GnRH Stimulates CREB Phosphorylation in Vitro
T3 cells were treated with GnRH to examine whether it alters
CREB phosphorylation in gonadotrope cells. GnRH increased the level of
pCREB 4- to 5-fold within 5 min, and this level of phosphorylation was
sustained for at least 4 h. The total amount of CREB was unchanged
throughout this time course (Fig. 9
). The
lower band detected with the pCREB antibody in these cells may
represent another b-Zip family member, or a degradation product of
CREB. Similarly, GnRH increased CREB phosphorylation in 293 cells that
were stably transfected with the GnRH receptor (data not shown). To
determine whether long-term pretreatment with estradiol affects
GnRH-induced CREB phosphorylation,
T3 cells were treated with
estradiol for 5 days and then exposed to GnRH for 15 min. Pretreatment
with estradiol for 5 days did not alter CREB phosphorylation in
response to GnRH (data not shown).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 9. GnRH Stimulates CREB Phosphorylation in T3 Cells
T3 cells were grown in DMEM/F12 with 10% FBS and treated with GnRH
(10 nM) for different time courses. Duplicate blots of
nuclear extracts were prepared, and Western blot analyses were
performed with anti-pCREB and anti-CREB antibodies (upper
panel). The lower panel shows the fold changes
in the level of pCREB/CREB (mean ± SEM from three
independent experiments) normalized to the value in the absence of GnRH
treatment.
|
|
 |
DISCUSSION
|
|---|
Estrogen has complex effects on the hypothalamic-pituitary axis.
Estradiol, in combination with progesterone, exerts positive feedback
to enhance gonadotropin synthesis and secretion (19, 24, 62, 63, 64). On
the other hand, chronic treatment with estradiol suppresses pituitary
gonadotropin mRNA levels and inhibits gonadotropin secretion (24, 26, 29, 30, 63, 65). Recently, we developed a model for examining the
effects of estradiol on GnRH stimulation of the
-promoter
after it has been transfected into primary cultures of pituitary cells.
These experiments revealed that estradiol suppresses basal
-promoter
expression, but it dramatically enhances GnRH responsiveness of the
-promoter (33). Several aspects of this model warrant comment. The
effects of in vivo administration of estradiol persist in
the pituitary cells, despite the fact that they are cultured in
vitro for several days before the luciferase assays are performed.
Treatment with estradiol in vitro did not alter
-promoter
activity. Long-term (710 days) in vivo treatment was
necessary to see the estradiol effect. This combination of observations
led us to consider the possibility that estradiol treatment was
altering the expression or activity of a factor involved with the
modulation of pituitary sensitivity to GnRH. CREB phosphorylation was
considered as a likely step in such a pathway, since CREB is known to
be a critical factor involved in the regulation of
-promoter
transcription.
When we began these studies, existing data suggested the possibility
that estradiol might stimulate pituitary CREB phosphorylation or
enhance GnRH-mediated CREB phosphorylation. For example, acute
estradiol treatment (1530 min) of Ovx rats rapidly enhances CREB
phosphorylation in brain (57, 58, 59). Based on this observation, we tested
whether CREB phosphorylation varied during the estrous cycle,
anticipating that it might be greatest during proestrus, when estradiol
levels are high. Unexpectedly, the level of pCREB in the pituitary was
inversely related to estradiol during the estrous cycle. It was
greatest in metestrus and diestrus, and lowest in proestrus. This
inverse relationship between the level of estradiol and the level of
pCREB was supported by the finding that pCREB was relatively high in
males and increased in females after ovariectomy. Lastly, replacement
of estradiol in Ovx rats caused a striking decrease in the level of
pCREB. Interestingly, the reduction of pCREB required long-term
treatment of at least 5 days, which is reminiscent of our previous
findings using
-promoter activity as an indicator of the estradiol
effect (33).
Based on the long time course required for the estradiol effect and the
observation that estradiol reduces, rather than enhances, CREB
phosphorylation, we considered the possibility that estradiol might act
indirectly by inhibiting input from hypothalamic GnRH (24, 63). Azaline
B, a competitive antagonist of the GnRH receptor (61), was used to test
this hypothesis. Treatment with azaline B reduced pCREB in Ovx rats to
a level that was similar to that seen in estradiol-treated rats. The
serum levels of LH and FSH were also measured in these experiments to
assess the effectiveness of the GnRH antagonist. Suppressed levels of
LH and FSH were seen, as expected, except in one rat. It is notable
that in the rat with higher levels of LH and FSH, and incomplete
blockade by azaline B, there was a greater level of pCREB in the
pituitary.
Removal of the estradiol pellet for 4 days increased the level of
pCREB, and this effect paralleled the increase in serum LH and FSH.
These findings strengthen the notion that the lower amount of pCREB in
estradiol-treated rats is likely the result of reduced GnRH input. If
this is true, then it should be possible to reverse the effect of
estradiol treatment by the administration of exogenous GnRH. This
experiment was attempted in two different protocols. First, GnRH was
administered acutely (four pulses over 2 h) to
estra-diol-treated rats, and CREB phosphorylation was determined 20
min after the last injection. Although LH and FSH levels increased
dramatically after the injection of GnRH, the level of pCREB was not
increased. In a second paradigm, pulsatile GnRH was administered hourly
over a 6- or 24-h period, but again there was no change in the level of
pCREB. These findings raise the possibility that estradiol might have
additional direct effects on the pituitary. In fact, it has been
reported that pulses of GnRH are unable to override the inhibitory
effect of estradiol on
-subunit mRNA levels (66). Estradiol may
alter the production of other hypothalamic factors that are required
for GnRH-dependent CREB phosphorylation. Alternatively, and perhaps
most likely, longer treatment with pulsatile GnRH, or the use of
different pulse frequencies, may be required to prime pituitary
responses to GnRH (67, 68).
It is intriguing that in a transgenic mouse model in which there is
overexpression of the LHß subunit gene and increased estradiol
levels, endogenous LHß gene expression is responsive to steroid
feedback, whereas the
-subunit gene is resistant to estradiol
feedback and to regulation by GnRH (69). The level of CREB in the
pituitaries of these mice is increased dramatically (69). Our finding
that pCREB plays a critical role in the regulation of the
-promoter
activity by GnRH and estradiol may relate to these findings. The
persistently higher level of CREB in these transgenic mice may
contribute to a state of GnRH- and estradiol-independent expression of
the
-promoter.
The observation that the GnRH antagonist, azaline B, substantially
reduces pCREB in the pituitary argues that much of the pCREB detected
in these experiments is derived from GnRH-responsive cells. It is
somewhat surprising that estradiol and azaline B have such pronounced
effects on the level of pCREB in whole pituitaries since the
gonadotropes comprise only about 14% of pituitary cells (70, 71). CREB
is a ubiquitously expressed protein and CREB phosphorylation has been
documented in somatotropes (60, 72) and lactotropes (73, 74). In
experiments using double-label immunocytochemistry (LHß and pCREB),
we found that pCREB is present in both gonadotrope and nongonadotrope
cell types in the pituitary. It is possible that estradiol has direct
effects on several pituitary cell types. In addition, GnRH receptors
have been found on cells other than gonadotropes (75, 76), raising the
possibility that CREB phosphorylation in some of these cells might be
GnRH dependent. GnRH has also been demonstrated to act indirectly on
nongonadotrope cells (77). It is also possible that gonadotropes
comprise a population of cells that are particularly responsive to
changes in CREB phosphorylation. Further studies of dynamic changes in
phosphorylation with double- label immunohistochemical analysis in
specific cell types will be necessary to address this issue.
Consistent with the in vivo data suggesting that estradiol
is acting indirectly, via GnRH, to modulate the state of CREB
phosphorylation, we did not observe direct effects of estradiol on CREB
phosphorylation in vitro. For example, treatment of
T3
cells with estradiol from 5 min to 4 h did not change the level of
pCREB. Similar results were seen in primary cultures of pituitary cells
(data not shown). Furthermore, transient transfection experiments with
estrogen-responsive T47D cells confirmed the lack of a direct
stimulatory effect of estradiol on CREB phosphorylation. These findings
raise the possibility that some of the acute estradiol effects in the
brain (57, 58, 59) might also be indirect, perhaps reflecting the release
of neurotransmitters that in turn alter the state of CREB
phosphorylation (78, 79, 80, 81).
In light of data suggesting that GnRH input is critical for
estradiol-induced changes in pCREB, we used
T3 gonadotrope cells to
further explore the direct phosphorylation of CREB by GnRH. As
expected, GnRH stimulated CREB phosphorylation by 4- to 5-fold within 5
min. Although the PKC and calcium pathways, among others, have been
shown to mediate many of the downstream effects of GnRH (9, 10), it
remains to be determined which of the many potential signaling pathways
that are involved in CREB phosphorylation (46, 48, 49, 50, 51, 52, 53) might be
affected by GnRH.
These results emphasize the importance of identifying other
transcription factors and DNA sequences in the
-promoter that are
regulated by GnRH. In our experience, these experiments are difficult
to interpret in
T3 cells because GnRH treatment of these cells
stimulates the activity of most reporter genes, including many control
promoters that are not expected to be GnRH responsive (our
unpublished data). For this reason, we performed analyses of GnRH
responsiveness in primary cultures of pituitary cells, even though
transfection efficiency and the level of expression is relatively low.
In these cells, GnRH stimulates the
-promoter, but it does not
activate control promoters (33). Mutation of the CREs in the
-promoter greatly reduced basal activity, as expected. However, it
was still possible to detect GnRH responsiveness, indicating that the
CREs are not essential for at least part of the GnRH response. However,
because basal activity is greatly reduced by the CRE deletion, the
absolute level of promoter activity after GnRH stimulation is greatly
diminished. These findings underscore the importance of distinguishing
effects on basal and GnRH-stimulated activity. In contrast, a dominant
negative mutant of CREB blocks both basal activity and GnRH
responsiveness. The more potent inhibition by mutant CREB in comparison
to deletion of the CREs raises the possibility that the mutant
transcription factor exerts a more general effect to impair the
assembly of an active transcription complex. Clearly, additional
studies are needed to further localize GnRH response elements in this
promoter and to characterize cognate transcription factors at these
sites.
In conjunction with previous data, these findings suggest that multiple
transcription factors and regulatory elements may be involved in GnRH
regulation of the
-promoter (13, 37, 38). As noted above, GnRH
activates several limbs of the MAPK cascade as well as the protein
kinase C- and calcium-signaling pathways. Similar to the findings with
the CRE mutations, inhibition of the MAPK pathway greatly reduces the
basal activity of the
-promoter with little effect on the degree of
GnRH stimulation (15, 16, 38). Therefore, it seems likely that GnRH
signaling to the
-promoter is redundant, perhaps involving several
different transcription factors that are modified by GnRH-induced
kinase pathways. It also appears that transcription factors involved in
the GnRH response may be coupled to basal expression of the promoter.
For example, several pathways might converge on CREB to establish a
"basal" level of expression that can be modulated further by GnRH
or other hormonal signals that stimulate kinase pathways. In this
respect, it is interesting to note the inverse relationship between
estradiol suppression of basal promoter activity and the apparent
enhancement of GnRH responsiveness (e.g. female pituitary
cells) (15, 33). One explanation for this phenomenon is that estradiol
suppresses GnRH input, leading to decreased CREB phosphorylation and
reduced basal promoter activity. In this context, restoration of GnRH
input in vivo may exert its greatest effect on basal
promoter activity, with the consequence that fold-stimulation by
subsequent administration of GnRH in vitro is reduced.
In conclusion, we find that the chronic administration of estradiol in
Ovx rats produces an inhibitory effect on CREB phosphorylation in the
pituitary. Estradiol inhibition of CREB phosphorylation appears to be
mediated indirectly by a decrease in GnRH production in the
hypothalamus. GnRH directly stimulates CREB phosphorylation at Ser-133
in gonadotrope cells. Based on these findings, we postulate that the
estradiol-induced decrease in pCREB lowers
-promoter activity and
accounts for the relatively low level of basal promoter activity in
females (33). In addition, the reduced basal level of CREB
phosphorylation may sensitize the pituitary to GnRH, as there would be
more CREB phosphorylation sites available to respond to the GnRH
signal.
 |
MATERIALS AND METHODS
|
|---|
Animal Models
All surgical and experimental procedures were conducted in
accordance with the policies of Northwestern Universitys Animal Care
and Use Committee. Male and female Sprague Dawley rats
(Charles River Laboratories, Inc., Wilmington, MA)
(200225 g) were housed in a controlled environment (temperature
2426 C) with a 14-h light, 10-h dark cycle, and free access to tap
water and standard laboratory chow. Estrous cyclicity was monitored by
daily examination of vaginal cytology. Only animals exhibiting two
consecutive 4-day estrous cycles were used in the experiments.
Rats were Ovx bilaterally 1012 days before the experiments involving
the effect of estradiol on CREB phosphorylation. Animals were lightly
anesthetized with metofane and received 17ß-estradiol-filled
SILASTIC implants subcutaneously (Dow Corning Corp.,
Midland, MI; id, 0.062 inches; od, 0.125 inches; 5 mm in length) for 3,
5, or 10 days. In one group of rats, estradiol capsules were removed
after 7 days of implantation to assess the reversibility of the
estrogen effects. In this case, rats were killed 4 days after the
removal of estradiol.
In estradiol-treated rats, GnRH pulses (50 µg/pulse) were given every
30 min ip for 2 h and by tail vein injection (the last pulse). In
addition, estradiol-treated rats were anesthetized and a catheter was
inserted into the right carotid artery and connected to an infusion
pump. GnRH pulses (100 ng/pulse every hour) were administered manually
through carotid arterial catheters for 6 or 24 h. LH and FSH
levels were measured by obtaining serum samples 20 min after the last
GnRH injection.
In the experiments that involved the GnRH receptor antagonist, rats
were ovariectomized bilaterally for 1012 days and the antagonist,
azaline B, was injected once (400 µg sc/rat in 0.2 ml sesame oil)
(61). The control group received sesame oil only. Rats were killed 10
days after azaline B treatment. Azaline B was also given to a group of
animals that received estradiol pellets on the same day. Rats were
killed by decapitation. Anterior pituitary glands were rapidly removed
and frozen with dry ice. Blood was collected for subsequent
measurements of LH, FSH, and estradiol by RIA.
Immunocytochemistry
Random cycling female rats were anesthetized with sodium
pentobarbitol (50 mg/ml; 60 mg/kg of body weight) and perfused with 600
ml 4% paraformaldehyde solution at room temperature for 1 h. The
pituitaries were immediately removed and placed in 4% paraformaldehyde
solution for 1 h at 4 C, and then transferred to 30% sucrose in
0.01 M sodium phosphate buffer overnight at 4 C. The
tissues were embedded in mounting media optimum cutting
temperature compound (Tissue Tek II, Miles, Elkhart, IN)
and quickly frozen in dry ice-acetone. Cryostat sections (5 µm) were
mounted on vectabond-coated slides and stored at -70 C. For
immunocytochemistry, slides were equilibrated at room temperature, and
then washed three times with cold washing buffer (0.01 M
TBS with 0.4% Triton X-100) for 15 min each. Before incubation with
primary antibody, the slides were blocked with 10% normal goat serum
(in 0.01 M TBS buffer with 1% BSA, 0.4% TX-100) for
1 h at room temperature. The guinea pig antirat LHß primary
antibody (NIDDK, AFP-22238790GPOLHB) was preincubated with control
tissue (cerebral cortex from the same rat at 4 C for 1 h) to
reduce nonspecific binding of the antibody. Slides were then incubated
with the anti-LHß antibody (1:1000) and/or rabbit antirat pCREB
antibody (1:100) (Upstate Biotechnology, Inc., Lake
Placid, NY) in a 0.01 M TBS buffer containing 1% goat
serum, 1% BSA, and 0.5% Triton X-100 for 1.5 h at room
temperature. Slides were rinsed through six changes of cold washing
buffer for 1 h at room temperature. Immunoreactivity was
subsequently detected using fluorescein isothiocyanate-conjugated goat
antiguinea pig antibody (Sigma Chemical Co., St. Louis,
MO) to detect LHß, and rhodamine-conjugated goat antirabbit antibody
(Pierce Chemical Co., Rockford, IL) to detect pCREB, both
diluted to 1:200 in a TBS buffer containing 1% goat serum, 1% BSA,
and 0.4% Triton X-100. Sections were washed four times for 1 h
each with cold washing buffer and dried in a vacuum dessicator for 15
min. Drops of aqueous mounting media (Mowiol, DAKO Corp., Carpinteria, CA) were used to mount the coverslips, which
were sealed with clear nail polish and allowed to dry for 15 min.
Single or double-labeled cells (gonadotropes and pCREB containing
cells) were photographed after single or double exposures using a
Fluorescent Axiokop microscope (Carl Zeiss, Thornwood, NY)
and Ektachrome 400 daylight film.
Tissue and Cell Cultures, Transfections, and Luciferase
Assays
Pituitary glands were excised from male and random cycling
female rats. The anterior lobes were cut into 1520 small pieces.
Fragments were rinsed twice in incomplete PBS (2.7 mM KCl,
1.2 mM K2HPO4, 138 mM
NaCl, and 8.1 mM Na2HPO4, pH 7.1),
digested for two 15-min periods in a solution containing 0.125%
trypsin (TRLS, Worthington Biochemical Corp., Freehold,
NJ) in PBS, followed by a 2-min digestion in a solution containing 10
U/ml deoxyribonuclease I (Sigma Chemical Co.). Cells were
then incubated for 10 min in a 0.125% collagenase solution (type IV,
Sigma Chemical Co.) before being dispersed mechanically by
pipetting. Cells were resuspended in DMEM with 10% FBS, 100 U/ml
penicillin, 50 µg/ml streptomycin, and 2.5 µg/ml Fungizone
(Biologos, Naperville, IL), and then plated in 24-well dishes.
After recovery for 40 h in DMEM with 1% FBS, cells were
transfected with 1020 µg/well DNA using the calcium phosphate
precipitation technique (33). The
-Luc reporter gene contains either
846 or 420 bp of 5'-flanking sequence and 44 bp of exon 1 of the human
glycoprotein
-subunit gene linked to the firefly luciferase gene in
the plasmid pA3 luc. In the -846
-Luc
CRE construct, both copies
of the CRE (TGACGTCATGGTAAAAATTGACGTCA) were removed and substituted
with a SpeI site (ACTAGT). The DNA sequence was confirmed by
sequencing. The cells were also cotransfected with the -846
-Luc and
either wild-type human CREB or mutant CREB in which Ser-133 was
substituted with alanine (kindly provided by Dr. Jeffrey Leiden,
University of Chicago). As a control, cells were also transfected with
the -846
-Luc and the empty expression vector pCMX. Cells were
exposed to the DNA precipitate for 6 h. After 24-h treatment with
or without 10 nM GnRH analog (Des-Gly10,
[D-Ala6] GnRH ethylamide; Sigma Chemical Co.; hereafter referred to as GnRH), cells were
harvested for luciferase assays by adding 0.5 ml/well lysis buffer
[1% Triton X-100 in 25 mM glycylglycine buffer, 15
mM MgSO4, 4 mM EGTA, and 1
mM dithiothreitol (DTT), pH 7.8]. Luciferase assays were
performed by adding 0.3 ml cell extract to 0.4 ml luciferase buffer (25
mM glycylglycine, 15 mM MgSO4, 4
mM EGTA, 1 mM DTT, 16 mM potassium
phosphate, and 2 mM ATP, pH 7.8). The reactions were
performed at room temperature using an AutoLumat LB 953 luminometer
(EG&G Instruments, Oak Ridge, TN). Luciferase activity was determined
by measuring the light emitted during the initial 30 sec of the
reaction. The values are expressed in relative light units.
T3 cells were grown to about 80% confluency in DMEM/F12 with 10%
FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin in 10-cm plates.
In experiments that involved estrogen, cells were maintained in
estrogen-depleted medium for at least 48 h. 17ß-estradiol
(1 nM, Sigma Chemical Co.) or GnRH (10
nM) was added to cells for various time intervals. Cells
were washed with ice-cold PBS and harvested with 5 ml PBS+
(PBS, 1 mM EDTA and 1 mM phenylmethylsulfonyl
fluoride and 1 mM DTT). Nuclear extracts were prepared by
the Shapiro method (82) modified by the addition of a protease
inhibitor, Complete (Roche Molecular Biochemicals,
Indianapolis, IN) and 25 mM NaF.
T47D cells were maintained in RPMI 1640 medium supplemented with 10%
FBS, nonessential amino acids, 100 U/ml penicillin, and 100 µg/ml
streptomycin sulfate. Cells were switched to an estrogen-depleted
medium containing charcoal-stripped serum and no phenol red 5 days
before transfection by electroporation with a single pulse at 300 V and
960 µfarads. Cells in 12-well plates were transfected with 1 µg
UAS-TK-luc (containing two copies of GAL4 recognition sequence, UAS,
upstream of TK) and 0.25 µg GAL4-ER (containing the GAL4 DNA-binding
domain and the human estrogen receptor EF domains) or GAL4-CREB
(containing the GAL4 DNA-binding domain and the human CREB
transactivation domain). After exposure to 17ß-estradiol (1
nM) or 8-bromo-cAMP (1 mM, Sigma Chemical Co.) for 48 h, cells were harvested for luciferase assays
as described above.
Western Blot Analysis
Anterior pituitaries were homogenized in a solution (0.9
M NaCl, 50 mM Na2HPO4,
2.5 mM EDTA, 20 mM NaF, 1 mM
phenylmethylsulfonyl fluoride, and 50 mM HEPES-Tris, pH
7.4) containing the complete protease inhibitor cocktail (Roche Molecular Biochemicals). Equal amounts of total pituitary
homogenate proteins (30 µg) or nuclear extracts (15 µg) were
resolved by 10% SDS-PAGE and transferred onto nitrocellulose filters.
In each experiment, duplicate membranes were prepared. The membranes
were incubated with 3% nonfat milk in PBS for 1.5 h and then
incubated overnight at 4 C with rabbit polyclonal antibodies against
either total CREB or Ser-133-phosphorylated CREB (Upstate Biotechnology, Inc., Lake Placid, NY). Immunoreactive proteins
were detected using an antirabbit horseradish peroxidase-conjugated
antibody and the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Arlington Heights, IL). Bands were detected
with Kodak (Rochester, NY) X-Omat film and quantitated
using a GS-700 Imaging Densitometer (Bio-Rad Laboratories, Inc., Hercules, CA).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Richard P. Blye for providing the GnRH receptor
antagonist, azaline B; Brigitte G. Mann for RIAs; Masafumi Ito for
Gal4-ER; Jeff Leiden for mutant CREB; James B. Young and Eun Jig Lee
for technical assistance in tail vein injection and carotid arterial
catheterization; and Jeffrey Weiss and Teresa K. Woodruff for helpful
comments and suggestions.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: J. Larry Jameson, M.D., Ph.D., Division of Endocrinology, Metabolism, and Molecular Medicine, Northwestern University Medical School, Tarry 15709, 303 East Chicago Avenue, Chicago, Illinois 60611-3008.
This work was conducted as a part of the National Cooperative Program
on Infertility Research and was supported by NIH Grants U54-HD-29164
and RO3 HD-36391. RIAs were performed by the P30 RIA core facility (NIH
Grant HD-28048). Rachel Duan is a recipient of NIH Fellowship Award
HD-08311 and Jennifer Shin received a summer fellowship grant from The
Endocrine Society.
Received for publication December 15, 1998.
Revision received April 21, 1999.
Accepted for publication May 3, 1999.
 |
REFERENCES
|
|---|
-
Schally A, Arimura A, Kastin A 1973 Hypothalamic
regulatory hormones. Science 179:341350[Abstract/Free Full Text]
-
Crowley WF, Filicori M, Spratt DI, Santoro NF 1985 The
physiology of gonadotropin-releasing hormone (GnRH) secretion in
men and women. Recent Prog Horm Res 41:473531
-
Clarke IJ, Cummins JT 1982 The temporal relationship
between gonadotropin-releasing hormone (GnRH) and luteinizing hormone
(LH) secretion in ovariectomized ewes. Endocrinology 111:17371739[Medline]
-
Marshall JC, Dalkin AC, Haisenleder DJ, Griffin ML,
Kelch RP 1992 GnRH pulsesthe regulators of human reproduction. Trans
Am Clin Climatol Assoc 104:3146[Medline]
-
Marshall JC, Dalkin AC, Haisenleder DJ, Paul SJ,
Ortolano GA, Kelch RP 1991 Gonadotropin-releasing hormone pulses:
regulators of gonadotropin synthesis and ovulatory cycles. Recent Prog
Horm Res 47:155187
-
Haisenleder DJ, Dalkin AC, Ortolano GA, Marshall JC,
Shupnik MA 1991 A pulsatile gonadotropin-releasing hormone stimulus is
required to increase transcription of the gonadotropin subunit genes:
evidence for differential regulation of transcription by pulse
frequency in vivo. Endocrinology 128:509517[Abstract]
-
Haisenleder DJ, Dalkin AC, Marshall JC 1994 Regulation
of gonadotropin gene expression. In: Knobil E, Neill JD (eds) The
Physiology of Reproduction. Raven Press, New York, pp 17931813
-
Weiss J, Jameson JL, Burrin JM, Crowley Jr WF 1990 Divergent responses of gonadotropin subunit messenger RNAs to
continuous versus pulsatile gonadotropin- releasing hormone
in vitro. Mol Endocrinol 4:557564[Abstract]
-
Stojilkovic SS, Catt KJ 1995 Expression and signal
transduction pathways of gonadotropin-releasing hormone receptors.
Recent Prog Horm Res 50:161205
-
Naor Z, Harris D, Shacham S 1998 Mechanism of GnRH
receptor signaling: combinatorial cross-talk of Ca2+ and
protein kinase C. Front Neuroendocrinol 19:119[CrossRef][Medline]
-
Conn PM, Janovick JA, Stanislaus D, Kuphal D, Jennes L 1995 Molecular and cellular bases of gonadotropin-releasing hormone
action in the pituitary and central nervous system. Vitam Horm 50:151214[Medline]
-
Andrews WV, Hansen JR, Janovick JA, Conn PM 1990 Gonadotropin-releasing hormone modulation of protein kinase-C activity
in perifused anterior pituitary cell cultures. Endocrinology 127:23932399[Abstract]
-
Albanese C, Colin IM, Crowley WF, Ito M, Pestell RG,
Weiss J, Jameson JL 1996 The gonadotropin genes: evolution of distinct
mechanisms for hormonal control. Recent Prog Horm Res 51:2358
-
Kay TW, Chedrese PJ, Jameson JL 1994 Gonadotropin-releasing hormone causes transcriptional stimulation
followed by desensitization of the glycoprotein hormone alpha promoter
in transfected
T3 gonadotrope cells. Endocrinology 134:568573[Abstract]
-
Colin IM, Jameson JL 1998 Estradiol sensitization of rat
pituitary cells to GnRH: involvement of protein kinase C- and
calcium-dependent signaling pathways. Endocrinology 139:37963802[Abstract/Free Full Text]
-
Sundaresan S, Colin IM, Pestell RG, Jameson JL 1996 Stimulation of mitogen-activated protein kinase by
gonadotropin-releasing hormone: evidence for the involvement of protein
kinase C. Endocrinology 137:304311[Abstract]
-
Reiss N, Llevi LN, Shacham S, Harris D, Seger R, Naor Z 1997 Mechanism of mitogen-activated protein kinase activation by
gonadotropin-releasing hormone in the pituitary of
T31 cell line:
differential roles of calcium and protein kinase C. Endocrinology 138:16731682[Abstract/Free Full Text]
-
Evans NP, Dahl GE, Mauger D, Karsch FJ 1995 Estradiol
induces both qualitative and quantitative changes in the pattern of
gonadotropin-releasing hormone secretion during the presurge period in
the ewe. Endocrinology 136:16031609[Abstract]
-
Speight A, Popkin R, Watts AG, Fink G 1981 Oestradiol-17ß increases pituitary responsiveness by a mechanism that
involves the release and the priming effect of luteinizing hormone
releasing factor. J Endocrinol 88:301308[Abstract]
-
Keye Jr WR, Jaffe RB 1975 Strength-duration
characteristics of estrogen effects on gonadotropin response to
gonadotropin-releasing hormone in women. I. Effects of varying duration
of estradiol administration. J Clin Endocrinol Metab 41:10031008[Abstract]
-
Yen SS, Tsai CC, Naftolin F, Vandenberg G, Ajabor L 1972 Pulsatile patterns of gonadotropin release in subjects with and without
ovarian function. J Clin Endocrinol Metab 34:671675[Medline]
-
Knobil E 1980 The neuroendocrine control of the
menstrual cycle. Recent Prog Horm Res 36:5388
-
Liu JH, Yen SS 1983 Induction of midcycle gonadotropin
surge by ovarian steroids in women: a critical evaluation. J Clin
Endocrinol Metab 57:797802[Abstract]
-
Sarkar DK, Fink G 1980 Luteinizing hormone releasing
factor in pituitary stalk plasma from long-term ovariectomized rats:
effects of steroids. J Endocrinol 86:511524[Abstract]
-
Leipheimer RE, Bona-Gallo A, Gallo RV 1984 The influence
of progesterone and estradiol on the acute changes in pulsatile
luteinizing hormone release induced by ovariectomy on diestrus day 1 in
the rat. Endocrinology 114:16051612[Abstract]
-
Leipheimer RE, Bona-Gallo A, Gallo RV 1986 Influence
of estradiol and progesterone on pulsatile LH secretion in
8-day ovariectomized rats. Neuroendocrinology 43: 300307
-
Higuchi T, Kawakami M 1982 Changes in the
characteristics of pulsatile luteinizing hormone secretion during the
oestrous cycle and after ovariectomy and oestrogen treatment in female
rats. J Endocrinol 94:177182[Abstract]
-
Evans NP, Dahl GE, Glover BH, Karsch FJ 1994 Central
regulation of pulsatile gonadotropin-releasing hormone (GnRH) secretion
by estradiol during the period leading up to the preovulatory GnRH
surge in the ewe. Endocrinology 134:18061811[Abstract]
-
Shupnik MA, Gharib SD, Chin WW 1988 Estrogen suppresses
rat gonadotropin gene transcription in vivo. Endocrinology 122:18421846[Abstract]
-
Nilson JH, Nejedlik MT, Virgin JB, Crowder ME, Nett TM 1983 Expression of
subunit and luteinizing hormone ß genes in the
ovine anterior pituitary. Estradiol suppresses accumulation of mRNAS
for both
subunit and luteinizing hormone ß. J Biol Chem 258:1208712090[Abstract/Free Full Text]
-
Mercer JE, Clements JA, Funder JW, Clarke IJ 1989 Regulation of follicle-stimulating hormone beta and common
-subunit
messenger ribonucleic acid by gonadotropin-releasing hormone and
estrogen in the sheep pituitary. Neuroendocrinology 50:321326[CrossRef][Medline]
-
Counis R, Corbani M, Jutisz M 1983 Estradiol regulates
mRNAs encoding precursors to rat lutropin (LH) and follitropin (FSH)
subunits. Biochem Biophys Res Commun 114:6572[CrossRef][Medline]
-
Colin IM, Bauer-Dantoin AC, Sundaresan S, Kopp P,
Jameson JL 1996 Sexually dimorphic transcriptional responses to
gonadotropin-releasing hormone require chronic in vivo
exposure to estradiol. Endocrinology 137:23002307[Abstract]
-
Keri RA, Andersen B, Kennedy GC, Hamernik DL, Clay CM,
Brace AD, Nett TM, Notides AC, Nilson JH 1991 Estradiol inhibits
transcription of the human glycoprotein hormone
-subunit gene
despite the absence of a high affinity binding site for estrogen
receptor. Mol Endocrinol 5:725733[Abstract]
-
Jameson JL, Hollenberg AN 1993 Regulation of chorionic
gonadotropin gene expression. Endocr Rev 14:203221[CrossRef][Medline]
-
Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A,
Nilson JH 1987 Cyclic AMP regulation of the human glycoprotein hormone
-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad
Sci USA 84:21982202[Abstract/Free Full Text]
-
Kay TW, Jameson JL 1992 Identification of a
gonadotropin-releasing hormone-responsive region in the glycoprotein
hormone
-subunit promoter. Mol Endocrinol 6:17671773[Abstract]
-
Roberson MS, Misra-Press A, Laurance ME, Stork PJ,
Maurer RA 1995 A role for mitogen-activated protein kinase in mediating
activation of the glycoprotein hormone
-subunit promoter by
gonadotropin-releasing hormone. Mol Cell Biol 15:35313539[Abstract]
-
Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-
specific enhancer of the human glycoprotein hormone
-subunit
gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:39944002[Abstract/Free Full Text]
-
Deutsch PJ, Jameson JL, Habener JF 1987 Cyclic AMP
responsiveness of human gonadotropin-
gene transcription is directed
by a repeated 18-base pair enhancer.
-Promoter receptivity to the
enhancer confers cell-preferential expression. J Biol Chem 262:
1216912174
-
Andersen B, Kennedy GC, Hamernik DL, Bokar JA, Bohinski
R, Nilson JH 1990 Amplification of the transcriptional signal mediated
by the tandem cAMP response elements of the glycoprotein hormone
-subunit gene occurs through several distinct mechanisms. Mol
Endocrinol 4:573582[Abstract]
-
Gonzalez GA, Yamamoto KK, Fischer WH, Karr D, Menzel P,
Biggs Wd, Vale WW, Montminy MR 1989 A cluster of phosphorylation sites
on the cyclic AMP-regulated nuclear factor CREB predicted by its
sequence. Nature 337:749752[CrossRef][Medline]
-
Brindle PK, Montminy MR 1992 The CREB family of
transcription activators. Curr Opin Genet Dev 2:199204[CrossRef][Medline]
-
Alberts AS, Arias J, Hagiwara M, Montminy MR,
Feramisco JR 1994 Recombinant cyclic AMP response element binding
protein (CREB) phosphorylated on Ser-133 is transcriptionally active
upon its introduction into fibroblast nuclei. J Biol Chem 269:76237630[Abstract/Free Full Text]
-
Yamamoto KK, Gonzalez GA, Biggs III WH, Montminy
MR 1988 Phosphorylation-induced binding and transcriptional efficacy of
nuclear factor CREB. Nature 334:494498[CrossRef][Medline]
-
Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates
somatostatin gene transcription by phosphorylation of CREB at serine
133. Cell 59:675680[CrossRef][Medline]
-
Gonzalez GA, Menzel P, Leonard J, Fischer WH, Montminy
MR 1991 Characterization of motifs which are critical for activity of
the cyclic AMP-responsive transcription factor CREB. Mol Cell Biol 11:13061312[Abstract/Free Full Text]
-
Xie H, Rothstein TL 1995 Protein kinase C mediates
activation of nuclear cAMP response element-binding protein (CREB) in B
lymphocytes stimulated through surface Ig. J Immunol 154:17171723[Abstract]
-
Sheng M, Thompson MA, Greenberg ME 1991 CREB: a
Ca(2+)-regulated transcription factor phosphorylated by
calmodulin-dependent kinases. Science 252:14271430[Abstract/Free Full Text]
-
Dash PK, Karl KA, Colicos MA, Prywes R, Kandel ER 1991 cAMP response element-binding protein is activated by Ca2+/calmodulin-
as well as cAMP-dependent protein kinase. Proc Natl Acad Sci USA 88:50615065[Abstract/Free Full Text]
-
Sun P, Enslen H, Myung PS, Maurer RA 1994 Differential
activation of CREB by Ca2+/calmodulin-dependent protein
kinases type II and type IV involves phosphorylation of a site that
negatively regulates activity. Genes Dev 8:25272539[Abstract/Free Full Text]
-
Matthews RP, Guthrie CR, Wailes LM, Zhao X, Means AR,
McKnight GS 1994 Calcium/calmodulin-dependent protein kinase types II
and IV differentially regulate CREB-dependent gene expression. Mol Cell
Biol 14:61076116[Abstract/Free Full Text]
-
Xing J, Kornhauser JM, Xia Z, Thiele EA, Greenberg ME 1998 Nerve growth factor activates extracellular signal-regulated
kinase and p38 mitogen-activated protein kinase pathways to stimulate
CREB serine 133 phosphorylation. Mol Cell Biol 18:19461955[Abstract/Free Full Text]
-
Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen
action via the cAMP signaling pathway: stimulation of adenylate cyclase
and cAMP-regulated gene transcription. Proc Natl Acad Sci USA 91:85178521[Abstract/Free Full Text]
-
Nakhla AM, Khan MS, Romas NP, Rosner W 1994 Estradiol
causes the rapid accumulation of cAMP in human prostate. Proc Natl Acad
Sci USA 91:54025405[Abstract/Free Full Text]
-
Szego CM, Davis JS 1967 Adenosine 3',5'-monophosphate in
rat uterus: acute elevation by estrogen. Proc Natl Acad Sci USA 58:17111718[Free Full Text]
-
Gu G, Rojo AA, Zee MC, Yu J, Simerly RB 1996 Hormonal
regulation of CREB phosphorylation in the anteroventral periventricular
nucleus. J Neurosci 16:30353044[Abstract/Free Full Text]
-
Zhou Y, Watters JJ, Dorsa DM 1996 Estrogen rapidly
induces the phosphorylation of the cAMP response element binding
protein in rat brain. Endocrinology 137:21632166[Abstract]
-
Watters JJ, Dorsa DM 1998 Transcriptional effects of
estrogen on neuronal neurotensin gene expression involve cAMP/protein
kinase A-dependent signaling mechanisms. J Neurosci 18:66726680[Abstract/Free Full Text]
-
Struthers RS, Vale WW, Arias C, Sawchenko PE, Montminy
MR 1991 Somatotroph hypoplasia and dwarfism in transgenic mice
expressing a non-phosphorylatable CREB mutant. Nature 350:622624[CrossRef][Medline]
-
Campen CA, Lai MT, Kraft P, Kirchner T, Phillips A, Hahn
DW, Rivier J 1995 Potent pituitary-gonadal axis suppression and
extremely low anaphylactoid activity of a new gonadotropin releasing
hormone (GnRH) receptor antagonist "azaline B." Biochem Pharmacol 49:13131321[CrossRef][Medline]
-
Bronson FH, Vom Saal FS 1979 Control of the preovulatory
release of luteinizing hormone by steroids in the mouse. Endocrinology 104:12471255[Abstract]
-
Herbison AE 1998 Multimodal influence of estrogen upon
gonadotropin-releasing hormone neurons. Endocr Rev 19:302330