help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orcel, P.
Right arrow Articles by Nishimoto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orcel, P.
Right arrow Articles by Nishimoto, I.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Molecular Endocrinology 14 (1):170
Copyright © 2000 by The Endocrine Society

Multiple Domains Interacting with Gs in the Porcine Calcitonin Receptor

Philippe Orcel1, Hirohisa Tajima1, Yoshitake Murayama, Toshiro Fujita, Stephen M. Krane, Etsuro Ogata, Steven R. Goldring and Ikuo Nishimoto

Department of Medicine (P.O., S.M.K., S.R.G., I.N.) Harvard Medical School Cardiovascular Research Center and Arthritis Research Massachusetts General Hospital-East Charlestown, Massachusetts 02129
INSERM U349 (P.O.) Centre Viggo Petersen Hopital Lariboisière 75010 Paris, France
Department of Pharmacology and Neurosciences (H.T., I.N.) KEIO University School of Medicine Tokyo 160, Japan
Department of Medicine (Y.M., T. F.) University of Tokyo School of Medicine Mejirodai, Bunkyo-ku Tokyo 113, Japan
Cancer Research Center (E.O.) Toshima-ku, Tokyo 170, Japan
Department of Medicine (S.R.G.) Beth Israel Deaconess Medical Center and New England Baptist Bone and Joint Institute Harvard Institutes of Medicine Boston, Massachusetts 02215


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The molecular basis for Gs activation by the calcitonin (CT) receptor was investigated. Based upon the analysis of conserved regions in G protein-coupled receptors, two nonoverlapping regions in the heptahelical porcine CT receptor (CTR) were selected as candidate Gs-interacting domains: the third intracellular loop residues 327–344 (KLKESQEAESHMYLKAVR, P3 region) and the C-tail residues 404–418 (KRQWNQYQAQRWAGR, P4 region). To assess their Gs-interacting function, we expressed these sequences in hybrid insulin-like growth factor II receptors in which the receptor native Gi-interacting domain was converted to CTR sequences. In COS cells transfected with either P3- or P4-substituted hybrid receptor, membrane adenylyl cyclase activity significantly increased. The up-regulated activity of cAMP was confirmed by measuring the transcriptional activity of the cAMP response element in cells expressing either hybrid receptor. A mutant CTR lacking the P4 region maintained positive cAMP response but with an attenuated maximal capacity to produce cAMP. In contrast, we could not assess the function of the P3 region using a conventional deletion method, as CT bound poorly to cells transfected with either of the two P3-deficient CTRs (one lacking the P3 region and the other lacking P3 but having the P3 sequence in reverse orientation). These data suggest that the third intracellular loop and the C-tail in CTR have domain-specific roles in Gs activation and that the hybrid receptor approach used here, combined with a conventional mutagenesis approach, is useful for intact cell analysis and functional dissection of G protein-coupled receptors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The calcitonin receptor (CTR) is a member of the superfamily of heptahelical receptors, sharing common structural features with other G protein-coupled receptors (GPCRs) (1 ). Binding of calcitonin (CT) to this receptor activates membrane adenylyl cyclase (AC) and production of cAMP through the G protein Gs, promotes polyphosphoinositide turnover, and activates protein kinase C (PKC) via G proteins of the Gq family; under certain conditions, CT inhibits AC via the Gi subclass of G proteins (2 3 4 ). While these results indicate multipotential coupling of the CTR to various G protein-linked pathways, a number of studies have shown that Gs activation and subsequent cAMP accumulation transmit the major signal for the physiological effects of CT in target cells (1 3 4 5 ). This study was conducted to define the molecular basis for Gs activation by CTR.

Various GPCRs share structurally similar sequences in their cytoplasmic domains, which have been implicated in G protein interactions. By examining the structure/function relationship of these regions, we initially defined structural motifs underlying the G protein-interacting function as: 1) at least two basic residues in the N-terminal side; 2) B1-B2-X-B3, or B1-B2'-X-X-B3 (B: basic residue, X: nonbasic residue in the C-terminal side); and 3) length between 10 and 26 residues (6 ). Okamoto et al. (7 ) found that B2 can be substituted for alanine, based upon the results from alanine residue substitution, and Ikezu et al. (8 ) found that B3 can be substituted for aromatic amino acid residue, based upon the identified sequence in the {alpha}2-adrenergic receptor. As this is a screening method for the G protein-coupling candidates followed by confirmation (or exclusion) with actual experimentation, we considered reasonably broad criteria to be most useful. To allow as broad a screening as possible, we have therefore revised criterion 2 to 2' B1-B2-X-B3, or B1-B2'-X-X-B3 (B1/B2'/B3: basic or aromatic residue, B2: basic or aromatic residue or alanine, X: non-basic residue). These criteria potentially represent the structural characteristics of the regions shared by various GPCRs as well as those of a small number of the regions that have been shown to directly activate G proteins in vitro. With a small number of GPCRs, the usefulness of these criteria have been noted by ourselves (9 10 ) and by other groups (11 12 13 14 15 16 17 18 19 ), when these researchers specified domain-specific functions in GPCRs or a non- or atypical receptor type of G protein-linked proteins. Analysis of the predicted amino acid sequence of the porcine CTR revealed the presence of two nonoverlapping regions, referred to here as P3 and P4, as assessed by these criteria. The first sequence KLKESQEAESHMYLKAVR (P3) is located in the third cytoplasmic loop (residues 327–344; the numbering is for CTR-1a); the second sequence KRQWNQYQAQRWAGR (P4) is located in the C-tail of the receptor (residues 404–418). While there are two alternative splicing isoforms of the porcine CTR, termed CTR-1a and -1b (20 ), these sequences are completely conserved between them. It should be emphasized that a few GPCRs so far investigated with the aforementioned criteria bear the E/DRY motif in the juxtamembrane region of the second intracellular loop, whereas CTR belongs to a different subfamily of GPCRs, bearing no E/DRY motif in the corresponding site. Therefore, it was further necessary to investigate whether these regions in CTR can interact with Gs in intact cells.

Short polypeptides of length less than 30 amino acids, such as the P3 and P4 regions, are generally hard to express in cells and, even if expressed, may not have effective access to the plasma membrane where G proteins reside. We therefore developed a novel strategy using an insulin-like growth factor II (IGF-II) receptor (IGF-IIR) hybrid system as a sequence-expressing vector for monitoring the stimulation of AC. Increased AC activity is one of the most reliable indices of Gs stimulation in intact cells. The IGF-IIR is the first single-transmembrane receptor identified that interacts with and activates G proteins, especially Gi, in cell-free systems (21 ), semi-cell-free systems (22 ), or whole-cell systems (23 24 ). Although failure of IGF-IIR coupling to G proteins was reported once (25 ), a subsequent paper (23 ), with two of the same authors, demonstrated the Gi coupling function of IGF-IIR in vivo. While most of the GPCRs consist of a heptahelical structure, such a structure is therefore not an absolute prerequisite for interactions with G proteins. Subsequent studies by ourselves (26 ) and by other groups (14 16 17 ) have lent additional credence to this notion. In the case of IGF-IIR, its cytoplasmic R2410-K2423 region has been consistently shown to be the domain necessary and sufficient for Gi activation in all systems so far analyzed (6 22 24 ). It has been shown that the Gs-activating function of a specific amino acid sequence can be examined by replacing this R2410-K2423 region in the IGF-IIR, expressing the hybrid IGF-IIR, and checking whether the activity of the cAMP system is enhanced (22 ).

We constructed two hybrid IGF-IIR cDNAs, each containing the P3 or P4 sequence in place of the native R2410-K2423 region (the hybrid receptors are referred to as P3/IGF-IIR or P4/IGF-IIR, respectively). These constructs were transiently expressed in COS cells and examined for activation of the AC pathway by monitoring for stimulation of the membrane AC activity and increased production of cAMP in intact cells. We also investigated the intramolecular role of these domains by examining CTR mutants lacking either the P3 or P4 domains.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The primary sequence of the cloned porcine CTR-1a (pCTR) was analyzed for regions that satisfy the aforementioned criteria for G protein-interacting candidate domains (see Introduction). We identified two such domains, both located in the intracellular regions. The first sequence, KLKESQEAESHMYLKAVR (P3), is located in the predicted third intracellular loop (amino acids 327–344); the second sequence, KRQWNQYQAQRWAGR (P4), is located in the C-terminal tail of the receptor (amino acids 404–418) (Fig. 1AGo). These sequences are completely conserved in the corresponding sites in the third intracellular loop and the C-tail in CTR-1b.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Hybrid Receptor Construction

A, The amino acid sequence of the porcine CTR from position 297 to 424, and location of the putative G protein-coupling sequences in the third intracellular domain (residues 327–344) and in the C-tail of CTR (residues 404–418). B, Construction of the hybrid receptors. The IGF-IIR-XhoI has two XhoI sites, corresponding to Leu-Glu (LE), between codons for wild-type IGF-IIR residues 2409 and 2410, and residues 2423 and 2424 (the inserted LEs are therefore at positions 2410/2411 and 2426/2427). The hybrid P3/IGF-IIR or P4/IGF-IIR thus consists of the P3 or P4 sequence, respectively, LE before and after these sequences, and IGF-IIR lacking the native amino acids 2410–2423.

 
Hybrid P3/and P4/IGF-IIRs were constructed utilizing the XhoI sites, which had been inserted into the original human IGF-IIR cDNA as described previously (22 ). Sequencing of the region encoding the inserts between these sites verified that P3/and P4/IGF-IIRs have the correct P3 or P4 sequences between the native amino acids 2410 and 2423 of the IGF-IIR (Fig. 1BGo). Hybrid IGF-IIRs with reverse-oriented P3 or P4 sequences were obtained in other clones. No stop codon was present in these reverse sequences, thus allowing the expression of the entire hybrid receptors. The deduced sequences of these reverse-oriented constructs were as follows: revP3, SNSFKIHRFSFLRFFKF; revP4, STSPSLSLVLIPLSF. Each consisted of the same residue numbers as the original P3 or P4 region. The corresponding hybrid receptors, referred to as revP3/and revP4/IGF-IIR, were used as controls in the following experiments.

Mock-transfected COS cells—cells transfected with two different empty vectors (pECE or pcDNA1)—exhibited low basal membrane AC activity (Fig. 2Go, A and B). When cells were transfected with either P3/IGF-IIR or P4/IGF-IIR cDNA, membrane AC activity significantly increased. In contrast, transfection of either hybrid receptor with reverse-oriented regions, revP3/IGF-IIR or revP4/IGF-IIR, was without effect on AC activity (Fig. 2AGo). In these experiments, the hybrid receptors, P3/IGF-IIR, P4/IGF-IIR, revP3/IGF-IIR, and revP4/IGF-IIR, were expressed to similar levels, as assessed with anti-IGF-IIR antibody immunostaining or IGF-II binding (data not shown). In cells expressing P3/IGF-IIR or P4/IGF-IIR, low concentrations of IGF-II exerted a small additional effect on AC activity. The wild-type IGF-IIR had no positive effect on AC activity in the presence or absence of IGF-II (Fig. 2BGo).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. AC Activity of the Membranes from Cells Transfected with the Wild-Type pCTR or with P3/IGF-IIR or P4/IGF-IIR

A, Various amounts of either P3/IGF-IIR or P4/IGF-IIR hybrid receptor cDNAs were transfected into 106 COS cells, and the cell membranes were prepared for the measurement of the AC activity, as described in Materials and Methods. As controls, activity of the membranes prepared from cells transfected with 5 µg of the empty vector used for hybrid receptor constructions (pECE), with 5 µg of the wild-type pCTR cDNA in the absence (-) or presence (+) of 100 nM sCT, or with the non-sense revP3/IGF-IIR (10 µg) or revP4/IGF-IIR (2.5 µg) cDNA. The 100% activity is the activity stimulated by 100 µM isoproterenol in parental COS cells, 49.6 ± 3.9 pmol/min/mg protein. B, Effect of IGF-II on AC activity in P3/IGF-IIR- or P4/IGF-IIR-expressing membranes. Membrane AC activity of COS cells transfected with 10 µg of P3/IGF-IIR, 2.5 µg of P4/IGF-IIR, or wild-type IGF-IIR cDNA was measured in the absence (-) or presence (+) of 3 nM of IGF-II (10 nM IGF-II was used in case of IGF-IIR transfection). As controls, we used activity of the membranes prepared from cells transfected with 5 µg of the pECE vector, with 5 µg of the pcDNA1 vector (the plasmid encoding wild-type pCTR cDNA), or with 5 µg of the wild-type pCTR cDNA in the absence (-) or presence (+) of 100 nM sCT. The 100% activity is the activity stimulated by 100 µM isoproterenol in parental COS cells, 42.3 ± 6.9 pmol/min/mg protein. Values in all figures in this study represent the mean ± SE of triplicate samples from at least two independent transfections.

 
The AC activity in membranes expressing either P3/IGF-IIR or P4/IGF-IIR was comparable to or even higher than that measured in membranes expressing the wild-type pCTR treated with 100 nM, a saturating concentration of salmon CT (sCT) (Fig. 2Go, A and B). As shown in Fig. 2AGo, as higher amounts of P3/IGF-IIR cDNA were transfected, more increase was observed in AC activity. In contrast, the profile of the relation between the DNA amount and the AC response was different for P4/IGFIIR. Stimulation of AC activity was observed for lower cDNA amounts. Activity peaked for 2.5 µg P4/IGF-IIR cDNA and then decreased for higher amounts of this hybrid receptor. However, the maximal AC activities attained by these two hybrid receptors were comparable.

We also measured the reporter activity of the cAMP response element (CRE) in the cell homogenates after transfection of either hybrid receptor cDNA with the CRE-driven chloramphenicol acetyltransferase (CAT) plasmid. CRE is typified by the consensus palindromic sequence TGACGTCA, which is present in the promoters of many genes. Our CRE-CAT reporter has multiple CRE sequences located in the promoter of the somatostatin gene, which is highly and selectively responsive to cAMP stimulation. Transient expression requires a prolonged period of time and the gene transiently transfected is expressed randomly during this period. This would make it technically difficult to quantitate the cAMP-stimulating function of constitutive receptors by measuring cAMP concentrations, which could rapidly fluctuate in the cells after the receptor cDNA transfection. In contrast, with the CRE-CAT reporter method, the accumulation of cAMP activity stimulated by the expression of transfected activators could be more properly assessed.

Cells expressing P3/IGF-IIR or of P4/IGF-IIR exhibited significant increases in CAT activity (Fig. 3Go, A and B). These increases were dependent on the amount of transfected plasmids. Concerning each hybrid receptor, the profile of the relation between the DNA amount and the CRE-CAT response was proportional to that observed in the cell-free AC assay, suggesting that the hybrid-induced CRE activation is tightly linked with the hybrid receptor-induced AC activation. IGF-II treatment again exerted small additional effects on the transcriptional activity of CRE in either transfection of P3/IGF-IIR or P4/IGF-IIR (Fig. 3CGo). In contrast, the CRE activities in cells transfected with empty vectors or with either of the two control hybrid receptors having reverse-oriented sequences (revP3/IGF-IIR and revP4/IGF-IIR) were low (Fig. 3CGo). Likewise, the wild-type IGF-IIR had no significantly positive effect on CRE activity with or without IGF-II (Fig. 3CGo).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. CAT Activity in Cells Transfected with Hybrid Receptor cDNAs and the CRE-CAT Reporter Plasmid

A and B, COS cells were cotransfected with various amounts of hybrid IGF-IIR cDNAs and 2.5 µg of the CRE-CAT plasmid. After 48 h, cell homogenates were prepared and CAT activity was assayed. As controls, COS cells were transfected with pECE (5 µg), or wild-type pCTR cDNA (5 µg) in the presence (+) or absence (-) of 100 nM sCT. The maximal activity elicited by (Bu)2cAMP in mock-transfected cells was 400 ± 20 cpm/h (means ± SE, n = 3). C, COS cells were transfected with 10 µg of P3/IGF-IIR, 2.5 µg of P4/IGF-IIR, or wild-type IGF-IIR cDNA in the presence of 2.5 µg of the CRE-CAT plasmid. During the last 12 h, cells were incubated with 3 nM IGF-II (+) or vehicle (-) (10 nM IGF-II was used in case of IGF-IIR transfection). After 48 h, cell homogenates were prepared and CAT activity was assayed. As controls, COS cells were transfected with 5 µg of pECE, 5 µg of pcDNA1, 5 µg of wild-type pCTR cDNA in the presence (+) or absence (-) of 100 nM sCT, or with the hybrid receptors bearing reverse-oriented sequences: revP3/IGF-IIR (10 µg cDNA) or revP4/IGF-IIR (2.5 µg cDNA). The values indicate CAT activity relative to that of pECE-transfected cells. The maximal activity elicited by (Bu)2cAMP in mock-transfected cells was approximately 12-fold of the control activity.

 
As a positive control in this assay, we measured the CRE activity in cells transfected with wild-type pCTR cDNA with or without CT treatment. Cells were transfected and after 28 h were treated with saturating concentrations of sCT for 20 h of culture. The cells treated with 100 nM sCT showed a few hundreds % of increase in CRE activity compared with untreated cells (Fig. 3Go, A, B, and C). Therefore, both P3/IGF-IIR and P4/IGF-IIR stimulated the transcriptional activity of CRE to levels comparable to or even higher than the maximal CT-induced stimulation of the wild-type pCTR. These findings indicate that AC stimulation by both P3- and P4-containing hybrid receptors does trigger in vivo activation of intracellular responses leading to nuclear gene expression.

Although the observed CRE stimulation most likely resulted from in situ stimulation of AC by the expressed hybrid receptors within a single cell, it was also possible that the hybrid receptor expression resulted in an extracellular secretion of factors that could trigger the CRE activation cascade in the neighboring cells. If so, the CRE-CAT assay might not reflect direct stimulation of AC activity by the hybrid receptors. To clarify this issue, we initially transfected COS cells with each DNA (hybrid receptors and CRE-CAT), respectively, later mixed them, and measured whether CRE-CAT activity was elevated. As shown in Fig. 4Go, the mixture of the separately transfected cells resulted in no significant increase in CRE-CAT activity, as compared with the elevated CRE-CAT activity in cotransfected cells. This observation provides evidence that stimulation of CRE-CAT should be a direct result from the activation of intracellular cAMP pathways triggered by hybrid receptors. In support, the coincidence of immunoreactivities was observed when the cells cotransfected with hybrid receptor and CRE-CAT plasmids were doubly stained with anti-IGF-IIR antibody and anti-CAT antibody (data not shown). Therefore, both P3- and P4-containing hybrid receptors activated the AC and consequent CRE cascade in situ within a single cell.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Comparison of the Effect of the Mixed Transfection of a Hybrid Receptor and CRE-CAT Plasmid with That of Independent Transfection/Subsequent Mixture

In the right two columns, 0.9 µg of P3/IGF-IIR or P4/IGF-IIR was cotransfected with 0.9 µg of CRE-CAT into COS cells (3 x 105). Twenty-four hours after transfection, those cells were replated into one dish at 4 x 104. CAT activity was measured 36 h after replating. In the left three columns, 0.9 µg of P3/IGF-IIR or P4/IGF-IIR was transfected into COS cells (3 x105) in one dish and 0.9 µg of CRE-CAT into COS cells (3 x105) in the other dish. Twenty-four hours after transfection, those cells (2 x 104 each) were mixed into one dish, and CAT activity was measured 36 h after mixture. The values indicate the CAT activity relative to that of cells transfected separately with 0.9 µg of pECE and 0.9 µg of CRE-CAT. In this setting, 0.9 µg of a plasmid was equivalent to 3 µg in other experiments in this study. The values represent the mean ± SE of eight independent experiments.

 
Finally, we applied a conventional deletion approach to the P3 and P4 domains. We constructed mutant pCTRs lacking either the P3 or P4 region from the wild-type pCTR ({Delta}P3-CTR or {Delta}P4-CTR; Fig. 5AGo). To construct the {Delta}P3-CTR, we first prepared pCTR possessing XhoI sites immediately before and after the P3 region (CTR-XhoI). As the XhoI site represents Leu-Glu (LE) in amino acids, the CTR-XhoI contains two LEs flanking the P3 region. {Delta}P3-CTR, which was constructed by digesting CTR-XhoI with XhoI, has LE instead of the P3 region. In contrast, {Delta}P4-CTR has no additional LE in the third intracellular loop or the C-terminal tail, as it was constructed from the authentic CTR cDNA. We also constructed a revP3-addback {Delta}P3-CTR mutant (rP3-{Delta}P3-CTR), a pCTR mutant which, instead of the P3 region, retains the reverse (at a nucleotide level) oriented sequence revP3 flanked by two LEs in the third cytoplasmic loop. In this regard, CTR-XhoI is identical to the P3-addback {Delta}P3-CTR. We initially found that the expression level of CTR-XhoI decreased severalfold relative to that of authentic CTR (Fig. 5CGo, lower inset), although both the CT affinity and the molecular capacity to produce a cAMP response were similar between authentic CTR and CTR-XhoI (see below). We thus used CTR-XhoI as a positive control in the following experiments (only for {Delta}P4-CTR, authentic CTR provided a control). It should also be noted that as we used the pCTR containing a hemagglutinin (HA) tag between residues 66 and 67, CTR-XhoI, {Delta}P3-CTR, rP3-{Delta}P3-CTR, and {Delta}P4-CTR were all tagged with an HA epitope.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. Examination Of COS Cells Transfected with Mutant CTR cDNAs

A, Illustrations of the mutant CTRs. B, cAMP production in cells transfected with mutant CTR cDNAs. COS cells were transfected with mutant CTR cDNAs at 48 h before cAMP assay. To test for hormone-induced cAMP responses, cells in triplicate wells were incubated with either test buffer alone or with increasing concentrations of sCT. Similar experiments were performed three times, each of which resulted in similar results. Inset, dose-response curves of the sCT effect in COS cells transfected with authentic pCTR cDNA (open circles) or CTR-XhoI cDNA (closed circles). COS cells were transfected with CTR cDNAs at 48 h before cAMP assay, in which cells in triplicate wells were incubated with either test buffer alone or with increasing concentrations of sCT. The cAMP response was indicated as a fold of the basal cAMP content, which was similar to that shown in panel B. C, CT binding to cells transfected with mutant CTR cDNAs. Cells were transfected with mutant CTR cDNAs at 48 h before the binding assay. The binding of radioactive CT to transfected cells in duplicate wells was measured in the presence of increasing concentrations of nonradioactive sCT. The values represent the mean of the specific binding (total binding - nonspecific binding; nonspecific binding is the binding in the presence of 100 nM nonradioactive CT). Each value indicates the mean of results obtained from two independent dishes. The data indicate a representative result of four independent experiments. Lower inset, CT binding to cells transfected with authentic pCTR cDNA (open circles) is shown with the CT binding to CTR-XhoI-transfected cells (closed circles) shown in panel C. Experiments were performed similarly to those in panel C. Upper inset, Immunoblot analysis of transfected CTR mutants (1: pcDNA1, 2: CTR-XhoI, 3: rP3-{Delta}P3-CTR, 4: {Delta}P4-CTR, 5: {Delta}P3-CTR). Forty-eight hours after transfection of mutant CTR cDNAs, cell lysates (30 µg protein/lane) were submitted to immunoblot analysis with anti-HA antibody (1.6 µg/ml; Roche Molecular Biochemicals). Similar experiments were performed four times, resulting in similar data.

 
sCT treatment of cells transfected with CTR-XhoI resulted in a dose-dependent increase in cAMP production (Fig. 5BGo). In clear contrast, sCT treatment of transfected cells elicited little cAMP response, when cells were transfected with {Delta}P3-CTR or rP3-{Delta}P3-CTR. Cells transfected with {Delta}P4-CTR exhibited a significant CT-induced cAMP response. We then examined the surface binding of radiolabeled sCT to transfected cells. As shown in Fig. 5CGo, CTR-XhoI and {Delta}P4-CTR were similarly expressed on the surface of the transfected cells with similar affinity for CT. In contrast, there was minimal CT binding to cells transfected with either {Delta}P3-CTR or rP3-{Delta}P3-CTR. Immunoblot analysis using anti-HA antibody revealed that CTR-XhoI, rP3-{Delta}P3-CTR, and {Delta}P4-CTR were comparably expressed in transfected cells, whereas {Delta}P3-CTR was poorly expressed (Fig. 5CGo, upper inset).

As rP3-{Delta}P3-CTR, in which the same length peptide was replaced for the P3 region, was significantly expressed, the poor expression of {Delta}P3-CTR was probably due to rapid degradation based upon an improper folding induced by the replacement of the P3 region, which occupies a major portion in the third intracellular loop, with the amino acids LE. As anti-HA antibody nonspecifically recognized an approximately 80-kDa protein as strongly as the transfected CTR proteins in the immunoblotting (data not shown), we were unable to further clarify, by means of the immunostaining analysis, whether rP3-{Delta}P3-CTR was expressed on the cell surface. While it remained unclear whether the poor CT binding to the rP3-{Delta}P3-CTR-transfected cells was due to a loss of the affinity for CT and/or due to inefficient trafficking from the cytoplasm to the surface, it became difficult, with the conventional deletion approach, to further address the in vivo function of the P3 region in CTR, because CT failed to bind to the cells transfected with the P3-deleted mutants, one with a simple deletion and the other with a replacement of the same length polypeptide. In this regard, the hybrid receptor approach, which detects a positive function of a receptor domain without any necessity for a receptor ligand (CT in this case), points to a role for the P3 region in the signal transduction mechanism of CTR.

In contrast to the P3 region study, the function of the P4 region could be examined by our mutagenesis approach. The data suggest that the P4 region was dispensable for AC activation per se. However, comparison of the maximal CT-induced cAMP responses standardized by Bmax between authentic CTR and {Delta}P4-CTR indicated a decrease in the molecular capacity to produce cAMP response by the deletion of P4 domain from CTR. The Bmax data indicated that transfection of authentic CTR, CTR-XhoI, and {Delta}P4-CTR cDNAs resulted in expression of the cognate receptors at 260 fmol/well, 51 fmol/well, and 62 fmol/well, respectively, corresponding to 3.9 x 106, 7.7 x 105, 9.3 x 105 (number per cell). Cells transfected with authentic CTR, CTR-XhoI, and {Delta}P4-CTR cDNAs and incubated with sCT increased cAMP content to a mean maximum of 21, 17, and 9.5 (pmol/receptor x 10-10), respectively. Not only the expression level of transfected authentic CTR (number per cell) but also the calculated value of the transfected CTR capacity to produce maximal cAMP response (pmol/receptor) was comparable to those previously reported (27 ). These data indicate that the maximal capacity of CTR to produce cAMP in response to CT was impaired by the deletion of P4 domain. It is thus highly likely that P4 domain regulates the CTR function in transducing the CT signal to its effector by modulating the maximal response of Gs activation by this receptor.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have herein shown novel domain-specific Gs-activating functions in the third intracellular loop and the C-tail of CTR, using the cassette IGF-IIR method. The IGF-IIR containing two independent CTR sequences, but neither wild-type IGF-IIR nor the IGF-IIR containing irrelevant sequences of the same length, augmented both membrane AC activity and nuclear CRE transcriptional activity. In addition, CRE activity was stimulated only when the hybrid IGF-IIR cDNAs were cotransfected with the reporter plasmid, indicating that CRE stimulation was the direct result of the activation of intracellular cAMP pathways triggered by hybrid receptors. In support of this notion, the AC stimulation and the CRE response caused by each hybrid receptor were highly proportional. These results indicate that hybrid IGF-IIRs containing either the P3 or P4 domain of CTR stimulated the AC–CRE cascade in the hybrid receptor-expressing cells. Multiple controls ensured that the inserted CTR sequences conferred cAMP-stimulating ability on the hybrid receptors. The conventional mutagenesis study supported a significant role of the P4 domain in the maximal capacity of CTR to activate Gs. However, in this case, the mutagenesis study did not allow for further investigation of the P3 function in CTR, suggesting that it would have been difficult to specify the P3 function in vivo without using the hybrid receptor approach.

The data measuring membrane AC activity in cells transfected with CTR or hybrid IGF-IIRs were quantitatively consistent among experiments, when standardized by maximal response to isoproterenol: the basal activity was 30–40%, and the activities stimulated by 5 µg CTR cDNA and 100 nM sCT, by 10 µg P3/IGF-IIR cDNA, and by 2.5 µg P4/IGF-IIR cDNA were similarly 70–80% of the maximal AC activity stimulated by isoproterenol. In contrast, the data measuring CRE activity were more variable among experiments. For the CRE assay, we were unable to employ isoproterenol as an interexperimental standard, since an increase in CRE-CAT by high concentrations of isoproterenol was marginal in this system, as reported previously (22 ), although this observation suggested that ß-adrenergic receptors were rapidly down-regulated after isoproterenol stimulation. While (Bu)2cAMP yielded the standard maximal response of CRE-CAT stimulation in this assay, normalization among CRE-CAT experiments was not simple, even with (Bu)2cAMP as a standard, particularly for CTR. This was so because 1) basal CRE-CAT production fluctuates within a range of approximately 1/12 to 1/4 of the maximal production by (Bu)2cAMP; and 2) the quantity as well as the timing of down-regulation of CTR occurring after CT stimulation should vary, depending on each transfected cell, whereas (Bu)2cAMP stimulation may not be down-regulated as it is with receptors. The variability in the CRE response to CTR was thus, at least in part, attributable to the receptor down-regulation. Furthermore, CRE activation by CTR might be conditionally influenced by cell cycle, whereas the cell cycle condition of transfected cells could not be reproduced precisely. It has been reported that Gi is activated by CTR in a cell-cycle dependent manner (2 ). Such a cell cycle-dependent action of CTR could be responsible for interexperimental variability in the CRE response to CTR.

In contrast, CRE activity stimulated by hybrid receptors was consistently 60–70% of the maximal response by (Bu)2cAMP; the maximal CRE responses to both hybrid receptors were comparable. This suggests that hybrid receptors were more resistant in receptor down-regulation than CTR and that the variability in the CRE response by hybrid receptors was thus mainly due to the fluctuation of the basal CRE-CAT production. In support of this idea, Wada et al. (28 ) reported a cAMP-dependent protein kinase A (PKA)-mediated down-regulation of CTR as a major mechanism underlying homologous desensitization; in contrast, the hybrid IGF-IIRs would not be affected by CTR-mediated down-regulation, as IGF-IIR is highly resistant to both homologous and heterologous down-regulation (29 ), and no potential PKA phosphorylation site is included in either the P3 or P4 domain. The observed discrepancy between the hybrid receptors and liganded CTR could thus be attributable, at least in part, to the difference in the receptor sensitivity to CTR- or CTR sequence-mediated down-regulation.

As compared with P3/IGF-IIR, the P4 hybrid receptor caused both cAMP and CRE responses by transfection with lower DNA concentrations. As both receptors were expressed similarly at each DNA concentration, this finding suggests that the P4 sequence may be more effective in activating the cAMP system. However, it remained unclear why impaired actions of P4/IGF-IIR plasmid were observed at higher DNA doses. A simple interpretation was that AC activation by P4/IGF-IIR was attenuated by a negative feedback mechanism acting on P4/IGF-IIR: the mechanism was only triggered by highly expressed P4/IGF-IIR. Such a feedback mechanism should be other than through PKA- or PKC-mediated regulation, because the P4 sequence contains no potential phosphorylation sites for these protein kinases. Alternatively, the feedback mechanism could act on Gs. For instance, it has been reported that phosphorylation of the Tyr residue at the C terminus of the G protein {alpha} subunits (G{alpha}s and G{alpha}q/11) alters the efficiency of receptor-G protein interactions (30 31 ), and that CT stimulation of CTR activates Shc tyrosine phosphorylation and downstream pathways (32 ). It is thus conceivable that Gs may change its response to P4/IGF-IIR through phosphorylation, potentially resulting in altered actions of highly expressed P4/IGF-IIR to act on AC. Obviously, more detailed investigation is necessary to address this issue.

The magnitude of the maximal stimulation by the P3 and P4 hybrid receptors was comparable to or even higher than that observed with maximally liganded CTR, suggesting that those two short domains in the CTR can quantitatively mimic the action of the entire receptor. Activation of the intracellular cAMP system appears to be the major signaling pathway involved in regulation of the physiological effects of CT in target cells (1 4 5 7 8 9 10 11 ). Therefore, it is likely that the dissected AC-activating domains in CTR are of physiological significance, and it is tempting to examine whether the active hybrid receptors bearing the CTR domains can mimic the biological functions of CTR in primary cultured target cells or in transgenic mice.

Although the P3 and P4 regions were selected based upon the structural characteristics of the regions shared by various GPCRs as well as those of a small number of the regions that have been shown to activate G proteins in vitro, the universality may not necessarily be given to this procedure. It has become evident that a complex inner surface defined by multiple intracellular loops and the C-tail is necessary for receptors to interact with G proteins, which has limited the usefulness of sequence-based approaches toward defining the function of GPCRs. However, this notion does not deny the domain-specific functions in GPCRs or the sequence-based approach to determine the functions of G protein-linked molecules other than GPCRs. In addition, a method that can dissect the in vivo function of a given region is useful. The present study provides such a method, which is applicable to unlimited numbers of regions in G protein-linked molecules.

For the purpose of examining the G protein-linked function of receptor domains in vivo, the IGF-IIR vector provides several advantages. A plasmid encoding a protein interactive with G proteins would be appropriate as an expression vector for a sequence of interest in testing its G protein-stimulating activity, as such a vector protein is accessible to G proteins when expressed in intact cells. Also, a receptor domain natively involved in the coupling to G proteins would be appropriate as a site for the substitution of the test sequences. Accumulated evidence indicates that most GPCRs contain multiple nonoverlapping G-protein-interacting domains in various cytoplasmic loops or in the C-tail (8 33 34 ). Therefore, it is quite difficult to assign a specific G protein-linked function to specific receptor domains by conventional mutational or deletional approaches (35 ). Also, this redundancy makes it hard to specify a G protein-coupling function for a short sequence derived from other receptors by expressing these sequences in a recombinant GPCR. In contrast, IGF-IIR contains only one site for interaction with G-proteins (6 ), allowing for a simple interpretation of the data obtained from hybrid IGF-IIRs expressing putative G protein-interacting domains of other receptors. Furthermore, IGF-IIR is highly resistant to down-regulation (29 ), as also suggested by the experiments with the hybrid receptors. When receptor down-regulation occurs after cellular expression of the receptor cDNA used for expressing test sequences, it becomes difficult to examine the sequence function. Even if receptor down-regulation does not occur completely, when it occurs randomly after expression of the constitutive receptors, the data examining the signal of the expressed receptors should accompany large quantitative variability. For these reasons, the present system would be suitable for the examination of the domain-specific function to activate Gs in vivo.

There are advantages and disadvantages in both the conventional mutagenesis approaches and the developed hybrid receptor approach. For instance, there is an obvious limitation in assessing the physiological role of a selected domain in the entire function of the relevant receptor, using the cassette IGF-IIR method. We must also emphasize that the successfulness of the hybrid receptor approach may still be very dependent on the sequence of GPCRs chosen and that the usefulness of this method may therefore be limited to a narrow spectrum of GPCRs. However, once it works, this method will be able to dissect a domain-specific signaling function, whereas the mutagenesis approach cannot usually exclude interference from other domains in the same receptor. Furthermore, as observed in this study, when domain-mutagenized receptors lose proper surface expression or ligand binding, the mutagenesis approach does not allow for further investigation of the domain-specific signal transduction. Even in such a case, the hybrid receptor approach is able to investigate it in vivo. Mutagenesis study primarily assumes a region-specific function by deleting or substituting the region of interest to observe negative changes or disappearance of cellular outputs, whereas the hybrid receptor approach provides an in vivo method to detect domain-specific function positively. Combining these supplementary methods, researchers will be able to deepen the understanding of the signal transduction mechanism for transmembrane receptors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Construction
The IGF-IIR-XhoI cDNA was described previously (22 ). This cDNA has two unique XhoI sites, corresponding to LE in amino acids, before and after the R2410-K2423 region of the human IGF-IIR. These additional residues do not alter the capacity of IGF-IIR to couple to Gi, as described (22 ). Oligonucleotides corresponding to the P3 domain (TCGAGAA-ACTTAAAGAATCTCAAGAAGCTGAATCTCATATGTATCTT-AAAGCTGTTAGAC and CGAGTCTAACAGCTTTAAGATA-CATATGAGATTCAGCTTCTTGAGATTCTTTAAGTTTC) or to the P4 domain (TCGAGAAAAGACAATGGAATCAGTACCAA-GCTCAAAGATGGGCTGGTAGAC and CGAGTCTACCGCCCATCTTTGAGCTTGGTACTGATTCCATTGTCTTTTC) were hybridized and ligated between the XhoI sites. Double-stranded plasmids were sequenced to confirm the correct orientation of the P3 and P4 inserts in the IGF-IIR-XhoI cDNA sequence. The porcine CTR cDNA (the 1a version) (1 ) was inserted into pcDNA1 with the HA tag PYDVPDYA between residues 66 and 67, as described previously (36 ). A PCR strategy was designed to delete the P3 sequence at nucleotide position 1234–1287 (the nucleotide numbering is by GenBank M74420), while inserting a XhoI site at nucleotide position 1234, using the following couples of primers CCAACTACACTATGTGCAATGC and AGTGGCCTCGAGCTTCACGAGCACGCGGAGG for the 5'-side, CCCTGGAAGTGGATCAGAGAGTGCACCACGT and TCGTGAAGCTCGAGGCCACTCTGATCTTGGTGCC for the 3'-side. Underlined nucleotides indicate the sequence for the XhoI restriction site to be added exactly at the site of the deletion. Two separate PCRs were performed using each set of primers and the HA-tagged pCTR cDNA in pcDNA1 as template, with 25 cycles (1 min at 95 C/2 min at 55 C/3 min at 72 C). Subsequently, a second-round PCR was performed, using a three-step procedure. In the first step, 20 µmol of each PCR product from the first reactions were mixed together with deoxynucleoside triphosphates and MgCl2, and heated at 80 C for 10 min under a layer of wax. Then, 0.5 µl of Taq polymerase was added on top of the wax and one cycle was performed (1 min at 94 C/2 min at 50 C/3 min at 72 C). Finally, a preheated mix of both outside primers was added and the final PCR was run for 20 cycles (1 min at 94 C/2 min at 50 C/3 min at 72 C). The final PCR product, encoding a cDNA fragment exhibiting the deletion of the P3 sequence and the insertion of the XhoI site, was digested with appropriate restriction enzymes and ligated to the HA-tagged pCTR cDNA digested with the same combination of restriction enzymes. Positive clones were selected and sequenced to confirm the deletion of the P3 domain and the presence of the XhoI site. The same PCR strategy was used to delete the P4 sequence at nucleotide position 1465–1509, except that no XhoI site was inserted at the site of the deletion. The 5'-side primers were CCAACTACACTATGTGCAATGC and GGTGGAGCGCAGGGCTCCCTGAAC-CTCG, and the 3'-side primers were CAACACCCTCCACCTCC and GGAGCCCTGC-GCTCCACCCGGGCCGC. All plasmid DNAs were prepared by maxipreps of overnight Escherichia coli cultures, using the alkaline lysis procedure, followed by two cycles of CsCl equilibrium density gradient centrifugation, and repeated isopropanol and phenol/chloroform extractions. Purified plasmid cDNAs were stored at -80 C until use for cell transfection.

Cell Transfection
Plasmids were transiently expressed in COS cells by transfection using LipofectAMINE (2 µl/µg DNA, Life Technologies, Inc., Gaithersburg, MD), as described previously (24 ). COS cells were plated at 106 cells in a 100-mm dish 24 h before transfection and cultured in DMEM supplemented with 10% calf serum. After transfection, cells were cultured for 24 h in a humidified atmosphere of 5% CO2-95% air at 37 C. After removing transfection media, prewarmed DMEM plus 10% calf serum was added to the cultures. Cells were cultured for another 24 h.

AC Assay
The AC assay was performed, as described previously (22 ). Membranes were prepared from cells 48 h after transfection. Cells were incubated for 30 min at room temperature with PBS containing 5 mM mannose 6-phosphate, washed three times with PBS, scraped, suspended in ice-cold PBS, and centrifuged at 1500 rpm for 5 min. The pellet was suspended in ice-cold buffer A [20 mM HEPES/NaOH (pH 7.4), 1 mM EDTA, 1 mM dithiothreitol, 20 µM leupeptin, and 20 µg/ml aprotinin], homogenized, and centrifuged at 1,500 rpm for 5 min. The pellet was again suspended in buffer A, homogenized, and centrifuged. The first and second supernatants were mixed and centrifuged at 15,000 rpm for 60 min at 4 C. The final pellet suspended in buffer A was subjected to AC assay. AC activity of prepared membranes (60 µg of membrane protein) was measured for 20 min at 30 C in 100 µl of 20 mM HEPES/NaOH (pH 8.0) buffer containing 0.37 µM [{alpha}-32P]-ATP (NEN Life Science Products ; specific activity, 30 Ci/mmol), 1 mM ATP, 1 mM cAMP, 10 µM GTP, 1 mM EDTA, 2 mM MgCl2, 5 mM phosphoenol pyruvate, 25 µg/ml pyruvate kinase, 0.1 mM isobutyl methylxanthine, 0.1 mg/ml BSA. Recombinant IGF-II (Roche Molecular Biochemicals), sCT (Peninsula Laboratories, Inc., San Carlos, CA), or a respective vehicle was added to the appropriate reaction solutions, just before mixing them with the aliquots of membrane preparations. Resultant radioactive cAMP was measured by two-step column chromatography according to the method of Salomon. The maximal AC activity was measured in untransfected COS cell membranes stimulated by 100 µM isoproterenol.

CRE-CAT Assay
The CAT plasmid fused with triple CRE of the somatostatin gene (22 ) [provided by Dr. S. Ishii (Institute of Physical and Chemical Research, Saitama, Japan)] was cotransfected with plasmids encoding hybrid receptors. Unless otherwise specified, 106 cells were used for these assays. Transfected cells were treated with IGF-II or vehicle for the last 20 h of day 2 after transfection; cells transfected with wild-type pCTR were treated with 100 nM sCT or vehicle for the last 20 h of the transfection, similarly. Forty-eight hours after transfection, cells were washed twice with ice-cold PBS and scraped in 40 mM Tris/HCl (pH 8.0), 150 mM NaCl, and 1 mM EDTA. After centrifugation at 8,000 rpm for 2 min at 4 C, the pellet was suspended in 250 mM Tris/HCl (pH 8.0), and samples were homogenized by three cycles of freezing and thawing using liquid nitrogen and 37 C water. After heating at 65 C for 15 min, samples were centrifuged at 15,000 rpm for 10 min at 4 C. CAT activity of the pellets (50 µg of protein) was measured in 262.5 µl 100 mM Tris/HCl (pH 8.0), 1.25 mM chloramphenicol, 1 µCi [14C]butyryl-CoA (finally 0.1 mM, NEN Life Science Products ; specific activity, 4.0 mCi/mmol), gently overlaid with 5 ml Econofluor-2 (NEN Life Science Products). Capped vials were incubated at room temperature for a few hours and the radioactivity was counted in a liquid scintillator. The cAMP assay was performed in COS cells transfected with the mutant CTR cDNAs, as previously described (37 ).

CT Binding Assay
The binding of CT to cells transfected with mutant CTR cDNAs was measured according to the method described previously (1 ), with modification. In brief, 48 h after transfection, cells were incubated with 43.0–52.0 pM [125I]sCT in 40 mM HEPES buffer containing 0.1% BSA in the presence of various concentrations of nonradioactive sCT for 16 h at 4 C. After being washed, cells were lyzed by 0.2 N NaOH, and the radioactivity of the sample was measured by a {gamma}-counter.


    ACKNOWLEDGMENTS
 
We thank M. Byrne, A. Gorn, M. Flannery, T. Yamatsuji, and T. B. Kinane for expert advice and helpful discussion; J. T. Potts Jr. and Y. and Y Tamai for essential support; K. Takahashi, T. Okamoto, and K. Tsuchiya for indispensable cooperation and technical assistance; S. Ishii for CRE-CAT plasmid; and K. Nishihara, J. Hatomi, L. Duda, and D. Wylie for expert assistance. We are also especially indebted to T. Hiraki, T. Yoshida, and M. C. Fishman for indispensable support of this study; and anonymous reviewers for constructive criticism.


    FOOTNOTES
 
Address requests for reprints to: Ikuo Nishimoto, Department of Pharmacology, KEIO University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160, Japan.

This work was supported in part by grants from the Naito Foundation, the Brain Science Foundation, the Mitsubishi Foundation, the Takeda Science Foundation, the Pathological Metabolism Foundation, the Mochida Memorial Foundation for Medical and Pharmaceutical Research, the Suzuken Memorial Foundation, Japan Brain Foundation, the Ministry of Health and Welfare of Japan, the Ministry of Education, Science, and Culture of Japan, and the Organization for Pharmaceutical Safety and Research (I. N.) and a Massachusetts General Hospital Research Fellow grant (P. O.). P. O. was also supported by grants from the French Ministry of Foreign Affairs (Bourse Lavoisier), the Société Française de Rhumatologie, and the European League Against Rheumatism. This work was also supported by NIH Grant RO1-DK-46772 and PD1AR-03564 to S.R.G. and S.M.C.

1 The first two authors equally contributed to this study. Back

Received for publication March 25, 1998. Revision received August 11, 1999. Accepted for publication September 15, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Lin HY, Harris TL, Flannery MR, Aruffo A, Kaji EH, Gorn A, Kolakowski Jr LF, Lodish HF, Goldring SR 1991 Expression cloning of an adenylate cyclase-coupled calcitonin receptor. Science 254:1022–1024[Abstract/Free Full Text]
  2. Chakraborty M, Chatterjee D, Kellokumpu S, Rasmussen H, Baron R 1991 Cell cycle-dependent coupling of the calcitonin receptor to different G proteins. Science 251:1078–1082[Abstract/Free Full Text]
  3. Force T, Bonventre JV, Flannery MR, Gorn AH, Yamin M, Goldring SR 1992 A cloned porcine renal calcitonin receptor couples to adenylyl cyclase and phospholipase C. Am J Physiol 262:F1110–F1115
  4. Chabre O, Conklin BR, Lin HY, Lodish HF, Wilson E, Ives HE, Catanzariti L, Hemmings BA, Bourne HR 1992 A recombinant calcitonin receptor independently stimulates 3',5'-cyclic adenosine monophosphate and Ca2+/inositol phosphate signaling pathways. Mol Endocrinol 6:551–556[Abstract/Free Full Text]
  5. Nicholson GC, Moseley JM, Sexton PM, Mendelsohn FAO, Martin TJ 1986 Abundant calcitonin receptors in isolated rat osteoclasts: biochemical and autoradiographic characterization. J Clin Invest 78:355–360
  6. Okamoto T, Katada T, Murayama Y, Ui M, Ogata E, Nishimoto I 1990 A simple structure encodes G protein-activating function of the IGF-II/mannose 6-phosphate receptor. Cell 62:709–717[CrossRef][Medline]
  7. Okamoto T, Ohkuni Y, Ogata E, Nishimoto I 1991 Distinct mode of G protein activation due to single residue substitution of active IGF-II receptor peptide Arg2410-Lys2423: evidence for stimulation acceptor region other than C-terminus of Gi{alpha}. Biochem Biophys Res Commun 179:10–16[CrossRef][Medline]
  8. Ikezu T, Okamoto T, Ogata E, Nishimoto I 1992 Amino acids 356–372 constitute a Gi-activator sequence of the {alpha}2-adrenergic receptor and have a Phe substitute in the G protein-activator sequence motif. FEBS Lett 311:29–32[CrossRef][Medline]
  9. Okamoto T, Murayama Y, Hayashi Y, Inagaki M, Ogata E, Nishimoto I 1991 Identification of a Gs activator region of the ß2-adrenergic receptor that is autoregulated via protein kinase A-dependent phosphorylation. Cell 67:723- 730[CrossRef][Medline]
  10. Okamoto T, Nishimoto I 1992 Detection of G protein-activator regions in M4 subtype muscarinic cholinergic and {alpha}2-adrenergic receptors based upon characteristics in primary structure. J Biol Chem 267:8342–8346[Abstract/Free Full Text]
  11. Liggett SB, Caron MG, Lefkowitz RJ, Hnatowich M 1991 Coupling of a mutated form of the human ß2-adrenergic receptor to Gi and Gs. Requirement for multiple cytoplasmic domains in the coupling process. J Biol Chem 266:4816–4821[Abstract/Free Full Text]
  12. Dittman AH, Weber JP, Hinds TJ, Choi EJ, Migeon JC, Nathanson NM, Storm DR 1994 A novel mechanism for coupling of m4 muscarinic acetylcholine receptors to calmodulin-sensitive adenylyl cyclases: crossover from G protein-coupled inhibition to stimulation. Biochemistry 33:943–951[CrossRef][Medline]
  13. Eason MG, Liggett SB 1995 Identification of a Gs coupling domain in the amino terminus of the third intracellular loop of the {alpha}2A-adrenergic receptor. Evidence for distinct structural determinants that confer Gs versus Gi coupling. J Biol Chem 270:24753–24760[Abstract/Free Full Text]
  14. Sun H, Seyer JM, Patel TB 1995 A region in the cytoplasmic domain of the epidermal growth factor receptor antithetically regulates the stimulatory and inhibitory guanine nucleotide-binding regulatory proteins of adenylyl cyclase. Proc Natl Acad Sci USA 92:2229–2233[Abstract/Free Full Text]
  15. Wu D, Jiang H, Simon MI 1995 Different {alpha}1-adrenergic receptor sequences required for activating different G{alpha} subunits of Gq class of G proteins. J Biol Chem 270:9828–9832[Abstract/Free Full Text]
  16. Gong, X, Dubois DH, Miller J, Shur BD 1995 Activation of a G protein complex by aggregation of ß-1,4-galactosyltransferase on the surface of sperm. Science 269:1718–1721[Abstract/Free Full Text]
  17. Sun H, Chen Z, Poppleton H, Scholich K, Mullenix J, Weipz GJ, Fulgham DL, Bertics PJ, Patel TB 1997 The juxtamembrane, cytosolic region of the epidermal growth factor receptor is involved in association with {alpha}-subunit of Gs. J Biol Chem 272:5413–5420[Abstract/Free Full Text]
  18. Strittmatter SM, Igarashi M, Fishman MC 1994 GAP-43 amino terminal peptides modulate growth cone morphology and neurite outgrowth. J Neurosci 14:5503–5513[Abstract]
  19. Li S, Chun M, Okamoto T, Sargiacomo M, Casanova JE, Nishimoto I, Lisanti MP 1995 Evidence for a regulated interaction between heterotrimeric G proteins and caveolin. J Biol Chem 270:15693–15701[Abstract/Free Full Text]
  20. Zolnierowicz S, Cron P, Solinas-Toldo S, Fries R, Lin HY, Hemmings BA 1994 Isolation, characterization, and chromosomal localization of the porcine calcitonin receptor gene. Identification of two variants of the receptor generated by alternative splicing. J Biol Chem 269:19530–19538[Abstract/Free Full Text]
  21. Murayama Y, Okamoto T, Ogata E, Asano T, Iiri T, Katada T, Ui M, Grubb JH, Sly WS, Nishimoto I 1990 Distinctive regulation of the functional linkage between the human cation-independent mannose 6-phosphate receptor and GTP-binding proteins by IGF-II and mannose 6-phosphate. J Biol Chem 265:17456–17462[Abstract/Free Full Text]
  22. Takahashi K, Murayama Y, Okamoto T, Yokota T, Ikezu T, Takahashi S, Giambarella U, Ogata E, Nishimoto I 1993 Conversion of G-protein specificity of IGF-II/mannose 6-phosphate receptor by exchanging of a short region with ß-adrenergic receptor. Proc Natl Acad Sci USA 90:11772–11776[Abstract/Free Full Text]
  23. Pfeifer A, Nürnberg B, Kamm S, Uhde M, Schultz G, Ruth P, Hofmann F 1995 Cyclic GMP-dependent protein kinase blocks pertussis toxin-sensitive hormone receptor signaling pathways in Chinese Hamster ovary cells. J Biol Chem 270:9052–9059[Abstract/Free Full Text]
  24. Ikezu, T, Okamoto T, Giambarella U, Yokota T, Nishimoto I 1995 In vivo coupling of IGF-II/M6P receptor to heteromeric G proteins: distinct roles of cytoplasmic domains and signal sequestration by the receptor. J Biol Chem 270:29224–29228[Abstract/Free Full Text]
  25. Körner C, Nürnberg B, Uhde M, Braulke T 1995 Mannose 6-phosphate/insulin-like growth factor II receptor fails to interact with G-proteins: analysis of mutant cytoplasmic receptor domain. J Biol Chem 270:287–295[Abstract/Free Full Text]
  26. Okamoto T, Takeda S, Murayama Y, Ogata E, Nishimoto I 1995 Ligand-dependent G protein coupling function of amyloid transmembrane precursor. J Biol Chem 270:4205–4208[Abstract/Free Full Text]
  27. Gorn A, Rudolph SM, Flannery MR, Morton CC, Weremowicz S, Wang J-T, Krane SM, Goldring SR 1995 Expression of two human skeletal calcitonin receptor isoforms cloned from a giant cell tumor of bone: the first intracellular domain modulates ligand binding and signal transduction. J Clin Invest 95:2680–2691
  28. Wada S, Udagawa N, Nagata N, Martin TJ, Findlay DM 1996 Physiological levels of calcitonin regulate the mouse osteoclast calcitonin receptor by a protein kinase A-mediated mechanism. Endocrinology 137:312- 320[Abstract]
  29. Hu K-Q, Backer JM, Sahagian G, Feener EP, King GL 1990 Modulation of the insulin growth factor II/mannose 6-phosphate receptor in microvascular endothelial cells by phorbol ester via protein kinase C. J Biol Chem 265:13864–13870[Abstract/Free Full Text]
  30. Poppleton H, Sun H, Fulgham D, Bertics P, Patel TB 1996 Activation of Gs{alpha} by the epidermal growth factor receptor involves phosphorylation. J Biol Chem 271:6947–51[Abstract/Free Full Text]
  31. Umemori H, Inoue T, Kume S, Sekiyama N, Nagao M, Itoh H, Nakanishi S, Mikoshiba K, Yamamoto T 1997 Activation of the G protein Gq/11 through tyrosine phosphorylation of the {alpha} subunit. Science 276:1878–81[Abstract/Free Full Text]
  32. Chen Y, Shyu JF, Santhanagopal A, Inoue D, David JP, Dixon SJ, Horne WC, Baron R 1998 The calcitonin receptor stimulates Shc tyrosine phosphorylation and Erk1/2 activation. Involvement of Gi, protein kinase C, and calcium. J Biol Chem 273:19809–19816[Abstract/Free Full Text]
  33. Strader CD, Fong TM, Tota MR, Underwood D, Dixon RA 1994 Structure and function of G protein-coupled receptors. Annu Rev Biochem 63:101–32[CrossRef][Medline]
  34. Wess J 1998 Molecular basis of receptor/G-protein-coupling selectivity. Pharmacol Ther 80:231–64[CrossRef][Medline]
  35. Findlay DM, Houssami S, Lin HY, Myers DE, Brady CL, Darcy PK, Ikeda K, Martin TJ, Sexton PM 1994 Truncation of the porcine calcitonin receptor cytoplasmic tail inhibits internalization and signal transduction but increases receptor affinity. Mol Endocrinol 8:1691–1700[Abstract/Free Full Text]
  36. Bergwitz C, Gardella TJ, Flannery MR, Potts JT Jr., Kronenberg HM, Goldring SR, Juppner H 1996 Full activation of chimeric receptors by hybrid between parathyroid hormone and calcitonin. Evidence for a common pattern of ligand-receptor interaction. J Biol Chem 271:26469–26472[Abstract/Free Full Text]
  37. Gorn AH, Lin HY, Yamin M, Auron PE, Flannery MR, Tapp DR, Manning CA, Lodish HF, Krane SM, Goldring SR 1992 Cloning, characterization, and expression of a human calcitonin receptor from an ovarian carcinoma cell line. J Clin Invest 90:1726–1735



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
E. Kostenis, L. Martini, J. Ellis, M. Waldhoer, A. Heydorn, M. M. Rosenkilde, P. K. Norregaard, R. Jorgensen, J. L. Whistler, and G. Milligan
A Highly Conserved Glycine within Linker I and the Extreme C Terminus of G Protein {alpha} Subunits Interact Cooperatively in Switching G Protein-Coupled Receptor-to-Effector Specificity
J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 78 - 87.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orcel, P.
Right arrow Articles by Nishimoto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orcel, P.
Right arrow Articles by Nishimoto, I.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals