| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Molecular Endocrinology (S.A.J., L.B.M., J.L.S.,
G.B.W., D.D.M., S.A.K., J.T.M.), Medicinal Chemistry (N.C.O.T, T.M.W.),
and Structural Chemistry (M.H.L) Glaxo Wellcome Inc.
Research and Development Research Triangle Park, North Carolina
27709
Department of Drug Delivery and Disposition (G.A.H.,
E.L.L.) School of Pharmacy University of North Carolina at
Chapel Hill Chapel Hill, North Carolina 27599
| ABSTRACT |
|---|
|
|
|---|
-carbonitrile is a more potent activator of the rat and
mouse PXR than the human and rabbit receptor. The activities of
xenobiotics in PXR activation assays correlate well with their ability
to induce CYP3A expression in primary hepatocytes. Through the use of a
novel scintillation proximity binding assay, we demonstrate that many
of the compounds that induce CYP3A expression bind directly to human
PXR. These data establish PXR as a promiscuous xenobiotic receptor that
has diverged during evolution. | INTRODUCTION |
|---|
|
|
|---|
Expression of CYP3A genes is induced by a variety of compounds, including many drugs (1 2 ). The induction of CYP3A transcription represents the basis for a number of common drug-drug interactions. Many xenobiotics have been profiled for their effects on CYP3A expression in primary hepatocytes from rabbits or rats (3 4 5 ). These studies have revealed marked species differences and called into question the validity of using animal models or nonhuman hepatocytes for predicting the effects of xenobiotics on CYP3A transcription in humans. Transfection studies in which reporter genes driven by CYP3A promoter sequences were introduced into rabbit or rat hepatocytes showed these differences were a consequence of host cell factors rather than differences in cis-acting sequences in the CYP3A gene promoters (5 ). However, the molecular basis for these species differences had remained in question.
We and others recently cloned novel mouse and human orphan members of the nuclear hormone receptor superfamily and showed that they are activated by a variety of known inducers of CYP3A expression (6 7 8 9 10 ). We have named these orphan nuclear receptors pregnane X receptors (PXRs) based upon their efficacious activation by natural C21 steroids (pregnanes). Mouse and human PXR are predominantly expressed in liver and intestine and bind to xenobiotic response elements previously identified in the human and rat CYP3A promoters (6 7 8 9 ). Based upon these data, PXR has been suggested to serve as a key regulator of CYP3A expression. The human and mouse PXR share only 76% amino acid identity in their ligand-binding domains (LBDs) and display markedly different activation profiles in response to xenobiotics. Thus, it has remained an open question whether these receptors are bona fide orthologs or members of a broader subfamily of closely related orphan nuclear receptors.
We now report the cloning and characterization of PXR from rabbit and rat, two species that are frequently used for studies of drug metabolism and CYP3A regulation. Although PXR has diverged significantly during the course of evolution, our results provide evidence that it has an important role in CYP3A regulation in multiple species. In addition, we also report the development of a scintillation proximity binding assay for human PXR and show for the first time that structurally diverse compounds bind directly to this orphan nuclear receptor.
| RESULTS |
|---|
|
|
|---|
|
|
-carbonitrile (PCN) induced
CYP3A expression in rat hepatocytes but not rabbit hepatocytes. We
tested this same panel of compounds for activation of the rabbit and
rat PXR. PXR expression plasmids were cotransfected into CV-1 cells
together with a reporter plasmid containing two copies of the CYP3A1
direct repeat 3 (DR-3) PXR response element upstream of the minimal
thymidine kinase promoter and chloramphenicol acetyltransferase (CAT)
gene. The cells were then treated with 10 µM
concentrations of each compound except for phenobarbital, which was
tested at 1 mM. Both the rabbit and rat PXR
responded to xenobiotics. Rifampicin and dexamethasone were the most
efficacious activators of rabbit PXR, inducing reporter levels more
than 15-fold over the basal level (Fig. 3A
|
Among the established inducers of CYP3A expression that we tested for
PXR activation was troglitazone.
Troglitazone is a member of the thiazolidinedione class of
insulin-sensitizing drugs that lower glucose, lipid, and insulin levels
in patients with type 2 diabetes. Thiazolidinediones mediate their
therapeutic effects by binding and activating the nuclear receptor
PPAR
(14 ). Troglitazone is known to increase CYP3A4
activity and to enhance the metabolism of other drugs in patients (15 ).
Consistent with this, we found that troglitazone activated
both the human and rabbit PXR (Fig. 3A
). Full dose-response analysis
showed that troglitazone activated human PXR with an
EC50 value of approximately 3 µM,
which is comparable to the concentration required to activate PPAR
(data not shown). Thus, the interaction of troglitazone
with other drugs is likely to result from its activation of PXR.
Interestingly, troglitazone had little effect on the rat
and mouse PXR.
Rexinoids Activate PXR
Like many of the other orphan nuclear receptors, PXR binds to its
hormone response elements as a heterodimer with retinoid X receptor
(RXR) (6 7 8 9 ). These heterodimers have been classified as either
permissive or nonpermissive depending on whether they are
activated by RXR ligands (rexinoids) (16 ). To test whether the PXR/RXR
heterodimer is permissive for activation by rexinoids, we performed
cotransfection assays with PXR from the four species in CV-1 cells in
the presence of the natural RXR ligand 9-cis-retinoic acid
and the synthetic, RXR-selective compounds LGD1069
and LG100268 (17 18 ). The RXR ligands did not activate the
PXR/RXR heterodimer at the nanomolar concentrations that are typically
required to activate the RXR homodimer or the permissive RXR
heterodimers. However, micromolar concentrations of the rexinoids did
weakly activate the heterodimers formed between either the human or
rabbit PXR and RXR (Fig. 4
). Transfection
experiments performed with saturating concentrations of a PXR ligand
showed that LG100268 did not further activate the human PXR/RXR
heterodimer (data not shown). Notably, the rexinoids had no effect on
the rat or mouse PXR heterodimers with RXR (data not shown), suggesting
that these compounds might not mediate their effects through RXR but
rather via the rabbit and human PXR. Consistent with this idea, we have
shown that RXR ligands bind directly to human PXR at micromolar
concentrations (see below). Thus, our data indicate that the
heterodimers formed between either the human or rabbit PXR and RXR can
be activated by micromolar concentrations of rexinoids that cross-react
with PXR.
|
|
Structurally Diverse Xenobiotics Are PXR Ligands
The structural diversity of the compounds that activate PXR is
unprecedented for a nuclear receptor. Do these xenobiotics, which range
in mol wt from 232 (phenobarbital) to 823 (rifampicin), mediate their
effects through direct interactions with PXR? We set out to address
this issue by establishing a competition binding assay employing
[3H]SR12813 as a radioligand. Initial attempts
to express the LBD of human PXR in Escherichia coli were
unsuccessful due to its lack of solubility. However, coexpression of an
88-amino acid region of the steroid coactivator protein 1 (SRC-1) with
the human PXR LBD resulted in soluble protein that was purified to
homogeneity and biotinylated for use in ligand-binding assays. A
scintillation proximity-binding assay was developed using
streptavidin-coated polyvinyltoluene beads and the biotinylated human
PXR. [3H]SR12813 interacted specifically with
human PXR with a dissociation constant (Kd) of 40
nM (Fig. 6A
). This
value is in good agreement with the EC50 value
for SR12813 for activation of human PXR in the transfection assay (Fig. 5A
). These data demonstrate that [3H]SR12813
binds directly to human PXR.
|
Natural Steroids Are PXR Ligands
Human and mouse PXR are activated by a variety of naturally
occurring steroids, among which C21 steroids (pregnanes) are the most
potent (6 7 8 9 ). We tested various pregnanes and other steroids for their
activities on the human, rabbit, rat, and mouse PXR in the transfection
assay. Each PXR displayed a distinct activation profile (Fig. 7A
). However, in each case, the most
efficacious activator was a pregnane. 5ß-Pregnane-3,20-dione was the
most efficacious natural activator of the human, rat, and mouse PXR
(Fig. 7A
). Although 5ß-pregnane-3,20-dione also activated the rabbit
PXR, the closely related compound 17-OH progesterone was the most
efficacious activator of the rabbit receptor. Weaker activation of PXR
was also seen with other steroids, including corticosterone,
dihydrotestosterone, and estradiol (Fig. 7A
), as previously described
(8 9 ).
|
| DISCUSSION |
|---|
|
|
|---|
Since rifampicin is an efficacious inducer of CYP3A expression in human and rabbit but not in rat, it was recently postulated that the rabbit PXR might be more closely related to its human ortholog than the rat PXR (9 ). In fact, the human, rabbit, and mouse/rat PXR are all roughly equally divergent, sharing only approximately 80% amino acid identity in their LBDs. Although both the rabbit and human PXR are activated by rifampicin, there are marked differences in their responsiveness to synthetic steroids such as dexamethasone and CPA. These differences in PXR activation profiles are likely to be reflected at the level of CYP3A expression in vivo. Thus, caution must be exercised in extrapolating CYP3A induction data for a particular compound from rabbit to man. Despite their divergence, several lines of evidence suggest that that PXRs are orthologs and not closely related members of a subfamily of nuclear receptors. First, each PXR is most abundantly expressed in the liver and tissues of the gastrointestinal tract. Second, our pharmacological data strongly suggest that each PXR regulates CYP3A expression in its respective species. Finally, our searches of the expressed sequence tag (EST) databases have not revealed any other PXR-like sequences (J. T. Moore, unpublished results). The divergence in PXR could represent either an adaptive response to different environmental xenobiotic challenges or differences in natural PXR ligands between species. Although pregnanes are the most efficacious natural activators of PXR from each of the species, we have observed cross-species differences in PXR activation by natural steroids. However, the concentrations of these steroids required to activate PXR are superphysiological, and the natural ligand for PXR remains to be determined.
The known ligands for nuclear receptors are all small molecules with
similar volumes and molecular weights (23 ). Larger molecules, such as
growth factors, can also activate nuclear receptors through binding to
cell surface receptors and activation of their second
messenger-signaling cascades (24 ). The observation that rifampicin, a
macrolide antibiotic with a mol wt of 823, activated human PXR and
promoted its interaction with the coactivator SRC-1 in an in
vitro coprecipitation assay was surprising (7 8 9 ). Could PXR bind
to a ligand as large as rifampicin? The development of a radioligand
competition binding assay for this orphan receptor has allowed us to
address this question. Using [3H]SR12813 in a
scintillation proximity assay, we have demonstrated that many of the
xenobiotics, including rifampicin, that induce CYP3A4 expression bind
directly to PXR. The interaction of rifampicin with PXR suggests that
its ligand-binding pocket must be very large in comparison with other
nuclear receptors. The only other nuclear receptors that are known to
have such large ligand-binding pockets are the PPARs (11 12 13 ). x-Ray
crystallography has established that the large cavities in the PPARs
are due, in part, to the presence of an
-helix termed H2' that is
not present in other nuclear receptors. Sequence alignment suggests
that PXR has an even larger insert in the H2' region than the PPARs
(Fig. 1A
). Thus, it is possible that the promiscuity of PXR is due to
the presence of a ligand-binding pocket that is larger than those of
other nuclear receptors.
SR12813 lowers plasma cholesterol levels in a number of species
including primates (19 20 ). Although SR12813 has been reported to
reduce cholesterol biosynthesis, by increasing the degradation of
hydroxy-methylglutarate-coenzyme A reductase (20 ), the
molecular target for its actions remains unknown. Despite its potency
in activating human and rabbit PXR, we believe it unlikely that SR12813
mediates its hypocholesterolemic effects exclusively through PXR. PCN
is a potent activator of the mouse and rat PXR and has effects on bile
composition in rats (25 ). However, in agreement with previous studies
(25 ), we have found that treatment of wild-type rats with PCN does not
decrease serum cholesterol levels (J. L. Shenk and D. Winegar,
unpublished data). Under these same conditions, SR12813, which is only
a very weak activator of rat PXR, effectively lowers cholesterol
levels. Moreover, rifampicin, which is widely used to treat
tuberculosis at doses that induce CYP3A4 expression, has not been
associated with reductions in cholesterol levels. These results suggest
that PXR activation alone is unlikely to account for the
hypocholesterolemic actions of SR12813. It was recently shown that
micromolar concentrations of SR12813 activate the related nuclear
receptor farnesoid X receptor (FXR) (26 ). FXR is a bile acid
receptor that regulates genes such as cholesterol 7
-hydroxylase that
are involved in cholesterol homeostasis (27 28 29 ). Thus, SR12813 may
exert its hypocholesterolemic effects through FXR or other cellular
receptors.
The thiazolidinedione antidiabetic drugs were developed using rodent
models of insulin resistance, without knowledge of their cellular
target. It is now known that these insulin sensitizers mediate their
effects through activation of the PPAR
/RXR heterodimer (30 31 ).
Troglitazone is the first of these drugs to be marketed
for the treatment of type 2 diabetes. Although the drug is devoid of
serious side effects in rodents, in humans it has been shown to
increase CYP3A4 activity (15 ) and is also associated with an
idiosyncratic hepatotoxicity (32 ). Our data showing that
troglitazone activates human PXR at concentrations similar
to those required to activate PPAR
provides an explanation for its
interactions with other drugs, including oral contraceptives.
Interestingly, the relative lack of activity of
troglitazone on the mouse or rat PXR may explain why these
effects were not reported in animal toxicology studies. Additional
studies will be required to determine whether PXR also plays a role in
the hepatotoxicity observed with troglitazone. In this
regard, it is interesting that the PXR ligand rifampicin has also been
associated with hepatotoxicity in humans (33 34 ). Our data suggest
that certain rexinoids, which have been proposed as diabetes drugs
(35 ), may show side effects similar to troglitazone
through activation of PXR. The availability of PXR screening assays
should allow for the development of new drugs for type 2 diabetes with
increased selectivity for their cellular target, the PPAR
/RXR
heterodimer.
In summary, we have demonstrated that PXR is a promiscuous nuclear xenobiotic receptor with an LBD that has diverged considerably during the course of evolution. This divergence in the PXR LBD accounts in large part for the differential effects of various compounds on CYP3A expression across species. Comparative functional studies using rabbit and rat PXR will increase our ability to evaluate metabolism data from relevant nonhuman pharmacological model systems. Moreover, the availability of PXR in a high throughput binding format provides a valuable tool for the rapid identification of compounds that will induce CYP3A expression and interact with other drugs. Through the early elimination of these compounds from the drug discovery process, these assays will aid in the development of safer medicines.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of Rabbit and Rat PXR
The full-length coding region of rabbit PXR was derived from a
gt11 phage rabbit liver cDNA library (CLONTECH Laboratories, Inc. Palo Alto, CA). An internal 861-bp rabbit PXR fragment was
first obtained by PCR using oligonucleotides derived from the mouse PXR
LBD sequence (6 ). The forward oligonucleotide sequence was
5'-AAGTGCCTGGAGAGTGGCATG, and the reverse primer was 5'-
TCGCAGCTCAGTGAGGACGGC. The remainder of the rabbit PXR 5'- and
3'-coding sequence was obtained by nested PCR using oligonucleotides
within the 861-bp internal rabbit PXR sequence and oligonucleotides
within
gt11, which flank the EcoRI cloning site. The
oligonucleotides used for the nesting were: Nest 1: 5'
CTGAGCCTCCATCCGTTCTCTC and 5' AGGTGTGGTGCAGCGTGAAG; Nest 2: 5'
ACGGCCACATCGGACATGATC and 5'GATCATGGCCGTCCTCACTGAG. After obtaining the
full-length rabbit PXR sequence by this method, the entire coding
region was amplified and cloned again from rabbit liver cDNA to confirm
the original sequence. The primers used in this step contained flanking
EcoRI restriction sites for subcloning the PCR product into
the mammalian expression vector pSG5 as well as a consensus Kozak
sequence preceding the ATG to optimize mammalian expression. The
forward primer sequence used was 5'-
TCCACCGAATTCACCACCATGGGTGGAAAGCCCACCATCAGTGCAGAT and the reverse primer
was 5'- TCCACCGAATTCTCAGTCATCTGTGGTGCTGAACAGCTCCCG. The sequences
obtained in both cloning steps agreed over the entire coding region.
The sequence of rabbit PXR has been deposited in GenBank (accession
number AF188476).
The coding region of rat PXR was obtained by PCR amplification using rat liver cDNA (CLONTECH Laboratories, Inc.) and oligonucleotides derived from the 5'- and 3'-flanking regions of the mouse PXR. The forward primer sequence was 5'-TGATTCTTCAAGGTGGACCCC, and the reverse primer was 5'-GCAATTCAGAATGTCTGGGTCTAGC. Clones derived from three independent PCR reactions were sequenced. We note that while this work was in progress, the rat PXR clone was reported by another group (36 ).
Sequence Alignment
The program MVP (37 ) was used to align the PXR sequences
with the human PPAR
sequence. Most of the secondary structure was
identified from the x-ray structure of the PPAR
LBD (11 ). The region
between helix-1 and helix-3 failed to give a clear alignment, so the
PRISM secondary structure prediction procedure, as implemented in MVP,
was used to predict helix-2, helix-2', and ß-strands a and b.
Northern Analysis
Primary human, rabbit, and rat hepatocytes were treated for
24 h with the respective compounds, and total RNA was isolated
using Trizol reagent (Life Technologies, Inc.). Rabbit RNA
was isolated from normal rabbit tissues using Trizol reagent. Total RNA
from each sample (10 µg) was resolved on a 2.2 M
formaldehyde denaturing gel. The gels were stained with ethidium
bromide to examine for equal loading. The RNA was subsequently
transferred onto Nytran nylon membrane from Schleicher & Schuell, Inc. (Keene, NH). Rat blots were purchased from OriGene
(Rockville, MD). Blots were hybridized with 32P-labeled
CYP3A1, CYP3A4, CYP3A6, rat PXR, or rabbit PXR cDNA probes.
Cotransfection Assays
CV-1 cells were plated in 96-well plates at a density of 20,000
cells per well in high glucose DMEM supplemented with 10%
charcoal/dextran-treated FBS (HyClone Laboratories, Inc.
Logan, UT). Transfection mixes contained 5 ng of receptor expression
vector, 12 ng of reporter plasmid, 25 ng of ß-galactosidase
expression vector pCH110 (Amersham Pharmacia Biotech,
Piscataway, NJ) as internal control, and 38 ng of carrier plasmid.
Human and mouse PXR expression plasmids and the (CYP3A1
DR3)2-tk-CAT reporter were previously described
(6 7 ). Transfections were performed with Lipofectamine (Life Technologies, Inc.) essentially according to the manufacturers
instructions. Drug dilutions were prepared in phenol red-free DMEM/F-12
with 15 mM HEPES supplemented with 10% charcoal-stripped,
delipidated calf serum (Sigma). Cells were incubated for
24 h in the presence of drugs, and then cell extracts were
prepared and assayed for CAT and ß-galactosidase activities as
previously described (30 ).
Primary Hepatocytes
Hepatocytes were isolated from human liver tissue obtained as
surgical biopsy samples or from rejected donor livers by the two-step
collagenase digestion method (38 ) with minor modifications as
previously described (39 ). In most cases, encapsulated liver tissue
(25100 g) was perfused with calcium-free buffer containing 5.5
mM glucose, 5% BSA, ascorbic acid (50 mg/ml), and 0.5
mM EGTA for 1015 min at a flow rate of 2535 ml/min
followed by perfusion with DMEM containing 1.5 mM calcium,
5% BSA, ascorbic acid (50 mg/ml), and collagenase (0.30.4 mg/ml) for
1520 min. Hepatocytes were dispersed from the digested liver in DMEM
containing 5% FBS, insulin (4 µg/ml), and dexamethasone (1
µM) and washed by low-speed centrifugation (70 x
g, 4 min). Cell pellets were resuspended in supplemented
DMEM and 90% isotonic Percoll (3:1 vol:vol) and centrifuged at
100 x g for 5 min. The resulting pellets were washed
with fresh medium by low-speed centrifugation and resuspended in
supplemented DMEM. Viability was determined by trypan blue exclusion
and was typically between 80 and 90%. Human, rabbit, and rat
hepatocytes were cultured according to the method of LeCluyse et
al. (39 ). Briefly, approximately 4.5 x
106 hepatocytes were added to 60-mm NUNC Permanox
culture dishes coated with a rigid collagen substratum in 3 ml of
supplemented DMEM and allowed to attach for 24 h at 37 C in a
humidified chamber with 95%/5%, air/CO2.
Culture dishes were gently swirled and medium containing unattached
cells was then aspirated. Fresh ice-cold serum-free modified Chees
medium containing 0.1 µM dexamethasone,
6.25 µg/ml insulin, 6.25 µg/ml transferrin, and 6.25 ng/ml selenium
(ITS+) and 0.25 mg/ml Matrigel were added to each dish and cultures
were returned to the humidified chamber (40 ). Medium was changed on a
daily basis thereafter. Unless otherwise specified, primary cultures of
human, rabbit, and rat hepatocytes were maintained for 3648 h before
treatment with test compounds was initiated.
Synthesis of [3H]SR1281
[3H]SR12813 with a specific activity of
23 Ci/mmol was prepared by Amersham International plc
(Cardiff, UK) from
[3H]3,5-ditertbutyl-4-hydroxy benzaldehyde by
modification of the published procedure (41 ).
Expression of Recombinant Human PXR LBD
The LBD of human PXR (amino acids 130434) was expressed as an
amino-terminal polyhistidine-tagged fusion protein. The PXR LBD was
subcloned into the pRSETa bacterial expression vector
(Invitrogen, San Diego, CA). Sequence encoding a
polyhistidine tag derived from an N-terminal PCR primer (MKKGHHHHHHG)
was fused in frame to the PXR LBD. To enhance its solubility, the PXR
LBD was coexpressed with an 88-amino acid fragment of SRC-1 (42 43 ).
The human SRC-1 expression construct was created by insertion of a
fragment of SRC-1 encoding amino acids 623710 (43 ) flanked by
NdeI-BamHI restriction sites into the pACYC184
vector (New England Biolabs, Inc., Beverly, MA) containing
the T7 promoter region of the pRSETA vector (Invitrogen).
PCR primers were designed to amplify an 88-amino acid region of the
human SRC-1 gene (p160), which encodes two of the LXXLL motifs (motifs
1 and 2) along with an N-terminal tag (MKK). The resulting
SRC-1/pACYC184 plasmid was cotransformed with PXRLBD/pRSETa into the
BL21(DE3) E. coli strain. One-liter shake flask liquid
cultures containing standard Luria-Bertani (LB) broth with 0.05 mg/ml
ampicillin and 0.05 mg/ml chloramphenicol were inoculated and grown at
22 C for 24 h. The cells were induced with 0.05
mM isopropyl
ß-D-thiogalactopyranoside for 46 h at 22 C after
which the cells were harvested by centrifugation (20 min, 3,500 x
g, 4 C). The cell pellet was stored at -80 C. The cell
pellet was resuspended in 250 ml buffer A (50 mM
Tris-Cl pH 8.0, 250 mM NaCl, 50
mM Imidazole, pH 7.5). Cells were sonicated for
35 min on ice and the cell debris was removed by centrifugation (45
min, 20,000 x g, 4 C). The cleared supernatant was
filtered through a 0.45 µM filter and loaded on
to a 50 ml Ni++-charged ProBond Chelation
resin (Invitrogen). After washing to baseline with buffer
A, the column was washed with buffer A containing 125
mM Imidazole, pH 7.5. The PXRLBD/SRC-1 complex
was eluted from the column using buffer A with 300
mM Imidazole, pH 7.5. Column fractions were
pooled and concentrated using Centri-prep 30K (Amicon, Beverly, MA)
units. The protein was subjected to size exclusion, using a column (26
mm x 90 cm) packed with Sepharose S-75 resin (Amersham Pharmacia Biotech, Piscataway, NJ) preequilibrated with 20
mM Tris-Cl, pH 8.0, 200 mM
NaCl, 5 mM dithiothreitol, 2.5
mM EDTA, pH 8.0. Column fractions were pooled and
concentrated.
Scintillation Proximity Binding Assay
A scintillation proximity binding assay (44 ) was developed using
purified human PXR/SRC-1. Streptavidin-PVT scintillation proximity
assay (SPA) beads (Amersham Pharmacia Biotech
RPNQ0007) were suspended in assay buffer (50 mM Tris, pH
8.0, 50 mM KCl, 1 mM EDTA, 1 mM
3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate,1
mM dithiothreitol, 0.1 mg BSA/ml) at 0.5 mg/ml.
Biotinylated human PXR was added to a final concentration of 75
nM. The receptor/bead mix was allowed to incubate for 30
min at room temperature. Uncoupled receptor was removed by centrifuging
the receptor/bead mixture at 3,000 rpm for 10 min and pouring off the
supernatant. The receptor-coupled beads were resuspended in assay
buffer. All experiments were run in Packard Optiplates (Packard
6005190, Packard Instruments, Meriden, CT) using 25 µg
bead/well and an assay volume of 100 µl. Twelve-point saturation
curves were generated in triplicate using 10 µM
clotrimazole to define nonspecific binding.
[3H]SR12813 was added such that the final
concentration of radioligand ranged from 0.5 to 1,000 nM.
The Kd value was determined by nonlinear
regression. In competition experiments, test compounds were diluted in
100% dimethylsulfoxide and added to the wells in 1 µl-aliquots.
[3H]SR12813 was added to a final concentration
of 10 nM. The plates were shaken momentarily to ensure
complete mixing. After a 2-h incubation at room temperature, the plates
were counted on a Packard TopCount, which was programmed to compensate
for color quenching.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Equal contributions were made by these authors. ![]()
Received for publication August 27, 1999. Revision received September 21, 1999. Accepted for publication September 28, 1999.
| REFERENCES |
|---|
|
|
|---|
. Nature 395:137143[CrossRef][Medline]
. J Biol Chem 273:3110831112
- bigger than fat. Curr Opin Gen Dev 8:576581[CrossRef][Medline]
-carbonitrile on biliary cholesterol
output in the rat by the manipulation of the rate of hepatic
cholesterol synthesis. Gastroenterology 87:284292[Medline]
(PPAR
). J Biol Chem 270:1295312956
agonism and the
antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665668[CrossRef][Medline]
This article has been cited by other articles:
![]() |
Y. S. Lin, K. Yasuda, M. Assem, C. Cline, J. Barber, C.-W. Li, V. Kholodovych, N. Ai, J. D. Chen, W. J. Welsh, et al. The Major Human Pregnane X Receptor (PXR) Splice Variant, PXR.2, Exhibits Significantly Diminished Ligand-Activated Transcriptional Regulation Drug Metab. Dispos., June 1, 2009; 37(6): 1295 - 1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. S. Ross-Viola, N. F. Shay, D. D. Moore, and M.-L. Ricketts Human CYP3A4 and Murine Cyp3A11 Are Regulated by Equol and Genistein via the Pregnane X Receptor in a Species-Specific Manner J. Nutr., May 1, 2009; 139(5): 898 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Duniec-Dmuchowski, H.-L. Fang, S. C. Strom, E. Ellis, M. Runge-Morris, and T. A. Kocarek Human Pregnane X Receptor Activation and CYP3A4/CYP2B6 Induction by 2,3-Oxidosqualene:Lanosterol Cyclase Inhibition Drug Metab. Dispos., April 1, 2009; 37(4): 900 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ott, G. Fricker, and B. Bauer Pregnane X Receptor (PXR) Regulates P-Glycoprotein at the Blood-Brain Barrier: Functional Similarities between Pig and Human PXR J. Pharmacol. Exp. Ther., April 1, 2009; 329(1): 141 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Toriyabe, K. Nagata, T. Takada, Y. Aratsu, T. Matsubara, K. Yoshinari, and Y. Yamazoe Unveiling a New Essential Cis Element for the Transactivation of the CYP3A4 Gene by Xenobiotics Mol. Pharmacol., March 1, 2009; 75(3): 677 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ma, C. Cheung, K. W. Krausz, Y. M. Shah, T. Wang, J. R. Idle, and F. J. Gonzalez A Double Transgenic Mouse Model Expressing Human Pregnane X Receptor and Cytochrome P450 3A4 Drug Metab. Dispos., December 1, 2008; 36(12): 2506 - 2512. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shou, M. Hayashi, Y. Pan, Y. Xu, K. Morrissey, L. Xu, and G. L. Skiles Modeling, Prediction, and in Vitro in Vivo Correlation of CYP3A4 Induction Drug Metab. Dispos., November 1, 2008; 36(11): 2355 - 2370. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cheung and F. J. Gonzalez Humanized Mouse Lines and Their Application for Prediction of Human Drug Metabolism and Toxicological Risk Assessment J. Pharmacol. Exp. Ther., November 1, 2008; 327(2): 288 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y. H. Yeung, T. Sueyoshi, M. Negishi, and T. K. H. Chang Identification of Ginkgo biloba as a Novel Activator of Pregnane X Receptor Drug Metab. Dispos., November 1, 2008; 36(11): 2270 - 2276. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pettersson, N. Hanna, M. Lagodich, D. Dupere-Richer, M.-C. Couture, C. Choi, and W. H. Miller Jr. Rexinoids Modulate Steroid and Xenobiotic Receptor Activity by Increasing Its Protein Turnover in a Calpain-dependent Manner J. Biol. Chem., August 8, 2008; 283(32): 21945 - 21952. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Miller, B. Bauer, and A. M. S. Hartz Modulation of P-Glycoprotein at the Blood-Brain Barrier: Opportunities to Improve Central Nervous System Pharmacotherapy Pharmacol. Rev., June 1, 2008; 60(2): 196 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, H. Li, L. B. Moore, M. D. L. Johnson, J. M. Maglich, B. Goodwin, O. R. R. Ittoop, B. Wisely, K. Creech, D. J. Parks, et al. The Phytoestrogen Coumestrol Is a Naturally Occurring Antagonist of the Human Pregnane X Receptor Mol. Endocrinol., April 1, 2008; 22(4): 838 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kohalmy, V. Tamasi, L. Kobori, E. Sarvary, J.-M. Pascussi, P. Porrogi, D. Rozman, R. A. Prough, U. A. Meyer, and K. Monostory Dehydroepiandrosterone Induces Human CYP2B6 through the Constitutive Androstane Receptor Drug Metab. Dispos., September 1, 2007; 35(9): 1495 - 1501. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lemaire, C. Benod, V. Nahoum, A. Pillon, A.-M. Boussioux, J.-F. Guichou, G. Subra, J.-M. Pascussi, W. Bourguet, A. Chavanieu, et al. Discovery of a Highly Active Ligand of Human Pregnane X Receptor: A Case Study from Pharmacophore Modeling and Virtual Screening to "In Vivo" Biological Activity Mol. Pharmacol., September 1, 2007; 72(3): 572 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cerveny, L. Svecova, E. Anzenbacherova, R. Vrzal, F. Staud, Z. Dvorak, J. Ulrichova, P. Anzenbacher, and P. Pavek Valproic Acid Induces CYP3A4 and MDR1 Gene Expression by Activation of Constitutive Androstane Receptor and Pregnane X Receptor Pathways Drug Metab. Dispos., July 1, 2007; 35(7): 1032 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Woods, J. P. Vanden Heuvel, and I. Rusyn Genomic Profiling in Nuclear Receptor-Mediated Toxicity Toxicol Pathol, June 1, 2007; 35(4): 474 - 494. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Pacyniak, X. Cheng, M. L. Cunningham, K. Crofton, C. D. Klaassen, and G. L. Guo The Flame Retardants, Polybrominated Diphenyl Ethers, Are Pregnane X Receptor Activators Toxicol. Sci., May 1, 2007; 97(1): 94 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xue, L. B. Moore, J. Orans, L. Peng, S. Bencharit, S. A. Kliewer, and M. R. Redinbo Crystal Structure of the Pregnane X Receptor-Estradiol Complex Provides Insights into Endobiotic Recognition Mol. Endocrinol., May 1, 2007; 21(5): 1028 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ma, Y. Shah, C. Cheung, G. L. Guo, L. Feigenbaum, K. W. Krausz, J. R. Idle, and F. J. Gonzalez The Pregnane X Receptor Gene-Humanized Mouse: A Model for Investigating Drug-Drug Interactions Mediated by Cytochromes P450 3A Drug Metab. Dispos., February 1, 2007; 35(2): 194 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Ung, H. Li, C. W. Yap, and Y. Z. Chen In Silico Prediction of Pregnane X Receptor Activators by Machine Learning Approache Mol. Pharmacol., January 1, 2007; 71(1): 158 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhou, E.-J. Poulton, F. Grun, T. K. Bammler, B. Blumberg, K. E. Thummel, and D. L. Eaton The Dietary Isothiocyanate Sulforaphane Is an Antagonist of the Human Steroid and Xenobiotic Nuclear Receptor Mol. Pharmacol., January 1, 2007; 71(1): 220 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Urs, E. Dammer, and M. B. Sewer Sphingosine Regulates the Transcription of CYP17 by Binding to Steroidogenic Factor-1 Endocrinology, November 1, 2006; 147(11): 5249 - 5258. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. He, M. H. Court, D. J. Greenblatt, and L. L. von Moltke Human Pregnane X Receptor: Genetic Polymorphisms, Alternative mRNA Splice Variants, and Cytochrome P450 3A Metabolic Activity. J. Clin. Pharmacol., November 1, 2006; 46(11): 1356 - 1369. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bauer, X. Yang, A. M. S. Hartz, E. R. Olson, R. Zhao, J. C. Kalvass, G. M. Pollack, and D. S. Miller In Vivo Activation of Human Pregnane X Receptor Tightens the Blood-Brain Barrier to Methadone through P-Glycoprotein Up-Regulation Mol. Pharmacol., October 1, 2006; 70(4): 1212 - 1219. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-L. Song and R. A. DeBose-Boyd Insig-dependent Ubiquitination and Degradation of 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase Stimulated by {delta}- and {gamma}-Tocotrienols J. Biol. Chem., September 1, 2006; 281(35): 25054 - 25061. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jung, D. J. Mangelsdorf, and U. A. Meyer Pregnane X Receptor Is a Target of Farnesoid X Receptor J. Biol. Chem., July 14, 2006; 281(28): 19081 - 19091. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wang, A. J. Mendy, G. Dai, H.-R. Luo, L. He, and Y.-J. Y. Wan Retinoids Activate the RXR/SXR-Mediated Pathway and Induce the Endogenous CYP3A4 Activity in Huh7 Human Hepatoma Cells Toxicol. Sci., July 1, 2006; 92(1): 51 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lemaire, W. Mnif, J.-M. Pascussi, A. Pillon, F. Rabenoelina, H. Fenet, E. Gomez, C. Casellas, J.-C. Nicolas, V. Cavailles, et al. Identification of New Human Pregnane X Receptor Ligands among Pesticides Using a Stable Reporter Cell System Toxicol. Sci., June 1, 2006; 91(2): 501 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Johnson, C.-W. Li, L.-Y. Chen, J. C. Ghosh, and J. D. Chen Regulation and Binding of Pregnane X Receptor by Nuclear Receptor Corepressor Silencing Mediator of Retinoid and Thyroid Hormone Receptors (SMRT) Mol. Pharmacol., January 1, 2006; 69(1): 99 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Orans, D. G. Teotico, and M. R. Redinbo The Nuclear Xenobiotic Receptor Pregnane X Receptor: Recent Insights and New Challenges Mol. Endocrinol., December 1, 2005; 19(12): 2891 - 2900. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Komoroski, R. A. Parise, M. J. Egorin, S. C. Strom, and R. Venkataramanan Effect of the St. John's Wort Constituent Hyperforin on Docetaxel Metabolism by Human Hepatocyte Cultures Clin. Cancer Res., October 1, 2005; 11(19): 6972 - 6979. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kobayashi, Y. Yamanaka, N. Iwazaki, I. Nakajo, M. Hosokawa, M. Negishi, and K. Chiba IDENTIFICATION OF HMG-CoA REDUCTASE INHIBITORS AS ACTIVATORS FOR HUMAN, MOUSE AND RAT CONSTITUTIVE ANDROSTANE RECEPTOR Drug Metab. Dispos., July 1, 2005; 33(7): 924 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Maher, X. Cheng, A. L. Slitt, M. Z. Dieter, and C. D. Klaassen INDUCTION OF THE MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN FAMILY OF TRANSPORTERS BY CHEMICAL ACTIVATORS OF RECEPTOR-MEDIATED PATHWAYS IN MOUSE LIVER Drug Metab. Dispos., July 1, 2005; 33(7): 956 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Krasowski, K. Yasuda, L. R. Hagey, and E. G. Schuetz Evolution of the Pregnane X Receptor: Adaptation to Cross-Species Differences in Biliary Bile Salts Mol. Endocrinol., July 1, 2005; 19(7): 1720 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Burk, K. A. Arnold, A. K. Nussler, E. Schaeffeler, E. Efimova, B. A. Avery, M. A. Avery, M. F. Fromm, and M. Eichelbaum Antimalarial Artemisinin Drugs Induce Cytochrome P450 and MDR1 Expression by Activation of Xenosensors Pregnane X Receptor and Constitutive Androstane Receptor Mol. Pharmacol., June 1, 2005; 67(6): 1954 - 1965. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tang, J. H. Lin, and A. Y. H. Lu METABOLISM-BASED DRUG-DRUG INTERACTIONS: WHAT DETERMINES INDIVIDUAL VARIABILITY IN CYTOCHROME P450 INDUCTION? Drug Metab. Dispos., May 1, 2005; 33(5): 603 - 613. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Chrencik, J. Orans, L. B. Moore, Y. Xue, L. Peng, J. L. Collins, G. B. Wisely, M. H. Lambert, S. A. Kliewer, and M. R. Redinbo Structural Disorder in the Complex of Human Pregnane X Receptor and the Macrolide Antibiotic Rifampicin Mol. Endocrinol., May 1, 2005; 19(5): 1125 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Boekschoten, M. K. Hofman, R. Buytenhek, E. G. Schouten, H. M. G. Princen, and M. B. Katan Coffee Oil Consumption Increases Plasma Levels of 7{alpha}-Hydroxy-4-cholesten-3-one in Humans J. Nutr., April 1, 2005; 135(4): 785 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bauer, A. M. S. Hartz, G. Fricker, and D. S. Miller Modulation of p-Glycoprotein Transport Function at the Blood-Brain Barrier Experimental Biology and Medicine, February 1, 2005; 230(2): 118 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hariparsad, S. C. Nallani, R. S. Sane, D. J. Buckley, A. R. Buckley, and P. B. Desai Induction of CYP3A4 by Efavirenz in Primary Human Hepatocytes: Comparison With Rifampin and Phenobarbital J. Clin. Pharmacol., November 1, 2004; 44(11): 1273 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yoshinari, T. Sato, N. Okino, J. Sugatani, and M. Miwa Expression and Induction of Cytochromes P450 in Rat White Adipose Tissue J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 147 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhou, M. M. Tabb, A. Sadatrafiei, F. Grun, and B. Blumberg TOCOTRIENOLS ACTIVATE THE STEROID AND XENOBIOTIC RECEPTOR, SXR, AND SELECTIVELY REGULATE EXPRESSION OF ITS TARGET GENES Drug Metab. Dispos., October 1, 2004; 32(10): 1075 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhu, S. Kim, T. Chen, J.-H. Lin, A. Bell, J. Bryson, Y. Dubaquie, N. Yan, J. Yanchunas, D. Xie, et al. Correlation of High-Throughput Pregnane X Receptor (PXR) Transactivation and Binding Assays J Biomol Screen, September 1, 2004; 9(6): 533 - 540. [Abstract] [PDF] |
||||
![]() |
B. Bauer, A. M. S. Hartz, G. Fricker, and D. S. Miller Pregnane X Receptor Up-Regulation of P-Glycoprotein Expression and Transport Function at the Blood-Brain Barrier Mol. Pharmacol., September 1, 2004; 66(3): 413 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Podvinec, C. Handschin, R. Looser, and U. A. Meyer Identification of the xenosensors regulating human 5-aminolevulinate synthase PNAS, June 15, 2004; 101(24): 9127 - 9132. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-O. Chang, S. V. Sosnovtsev, G. Belliot, Y. Kim, L. J. Saif, and K. Y. Green Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1 PNAS, June 8, 2004; 101(23): 8733 - 8738. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Hartley, X. Dai, Y. D. He, E. J. Carlini, B. Wang, S.-e. W. Huskey, R. G. Ulrich, T. H. Rushmore, R. Evers, and D. C. Evans Activators of the Rat Pregnane X Receptor Differentially Modulate Hepatic and Intestinal Gene Expression Mol. Pharmacol., May 1, 2004; 65(5): 1159 - 1171. [Abstract] [Full Text] |
||||
![]() |
K. Kobayashi, S. Yamagami, T. Higuchi, M. Hosokawa, and K. Chiba KEY STRUCTURAL FEATURES OF LIGANDS FOR ACTIVATION OF HUMAN PREGNANE X RECEPTOR Drug Metab. Dispos., April 1, 2004; 32(4): 468 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Faucette, H. Wang, G. A. Hamilton, S. L. Jolley, D. Gilbert, C. Lindley, B. Yan, M. Negishi, and E. L. LeCluyse REGULATION OF CYP2B6 IN PRIMARY HUMAN HEPATOCYTES BY PROTOTYPICAL INDUCERS Drug Metab. Dispos., March 1, 2004; 32(3): 348 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Roitelman, D. Masson, R. Avner, C. Ammon-Zufferey, A. Perez, Y. Guyon-Gellin, C. L. Bentzen, and E. J. Niesor Apomine, a Novel Hypocholesterolemic Agent, Accelerates Degradation of 3-Hydroxy-3-methylglutaryl-coenzyme A Reductase and Stimulates Low Density Lipoprotein Receptor Activity J. Biol. Chem., February 20, 2004; 279(8): 6465 - 6473. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, A. F. Purchio, R. Coffee, and D. B. West DIFFERENTIAL REGULATION OF THE HUMAN CYP3A4 PROMOTER IN TRANSGENIC MICE AND RATS Drug Metab. Dispos., February 1, 2004; 32(2): 163 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Koyano, K. Kurose, Y. Saito, S. Ozawa, R. Hasegawa, K. Komamura, K. Ueno, S. Kamakura, M. Kitakaze, T. Nakajima, et al. FUNCTIONAL CHARACTERIZATION OF FOUR NATURALLY OCCURRING VARIANTS OF HUMAN PREGNANE X RECEPTOR (PXR): ONE VARIANT CAUSES DRAMATIC LOSS OF BOTH DNA BINDING ACTIVITY AND THE TRANSACTIVATION OF THE CYP3A4 PROMOTER/ENHANCER REGION Drug Metab. Dispos., January 1, 2004; 32(1): 149 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Tirona, B. F. Leake, L. M. Podust, and R. B. Kim Identification of Amino Acids in Rat Pregnane X Receptor that Determine Species-Specific Activation Mol. Pharmacol., January 1, 2004; 65(1): 36 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin and U. A. Meyer Induction of Drug Metabolism: The Role of Nuclear Receptors Pharmacol. Rev., December 1, 2003; 55(4): 649 - 673. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Luo, R. Sladek, J. Carrier, J.-A. Bader, D. Richard, and V. Giguere Reduced Fat Mass in Mice Lacking Orphan Nuclear Receptor Estrogen-Related Receptor {alpha} Mol. Cell. Biol., November 15, 2003; 23(22): 7947 - 7956. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Tabb, A. Sun, C. Zhou, F. Grun, J. Errandi, K. Romero, H. Pham, S. Inoue, S. Mallick, M. Lin, et al. Vitamin K2 Regulation of Bone Homeostasis Is Mediated by the Steroid and Xenobiotic Receptor SXR J. Biol. Chem., November 7, 2003; 278(45): 43919 - 43927. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, A. F. Purchio, K. Chen, J. Wu, L. Lu, R. Coffee, P. R. Contag, and D. B. West A TRANSGENIC MOUSE MODEL WITH A LUCIFERASE REPORTER FOR STUDYING IN VIVO TRANSCRIPTIONAL REGULATION OF THE HUMAN CYP3A4 GENE Drug Metab. Dispos., August 1, 2003; 31(8): 1054 - 1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Maglich, J. A. Caravella, M. H. Lambert, T. M. Willson, J. T. Moore, and L. Ramamurthy The first completed genome sequence from a teleost fish (Fugu rubripes) adds significant diversity to the nuclear receptor superfamily Nucleic Acids Res., July 15, 2003; 31(14): 4051 - 4058. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Tippin, G. Hamilton, L. Moore, E. J. Beaudet, S. Jolley, T. A. Brodie, R. C. Andrews, J. D. Becherer, D. L. McDougald, M. D. Gaul, et al. CYP3A INDUCTION BY N-HYDROXYFORMAMIDE TUMOR NECROSIS FACTOR-{alpha} CONVERTING ENZYME/MATRIX METALLOPROTEINASE INHIBITORS: USE OF A PREGNANE X RECEPTOR ACTIVATION ASSAY AND PRIMARY HEPATOCYTE CULTURE FOR ASSESSING INDUCTION POTENTIAL IN HUMANS Drug Metab. Dispos., July 1, 2003; 31(7): 870 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kliewer The Nuclear Pregnane X Receptor Regulates Xenobiotic Detoxification J. Nutr., July 1, 2003; 133(7): 2444S - 2447. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Whitfield, H. T. L. Dang, S. F. Schluter, R. M. Bernstein, T. Bunag, L. A. Manzon, G. Hsieh, C. Encinas Dominguez, J. H. Youson, M. R. Haussler, et al. Cloning of a Functional Vitamin D Receptor from the Lamprey (Petromyzon marinus), an Ancient Vertebrate Lacking a Calcified Skeleton and Teeth Endocrinology, June 1, 2003; 144(6): 2704 - 2716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Maglich, D. J. Parks, L. B. Moore, J. L. Collins, B. Goodwin, A. N. Billin, C. A. Stoltz, S. A. Kliewer, M. H. Lambert, T. M. Willson, et al. Identification of a Novel Human Constitutive Androstane Receptor (CAR) Agonist and Its Use in the Identification of CAR Target Genes J. Biol. Chem., May 2, 2003; 278(19): 17277 - 17283. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Raucy Regulation of CYP3A4 Expression in Human Hepatocytes by Pharmaceuticals and Natural Products Drug Metab. Dispos., May 1, 2003; 31(5): 533 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Nallani, B. Goodwin, J. M. Maglich, D. J. Buckley, A. R. Buckley, and P. B. Desai Induction of Cytochrome P450 3A by Paclitaxel in Mice: Pivotal Role of the Nuclear Xenobiotic Receptor, Pregnane X Receptor Drug Metab. Dispos., May 1, 2003; 31(5): 681 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Lee, Y. J. Kim, D. Y. Hwang, T. S. Kang, J. H. Hwang, C. H. Lim, H. K. Kang, J. S. Goo, H. J. Lim, K. S. Ahn, et al. An In Vitro Bioassay for Xenobiotics Using the SXR-Driven Human CYP3A4/lac Z Reporter Gene International Journal of Toxicology, May 1, 2003; 22(3): 207 - 213. [Abstract] [PDF] |
||||
![]() |
M.-F. Yueh, Y.-H. Huang, A. Hiller, S. Chen, N. Nguyen, and R. H. Tukey Involvement of the Xenobiotic Response Element (XRE) in Ah Receptor-mediated Induction of Human UDP-glucuronosyltransferase 1A1 J. Biol. Chem., April 18, 2003; 278(17): 15001 - 15006. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sahi, C. B. Black, G. A. Hamilton, X. Zheng, S. Jolley, K. A. Rose, D. Gilbert, E. L. LeCluyse, and M. W. Sinz Comparative Effects of Thiazolidinediones on in Vitro P450 Enzyme Induction and Inhibition Drug Metab. Dispos., April 1, 2003; 31(4): 439 - 446. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kawamata, R. Fujii, M. Hosoya, M. Harada, H. Yoshida, M. Miwa, S. Fukusumi, Y. Habata, T. Itoh, Y. Shintani, et al. A G Protein-coupled Receptor Responsive to Bile Acids J. Biol. Chem., March 7, 2003; 278(11): 9435 - 9440. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dussault, H.-D. Yoo, M. Lin, E. Wang, M. Fan, A. K. Batta, G. Salen, S. K. Erickson, and B. M. Forman Identification of an endogenous ligand that activates pregnane X receptor-mediated sterol clearance PNAS, February 4, 2003; 100(3): 833 - 838. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Goodwin, K. C. Gauthier, M. Umetani, M. A. Watson, M. I. Lochansky, J. L. Collins, E. Leitersdorf, D. J. Mangelsdorf, S. A. Kliewer, and J. J. Repa Identification of bile acid precursors as endogenous ligands for the nuclear xenobiotic pregnane X receptor PNAS, January 7, 2003; 100(1): 223 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Kocarek, M. S. Dahn, H. Cai, S. C. Strom, and N. A. Mercer-Haines Regulation of CYP2B6 and CYP3A Expression by Hydroxymethylglutaryl Coenzyme A Inhibitors in Primary Cultured Human Hepatocytes Drug Metab. Dispos., December 1, 2002; 30(12): 1400 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kliewer, B. Goodwin, and T. M. Willson The Nuclear Pregnane X Receptor: A Key Regulator of Xenobiotic Metabolism Endocr. Rev., October 1, 2002; 23(5): 687 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Raucy, L. Warfe, M.-F. Yueh, and S. W. Allen A Cell-Based Reporter Gene Assay for Determining Induction of CYP3A4 in a High-Volume System J. Pharmacol. Exp. Ther., October 1, 2002; 303(1): 412 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takeshita, M. Taguchi, N. Koibuchi, and Y. Ozawa Putative Role of the Orphan Nuclear Receptor SXR (Steroid and Xenobiotic Receptor) in the Mechanism of CYP3A4 Inhibition by Xenobiotics J. Biol. Chem., August 30, 2002; 277(36): 32453 - 32458. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, R. Amherd, R. Looser, J.-C. Ourlin, and U. A. Meyer Cholesterol and Bile Acids Regulate Xenosensor Signaling in Drug-mediated Induction of Cytochromes P450 J. Biol. Chem., August 9, 2002; 277(33): 29561 - 29567. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xiong, K. Yoshinari, K. L. R. Brouwer, and M. Negishi Role of Constitutive Androstane Receptor in the In Vivo Induction of Mrp3 and CYP2B1/2 by Phenobarbital Drug Metab. Dispos., August 1, 2002; 30(8): 918 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Raucy, L. Mueller, K. Duan, S. W. Allen, S. Strom, and J. M. Lasker Expression and Induction of CYP2C P450 Enzymes in Primary Cultures of Human Hepatocytes J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 475 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
J D Tugwood and C T Montague Biology and toxicology of PPARg ligands Human and Experimental Toxicology, August 1, 2002; 21(8): 429 - 437. [Abstract] [PDF] |
||||
![]() |
G. Luo, M. Cunningham, S. Kim, T. Burn, J. Lin, M. Sinz, G. Hamilton, C. Rizzo, S. Jolley, D. Gilbert, et al. CYP3A4 Induction by Drugs: Correlation between a Pregnane X Receptor Reporter Gene Assay and CYP3A4 Expression in Human Hepatocytes Drug Metab. Dispos., July 1, 2002; 30(7): 795 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, C. Xia, J. Meier, S. Li, X. Hu, and D. S. Lala The Hypolipidemic Natural Product Guggulsterone Acts as an Antagonist of the Bile Acid Receptor Mol. Endocrinol., July 1, 2002; 16(7): 1590 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Willson and J. T. Moore Minireview: Genomics Versus Orphan Nuclear Receptors--A Half-Time Report Mol. Endocrinol., June 1, 2002; 16(6): 1135 - 1144. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Johnson and C. D. Klaassen Regulation of Rat Multidrug Resistance Protein 2 by Classes of Prototypical Microsomal Enzyme Inducers That Activate Distinct Transcription Pathways Toxicol. Sci., June 1, 2002; 67(2): 182 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Ripp, J. L. Fitzpatrick, J. M. Peters, and R. A. Prough Induction of CYP3A Expression by Dehydroepiandrosterone: Involvement of the Pregnane X Receptor Drug Metab. Dispos., May 1, 2002; 30(5): 570 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Desai, S. C. Nallani, R. S. Sane, L. B. Moore, B. J. Goodwin, D. J. Buckley, and A. R. Buckley Induction of Cytochrome P450 3A4 in Primary Human Hepatocytes and Activation of the Human Pregnane X Receptor by Tamoxifen and 4-Hydroxytamoxifen Drug Metab. Dispos., May 1, 2002; 30(5): 608 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Moore, J. M. Maglich, D. D. McKee, B. Wisely, T. M. Willson, S. A. Kliewer, M. H. Lambert, and J. T. Moore Pregnane X Receptor (PXR), Constitutive Androstane Receptor (CAR), and Benzoate X Receptor (BXR) Define Three Pharmacologically Distinct Classes of Nuclear Receptors Mol. Endocrinol., May 1, 2002; 16(5): 977 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Guo, J. Staudinger, K. Ogura, and C. D. Klaassen Induction of Rat Organic Anion Transporting Polypeptide 2 by Pregnenolone-16alpha -carbonitrile Is via Interaction with Pregnane X Receptor Mol. Pharmacol., April 1, 2002; 61(4): 832 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Guo, D. R. Johnson, and C. D. Klaassen Postnatal Expression and Induction by Pregnenolone-16alpha -Carbonitrile of the Organic Anion-Transporting Polypeptide 2 in Rat Liver Drug Metab. Dispos., March 1, 2002; 30(3): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kliewer and T. M. Willson Regulation of xenobiotic and bile acid metabolism by the nuclear pregnane X receptor J. Lipid Res., March 1, 2002; 43(3): 359 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ekins and J. A. Erickson A Pharmacophore for Human Pregnane X Receptor Ligands Drug Metab. Dispos., January 1, 2002; 30(1): 96 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Guo, S. Choudhuri, and C. D. Klaassen Induction Profile of Rat Organic Anion Transporting Polypeptide 2 (oatp2) by Prototypical Drug-Metabolizing Enzyme Inducers That Activate Gene Expression through Ligand-Activated Transcription Factor Pathways J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 206 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hustert, A. Zibat, E. Presecan-Siedel, R. Eiselt, R. Mueller, C. Fu{beta}, I. Brehm, U. Brinkmann, M. Eichelbaum, L. Wojnowski, et al. Natural Protein Variants of Pregnane X Receptor with Altered Transactivation Activity Toward CYP3A4 Drug Metab. Dispos., November 1, 2001; 29(11): 1454 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Staudinger, Y. Liu, A. Madan, S. Habeebu, and C. D. Klaassen Coordinate Regulation of Xenobiotic and Bile Acid Homeostasis by Pregnane X Receptor Drug Metab. Dispos., November 1, 2001; 29(11): 1467 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Schuetz, S. Strom, K. Yasuda, V. Lecureur, M. Assem, C. Brimer, J. Lamba, R. B. Kim, V. Ramachandran, B. J. Komoroski, et al. Disrupted Bile Acid Homeostasis Reveals an Unexpected Interaction among Nuclear Hormone Receptors, Transporters, and Cytochrome P450 J. Biol. Chem., October 12, 2001; 276(42): 39411 - 39418. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Nugent, J. B. Prins, J. P. Whitehead, D. Savage, J. M. Wentworth, V. K. Chatterjee, and S. O'Rahilly Potentiation of Glucose Uptake in 3T3-L1 Adipocytes by PPAR{gamma} Agonists Is Maintained in Cells Expressing a PPAR{gamma} Dominant-Negative Mutant: Evidence for Selectivity in the Downstream Responses to PPAR{gamma} Activation Mol. Endocrinol., October 1, 2001; 15(10): 1729 - 1738. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, R. Looser, R. Amherd, and U. A. Meyer Multiple Enhancer Units Mediate Drug Induction of CYP2H1 by Xenobiotic-Sensing Orphan Nuclear Receptor Chicken Xenobiotic Receptor Mol. Pharmacol., October 1, 2001; 60(4): 681 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, J. Stockli, K. Hoffmann, and U. A. Meyer Conservation of Signaling Pathways of Xenobiotic-Sensing Orphan Nuclear Receptors, Chicken Xenobiotic Receptor, Constitutive Androstane Receptor, and Pregnane X Receptor, from Birds to Humans Mol. Endocrinol., September 1, 2001; 15(9): 1571 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Goodwin, L. B. Moore, C. M. Stoltz, D. D. McKee, and S. A. Kliewer Regulation of the Human CYP2B6 Gene by the Nuclear Pregnane X Receptor Mol. Pharmacol., September 1, 2001; 60(3): 427 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Falkner, J. A. Pinaire, G.-H. Xiao, T. E. Geoghegan, and R. A. Prough Regulation of the Rat Glutathione S-Transferase A2 Gene by Glucocorticoids: Involvement of Both the Glucocorticoid and Pregnane X Receptors Mol. Pharmacol., September 1, 2001; 60(3): 611 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Quattrochi and P. S. Guzelian CYP3A Regulation: From Pharmacology to Nuclear Receptors Drug Metab. Dispos., April 13, 2001; 29(5): 615 - 622. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |