help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolfe, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolfe, M. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Molecular Endocrinology 13 (9): 1497-1510
Copyright © 1999 by The Endocrine Society

The Equine Luteinizing Hormone ß-Subunit Promoter Contains Two Functional Steroidogenic Factor-1 Response Elements

Michael W. Wolfe

Department of Molecular and Integrative Physiology University of Kansas Medical Center Kansas City, Kansas 66160-7401


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The requirements for basal expression of the LH ß-subunit promoter in pituitary gonadotropes are largely unknown. We have used the equine (e) LHß subunit promoter as a model to unravel the combinatorial code required for gonadotrope expression. Through the use of 5'-deletion mutagenesis, a region between -185 and -100 of the eLHß promoter was shown to play a critical role in maintaining basal promoter activity in {alpha}T3–1 and LßT2 cells. This region encompasses the steroidogenic factor-1 (SF-1) binding site that has been reported to have a functional role in expression of the LHß promoter in other species. We have also identified an additional SF-1 site at -55 to -48. Binding of SF-1 to both sites was confirmed by electrophoretic mobility shift assays. Mutations within these sites, either individually or in combination, did not attenuate basal activity of the eLHß promoter in {alpha}T3–1 cells, but did diminish promoter activity in LßT2 cells. Interestingly, cotransfection with an expression vector encoding SF-1 induced eLHß promoter activity, and this induction was abrogated by mutations within the SF-1 sites in {alpha}T3–1 cells. Block replacement mutagenesis was performed on the -185/-100 region of the eLHß promoter to identify DNA response elements responsible for maintaining basal promoter activity. From this analysis, two regions emerged as being important: a distal 31-bp segment (-181 to -150) and an element located immediately 3' to the distal SF-1 site (-119 to -106). It is hypothesized that these two regions as well as the SF-1 sites represent regulatory elements that contribute to a combinatorial code involved in targeting expression of the eLHß promoter to gonadotropes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
LH and CG are heterodimeric glycoprotein hormones composed of a common {alpha}-subunit noncovalently linked to a unique ß-subunit. LH is synthesized in the pituitary of all mammals (1). This glycoprotein hormone stimulates ovulation in females, promotes spermatogenesis in males, and directs gonadal steroidogenesis in both sexes. In contrast, synthesis of CG occurs only in placenta of primates and equids (2). In primates, and presumably equids, CG maintains function of the corpus luteum during the early stages of pregnancy, which in turn sustains pregnancy.

A single gene encodes the {alpha}-subunit in all mammals studied to date (1). Thus, synthesis of LH and CG requires that expression of the {alpha}-subunit gene occurs in two locations: gonadotropes of the pituitary and trophoblasts of the placenta (1, 3, 4, 5). Placenta-specific expression is achieved through a compact and interactive array of regulatory elements located within the proximal 200 bp of the human {alpha}-subunit 5'-flanking region (5, 6). Some of the transcription factors that interact with these elements have been identified and consist of ubiquitous proteins such as members of the cAMP-response element binding protein (CREB)/ activating transcription factor (ATF) family (4, 7, 8), the GATA family of DNA binding proteins (9), and a protein that appears to be unique to the placenta (trophoblast-specific element binding protein or TSEB; Refs. 9, 10). In contrast, a different but overlapping set of regulatory elements appears to be required for pituitary-specific expression of the {alpha}-subunit gene. For example, at least one of the cis-acting elements involved in placenta-specific expression (the GATA binding site) may also contribute to expression in pituitary gonadotropes (11, 12). Additional elements upstream of the 200-bp promoter-proximal region have also been identified. These include an element that binds a member of the orphan nuclear receptor family, steroidogenic factor-1 (SF-1; Ref. 13) and a site that binds a member of the LIM-homeodomain family of DNA-binding proteins (LH-2; Ref. 14).

Synthesis of LH and CG also requires expression of the hormone-defining ß- subunit gene. Most mammals have a single LHß gene with transcription occurring only in gonadotropes of the pituitary. In primates, the single-copy LHß gene has undergone a series of gene duplications resulting in the formation of a linked array of multiple CGß genes (2). Although LHß and CGß genes maintain a homology of greater than 90%, transcription of CGß genes occurs only in placenta and initiates at a site 366 bp upstream from that used for transcription of the LHß gene (15, 16). Thus, different promoters and regulatory elements are responsible for the pituitary- and placenta-specific expression of primate LHß and CGß genes.

As indicated from several transfection studies (17, 18, 19), the human CGß promoter contains one element located between nucleotides -305 and -279 that appears important for both basal transcription and responsiveness to cAMP. Although less well defined, full responsiveness to cAMP requires at least one other element located between -248/-210 (18). Interestingly, both of these elements can bind TSEB, the aforementioned placenta-specific protein that forms part of the regulatory code required for targeting expression of the {alpha}-subunit gene to the placenta (19). While the binding of TSEB may provide a mechanism for coordinating placenta-specific expression of the {alpha}- and CGß-subunit genes, functional studies that test this possibility are lacking.

Resolution of regulatory elements required for pituitary-specific expression of mammalian LHß genes has been hampered by the lack of cell lines that actively express either the endogenous LHß gene or transfected LHß promoter-reporter genes. For reasons that still remain unresolved, transfection studies that employ primary cultures of pituitary cells have also been relatively uninformative (20). Due to these limitations, transgenic mice have become the model of choice for studying the LHß promoter. Data from transgenic studies suggest that elements required for gonadotrope-specific expression and responsiveness to GnRH and sex steroids reside within the first 800 bp of the LHß-promoter proximal region (21, 22, 23). It has been demonstrated both in vitro and in vivo that SF-1 can bind to and transactivate the rat and bovine LHß promoters (24, 25). In fact, mutation of the SF-1 site severely attenuated activity of the bovine promoter in transgenic mice (25). Recent reports indicate that SF-1 interacts with an immediate-early response gene product, early growth response protein 1 (Egr-1), and that these two transcription factors mediate GnRH regulation of the LHß gene (26, 27, 28). Thus, SF-1 appears to play an important role in regulating gonadotrope expression of both the {alpha}- and LHß-subunit genes.

Characterization of the equine LH and CG ß-subunit gene (29) has shown that, in contrast to primates, the ß-subunits of eLH and eCG are encoded by the same single-copy gene. The single eLH/CGß transcript gives rise to proteins having identical amino acid sequences (30). This protein is more like the human and primate CGß than LHß since it contains a carboxyl-terminal peptide unique to primate CGß genes. In contrast, initiation of transcription of the eLH/CGß gene occurs at the same nucleotide position in placenta and pituitary (29). The TATA-containing promoter responsible for this event is comparable to the primate LHß promoter. Therefore, the eLH/CGß gene shares features that are common to the primate and equid {alpha}-subunit gene in that they are single-copy genes, transcription is initiated through the use of a TATA-containing promoter, and both subunits are expressed in pituitary and placenta.

Given the unique structural configuration of the eLH/CGß gene, and the paucity of information regarding mechanisms regulating pituitary expression of mammalian LHß genes, activity of the eLHß promoter was evaluated in the {alpha}T3–1 (31) and LßT2 (32, 33) gonadotrope cell lines. Data reported herein identify two functional SF-1 sites and two additional proximal activating elements/regions. It is hypothesized that these DNA response elements contribute to a combinatorial code that directs LHß expression in pituitary gonadotropes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning of Additional eLHß Sequence
Expression of the LHß promoter in the pituitaries of transgenic mice has been reported in three studies that used 1.9 kb of ovine (21), 1.5 kb of rat (23), or 776 bp of bovine (22) 5'-flanking sequence. The bovine construct was expressed exclusively in the pituitary and was regulated appropriately by GnRH, estrogen, and androgen (22). These data suggested that the cis-elements required for pituitary-specific expression of LHß are contained within 800 bp of the proximal 5'-flanking region. Our original eLHß promoter clone extended only to -448 and, hence, may not have contained important cis-acting elements necessary for gonadotrope expression. To generate additional 5'-flanking sequences, we screened an equine genomic library and isolated two overlapping {lambda}-clones (Fig. 1Go). The promoter-proximal region of one the clones (eß5{lambda}) was sequenced to confirm that it contained an authentic eLHß 5'-flanking region. This clone contains approximately 3 kb of 5'-flanking sequence, the entire coding region, and approximately 12 kb of 3'-flanking sequence.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Schematic Representation of eLHß Genomic Clones

The {lambda}-clones were isolated as described in Materials and Methods. Shown are the three exons of the eLHß gene (black boxes) and HindIII restriction sites (H). Overall size of the clones is indicated on the lower line with 0 denoting the start site of transcription.

 
The eLHß Promoter Is Active in the {alpha}T3–1 Gonadotrope Cell Line
Previous studies have demonstrated that the rat and bovine LHß promoters are inactive in the {alpha}T3–1 cell line (22, 23, 24). We examined transcriptional activity of 5'-deletion mutants of the eLHß promoter to determine whether it was also inactive in {alpha}T3–1 cells. Although these cells lack endogenous expression of LHß, they have many of the characteristics exhibited by mature gonadotropes (31). Unlike previous reports for the rat and bovine LHß promoters, activity of all of the eLHß promoter constructs was greater than that of the promoterless control (pGL2 basic; Fig. 2AGo). Transcriptional activity of the -185/+60 promoter was 17-fold greater than the promoterless control. In contrast, these same constructs were inactive in the BeWo human choriocarcinoma cell line (1- to 3-fold over pGL2 basic; Fig. 2BGo). All of the eLHß promoter constructs had similar levels of basal activity except for the shortest construct (-100/+60). Truncation of the promoter from -185 to -100 resulted in a 65% decrease in basal activity.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. The eLHß Promoter Is Active in the {alpha}T3–1 Cell Line, but Inactive in BeWo Cells

The plasmid constructs indicated along the left side of the figure were transfected into {alpha}T3–1 (A) and BeWo (B) cells and evaluated for luciferase reporter gene activity as described in Materials and Methods. Luciferase activity was normalized to ß-galactosidase levels. Values shown are the mean ± SEM for triplicate wells from a minimum of three independent transfections.

 
Due to the elevated basal activity of the eLHß promoter in {alpha}T3–1 cells, we evaluated whether this was unique to the equine promoter. Similar regions of the bovine and mouse LHß promoters (based on sequence homology and alignment) were cloned by PCR and evaluated for basal activity in {alpha}T3–1 cells. Both the bovine and mouse LH promoters were inactive in the {alpha}T3–1 cells, corroborating previous data (Fig. 3Go and Ref. 22). Furthermore, we also observed variation between species in regard to activity of the {alpha}-subunit promoter. Some of the differences in activity of the {alpha}-subunit promoters could be attributed to variation in promoter length, but not all. Thus, species differences appear to exist in the requirements for expression of both the {alpha} and LHß-subunit promoters in {alpha}T3–1 cells.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Basal Activity of {alpha} and LHß Promoters Varies across Species in {alpha}T3–1 Cells

Basal activity of the human (h{alpha} -485/+48), mouse (m{alpha} -507+42), and bovine (b{alpha} -315/+45) {alpha}-subunit promoters and equine (eLHß -185/+60), bovine (bLHß -185/+10) and mouse (mLHß -196/+8) LHß-subunit promoters were elevated in {alpha}T3–1 cells. Data are expressed as fold induction over a promoterless control luciferase vector (pGL2 basic). Values shown are the mean ± SEM for triplicate wells from two independent transfections.

 
The Equine LHß Promoter Contains Two SF-1 Binding Sites
Since SF-1 has been shown to be an important regulator of LHß expression (24, 25, 26, 27, 28), it was important to determine whether a SF-1 site located within the -185 to -100 region of the eLHß promoter contributed to basal promoter activity. This site is homologous to the SF-1 response element identified in the LHß promoter of other species (Fig. 4Go, dSF-1). Furthermore, an additional more proximal SF-1-like sequence is also present in the LHß promoters of other species including the horse (Fig. 4Go, pSF-1). Electrophoretic mobility shift assays (EMSAs) were performed to determine whether these eLHß SF-1 sites were authentic SF-1 binding sites. Nuclei from {alpha}T3–1 cells were used as the source for SF-1 (34, 35). A single, predominant complex was detected with both the distal and proximal eLHß SF-1 probes (Fig. 5AGo, lanes 1 and 6). An antibody that recognizes an epitope within the DNA-binding domain of SF-1 was used to determine whether SF-1 was a component of this complex. Inclusion of the SF-1-specific antibody blocked the formation of the complex on both probes (Fig. 5AGo, lanes 2 and 7), indicating that SF-1 can bind to both sites. In contrast, inclusion of nonimmune rabbit serum did not disrupt binding of the complex to the distal and proximal SF-1 sites (Fig. 5AGo, lanes 3 and 8). A similar scenario was observed when the SF-1 site within the human {alpha}-subunit promoter (h{alpha}GSE) was used as labeled probe (Fig. 5AGo, lanes 11–13). Thus, SF-1 can bind to both the proximal and distal SF-1 sites.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 4. Species Conservation of SF-1 Sites within the LHß Promoter

The proximal promoter region of the LHß gene from various species was aligned to identify homologous regions. A distal SF-1 site was identified in the equine (E;29), human (H;40), bovine (B;37), ovine (O;21), porcine (P;38), mouse (M;41), and rat (R;39) LHß promoters. This site has been previously characterized in the bovine (25 ) and rat (24 ) LHß promoters. A similar DNA sequence was identified more proximal (pSF-1) in all of these species except bovine and ovine. The numbers indicate the position of the sequence relative to the transcription start site (+1) for the eLHß promoter.

 


View larger version (51K):
[in this window]
[in a new window]
 
Figure 5. SF-1 Can Bind to Both the Distal and Proximal SF-1 Sites in the eLHß Promoter

EMSAs were performed with nuclei from {alpha}T3–1 cells and labeled oligodeoxynucleotide probes representing the eLHß distal SF-1 site (dSF1, -135/-104), the eLHß proximal SF-1 site (pSF1, -64/-39), and the human {alpha}-subunit GSE/SF-1 (GSE, -228/-198 of the human {alpha}-subunit promoter; Ref. 30). A, Included in the reactions were antisera to SF-1 (directed against the DNA binding domain of SF-1), normal rabbit sera (NRS), or the indicated unlabeled, competitor DNA (100-fold molar excess). B, Binding of SF-1 to the radiolabeled h{alpha} GSE probe was competed for by using 100-fold molar excess of unlabeled eß dSF-1 (lane 15), eß pSF-1 (lane 16), or h{alpha} GSE (lane 17). C, Competition for SF-1 binding to radiolabeled eß dSF-1 by no competitor (lane 1), 10-fold (lanes 2, 5, and 8), 50-fold (lanes 3, 6, and 9) or 100-fold (lanes 4, 7, and 10) molar excess of dSF-1 or pSF-1 eLHß oligos or the h{alpha} GSE. The protein complex corresponding to SF-1 is indicated by the arrow.

 
Additional confirmation of these data was provided by competitions with unlabeled SF-1 sites. Lanes 4 and 9 (Fig. 5AGo) represent competition of protein binding by 100-fold molar excess of homologous DNA, while lanes 5 and 10 depict competition with the human {alpha}-subunit promoter SF-1 site. The h{alpha}GSE oligo competed for protein binding as well as did the homologous competitors. We also evaluated the ability of the eLHß SF-1 sites to compete for binding of SF-1 to the radiolabeled h{alpha}GSE site (Fig. 5BGo). Both eLHß SF-1 sites competed for SF-1 binding to the h{alpha}GSE oligo (lanes 15 and 16). The pSF-1 site was less effective at competing for SF-1 binding to the h{alpha}GSE oligo as compared with the dSF-1 and h{alpha}GSE oligos. These data suggested that the pSF-1 response element had a weaker affinity for SF-1 as compared with the dSF-1 and h{alpha}GSE response elements and was supported by the binding data shown in Fig. 5AGo (decreased SF-1 complex formed with the labeled eLHß pSF-1 oligo when compared with that observed when the dSF-1 or h{alpha}GSE oligos were used as probes; lanes 6 vs. 1 and 11).

To further document the affinity differences between the distal and proximal SF-1 sites, a more thorough competition analysis was performed (Fig. 5CGo). Binding of SF-1 to the dSF-1 site was effectively blocked using as little as a 10-fold molar excess of homologous competitor (eß dSF1, lane 2) or the h{alpha} GSE site as competitor (lane 8), while a 10-fold molar excess of eß pSF1 was ineffective (lane 5) at competing for SF-1 binding. It required 10 times more eß pSF1 than eß dSF1 to achieve equivalent levels of competition (lanes 2 vs. 7). A similar pattern of competition was observed when the proximal SF-1 site was used as the labeled probe (data not shown). These data suggest that the distal site binds SF-1 with an affinity that is approximately 10-fold higher than that of the proximal site in the eLHß promoter.

The Equine LHß SF-1 Sites Are Not Required for Basal Activity in {alpha}T3–1 Cells
To address the functional significance of the eLHß SF-1 sites, transient transfections were performed in {alpha}T3–1 cells with the wild-type -448/+60 eLHß promoter linked to luciferase or constructs that harbored mutations in the SF-1 sites (single or double mutations). The distal and proximal SF-1 sites (TGACCTTG and TGGCCTTG, respectively) in the eLHß promoter were mutated to aGatCTTG. These mutations completely abolished SF-1 binding in an EMSA (data not shown). Mutation of the distal or proximal SF-1 sites, individually or in combination, had little impact on basal promoter activity (Fig. 6AGo). These data suggest that although SF-1 can bind to the eLHß promoter, SF-1 does not contribute to basal expression in {alpha}T3–1 cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. The Distal and Proximal SF-1 Sites in the eLHß Promoter Are not Essential for Maintaining Basal Activity in {alpha}T3–1 Cells

The plasmid constructs indicated along the left side of the figures were transfected into {alpha}T3–1 cells and evaluated for basal transcriptional activity (A). Luciferase activity was normalized to ß-galactosidase levels. The ability of SF-1 to transactivate the eLHß promoter was also evaluated (B). {alpha}T3–1 cells were cotransfected with various eLHß promoter constructs or a RSV Luc construct along with a RSV expression vector encoding SF-1. Data (B) are expressed as fold induction over cotransfection with a RSV globin expression vector. Values shown are the mean ± SEM for triplicate wells from a minimum of three independent transfections.

 
These data conflict with previous findings regarding SF-1 regulation of the bovine and rat LHß promoters (24, 25). The previous studies used an overexpression model to evaluate promoter regulation by SF-1. Therefore, we evaluated the ability of SF-1 to transactivate the eLHß promoter in an overexpression experiment. The constructs described above were cotransfected into {alpha}T3–1 cells along with an expression vector encoding the SF-1 cDNA. Overexpression of SF-1 increased activity of the -448/+60 eLHß promoter by 2.2-fold (Fig. 6BGo), while it had no effect on the Rous sarcoma virus (RSV) promoter. We also have observed a similar 2- to 3-fold induction by SF-1 of the -185/+10 bovine LHß promoter (data not shown). Mutation of both SF-1 sites in the eLHß promoter completely abrogated the ability of SF-1 to transactivate the promoter. Furthermore, the individual mutations reduced, but did not completely abrogate, SF-1 induction of eLHß promoter activity (1.4- and 1.5-fold for the distal and proximal mutants, respectively, vs. 2.2-fold for the wild-type construct). These data indicate that SF-1 can transactivate the eLHß promoter when levels of SF-1 are elevated in {alpha}T3–1 cells and that full transactivation requires both SF-1 sites.

Two Regions Flanking the SF-1 Site Are Responsible for Basal Activity of the eLHß Promoter in {alpha}T3–1 Cells
As shown earlier, sequences between -185 and -100 are needed for full promoter activity (Fig. 2AGo). Therefore, to further delineate the sequences required for basal activity of the eLHß promoter in {alpha}T3–1 cells, five block replacement mutations (A–E) were generated that scanned through the -185/-100 region (Fig. 7AGo). These mutations were made within the context of the -448/+60 promoter. As an additional test of the importance of this 85-bp segment, we evaluated activity of a promoter that had the bases between -185 and -100 deleted (eß {Delta}85). Mutation of regions A, B, and E resulted in a decrease in basal promoter activity of 46, 50, and 85%, respectively (Fig. 7BGo). An additional E mutant was generated (changed E to a different mutant sequence; µE1.2) that also severely attenuated promoter activity (data not shown). The impact of these E mutations was essentially indistinguishable from the effect of the 85-bp internal deletion (eß {Delta}85). In contrast, the C and D mutations had little to no effect on promoter activity. Interestingly, the D mutation disrupts two cytosines that have been shown to be critical for SF-1 binding (13, 35). These data from the D mutation further support the data described above for the dSF-1 mutant. Collectively, the data reveal that the regions defined by A, B, and E are essential for full promoter activity, while the greatest impact was seen from mutation of E.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Multiple Regions between -185 and -100 Regulate Basal Activity of the eLHß Promoter

Shown in uppercase letters is the nucleotide sequence of the eLHß promoter between -181 and -106 (A). The A–E regions are indicated above the sequence. In lowercase below the native sequence are the mutations that were made in each of these regions (µA–µE). B, The mutations shown in panel A were placed individually into the eß -448/+60 Luc vector and tested for functional activity in {alpha}T3–1 cells as described in Materials and Methods. The eß{Delta}85 construct had the bases between -185 and -100 deleted. Schematic representations of these constructs are shown along the left side of the figure and functional activity is shown within the graph. Luciferase activity was normalized to ß-galactosidase levels and is expressed as a percentage of the wild-type promoter (eß -448/+60). Values shown are the mean ± SEM for triplicate wells from a minimum of three independent transfections.

 
Attempts were subsequently made at characterizing the protein(s) that interacted with the E region of the promoter. EMSAs were performed using 21- and 51-bp oligodeoxynucleotide probes encompassing the E region. The shorter probe represented sequence within the E region and included additional 3'-sequence. This probe should not interact with SF-1. The longer probe extended both 5' and 3' to region E and encompassed the SF-1 site. A representative EMSA using these probes is shown in Fig. 8AGo. We were unable to detect protein binding to eßE (lane 1, Fig. 8AGo), while eßDEF interacted with SF-1 (lane 2). Upon overexposure, an extremely weak band could be detected with the eßDEF probe that migrated more slowly than SF-1. The EMSA conditions that were used did not appear to be problematic in that they allowed binding of SF-1 to the probes containing an SF-1 response element (Figs. 5Go and 8AGo) and also binding of proteins to consensus AP1 and Sp1 probes (Fig. 8BGo).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 8. Multiple Proteins Bind to the -185 to -78 Region of the eLHß Promoter

A, EMSAs were performed with nuclei from {alpha}T3–1 cells and labeled oligodeoxynucleotide probes representing the eLHß E region (E, lane 1; -119 to -99), the eLHß DEF region (DEF, lane 2; -128 to -79), as well as with consensus AP1 (lane 3) and Sp1 (lane 4) probes. A protein complex representing SF-1 is indicated by the arrow. B, Restriction fragments encompassing the -185 to -78 region of the eLHß promoter were isolated from the wild type (lane 5), µE (lanes 6 and 7), and µdSF1 (lane 8) clones, radiolabeled, and used as EMSA probes. Multiple protein complexes interacted with these probes. A complex representing SF-1 is indicated as well as additional complexes of proteins (bracketed).

 
Due to the inability to conclusively identify protein binding to the E region with the eß E and DEF probes, protein binding was evaluated using a larger fragment of the eLHß promoter. It was reasoned that protein binding to the E region might be unstable or transient. Use of a larger probe may allow for protein-protein interactions that might stabilize such interactions and allow complex formation and visualization in an EMSA. A restriction fragment encompassing the -185/-78 region of the promoter was isolated, radiolabeled, and used as an EMSA probe. Comparable restriction fragments were also isolated from promoters containing mutations within region E (µE1.1 and µE1.2) and the distal SF-1 site (µdSF1), radiolabeled, and used as probes. Inclusion of the mutant probes permitted a correlation between protein binding and functional activity since regions covered by the mutations were the same as those tested in the transfection assays. Multiple protein complexes were observed when the wild-type region of the promoter was used as probe (Fig. 8BGo, lane 5). One of the complexes was absent when the regions containing the E mutations were used as probes (lanes 6 and 7). This complex was also absent when the probe containing the mutant SF1 site was used (lane 8) and suggests that this complex represents SF-1. Furthermore, since the µdSF1 construct was fully functional (Fig. 5AGo), this complex is presumably not critical for basal activity of the eLHß promoter. None of the protein complexes shown in Fig. 8BGo could be definitively assigned to the E region. However, it is interesting to note that the intensity of the predominant complex (as well as an additional slower migrating complex; bracketed in Fig. 8BGo) was slightly diminished with the µE1.1 and µE1.2 probes.

Activity of the eLHß Promoter in LßT2 Cells
To affirm the results obtained in {alpha}T3–1 cells, the LßT2 gonadotrope cell line was obtained, and the previous promoter constructs were reevaluated. LßT2 cells are a newly derived gonadotrope cell line and, unlike the {alpha}T3–1 cells, they express their endogenous LHß-subunit gene and it is responsive to GnRH (32). As was the case for {alpha}T3–1 cells, the equine promoter was active in LßT2 cells, and the region between -185 and -100 retained its importance in enhancing basal promoter activity (Fig. 9Go). Unlike {alpha}T3–1 cells, the bovine and mouse LHß promoters exhibited some basal promoter activity (Fig. 10AGo); however, the equine promoter had considerably more activity.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 9. The eLHß Promoter Is Active in LßT2 Cells

The plasmid constructs indicated along the left side of the figure were transfected into LßT2 cells and evaluated for luciferase reporter gene activity as described in Materials and Methods. Luciferase activity was normalized to ß-galactosidase levels. Values shown are the mean ± SEM for triplicate wells from a minimum of three independent transfections.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 10. The SF-1 Sites and Regions B, D, and E Are Required for Basal Activity of eLHß Promoter in LßT2 Cells

A, Basal activity of the human (h{alpha} -485/+48), mouse (m{alpha} -507+42), and bovine (b{alpha} -315/+45) {alpha}-subunit promoters and equine (eLHß -185/+60), bovine (bLHß -185/+10), and mouse (mLHß -196/+8) LHß-subunit promoters were elevated in LßT2 cells. Data are expressed as fold induction over a promoterless control luciferase vector (pGL2 basic). B, The plasmid constructs described in Fig. 6Go and indicated along the left side of the figures were transfected into LßT2 cells and evaluated for basal transcriptional activity. Luciferase activity was normalized to ß-galactosidase levels. C, eLHß promoters containing the A–E mutations and {Delta} 85 deletion (described in Fig. 7Go) were tested for functional activity in LßT2 cells as described in Materials and Methods. Luciferase activity was normalized to ß-galactosidase levels and is expressed as a percentage of the wild-type promoter (eß -448/+60). Values shown are the mean ± SEM for triplicate wells from a minimum of three independent transfections.

 
The importance of the SF-1 sites as well as the A, B, and E regions were subsequently evaluated in the LßT2 cells. Mutation of the distal, proximal, or both SF-1 sites resulted in a 34, 14, and 24% decrease, respectively, in basal promoter activity of the eLHß promoter (Fig. 10BGo). Thus, the SF-1 sites appear to have a more critical role in regulating promoter activity in this cell line. Analysis of the A–E mutations confirmed the results from {alpha}T3–1 cells with one exception (Fig. 10CGo). Mutation of region D had a more severe affect on promoter activity and presumably reflects the increased importance placed on the distal SF-1 site in this cell line. Furthermore, these data confirm the importance of regions B and E in maintaining basal activity of the eLHß promoter.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Much has been learned about regulation of LH secretion during various physiological states and the roles played by GnRH, steroids, and other factors (3). Information is also available as to the associated changes that occur in gonadotropin mRNA levels (3). However, a paucity of information exists as to the molecular events that are required to produce these changes, and in particular, the requirements for transcription of the LHß-subunit gene. This has been an area of intense investigation, but one in which little progress has been made. The major obstacle impeding rapid progress has been the lack of an in vitro model for dissecting LHß promoter regulation. We have used the {alpha}T3–1 and LßT2 cell lines to study expression of the eLHß-subunit promoter. Unlike the bovine, mouse, and rat (23, 24) LHß promoters, the eLHß promoter is active in the {alpha}T3–1 cell line. Furthermore, the equine promoter is approximately 7 times more active in LßT2 cells than are the bovine and mouse LHß promoters. This has allowed us to begin to identify DNA response elements and trans-acting factors that are involved in regulating basal expression of the eLHß promoter.

Analysis of 5'-deletion mutants of the eLHß promoter indicated that all of the constructs had basal activities greater than that of the promoterless control in {alpha}T3–1 (ranged from 7- to 18-fold over pGL2 basic) and LßT2 cells (16- to 112-fold over pGL2 basic). These same constructs were inactive in a human choriocarcinoma cell line. Thus, the transcription factors involved in expression of the eLHß promoter in {alpha}T3–1 and LßT2 cells appear to be absent in BeWo cells. Of interest is the fact that we and others (22) have not observed any significant activity of the bLHß promoter in {alpha}T3–1 or BeWo cells. Similarly, the rat LHß promoter has been reported to be inactive in {alpha}T3–1 cells (24), as is the mouse LHß promoter based on our own data. Together these findings, as well as those from LßT2 cells (Fig. 10AGo), suggest that differences exist between species in the requirements for gonadotrope ({alpha}T3–1, LßT2) expression of the LHß gene. The unique features that result in elevated activity of the eLHß promoter appear to reside within the -185/+60 region. Four primary areas of sequence divergence exist in this region between the equine and bovine promoters: -185 to -130, -115 to -113, -75 to -57, and -16 to +45. The two most distal regions are located within the block replacements shown in Fig. 7Go and are involved in maintaining basal promoter activity. It is interesting to note that region E was extremely important for basal activity of the promoter, and this sequence differs from bovine by only two nucleotides. Minor sequence variation in these regions may account for the elevated basal activity of the equine promoter as compared with bovine.

Basal activity of the eLHß promoter is primarily driven by sequences located between -185 and -100. This is in contrast to data obtained from a study of the rat LHß promoter in primary cultures of rat pituitary cells (20). A gradual decline in basal promoter activity was observed when serial 5'-deletions were performed on a 1.7-kb promoter. The shortest rat LHß promoter tested (75 bp) maintained 37% of the activity of the 1.7-kb promoter. It is not clear as to whether these discrepancies are due to species differences, use of a different model, or a combination of these two.

It was initially hypothesized that a SF-1 site located between -185 and -100 was responsible for regulating basal activity of the eLHß promoter. This hypothesis was formulated based on 1) data shown in Fig. 2AGo; 2) the striking conservation of this sequence across species (Fig. 4Go, dSF-1); 3) previous reports regarding SF-1 regulation of the bovine and rat LHß promoters (24, 25); and 4) the loss of LHß expression in mice harboring a homozygous disruption of the Ftz-F1 gene, which encodes SF-1 (29). Furthermore, as we began to analyze the eLHß promoter, we identified a second, putative SF-1 binding site (Fig. 4Go, pSF-1). This site was similar to the distal SF-1 site and was conserved in the human, porcine, rat, and mouse LHß promoters. This proximal SF-1 site has recently been determined to be functional in the rat LHß promoter (26). Due to the conservation and utilization of SF-1 response elements in the GnRH receptor (36), LHß- (21, 37, 38, 39, 40, 41), and {alpha}-subunit promoters (13, 35), it suggests that SF-1 may be serving a role in the gonadotrope analogous to the trophoblast-specific element (TSE) and TSEB in regulating placental expression of the human {alpha}- and CGß-subunits (19). Data from the current study indicate that SF-1 can indeed bind to both the distal and proximal SF-1 sites and activate the eLHß promoter (Figs. 5Go and 10BGo). Mutation of the SF-1 sites individually or in combination did not alter basal activity of the eLHß promoter in {alpha}T3–1 cells (Fig. 6AGo) but did so in LßT2 cells. Fold activation of the equine promoter by SF-1 was similar to that reported for the rat LHß promoter in LßT2 cells (26).

Data from the EMSAs suggested that SF-1 was not limiting in these cells. This contention was supported by a report indicating that mutation of the SF-1 site within the human {alpha}-subunit promoter decreased basal promoter activity (35). Thus, SF-1 is not limiting for transactivation of the {alpha}-subunit promoter. Based on the data presented in Fig. 5CGo, it appears that the human {alpha}-subunit SF-1 site has a similar affinity toward SF-1 as does the dSF-1 in the eLHß promoter. It is also interesting to note that SF-1 was unable to induce activity of a -82/+5 rat LHß promoter containing the pSF-1 site that we have identified (24). However, in a subsequent study this proximal site was shown to be functional (26). Several potential explanations exist as for why mutations of the SF-1 sites had no detrimental effect on activity of the equine LHß promoter, but does affect activity of the human {alpha}-subunit promoter. SF-1 may be interacting with other transcription factors, and these factors may differ between the {alpha}- and LHß-subunits. This is supported by data indicating that an immediate early response gene (Egr1/NGFIA) can interact with SF-1 and regulate expression of the rat LHß promoter (42). Effective interaction with a second transcription factor such as Egr1 may require higher cellular concentrations of SF-1, hence, the lack of SF-1 regulation of the eLHß promoter under basal conditions in {alpha}T3–1 cells. Alternatively, the lack of a response in {alpha}T3 cells may be due to the fact that these cells also express Dax-1 (43), which can block or repress SF-1-mediated transcription (M. Wolfe, unpublished data). Overexpression of SF-1 may have overcome this block and revealed the functional importance of the SF-1 response elements.

In light of the recent SF-1 transgenic mouse data (25, 34), further experimentation is warranted to determine the in vivo significance (i.e. transgenic mice) of the eLHß SF-1 sites and what role, if any, they play in the spatiotemporal expression pattern and hormonal regulation of the eLHß-subunit gene. It is interesting to note that exogenous administration of GnRH to the SF-1-deficient mice activated expression of LHß (44), suggesting that SF-1 is not essential for expression of LHß in vivo. However, it has also been shown that GnRH can increase the expression of SF-1 in gonadotropes (45). We and others have recently shown that SF-1 and Egr1 interact and that GnRH regulation of the LHß promoter occurs through the SF-1 and Egr response elements (27, 28). Thus, GnRH appears to be able to regulate LHß through SF-1-dependent and -independent pathways.

The most striking outcome of this study was the discovery that an 85-bp fragment of the eLHß promoter was required for basal activity in {alpha}T3–1 and LßT2 cells. Deletion of the bases between -185 and -100, within the context of the -448/+60 construct, severely attenuated promoter activity. Furthermore, attenuated promoter activity could be recapitulated by mutating the bases between -119 and -105 (region E). The block replacement mutagenesis uncovered an additional segment of DNA within the 85-bp region (regions A and B) that also plays a role in promoter activation. Mutation of these bases attenuated promoter activity, but not as effectively as mutations within region E. Attempts at further defining the DNA response element in the E region using smaller mutations have been unsuccessful. We are currently focusing on this region, as well as B, to identify the transcription factors responsible for maintaining elevated basal activity of the eLHß promoter. Both regions are G/C rich, and preliminary data suggest that they may represent weak Sp1 binding sites (M. Wolfe, unpublished).

Additional evidence suggests an Egr site lies immediately 3' to region E. Therefore, the E mutation would disrupt Egr binding. We have been unable to detect expression of Egr1 or binding to this site using nuclear proteins from unstimulated {alpha}T3–1 cells (Fig. 8Go and Ref. 28). Unlike the E mutant, mutation of this Egr site has no detrimental effect on eLHß promoter activity in {alpha}T3–1 cells (28). These data suggest that some other transcription factor may bind to region E. In contrast, basal promoter activity is attenuated in LßT2 cells when the Egr site is mutated. Furthermore, Egr proteins are expressed basally in LßT2 cells (46). This could be one explanation as to why the E mutation leads to attenuated promoter activity in LßT2 cells.

In summary, the {alpha}T3–1 and LßT2 cell lines are useful models for studying expression of the eLHß gene. Two SF-1 response elements were identified within the eLHß promoter that have been conserved across other species. These sites are functional and contribute to basal activity of the eLHß promoter in LßT2, but not {alpha}T3–1, cells. Two other regions of the promoter that lie between -185 and -100 were identified as being required for basal activity. The most important of these lies immediately downstream of the distal SF-1 site. At present, it is unclear as to what protein(s) binds to either of these regions, although they have some homology to Sp1 sites. These data are some of the first to identify functional cis-acting elements that play critical roles in regulating basal activity of a LHß gene. Transcriptional regulation of the eLHß gene appears to involve multiple elements as does expression of the glycoprotein hormone {alpha}-subunit gene. Further experimentation will be required to determine whether other similarities exist in regulation of gonadotrope expression of the {alpha}- and LHß- sub-unit genes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Restriction enzymes and other enzymes were obtained from the Promega Corp. (Madison, WI) and Life Technologies, Inc., Inc. (Gaithersburg, MD). Oligodeoxynucleotides were obtained from Midland Certified Reagent Co. (Midland, TX) or Life Technologies, Inc.. Bluescript plasmid vector (pBSK-) used for DNA cloning was obtained from Stratagene (La Jolla, CA), and the luciferase reporter vectors (pGL2 basic and control) were obtained from Promega Corp.. All radionuclides were purchased from New England Nuclear Life Science Products, Inc. (Boston, MA). A random prime labeling kit was purchased from Roche Molecular Biochemicals (Indianapolis, IN). DNA sequencing was conducted using Sequenase purchased from United States Biochemical Corp. (Cleveland, OH) or through cycling sequencing using reagents purchased from PE Applied Biosystems and subsequently run on the ABI 310 sequencer (Perkin Elmer Corp./ABD, Norwalk, CT). PCR amplification of DNA was performed using Taq polymerase (Life Technologies, Inc.) or Deep Vent DNA polymerase (New England Biolabs, Inc., Beverly, MA). All other chemicals and reagents were obtained from Pharmacia Biotech (Piscataway, NJ), Fisher Scientific (Pittsburgh, PA), Sigma Chemical Co. (St. Louis, MO), and Life Technologies, Inc..

Equine Genomic Clone
To isolate additional 5'-flanking sequence for the eLH/CGß gene, a Lambda FIX II equine genomic library (Stratagene; La Jolla, CA) was screened using standard procedures (40) and the -448/+60 equine promoter fragment as radiolabeled probe (29). Approximately 1.1 x 106 plaque-forming units were screened, from which three clones were isolated, each containing a 16-kb insert. Restriction analysis revealed that two of the clones were identical. Further characterization of the clones was determined by performing Southern analyses using either the eLH/CGß promoter fragment or cDNA as probes (29) and by sequencing a portion of the clone (48).

Plasmid Constructs
The pGL2 basic plasmid was used as a reporter vector for all of the promoter constructs used in this study. The original promoter clone isolated by Sherman et al. (29) was used to generate all of the constructs containing 448 bp or less of 5'-flanking sequence. The original equine clone was generated by PCR using an upstream bovine consensus oligodeoxynucleotide (-440/-420; Ref. 29) that contained a 5' HindIII site and an oligodeoxynucleotide specific to the 5' untranslated region of the equine LH/CGß gene (+41/+60). PstI linkers were added to this PCR product and subsequently digested with PstI and partially with HindIII. The PstI and HindIII fragment was subcloned into the HindIII and PstI sites of BSK.

The longer eLHß promoter constructs were generated as follows. The eß5{lambda} clone was digested with SacI and HindIII, gel isolated (2.5-kb fragment), partially digested with SalI, and reisolated as a 2.5-kb fragment containing the promoter. This represented a fragment cut at a SalI site in the lambda multiple cloning site and 3' at a HindIII site located at -387 in the promoter. The cloning vector was made by cutting the original promoter clone (29) with XhoI (cuts in multiple cloning site and is compatible with SalI) and HindIII (cuts at -387 in promoter) and isolating the vector. The SalI/HindIII promoter fragment was ligated into the XhoI/HindIII sites of the eLHß BSK vector, resulting in a 3-kb promoter construct.

The -448/+60, -185/+60, and -100/+60 constructs were made by digesting the parent vector with ClaI and SauI (-448), NarI (-185), or SmaI (-100), respectively, filling in the ends and religating. This removed the upstream bovine oligodeoxynucleotide and additional 5'-flanking sequence in the case of the shorter constructs. The -387/+60 promoter was constructed by digesting the parent promoter with HindIII and religating. These promoter constructs were subsequently subcloned into the pGL2 basic reporter vector. Promoter-containing plasmids were digested with PstI, blunted, digested with XhoI, and gel isolated. These fragments were ligated into the XhoI and blunted BglII sites of pGL2 basic. The eß -2200/+60 and -1400/+60 constructs were generated from the eLHß -3000/+60 BSK vector by partial digestion with XhoI (sites at -2200 and -1400) and complete digestion with SstI. Promoter fragments were isolated and subsequently ligated into the eß -448/+60 luc vector that had been cut with XhoI and SstI.

All mutant promoter constructs were made in the context of the -448/+60 promoter. Mutation of the dSF-1 site was accomplished by PCR using an upstream oligodeoxynucleotide located in the pGL2 vector (GL1), a downstream µdSF-1 oligodeoxynucleotide encompassing bases -135 to -73, and eß-448/+60 Luc as template. The dSF-1 site was mutated from TGACCTTG to aGAtCTTG. It has previously been shown that the CC pair within the GSE was critical for protein binding (13). The PCR product was digested with SstI and BstEII, and this fragment (-343 to -78) was gel isolated. The eß-448/+60 Luc vector was digested with SstI and BglII and both fragments were isolated. The smaller fragment (-343 to the BglII site 5' to the luciferase gene) was digested with BstEII, and the BstEII/BglII fragment was isolated. The SstI/BglII digested eß -448/+60 Luc vector, the BstEII/BglII fragment, and the SstI/BstEII PCR fragment were subsequently ligated to generate eß -448/+60 µdSF1 Luc.

The proximal SF-1 site was mutated by a similar PCR strategy. Two PCR reactions were performed using eß -448/+60 Luc as template. The first used GL2 (downstream oligodeoxynucleotide located in luciferase) and an oligodeoxynucleotide encompassing bases -64 to -27 (sense strand), while the second reaction used GL1 and an antisense oligodeoxynucleotide encompassing bases -64 to -27. The oligodeoxynucleotides encompassing -64 to -27 mutated the pSF-1 from TGGCCTTG to aGatCTTG and generated a BglII site. The GL1/µpSF-1 PCR product was digested with SstI and BglII, while the µpSF-1/GL2 PCR product was digested with BglII alone. These fragments were subsequently ligated into the eß -448/+60 Luc vector digested with SstI and BglII. Positive clones were evaluated for the correct orientation. Both SF-1 mutant clones were sequenced to confirm that the appropriate mutations had been made.

A similar paradigm was used for the block replacement mutants. Oligodeoxynucleotides were synthesized containing the mutations shown in Fig. 7AGo. Additional 5' and 3' sequence was incorporated onto these oligodeoxynucleotides to allow for annealing to the eß -448/+60 Luc template (µA -191/-150; µB -191/-136; µD -149/-94; µE -135/-94; the latter two oligos were in the reverse orientation). The second oligo that was used in PCR corresponded to bases -224/-205 (for mutants D and E) or +41/+60 (reverse orientation; for mutants A and B). These PCR products were gel isolated, digested with NarI and SmaI (or AvaI), and ligated into eß -448/+60 BSK that had been digested with NarI and SmaI (or AvaI). Generation of the C mutant required a two-step process with two mutant oligos. Two PCR reactions were performed: the first with the -224/-205 oligo and a reverse orientation µC (-164/-136) and the second with a positive orientation µC (-149/-120) oligo and the +41/+60 reverse orientation oligo. These PCR products were gel isolated and digested with NarI and BglII or BglII and SmaI (or AvaI), respectively (the BglII site is within the mutation), and gel isolated again. The two DNA fragments were ligated, digested with NarI and SmaI (or AvaI), and subsequently ligated into the NarI/SmaI (or AvaI) digested vector. The eß{Delta}85 Luc construct was made by blunting the NarI/SmaI digested eß -448/+60 BSK followed by religation. These mutant promoters were subcloned into pGL2 basic as described above and were sequenced to confirm that the appropriate mutation had been made.

The second E mutation (E1.2) was generated using a strategy similar to that used to make the µdSF1 clone. The mutant promoter fragment was amplified using GL1 and an oligo encompassing the bases between -128 and -73. This mutated the bases between -119 and -105 from TTGTCCGCCTCTCGC to ggtaaCtagTacgta and differs from the original mutation (Fig. 7AGo). The PCR product was digested with SstI and BstEII and ligated into the eß -448/+60 Luc vector previously cut with SstI and BstEII as described above. Positive clones were sequenced to confirm that the appropriate mutation had been made.

The bovine and mouse LHß promoter fragments were generated by PCR using the following oligos (5'–3'): 5'-bLHß oligo AATCTCGAGTACGGGAGCCACTCAGG (-185/+168), 3'-bLHß oligo GTTAAGCTTCTTGGTGCCTCCCCTGC (-7/+10), 5'-mLHß oligo AGGGCTAGCTCGAGCCCTGACACCTGGGC (-196/+181), 3'-mLHß oligo AGGAAGCTTAGATCTTTGATACCCTTCCCTAC (-12/+8). Bovine or mouse genomic DNA served as template. Products from the PCR reactions were digested with XhoI and HindIII (engineered into the oligos) and ligated into pGL2 basic previously cut with XhoI and HindIII. Positive clones were isolated and sequenced to confirm the accuracy of the PCR reaction.

The pGL2 basic vector served as a promoterless control, while the the pGL2 control (contains the SV40 promoter and enhancer) vector served as a positive control in the transient transfection experiments. An additional viral promoter linked to luciferase (pGL2) that was used as a positive control was the RSV long-terminal repeat. A 2.1-kb mouse SF-1 cDNA was obtained for experiments involving overexpression of SF-1 (49). This cDNA was subcloned into a RSV-driven expression vector (50). A similar construct containing a globin cDNA was used as a control.

Cell Culture and Transient Transfections
Cultures of {alpha}T3–1 cells (31) were plated in DMEM with 5% FBS, 5% horse serum, and antibiotics. On the day before transfection, {alpha}T3–1 cells were plated at a density of 1.8 x 105 cells per well in six-well plates. Cells were transfected with up to 1.5 µg of plasmid DNA, 400 ng of RSVßGal (internal control of transfection efficiency), and 7 µl of LipofectAmine (Life Technologies, Inc.) according to the manufacturers recommendations. Briefly, DNA and LipofectAmine were diluted separately in OptiMEM, combined, and incubated at room temperature for approximately 30 min. Media were aspirated from the cells and replaced with the DNA/LipofectAmine mix. The plates were then returned to the CO2 incubator. After an overnight incubation, the DNA/LipofectAmine mix was removed, fresh media were added, and the plates were returned to the incubator. Cells were harvested 2 days posttransfection. Plasmid constructs were evaluated in triplicate within each transfection, and transfections were performed a minimum of three times unless noted otherwise.

Cultures of LßT2 cells (32, 33) were plated on ECM (Sigma Chemical Co.)-coated plates in DMEM containing 10% FBS and antibiotics. On the day before transfection, cells were plated at 1.5 x 105 cells per well in 12-well plates. Cells were transfected with 1 µg of plasmid DNA, 400 ng of RSVßGal, 3 {lambda} of LipofectAmine Plus, and 2 {lambda} of LipofectAmine following the manufacturers recommendations. Cells were incubated with the DNA/Lipid mix for 4–5 h. Media containing 20% FBS were then added and the incubation was continued overnight. On the following morning, the transfection media were aspirated and replaced with fresh media. Cells were harvested 2 days posttransfection. Plasmid constructs were evaluated in triplicate within each transfection, and transfections were performed a minimum of three times unless noted otherwise.

Reporter Assays
Luciferase assays were performed following the protocol for the Promega Luciferase assay system (Promega Corp.). Briefly, cells were washed twice in PBS and harvested in 150 µl of reporter lysis buffer (Promega Corp.). After the addition of luciferase assay buffer (100 µl), relative luciferase activity (20 µl of lysate) was measured for 10 sec in a Berthold Lumat LB 9501 luminometer (Wallac, Inc. Gaithersburg, MD). The Galacto-Light ß-galactosidase reporter gene assay system (Tropix, Bedford, MA) was used to anaylze ß-galactosidase activity. Reaction buffer (100 µl) was added to cell lysates (20 µl) and incubated at room temperature for 1 h. Light emission accelerator (150 µl) was added, and light emission was measured for 5 sec in a luminometer. Luciferase activity (relative light units) was normalized to the activity of ß-galactosidase.

Nuclear Preparation and EMSAs
Nuclei were prepared from {alpha}T3–1 cells according to the methods of Hagenbuchle and Wellaur (51). Nuclei were diluted to a concentration of 2–4 x 105 nuclei/µl and stored at -80 C. Oligodeoxynucleotides were end labeled with [32P]ATP and T4 kinase while restriction fragments were labeled with [32P]dCTP and [32P]dATP using Klenow polymerase. These labeled DNAs were used as probes in EMSAs. Nuclei (1–2 µl) were incubated for 15 min at room temperature in binding buffer (10 mM HEPES, pH 7.9, 100 mM KCL, 5 mM MgCl2, 10 µM ZnCl2, 1 mM EDTA, 10% glycerol) containing 0.5 µg poly (dA-dT), 0.25 µg poly (dI-dC), and 0.1 µg salmon sperm DNA. Labeled probe (50 fmol) and competitor were then added and incubated for an additional 15 min at room temperature (total reaction volume of 20 µl). The DNA-protein complexes were resolved on a 4% native polyacrylamide gel (prerun for ~30 min) in 0.5x Tris-borate-EDTA buffer. In experiments where the antibody against the DNA-binding domain of SF-1 or normal rabbit sera were used, sera (2 µl) were added to the reaction 30 min before addition of labeled probe. The reaction was allowed to incubate for an additional 15 min after inclusion of labeled probe.


    ACKNOWLEDGMENTS
 
We wish to thank Weiwei Zhao, Gerald Call, Dr. Leslie L. Heckert, and Dr. Michael J. Soares for their technical advice and assistance. Sincere appreciation and gratitude is expressed to Dr. John H. Nilson for the bovine {alpha}-subunit promoter and for his generous advice and support of this work. We would also like to thank Dr. Pamela Mellon for the {alpha}T3–1 and LßT2 cell lines, Dr. Keith Parker for the SF-1 cDNA, Dr. Ulf Rapp for the RSV expression vector, Dr. Leslie L. Heckert for the human {alpha}-subunit promoter, and Dr. Mark S. Roberson for the mouse {alpha}-subunit promoter.


    FOOTNOTES
 
Address requests for reprints to: Michael W. Wolfe, Ph.D., Department of Molecular and Integrative Physiology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160-7401.

This work was supported by NIH Grant DK-50668 (M.W.W.) and was performed with the assistance of the Imaging/Photography and Cell Culture Cores of the NIH-supported Center of Reproductive Sciences (Grant HD-33994).

Received for publication April 28, 1998. Revision received April 22, 1999. Accepted for publication June 2, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Pierce J, Parsons TF 1981 Glycoprotein hormones: structure, function. Annu Rev Biochem 50:465–495[CrossRef][Medline]
  2. Fiddes JC, Talmadge K 1984 Structure, expression, and evolution of the genes encoding the human glycoprotein hormones. Recent Prog Horm Res 40:43–78
  3. Gharib SD, Wierman ME, Shupnik MA, Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocr Rev 11:177–199[Abstract/Free Full Text]
  4. Jameson JL, Hollenberg AN 1993 Regulation of chorionic gonadotropin gene expression. Endocr Rev 14:203–221[Abstract/Free Full Text]
  5. Bousfield GR, Perry WM, Ward DN 1994 Gonadotropins, chemistry and biosynthesis. In: Knobil E, Neill JD (eds) The Physiology of Reproduction, ed. 2. Raven Press, New York, vol. 1:1749–1785
  6. Pittman RH, Clay CM, Farmerie TA, Nilson JH 1994 Functional analysis of the placenta-specific enhancer of the human glycoprotein hormone {alpha} subunit gene: emergence of a new element. J Biol Chem 269:19360–19368[Abstract/Free Full Text]
  7. Silver BJ, Bokar J, Virgin JB, Valen E, Milsted A, Nilson JH 1987 Cyclic AMP regulation of the human glycoprotein hormone {alpha}-gene is mediated by an 18 base pair element. Proc Natl Acad Sci USA 84:2198–2202[Abstract/Free Full Text]
  8. Meyer TE, Habener JF 1993 Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr Rev 14:269–290[Abstract/Free Full Text]
  9. Steger DJ, Altschmied J, Buscher M, Mellon PL 1991 Evolution of placenta-specific gene expression: comparison of the equine and human gonadotropin {alpha}-subunit genes. Mol Endocrinol 5:243–255[Abstract/Free Full Text]
  10. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific enhancer of the human glycoprotein hormone {alpha}-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  11. Schoderbek WE, Kim KW, Ridgway EC, Mellon PL, Maurer RA 1992 Analysis of DNA sequences required for pituitary-specific expression of the glycoprotein hormone {alpha}-subunit gene. Mol Endocrinol 6:893–903[Abstract/Free Full Text]
  12. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the human gonadotropin {alpha}-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:5592–5602[Abstract/Free Full Text]
  13. Horn F, Windle JJ, Barnhart KM, Mellon PL 1992 Tissue-specific gene expression in the pituitary: the glycoprotein hormone {alpha}-subunit gene is regulated by a gonadotrope-specific protein. Mol Cell Biol 12:2143–2153[Abstract/Free Full Text]
  14. Roberson MS, Schoderbek WE, Tremml G, Maurer RA 1994 Activation of the glycoprotein hormone {alpha}-subunit promoter by a LIM-homeodomain transcription factor. Mol Cell Biol 14:2985–2993[Abstract/Free Full Text]
  15. Talmadge K, Vamvakopoulos NC, Fiddes JC 1984 Evolution of the genes for the ß subunits of human chorionic gonadotropin and luteinizing hormone. Nature 307:37–40[CrossRef][Medline]
  16. Jameson JL, Lindell CM, Habener JF 1986 Evolution of different transcriptional start sites in the human luteinizing hormone and chorionic gonadotropin ß-subunit genes. DNA 5:227–234[Medline]
  17. Fenstermaker RA, Milsted A, Virgin JB, Miller WL, Nilson JH 1989 The transcriptional response of the human chorionic gonadotropin ß-subunit gene to cAMP is cycloheximide sensitive and is mediated by cis-acting sequences different from that found in the {alpha}-subunit gene. Mol Endocrinol 3:1070–1076[Abstract/Free Full Text]
  18. Albanese C, Kay TWH, Troccoli NM, Jameson JL 1991 Novel cyclic adenosine 3',5'-monophosphate response element in the human chorionic gonadotropin ß-subunit gene. Mol Endocrinol 5:693–702[Abstract/Free Full Text]
  19. Steger DJ, Buscher M, Hecht JH, Mellon PL 1993 Coordinate control of the {alpha}- and ß-subunit genes of human chorionic gonadotropin by trophoblast-specific element-binding protein. Mol Endocrinol 7:1579–1588[Abstract/Free Full Text]
  20. Kim KE, Day KH, Howard P, Salton SRJ, Roberts JL, Maurer RA 1990 DNA sequences required for expression of the LHß promoter in primary cultures of rat pituitary cells. Mol Cell Endocrinol 74:101–107[CrossRef][Medline]
  21. Brown P, McNeilly JR, Wallace RM, McNeilly AS, Clark AJ 1993 Characterization of the ovine LH ß-subunit gene: the promoter directs gonadotrope-specific expression in transgenic mice. Mol Cell Endocrinol 93:157–165[CrossRef][Medline]
  22. Keri RA, Wolfe MW, Saunders TL, Anderson I, Kendall SK, Wagner T, Yun J, Gorski J, Nett TM, Camper SA, Nilson JH 1994 The proximal promoter of the bovine luteinizing hormone ß-subunit gene confers gonadotrope-specific expression and regulation by gonadotropin-releasing hormone, testosterone, and 17ß-estradiol in transgenic mice. Mol Endocrinol 8:1807–1816[Abstract/Free Full Text]
  23. Fallest PC, Trader GL, Darrow JM, Shupnik MA 1995 Regulation of rat luteinizing hormone ß gene expression in transgenic mice by steroids and a gonadotropin-releasing hormone antagonist. Biol Reprod 53:103–109[Abstract]
  24. Halvorson LM, Kaiser UB, Chin WW 1996 Stimulation of luteinizing hormone ß gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. J Biol Chem 271:6645–6650[Abstract/Free Full Text]
  25. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ß subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785[Abstract/Free Full Text]
  26. Halvorson LM, Ito M, Jameson JL, Chin WW 1998 Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone ß-subunit gene expression. J Biol Chem 273:14712–14720[Abstract/Free Full Text]
  27. Halvorson LM, Kaiser UB, Chin WW 1999 The protein kinase C system acts through the early growth response protein 1 to increase LHß gene expression in synergy with steroidogenic factor-1. Mol Endocrinol 13:106–110[Abstract/Free Full Text]
  28. Wolfe MW, Call GB 1999 Early growth response protein 1 binds to the luteinizing hormone-ß promoter and mediates gonadotropin-releasing hormone-stimulated gene expression. Mol Endocrinol 13:752–763[Abstract/Free Full Text]
  29. Sherman GB, Wolfe MW, Farmerie TA, Clay CM, Threadgill DS, Sharp DC, Nilson JH 1992 A single gene encodes the ß-subunits of equine luteinizing hormone and chorionic gonadotropin. Mol Endocrinol 6:951–959[Abstract/Free Full Text]
  30. Sugino H, Bousfield GR, Moore Jr WT, Ward DN 1987 Structural studies on equine glycoprotein hormones. J Biol Chem 262:8603–8609[Abstract/Free Full Text]
  31. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[Abstract/Free Full Text]
  32. Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439–450[Abstract/Free Full Text]
  33. Thomas P, Mellon PL, Turgeon JL, Waring DW 1996 The LßT2 clonal gonadotrope: a model for single cell studies of endocrine cell secretion. Endocrinology 137:2979–2989[Abstract]
  34. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312[Abstract/Free Full Text]
  35. Barnhart KM, Mellon PL 1994 The orphan nuclear receptor, steroidogenic factor-1, regulates the glycoprotein hormone {alpha}-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878–885[Abstract/Free Full Text]
  36. Duval DL, Nelson SE, Clay CM 1997 A binding site for steroidogenic factor-1 is part of a complex enhancer that mediates expression of the murine gonadotropin-releasing hormone receptor gene. Biol Reprod 56:160–168[Abstract]
  37. Virgin JB, Silver BJ, Thomason AR, Nilson JH 1985 The gene for the ß subunit of bovine luteinizing hormone encodes a gonadotropin mRNA with an unusually short 5'-untranslated region. J Biol Chem 260:7072–7077[Abstract/Free Full Text]
  38. Ezashi T, Hirai T, Kato T, Wakabayashi K, Kato Y 1990 The gene for the ß subunit of porcine LH: clusters of GC boxes and CACCC elements. J Mol Endocrinol 5:137–146[Abstract/Free Full Text]
  39. Jameson JL, Chin WW, Hollenberg AN, Chong AS, Habener JF 1984 The gene encoding the ß-subunit of rat luteinizing hormone. J Biol Chem 259:15474–15480[Abstract/Free Full Text]
  40. Talmadge K, Vamvakopoulos NC, Fiddes JC 1984 Evolution of the genes for the ß subunits of chorionic gonadotropin and luteinizing hormone. Nature 307:37–40
  41. Kumar TR, Matzuk MM 1995 Cloning of the mouse gonadotropin ß-subunit-encoding genes, II. Structure of the luteinizing hormone ß-subunit-encoding genes. Gene 166:335–336[CrossRef][Medline]
  42. Lee SL, Sadovsky Y, Swirnoff AH, Polish JA, Goda P, Gavrilina G, Milbrandt J 1996 Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGFI-A (Egr-1). Science 273:1219–1221[Abstract]
  43. Ikeda Y, Swain A, Weber TJ, Hentges KE, Zanaria E, Lalli E, Tamai KT, Sassone-Corsi P, Lovell-Badge R, Camerino G, Parker KL 1996 Steroidogenic factor 1 and Dax-1 colocalize in multiple cell lineages: potential links in endocrine development. Mol Endocrinol 10:1261–1272[Abstract/Free Full Text]
  44. Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478–486[Abstract/Free Full Text]
  45. Haisenleder DJ, Yasin M, Dalkin AC, Gilrain J, Marshall JC 1996 GnRH regulates steroidogenic factor-1 (SF-1) gene expression in the rat pituitary. Endocrinology 137:5719–5722[Abstract]
  46. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y 1999 Activation of luteinizing hormone-ß gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. J Biol Chem 274:13870–13876[Abstract/Free Full Text]
  47. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) 1994 Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York
  48. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain-termination inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  49. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 6:1249–1258[Abstract/Free Full Text]
  50. Dorn P, DaSilva L, Martarano L, Derse D 1990 Equine infectious anemia virus tat: insights into the structure, function, and evolution of lentivirus trans-activator proteins. J Virol 64:1616–1624[Abstract/Free Full Text]
  51. Hagenbuchle O, Wellaur PK 1992 A rapid method for the isolation of DNA-binding proteins from purified nuclei of tissues and cells in culture. Nucleic Acids Res 20:3555–3559[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
Y. Wang, J. Fortin, P. Lamba, M. Bonomi, L. Persani, M. S. Roberson, and D. J. Bernard
Activator Protein-1 and Smad Proteins Synergistically Regulate Human Follicle-Stimulating Hormone {beta}-Promoter Activity
Endocrinology, November 1, 2008; 149(11): 5577 - 5591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Shima, M. Zubair, T. Komatsu, S. Oka, C. Yokoyama, T. Tachibana, T. A. Hjalt, J. Drouin, and K.-i. Morohashi
Pituitary Homeobox 2 Regulates Adrenal4 Binding Protein/Steroidogenic Factor-1 Gene Transcription in the Pituitary Gonadotrope through Interaction with the Intronic Enhancer
Mol. Endocrinol., July 1, 2008; 22(7): 1633 - 1646.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Rui, J. Tsao, J. O. Scheys, G. D. Hammer, and B. P. Schimmer
Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells
Endocrinology, July 1, 2008; 149(7): 3668 - 3678.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Henke, C. Marc Luetjens, M. Simoni, and J. Gromoll
Chorionic Gonadotropin {beta}-Subunit Gene Expression in the Marmoset Pituitary Is Controlled by Steroidogenic Factor 1, Early Growth Response Protein 1, and Pituitary Homeobox Factor 1
Endocrinology, December 1, 2007; 148(12): 6062 - 6072.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld
Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks
Physiol Rev, July 1, 2007; 87(3): 933 - 963.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. B. Salisbury, A. K. Binder, J. C. Grammer, and J. H. Nilson
Maximal Activity of the Luteinizing Hormone{beta}-Subunit Gene Requires {beta}-Catenin
Mol. Endocrinol., April 1, 2007; 21(4): 963 - 971.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Karpova, J. Presley, R. R. Manimaran, S. P. Scherrer, L. Tejada, K. R. Peterson, and L. L. Heckert
A Ftz-F1-Containing Yeast Artificial Chromosome Recapitulates Expression of Steroidogenic Factor 1 in Vivo
Mol. Endocrinol., October 1, 2005; 19(10): 2549 - 2563.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
Q. Jiang, K.-H. Jeong, C. D Horton, and L. M Halvorson
Pituitary homeobox 1 (Pitx1) stimulates rat LH{beta} gene expression via two functional DNA-regulatory regions
J. Mol. Endocrinol., August 1, 2005; 35(1): 145 - 158.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson
Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone
Endocr. Rev., August 1, 2004; 25(4): 521 - 542.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. J. Bernard
Both SMAD2 and SMAD3 Mediate Activin-Stimulated Expression of the Follicle-Stimulating Hormone {beta} Subunit in Mouse Gonadotrope Cells
Mol. Endocrinol., March 1, 2004; 18(3): 606 - 623.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Quirk, D. D. Seachrist, and J. H. Nilson
Embryonic Expression of the Luteinizing Hormone beta Gene Appears to Be Coupled to the Transient Appearance of p8, a High Mobility Group-related Transcription Factor
J. Biol. Chem., January 10, 2003; 278(3): 1680 - 1685.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. P. Scherrer, D. A. Rice, and L. L. Heckert
Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within Its Proximal Promoter
Biol Reprod, November 1, 2002; 67(5): 1509 - 1521.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
L. L. Heckert and M. D. Griswold
The Expression of the Follicle-stimulating Hormone Receptor in Spermatogenesis
Recent Prog. Horm. Res., January 1, 2002; 57(1): 129 - 148.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. S. Jorgensen and J. H. Nilson
AR Suppresses Transcription of the LH{beta} Subunit by Interacting with Steroidogenic Factor-1
Mol. Endocrinol., September 1, 2001; 15(9): 1505 - 1516.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. L. Heckert
Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element
Mol. Endocrinol., May 1, 2001; 15(5): 704 - 715.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
C. C. Quirk, K. L. Lozada, R. A. Keri, and J. H. Nilson
A Single Pitx1 Binding Site Is Essential for Activity of the LH{beta} Promoter in Transgenic Mice
Mol. Endocrinol., May 1, 2001; 15(5): 734 - 746.
[Abstract] [Full Text]


Home page
DevelopmentHome page
L Zhao, M Bakke, Y Krimkevich, L. Cushman, A. Parlow, S. Camper, and K. Parker
Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function
Development, January 1, 2001; 128(2): 147 - 154.
[Abstract] [PDF]


Home page
Mol. Endocrinol.Home page
U. B. Kaiser, L. M. Halvorson, and M. T. Chen
Sp1, Steroidogenic Factor 1 (SF-1), and Early Growth Response Protein 1 (Egr-1) Binding Sites Form a Tripartite Gonadotropin-Releasing Hormone Response Element in the Rat Luteinizing Hormone-{beta} Gene Promoter: an Integral Role for SF-1
Mol. Endocrinol., August 1, 2000; 14(8): 1235 - 1245.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. A. Keri, D. J. Bachmann, A. Behrooz, B. D. Herr, R. K. Ameduri, C. C. Quirk, and J. H. Nilson
An NF-Y Binding Site Is Important for Basal, but Not Gonadotropin-releasing Hormone-stimulated, Expression of the Luteinizing Hormone beta Subunit Gene
J. Biol. Chem., April 21, 2000; 275(17): 13082 - 13088.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolfe, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolfe, M. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals