| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Integrative Physiology University of Kansas Medical Center Kansas City, Kansas 66160-7401
| ABSTRACT |
|---|
|
|
|---|
T31 and LßT2 cells. This
region encompasses the steroidogenic factor-1 (SF-1) binding site that
has been reported to have a functional role in expression of the LHß
promoter in other species. We have also identified an additional SF-1
site at -55 to -48. Binding of SF-1 to both sites was confirmed by
electrophoretic mobility shift assays. Mutations within these sites,
either individually or in combination, did not attenuate basal activity
of the eLHß promoter in
T31 cells, but did diminish promoter
activity in LßT2 cells. Interestingly, cotransfection with an
expression vector encoding SF-1 induced eLHß promoter activity, and
this induction was abrogated by mutations within the SF-1 sites in
T31 cells. Block replacement mutagenesis was performed on the
-185/-100 region of the eLHß promoter to identify DNA response
elements responsible for maintaining basal promoter activity. From this
analysis, two regions emerged as being important: a distal 31-bp
segment (-181 to -150) and an element located immediately 3' to the
distal SF-1 site (-119 to -106). It is hypothesized that these two
regions as well as the SF-1 sites represent regulatory elements that
contribute to a combinatorial code involved in targeting expression of
the eLHß promoter to gonadotropes. | INTRODUCTION |
|---|
|
|
|---|
-subunit noncovalently linked to a unique ß-subunit. LH is
synthesized in the pituitary of all mammals (1). This glycoprotein
hormone stimulates ovulation in females, promotes spermatogenesis in
males, and directs gonadal steroidogenesis in both sexes. In contrast,
synthesis of CG occurs only in placenta of primates and equids (2). In
primates, and presumably equids, CG maintains function of the corpus
luteum during the early stages of pregnancy, which in turn sustains
pregnancy.
A single gene encodes the
-subunit in all mammals studied to date
(1). Thus, synthesis of LH and CG requires that expression of the
-subunit gene occurs in two locations: gonadotropes of the pituitary
and trophoblasts of the placenta (1, 3, 4, 5). Placenta-specific
expression is achieved through a compact and interactive array of
regulatory elements located within the proximal 200 bp of the human
-subunit 5'-flanking region (5, 6). Some of the transcription
factors that interact with these elements have been identified and
consist of ubiquitous proteins such as members of the cAMP-response
element binding protein (CREB)/ activating transcription factor
(ATF) family (4, 7, 8), the GATA family of DNA binding proteins
(9), and a protein that appears to be unique to the placenta
(trophoblast-specific element binding protein or TSEB; Refs. 9, 10).
In contrast, a different but overlapping set of regulatory elements
appears to be required for pituitary-specific expression of the
-subunit gene. For example, at least one of the
cis-acting elements involved in placenta-specific expression
(the GATA binding site) may also contribute to expression in pituitary
gonadotropes (11, 12). Additional elements upstream of the 200-bp
promoter-proximal region have also been identified. These include an
element that binds a member of the orphan nuclear receptor family,
steroidogenic factor-1 (SF-1; Ref. 13) and a site that binds a member
of the LIM-homeodomain family of DNA-binding proteins (LH-2; Ref.
14).
Synthesis of LH and CG also requires expression of the hormone-defining ß- subunit gene. Most mammals have a single LHß gene with transcription occurring only in gonadotropes of the pituitary. In primates, the single-copy LHß gene has undergone a series of gene duplications resulting in the formation of a linked array of multiple CGß genes (2). Although LHß and CGß genes maintain a homology of greater than 90%, transcription of CGß genes occurs only in placenta and initiates at a site 366 bp upstream from that used for transcription of the LHß gene (15, 16). Thus, different promoters and regulatory elements are responsible for the pituitary- and placenta-specific expression of primate LHß and CGß genes.
As indicated from several transfection studies (17, 18, 19), the human
CGß promoter contains one element located between nucleotides -305
and -279 that appears important for both basal transcription and
responsiveness to cAMP. Although less well defined, full responsiveness
to cAMP requires at least one other element located between -248/-210
(18). Interestingly, both of these elements can bind TSEB, the
aforementioned placenta-specific protein that forms part of the
regulatory code required for targeting expression of the
-subunit
gene to the placenta (19). While the binding of TSEB may provide a
mechanism for coordinating placenta-specific expression of the
- and
CGß-subunit genes, functional studies that test this possibility are
lacking.
Resolution of regulatory elements required for pituitary-specific
expression of mammalian LHß genes has been hampered by the lack of
cell lines that actively express either the endogenous LHß gene or
transfected LHß promoter-reporter genes. For reasons that still
remain unresolved, transfection studies that employ primary cultures of
pituitary cells have also been relatively uninformative (20). Due to
these limitations, transgenic mice have become the model of choice for
studying the LHß promoter. Data from transgenic studies suggest that
elements required for gonadotrope-specific expression and
responsiveness to GnRH and sex steroids reside within the first 800 bp
of the LHß-promoter proximal region (21, 22, 23). It has been
demonstrated both in vitro and in vivo that SF-1
can bind to and transactivate the rat and bovine LHß promoters (24, 25). In fact, mutation of the SF-1 site severely attenuated activity of
the bovine promoter in transgenic mice (25). Recent reports indicate
that SF-1 interacts with an immediate-early response gene product,
early growth response protein 1 (Egr-1), and that these two
transcription factors mediate GnRH regulation of the LHß gene
(26, 27, 28). Thus, SF-1 appears to play an important role in regulating
gonadotrope expression of both the
- and LHß-subunit genes.
Characterization of the equine LH and CG ß-subunit gene (29)
has shown that, in contrast to primates, the ß-subunits of eLH and
eCG are encoded by the same single-copy gene. The single eLH/CGß
transcript gives rise to proteins having identical amino acid sequences
(30). This protein is more like the human and primate CGß than LHß
since it contains a carboxyl-terminal peptide unique to primate CGß
genes. In contrast, initiation of transcription of the eLH/CGß gene
occurs at the same nucleotide position in placenta and pituitary (29).
The TATA-containing promoter responsible for this event is comparable
to the primate LHß promoter. Therefore, the eLH/CGß gene shares
features that are common to the primate and equid
-subunit gene in
that they are single-copy genes, transcription is initiated through the
use of a TATA-containing promoter, and both subunits are expressed in
pituitary and placenta.
Given the unique structural configuration of the eLH/CGß gene, and
the paucity of information regarding mechanisms regulating pituitary
expression of mammalian LHß genes, activity of the eLHß promoter
was evaluated in the
T31 (31) and LßT2 (32, 33) gonadotrope cell
lines. Data reported herein identify two functional SF-1 sites and two
additional proximal activating elements/regions. It is hypothesized
that these DNA response elements contribute to a combinatorial code
that directs LHß expression in pituitary gonadotropes.
| RESULTS |
|---|
|
|
|---|
-clones (Fig. 1
) was sequenced to confirm that it contained an
authentic eLHß 5'-flanking region. This clone contains approximately
3 kb of 5'-flanking sequence, the entire coding region, and
approximately 12 kb of 3'-flanking sequence.
|
T31 Gonadotrope Cell
Line
T31 cell line (22, 23, 24). We examined
transcriptional activity of 5'-deletion mutants of the eLHß promoter
to determine whether it was also inactive in
T31 cells. Although
these cells lack endogenous expression of LHß, they have many of the
characteristics exhibited by mature gonadotropes (31). Unlike previous
reports for the rat and bovine LHß promoters, activity of all of the
eLHß promoter constructs was greater than that of the promoterless
control (pGL2 basic; Fig. 2A
|
T31
cells, we evaluated whether this was unique to the equine promoter.
Similar regions of the bovine and mouse LHß promoters (based on
sequence homology and alignment) were cloned by PCR and evaluated for
basal activity in
T31 cells. Both the bovine and mouse LH
promoters were inactive in the
T31 cells, corroborating previous
data (Fig. 3
-subunit promoter. Some of the differences in activity of the
-subunit promoters could be attributed to variation in promoter
length, but not all. Thus, species differences appear to exist in the
requirements for expression of both the
and LHß-subunit promoters
in
T31 cells.
|
T31 cells were used as the source for SF-1 (34, 35). A single, predominant complex was detected with both the distal
and proximal eLHß SF-1 probes (Fig. 5A
-subunit promoter (h
GSE) was used as labeled probe (Fig. 5A
|
|
-subunit promoter SF-1
site. The h
GSE oligo competed for protein binding as well as did the
homologous competitors. We also evaluated the ability of the eLHß
SF-1 sites to compete for binding of SF-1 to the radiolabeled h
GSE
site (Fig. 5B
GSE oligo (lanes 15 and 16). The pSF-1 site was less effective at
competing for SF-1 binding to the h
GSE oligo as compared with the
dSF-1 and h
GSE oligos. These data suggested that the pSF-1 response
element had a weaker affinity for SF-1 as compared with the dSF-1 and
h
GSE response elements and was supported by the binding data shown
in Fig. 5A
GSE oligos
were used as probes; lanes 6 vs. 1 and 11).
To further document the affinity differences between the distal and
proximal SF-1 sites, a more thorough competition analysis was performed
(Fig. 5C
). Binding of SF-1 to the dSF-1 site was effectively blocked
using as little as a 10-fold molar excess of homologous competitor
(eß dSF1, lane 2) or the h
GSE site as competitor (lane 8), while
a 10-fold molar excess of eß pSF1 was ineffective (lane 5) at
competing for SF-1 binding. It required 10 times more eß pSF1 than
eß dSF1 to achieve equivalent levels of competition (lanes 2
vs. 7). A similar pattern of competition was observed when
the proximal SF-1 site was used as the labeled probe (data not shown).
These data suggest that the distal site binds SF-1 with an affinity
that is approximately 10-fold higher than that of the proximal site in
the eLHß promoter.
The Equine LHß SF-1 Sites Are Not Required for Basal Activity in
T31 Cells
To address the functional significance of the eLHß SF-1 sites,
transient transfections were performed in
T31 cells with the
wild-type -448/+60 eLHß promoter linked to luciferase or constructs
that harbored mutations in the SF-1 sites (single or double mutations).
The distal and proximal SF-1 sites (TGACCTTG and TGGCCTTG,
respectively) in the eLHß promoter were mutated to aGatCTTG. These
mutations completely abolished SF-1 binding in an EMSA (data not
shown). Mutation of the distal or proximal SF-1 sites, individually or
in combination, had little impact on basal promoter activity (Fig. 6A
). These data suggest that although
SF-1 can bind to the eLHß promoter, SF-1 does not contribute to basal
expression in
T31 cells.
|
T31 cells along with an expression
vector encoding the SF-1 cDNA. Overexpression of SF-1 increased
activity of the -448/+60 eLHß promoter by 2.2-fold (Fig. 6B
T31 cells and that
full transactivation requires both SF-1 sites.
Two Regions Flanking the SF-1 Site Are Responsible for Basal
Activity of the eLHß Promoter in
T31 Cells
As shown earlier, sequences between -185 and -100 are needed for
full promoter activity (Fig. 2A
). Therefore, to further delineate the
sequences required for basal activity of the eLHß promoter in
T31 cells, five block replacement mutations (AE) were generated
that scanned through the -185/-100 region (Fig. 7A
). These mutations were made within the
context of the -448/+60 promoter. As an additional test of the
importance of this 85-bp segment, we evaluated activity of a promoter
that had the bases between -185 and -100 deleted (eß
85).
Mutation of regions A, B, and E resulted in a decrease in basal
promoter activity of 46, 50, and 85%, respectively (Fig. 7B
). An
additional E mutant was generated (changed E to a different mutant
sequence; µE1.2) that also severely attenuated promoter activity
(data not shown). The impact of these E mutations was essentially
indistinguishable from the effect of the 85-bp internal deletion (eß
85). In contrast, the C and D mutations had little to no effect on
promoter activity. Interestingly, the D mutation disrupts two cytosines
that have been shown to be critical for SF-1 binding (13, 35). These
data from the D mutation further support the data described above for
the dSF-1 mutant. Collectively, the data reveal that the regions
defined by A, B, and E are essential for full promoter activity, while
the greatest impact was seen from mutation of E.
|
|
Activity of the eLHß Promoter in LßT2 Cells
To affirm the results obtained in
T31 cells, the LßT2
gonadotrope cell line was obtained, and the previous promoter
constructs were reevaluated. LßT2 cells are a newly derived
gonadotrope cell line and, unlike the
T31 cells, they express
their endogenous LHß-subunit gene and it is responsive to GnRH (32).
As was the case for
T31 cells, the equine promoter was active in
LßT2 cells, and the region between -185 and -100 retained its
importance in enhancing basal promoter activity (Fig. 9
). Unlike
T31 cells, the bovine and
mouse LHß promoters exhibited some basal promoter activity (Fig. 10A
); however, the equine promoter had
considerably more activity.
|
|
T31
cells with one exception (Fig. 10C| DISCUSSION |
|---|
|
|
|---|
T31 and LßT2 cell lines to study expression of the
eLHß-subunit promoter. Unlike the bovine, mouse, and rat (23, 24)
LHß promoters, the eLHß promoter is active in the
T31 cell
line. Furthermore, the equine promoter is approximately 7 times more
active in LßT2 cells than are the bovine and mouse LHß promoters.
This has allowed us to begin to identify DNA response elements and
trans-acting factors that are involved in regulating basal
expression of the eLHß promoter.
Analysis of 5'-deletion mutants of the eLHß promoter indicated that
all of the constructs had basal activities greater than that of the
promoterless control in
T31 (ranged from 7- to 18-fold over pGL2
basic) and LßT2 cells (16- to 112-fold over pGL2 basic). These same
constructs were inactive in a human choriocarcinoma cell line. Thus,
the transcription factors involved in expression of the eLHß promoter
in
T31 and LßT2 cells appear to be absent in BeWo cells. Of
interest is the fact that we and others (22) have not observed any
significant activity of the bLHß promoter in
T31 or BeWo cells.
Similarly, the rat LHß promoter has been reported to be inactive in
T31 cells (24), as is the mouse LHß promoter based on our own
data. Together these findings, as well as those from LßT2 cells (Fig. 10A
), suggest that differences exist between species in the
requirements for gonadotrope (
T31, LßT2) expression of the LHß
gene. The unique features that result in elevated activity of the
eLHß promoter appear to reside within the -185/+60 region. Four
primary areas of sequence divergence exist in this region between the
equine and bovine promoters: -185 to -130, -115 to -113, -75 to
-57, and -16 to +45. The two most distal regions are located within
the block replacements shown in Fig. 7
and are involved in maintaining
basal promoter activity. It is interesting to note that region E was
extremely important for basal activity of the promoter, and this
sequence differs from bovine by only two nucleotides. Minor sequence
variation in these regions may account for the elevated basal activity
of the equine promoter as compared with bovine.
Basal activity of the eLHß promoter is primarily driven by sequences located between -185 and -100. This is in contrast to data obtained from a study of the rat LHß promoter in primary cultures of rat pituitary cells (20). A gradual decline in basal promoter activity was observed when serial 5'-deletions were performed on a 1.7-kb promoter. The shortest rat LHß promoter tested (75 bp) maintained 37% of the activity of the 1.7-kb promoter. It is not clear as to whether these discrepancies are due to species differences, use of a different model, or a combination of these two.
It was initially hypothesized that a SF-1 site located between -185
and -100 was responsible for regulating basal activity of the eLHß
promoter. This hypothesis was formulated based on 1) data shown in Fig. 2A
; 2) the striking conservation of this sequence across species (Fig. 4
, dSF-1); 3) previous reports regarding SF-1 regulation of the bovine
and rat LHß promoters (24, 25); and 4) the loss of LHß expression
in mice harboring a homozygous disruption of the Ftz-F1
gene, which encodes SF-1 (29). Furthermore, as we began to analyze the
eLHß promoter, we identified a second, putative SF-1 binding site
(Fig. 4
, pSF-1). This site was similar to the distal SF-1 site and was
conserved in the human, porcine, rat, and mouse LHß promoters. This
proximal SF-1 site has recently been determined to be functional in the
rat LHß promoter (26). Due to the conservation and utilization of
SF-1 response elements in the GnRH receptor (36), LHß- (21, 37, 38, 39, 40, 41),
and
-subunit promoters (13, 35), it suggests that SF-1 may be
serving a role in the gonadotrope analogous to the trophoblast-specific
element (TSE) and TSEB in regulating placental expression of the human
- and CGß-subunits (19). Data from the current study indicate that
SF-1 can indeed bind to both the distal and proximal SF-1 sites and
activate the eLHß promoter (Figs. 5
and 10B
). Mutation of the SF-1
sites individually or in combination did not alter basal activity of
the eLHß promoter in
T31 cells (Fig. 6A
) but did so in LßT2
cells. Fold activation of the equine promoter by SF-1 was similar to
that reported for the rat LHß promoter in LßT2 cells (26).
Data from the EMSAs suggested that SF-1 was not limiting in these
cells. This contention was supported by a report indicating that
mutation of the SF-1 site within the human
-subunit promoter
decreased basal promoter activity (35). Thus, SF-1 is not limiting for
transactivation of the
-subunit promoter. Based on the data
presented in Fig. 5C
, it appears that the human
-subunit SF-1 site
has a similar affinity toward SF-1 as does the dSF-1 in the eLHß
promoter. It is also interesting to note that SF-1 was unable to induce
activity of a -82/+5 rat LHß promoter containing the pSF-1 site that
we have identified (24). However, in a subsequent study this proximal
site was shown to be functional (26). Several potential explanations
exist as for why mutations of the SF-1 sites had no detrimental effect
on activity of the equine LHß promoter, but does affect activity of
the human
-subunit promoter. SF-1 may be interacting with other
transcription factors, and these factors may differ between the
-
and LHß-subunits. This is supported by data indicating that an
immediate early response gene (Egr1/NGFIA) can interact with SF-1 and
regulate expression of the rat LHß promoter (42). Effective
interaction with a second transcription factor such as Egr1 may require
higher cellular concentrations of SF-1, hence, the lack of SF-1
regulation of the eLHß promoter under basal conditions in
T31
cells. Alternatively, the lack of a response in
T3 cells may be due
to the fact that these cells also express Dax-1 (43), which can block
or repress SF-1-mediated transcription (M. Wolfe, unpublished data).
Overexpression of SF-1 may have overcome this block and revealed the
functional importance of the SF-1 response elements.
In light of the recent SF-1 transgenic mouse data (25, 34), further experimentation is warranted to determine the in vivo significance (i.e. transgenic mice) of the eLHß SF-1 sites and what role, if any, they play in the spatiotemporal expression pattern and hormonal regulation of the eLHß-subunit gene. It is interesting to note that exogenous administration of GnRH to the SF-1-deficient mice activated expression of LHß (44), suggesting that SF-1 is not essential for expression of LHß in vivo. However, it has also been shown that GnRH can increase the expression of SF-1 in gonadotropes (45). We and others have recently shown that SF-1 and Egr1 interact and that GnRH regulation of the LHß promoter occurs through the SF-1 and Egr response elements (27, 28). Thus, GnRH appears to be able to regulate LHß through SF-1-dependent and -independent pathways.
The most striking outcome of this study was the discovery that an
85-bp fragment of the eLHß promoter was required for basal activity
in
T31 and LßT2 cells. Deletion of the bases between -185 and
-100, within the context of the -448/+60 construct, severely
attenuated promoter activity. Furthermore, attenuated promoter activity
could be recapitulated by mutating the bases between -119 and -105
(region E). The block replacement mutagenesis uncovered an additional
segment of DNA within the 85-bp region (regions A and B) that also
plays a role in promoter activation. Mutation of these bases attenuated
promoter activity, but not as effectively as mutations within region E.
Attempts at further defining the DNA response element in the E region
using smaller mutations have been unsuccessful. We are currently
focusing on this region, as well as B, to identify the transcription
factors responsible for maintaining elevated basal activity of the
eLHß promoter. Both regions are G/C rich, and preliminary data
suggest that they may represent weak Sp1 binding sites (M. Wolfe,
unpublished).
Additional evidence suggests an Egr site lies immediately 3' to
region E. Therefore, the E mutation would disrupt Egr binding. We have
been unable to detect expression of Egr1 or binding to this site using
nuclear proteins from unstimulated
T31 cells (Fig. 8
and Ref. 28).
Unlike the E mutant, mutation of this Egr site has no detrimental
effect on eLHß promoter activity in
T31 cells (28). These data
suggest that some other transcription factor may bind to region E. In
contrast, basal promoter activity is attenuated in LßT2 cells when
the Egr site is mutated. Furthermore, Egr proteins are expressed
basally in LßT2 cells (46). This could be one explanation as to why
the E mutation leads to attenuated promoter activity in LßT2
cells.
In summary, the
T31 and LßT2 cell lines are useful models
for studying expression of the eLHß gene. Two SF-1 response elements
were identified within the eLHß promoter that have been conserved
across other species. These sites are functional and contribute to
basal activity of the eLHß promoter in LßT2, but not
T31,
cells. Two other regions of the promoter that lie between -185
and -100 were identified as being required for basal activity. The
most important of these lies immediately downstream of the distal SF-1
site. At present, it is unclear as to what protein(s) binds to
either of these regions, although they have some homology to Sp1 sites.
These data are some of the first to identify functional
cis-acting elements that play critical roles in regulating
basal activity of a LHß gene. Transcriptional regulation of the
eLHß gene appears to involve multiple elements as does expression
of the glycoprotein hormone
-subunit gene. Further
experimentation will be required to determine whether other
similarities exist in regulation of gonadotrope expression of the
- and LHß- sub-unit genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Equine Genomic Clone
To isolate additional 5'-flanking sequence for the eLH/CGß
gene, a Lambda FIX II equine genomic library (Stratagene;
La Jolla, CA) was screened using standard procedures (40) and the
-448/+60 equine promoter fragment as radiolabeled probe (29).
Approximately 1.1 x 106 plaque-forming units
were screened, from which three clones were isolated, each containing a
16-kb insert. Restriction analysis revealed that two of the clones were
identical. Further characterization of the clones was determined by
performing Southern analyses using either the eLH/CGß promoter
fragment or cDNA as probes (29) and by sequencing a portion of the
clone (48).
Plasmid Constructs
The pGL2 basic plasmid was used as a reporter vector for all of
the promoter constructs used in this study. The original promoter clone
isolated by Sherman et al. (29) was used to generate all of
the constructs containing 448 bp or less of 5'-flanking sequence. The
original equine clone was generated by PCR using an upstream bovine
consensus oligodeoxynucleotide (-440/-420; Ref. 29) that contained a
5' HindIII site and an oligodeoxynucleotide specific to the
5' untranslated region of the equine LH/CGß gene (+41/+60).
PstI linkers were added to this PCR product and subsequently
digested with PstI and partially with HindIII.
The PstI and HindIII fragment was subcloned into
the HindIII and PstI sites of BSK.
The longer eLHß promoter constructs were generated as follows. The
eß5
clone was digested with SacI and
HindIII, gel isolated (2.5-kb fragment), partially digested
with SalI, and reisolated as a 2.5-kb fragment containing
the promoter. This represented a fragment cut at a SalI site
in the lambda multiple cloning site and 3' at a HindIII site
located at -387 in the promoter. The cloning vector was made by
cutting the original promoter clone (29) with XhoI (cuts in
multiple cloning site and is compatible with SalI) and
HindIII (cuts at -387 in promoter) and isolating the
vector. The SalI/HindIII promoter fragment was
ligated into the XhoI/HindIII sites of the eLHß
BSK vector, resulting in a 3-kb promoter construct.
The -448/+60, -185/+60, and -100/+60 constructs were made by digesting the parent vector with ClaI and SauI (-448), NarI (-185), or SmaI (-100), respectively, filling in the ends and religating. This removed the upstream bovine oligodeoxynucleotide and additional 5'-flanking sequence in the case of the shorter constructs. The -387/+60 promoter was constructed by digesting the parent promoter with HindIII and religating. These promoter constructs were subsequently subcloned into the pGL2 basic reporter vector. Promoter-containing plasmids were digested with PstI, blunted, digested with XhoI, and gel isolated. These fragments were ligated into the XhoI and blunted BglII sites of pGL2 basic. The eß -2200/+60 and -1400/+60 constructs were generated from the eLHß -3000/+60 BSK vector by partial digestion with XhoI (sites at -2200 and -1400) and complete digestion with SstI. Promoter fragments were isolated and subsequently ligated into the eß -448/+60 luc vector that had been cut with XhoI and SstI.
All mutant promoter constructs were made in the context of the -448/+60 promoter. Mutation of the dSF-1 site was accomplished by PCR using an upstream oligodeoxynucleotide located in the pGL2 vector (GL1), a downstream µdSF-1 oligodeoxynucleotide encompassing bases -135 to -73, and eß-448/+60 Luc as template. The dSF-1 site was mutated from TGACCTTG to aGAtCTTG. It has previously been shown that the CC pair within the GSE was critical for protein binding (13). The PCR product was digested with SstI and BstEII, and this fragment (-343 to -78) was gel isolated. The eß-448/+60 Luc vector was digested with SstI and BglII and both fragments were isolated. The smaller fragment (-343 to the BglII site 5' to the luciferase gene) was digested with BstEII, and the BstEII/BglII fragment was isolated. The SstI/BglII digested eß -448/+60 Luc vector, the BstEII/BglII fragment, and the SstI/BstEII PCR fragment were subsequently ligated to generate eß -448/+60 µdSF1 Luc.
The proximal SF-1 site was mutated by a similar PCR strategy. Two PCR reactions were performed using eß -448/+60 Luc as template. The first used GL2 (downstream oligodeoxynucleotide located in luciferase) and an oligodeoxynucleotide encompassing bases -64 to -27 (sense strand), while the second reaction used GL1 and an antisense oligodeoxynucleotide encompassing bases -64 to -27. The oligodeoxynucleotides encompassing -64 to -27 mutated the pSF-1 from TGGCCTTG to aGatCTTG and generated a BglII site. The GL1/µpSF-1 PCR product was digested with SstI and BglII, while the µpSF-1/GL2 PCR product was digested with BglII alone. These fragments were subsequently ligated into the eß -448/+60 Luc vector digested with SstI and BglII. Positive clones were evaluated for the correct orientation. Both SF-1 mutant clones were sequenced to confirm that the appropriate mutations had been made.
A similar paradigm was used for the block replacement mutants.
Oligodeoxynucleotides were synthesized containing the mutations shown
in Fig. 7A
. Additional 5' and 3' sequence was incorporated onto these
oligodeoxynucleotides to allow for annealing to the eß -448/+60 Luc
template (µA -191/-150; µB -191/-136; µD -149/-94; µE
-135/-94; the latter two oligos were in the reverse orientation). The
second oligo that was used in PCR corresponded to bases -224/-205
(for mutants D and E) or +41/+60 (reverse orientation; for mutants A
and B). These PCR products were gel isolated, digested with
NarI and SmaI (or AvaI), and ligated
into eß -448/+60 BSK that had been digested with NarI and
SmaI (or AvaI). Generation of the C mutant
required a two-step process with two mutant oligos. Two PCR reactions
were performed: the first with the -224/-205 oligo and a reverse
orientation µC (-164/-136) and the second with a positive
orientation µC (-149/-120) oligo and the +41/+60 reverse
orientation oligo. These PCR products were gel isolated and digested
with NarI and BglII or BglII and
SmaI (or AvaI), respectively (the
BglII site is within the mutation), and gel isolated again.
The two DNA fragments were ligated, digested with NarI and
SmaI (or AvaI), and subsequently ligated into the
NarI/SmaI (or AvaI) digested vector.
The eß
85 Luc construct was made by blunting the
NarI/SmaI digested eß -448/+60 BSK followed by
religation. These mutant promoters were subcloned into pGL2 basic as
described above and were sequenced to confirm that the appropriate
mutation had been made.
The second E mutation (E1.2) was generated using a strategy similar to
that used to make the µdSF1 clone. The mutant promoter
fragment was amplified using GL1 and an oligo encompassing the bases
between -128 and -73. This mutated the bases between -119 and -105
from TTGTCCGCCTCTCGC to ggtaaCtagTacgta and differs from the original
mutation (Fig. 7A
). The PCR product was digested with SstI
and BstEII and ligated into the eß -448/+60 Luc vector
previously cut with SstI and BstEII as described
above. Positive clones were sequenced to confirm that the appropriate
mutation had been made.
The bovine and mouse LHß promoter fragments were generated by PCR using the following oligos (5'3'): 5'-bLHß oligo AATCTCGAGTACGGGAGCCACTCAGG (-185/+168), 3'-bLHß oligo GTTAAGCTTCTTGGTGCCTCCCCTGC (-7/+10), 5'-mLHß oligo AGGGCTAGCTCGAGCCCTGACACCTGGGC (-196/+181), 3'-mLHß oligo AGGAAGCTTAGATCTTTGATACCCTTCCCTAC (-12/+8). Bovine or mouse genomic DNA served as template. Products from the PCR reactions were digested with XhoI and HindIII (engineered into the oligos) and ligated into pGL2 basic previously cut with XhoI and HindIII. Positive clones were isolated and sequenced to confirm the accuracy of the PCR reaction.
The pGL2 basic vector served as a promoterless control, while the the pGL2 control (contains the SV40 promoter and enhancer) vector served as a positive control in the transient transfection experiments. An additional viral promoter linked to luciferase (pGL2) that was used as a positive control was the RSV long-terminal repeat. A 2.1-kb mouse SF-1 cDNA was obtained for experiments involving overexpression of SF-1 (49). This cDNA was subcloned into a RSV-driven expression vector (50). A similar construct containing a globin cDNA was used as a control.
Cell Culture and Transient Transfections
Cultures of
T31 cells (31) were plated in DMEM with 5%
FBS, 5% horse serum, and antibiotics. On the day before transfection,
T31 cells were plated at a density of 1.8 x 105
cells per well in six-well plates. Cells were transfected with up to
1.5 µg of plasmid DNA, 400 ng of RSVßGal (internal control of
transfection efficiency), and 7 µl of LipofectAmine (Life Technologies, Inc.) according to the manufacturers
recommendations. Briefly, DNA and LipofectAmine were diluted separately
in OptiMEM, combined, and incubated at room temperature for
approximately 30 min. Media were aspirated from the cells and replaced
with the DNA/LipofectAmine mix. The plates were then returned to the
CO2 incubator. After an overnight incubation, the
DNA/LipofectAmine mix was removed, fresh media were added, and the
plates were returned to the incubator. Cells were harvested 2 days
posttransfection. Plasmid constructs were evaluated in triplicate
within each transfection, and transfections were performed a minimum of
three times unless noted otherwise.
Cultures of LßT2 cells (32, 33) were plated on ECM (Sigma Chemical Co.)-coated plates in DMEM containing 10% FBS and
antibiotics. On the day before transfection, cells were plated at
1.5 x 105 cells per well in 12-well plates. Cells
were transfected with 1 µg of plasmid DNA, 400 ng of RSVßGal, 3
of LipofectAmine Plus, and 2
of LipofectAmine following the
manufacturers recommendations. Cells were incubated with the DNA/Lipid
mix for 45 h. Media containing 20% FBS were then added and the
incubation was continued overnight. On the following morning, the
transfection media were aspirated and replaced with fresh media. Cells
were harvested 2 days posttransfection. Plasmid constructs were
evaluated in triplicate within each transfection, and transfections
were performed a minimum of three times unless noted otherwise.
Reporter Assays
Luciferase assays were performed following the protocol for the
Promega Luciferase assay system (Promega Corp.). Briefly,
cells were washed twice in PBS and harvested in 150 µl of reporter
lysis buffer (Promega Corp.). After the addition of
luciferase assay buffer (100 µl), relative luciferase activity (20
µl of lysate) was measured for 10 sec in a Berthold Lumat LB 9501
luminometer (Wallac, Inc. Gaithersburg, MD). The
Galacto-Light ß-galactosidase reporter gene assay system (Tropix,
Bedford, MA) was used to anaylze ß-galactosidase activity. Reaction
buffer (100 µl) was added to cell lysates (20 µl) and incubated at
room temperature for 1 h. Light emission accelerator (150 µl)
was added, and light emission was measured for 5 sec in a luminometer.
Luciferase activity (relative light units) was normalized to the
activity of ß-galactosidase.
Nuclear Preparation and EMSAs
Nuclei were prepared from
T31 cells according to the
methods of Hagenbuchle and Wellaur (51). Nuclei were diluted to
a concentration of 24 x 105 nuclei/µl and stored
at -80 C. Oligodeoxynucleotides were end labeled with
[32P]ATP and T4 kinase while restriction fragments were
labeled with [32P]dCTP and [32P]dATP using
Klenow polymerase. These labeled DNAs were used as probes in EMSAs.
Nuclei (12 µl) were incubated for 15 min at room temperature in
binding buffer (10 mM HEPES, pH 7.9, 100 mM
KCL, 5 mM MgCl2, 10 µM
ZnCl2, 1 mM EDTA, 10% glycerol) containing 0.5
µg poly (dA-dT), 0.25 µg poly (dI-dC), and 0.1 µg salmon sperm
DNA. Labeled probe (50 fmol) and competitor were then added and
incubated for an additional 15 min at room temperature (total reaction
volume of 20 µl). The DNA-protein complexes were resolved on a 4%
native polyacrylamide gel (prerun for
30 min) in 0.5x
Tris-borate-EDTA buffer. In experiments where the antibody against the
DNA-binding domain of SF-1 or normal rabbit sera were used, sera (2
µl) were added to the reaction 30 min before addition of labeled
probe. The reaction was allowed to incubate for an additional 15 min
after inclusion of labeled probe.
| ACKNOWLEDGMENTS |
|---|
-subunit promoter and for his generous
advice and support of this work. We would also like to thank Dr. Pamela
Mellon for the
T31 and LßT2 cell lines, Dr. Keith Parker for the
SF-1 cDNA, Dr. Ulf Rapp for the RSV expression vector, Dr. Leslie L.
Heckert for the human
-subunit promoter, and Dr. Mark S. Roberson
for the mouse
-subunit promoter. | FOOTNOTES |
|---|
This work was supported by NIH Grant DK-50668 (M.W.W.) and was performed with the assistance of the Imaging/Photography and Cell Culture Cores of the NIH-supported Center of Reproductive Sciences (Grant HD-33994).
Received for publication April 28, 1998. Revision received April 22, 1999. Accepted for publication June 2, 1999.
| REFERENCES |
|---|
|
|
|---|
subunit gene: emergence of a new element. J Biol Chem 269:1936019368
-gene
is mediated by an 18 base pair element. Proc Natl Acad Sci USA 84:21982202
-subunit genes. Mol Endocrinol 5:243255
-subunit gene: dependence
on cyclic AMP-inducible elements. Mol Cell Biol 7:39944002
-subunit gene. Mol Endocrinol 6:893903
-subunit gene in the placenta and
pituitary gland. Mol Cell Biol 14:55925602
-subunit
gene is regulated by a gonadotrope-specific protein. Mol Cell Biol 12:21432153
-subunit promoter by a
LIM-homeodomain transcription factor. Mol Cell Biol 14:29852993
-subunit gene. Mol Endocrinol 3:10701076
- and ß-subunit genes of human chorionic
gonadotropin by trophoblast-specific element-binding protein. Mol
Endocrinol 7:15791588
-subunit
gene in pituitary gonadotropes. Mol Endocrinol 8:878885This article has been cited by other articles:
![]() |
Y. Wang, J. Fortin, P. Lamba, M. Bonomi, L. Persani, M. S. Roberson, and D. J. Bernard Activator Protein-1 and Smad Proteins Synergistically Regulate Human Follicle-Stimulating Hormone {beta}-Promoter Activity Endocrinology, November 1, 2008; 149(11): 5577 - 5591. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shima, M. Zubair, T. Komatsu, S. Oka, C. Yokoyama, T. Tachibana, T. A. Hjalt, J. Drouin, and K.-i. Morohashi Pituitary Homeobox 2 Regulates Adrenal4 Binding Protein/Steroidogenic Factor-1 Gene Transcription in the Pituitary Gonadotrope through Interaction with the Intronic Enhancer Mol. Endocrinol., July 1, 2008; 22(7): 1633 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Rui, J. Tsao, J. O. Scheys, G. D. Hammer, and B. P. Schimmer Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells Endocrinology, July 1, 2008; 149(7): 3668 - 3678. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Henke, C. Marc Luetjens, M. Simoni, and J. Gromoll Chorionic Gonadotropin {beta}-Subunit Gene Expression in the Marmoset Pituitary Is Controlled by Steroidogenic Factor 1, Early Growth Response Protein 1, and Pituitary Homeobox Factor 1 Endocrinology, December 1, 2007; 148(12): 6062 - 6072. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Salisbury, A. K. Binder, J. C. Grammer, and J. H. Nilson Maximal Activity of the Luteinizing Hormone{beta}-Subunit Gene Requires {beta}-Catenin Mol. Endocrinol., April 1, 2007; 21(4): 963 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Karpova, J. Presley, R. R. Manimaran, S. P. Scherrer, L. Tejada, K. R. Peterson, and L. L. Heckert A Ftz-F1-Containing Yeast Artificial Chromosome Recapitulates Expression of Steroidogenic Factor 1 in Vivo Mol. Endocrinol., October 1, 2005; 19(10): 2549 - 2563. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Jiang, K.-H. Jeong, C. D Horton, and L. M Halvorson Pituitary homeobox 1 (Pitx1) stimulates rat LH{beta} gene expression via two functional DNA-regulatory regions J. Mol. Endocrinol., August 1, 2005; 35(1): 145 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone Endocr. Rev., August 1, 2004; 25(4): 521 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Bernard Both SMAD2 and SMAD3 Mediate Activin-Stimulated Expression of the Follicle-Stimulating Hormone {beta} Subunit in Mouse Gonadotrope Cells Mol. Endocrinol., March 1, 2004; 18(3): 606 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Quirk, D. D. Seachrist, and J. H. Nilson Embryonic Expression of the Luteinizing Hormone beta Gene Appears to Be Coupled to the Transient Appearance of p8, a High Mobility Group-related Transcription Factor J. Biol. Chem., January 10, 2003; 278(3): 1680 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Scherrer, D. A. Rice, and L. L. Heckert Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within Its Proximal Promoter Biol Reprod, November 1, 2002; 67(5): 1509 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Heckert and M. D. Griswold The Expression of the Follicle-stimulating Hormone Receptor in Spermatogenesis Recent Prog. Horm. Res., January 1, 2002; 57(1): 129 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Jorgensen and J. H. Nilson AR Suppresses Transcription of the LH{beta} Subunit by Interacting with Steroidogenic Factor-1 Mol. Endocrinol., September 1, 2001; 15(9): 1505 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Heckert Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element Mol. Endocrinol., May 1, 2001; 15(5): 704 - 715. [Abstract] [Full Text] |
||||
![]() |
C. C. Quirk, K. L. Lozada, R. A. Keri, and J. H. Nilson A Single Pitx1 Binding Site Is Essential for Activity of the LH{beta} Promoter in Transgenic Mice Mol. Endocrinol., May 1, 2001; 15(5): 734 - 746. [Abstract] [Full Text] |
||||
![]() |
L Zhao, M Bakke, Y Krimkevich, L. Cushman, A. Parlow, S. Camper, and K. Parker Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function Development, January 1, 2001; 128(2): 147 - 154. [Abstract] [PDF] |
||||
![]() |
U. B. Kaiser, L. M. Halvorson, and M. T. Chen Sp1, Steroidogenic Factor 1 (SF-1), and Early Growth Response Protein 1 (Egr-1) Binding Sites Form a Tripartite Gonadotropin-Releasing Hormone Response Element in the Rat Luteinizing Hormone-{beta} Gene Promoter: an Integral Role for SF-1 Mol. Endocrinol., August 1, 2000; 14(8): 1235 - 1245. [Abstract] [Full Text] |
||||
![]() |
R. A. Keri, D. J. Bachmann, A. Behrooz, B. D. Herr, R. K. Ameduri, C. C. Quirk, and J. H. Nilson An NF-Y Binding Site Is Important for Basal, but Not Gonadotropin-releasing Hormone-stimulated, Expression of the Luteinizing Hormone beta Subunit Gene J. Biol. Chem., April 21, 2000; 275(17): 13082 - 13088. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |