help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, S. A.
Right arrow Articles by Moore, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, S. A.
Right arrow Articles by Moore, J. T.
Molecular Endocrinology 14 (1):27
Copyright © 2000 by The Endocrine Society

The Pregnane X Receptor: A Promiscuous Xenobiotic Receptor That Has Diverged during Evolution

Stacey A. Jones1, Linda B. Moore1, Jennifer L. Shenk1, G. Bruce Wisely, Geraldine A. Hamilton, David D. McKee, Nicholas C. O. Tomkinson, Edward L. LeCluyse, Millard H. Lambert, Timothy M. Willson, Steven A. Kliewer and John T. Moore

Departments of Molecular Endocrinology (S.A.J., L.B.M., J.L.S., G.B.W., D.D.M., S.A.K., J.T.M.), Medicinal Chemistry (N.C.O.T, T.M.W.), and Structural Chemistry (M.H.L) Glaxo Wellcome Inc. Research and Development Research Triangle Park, North Carolina 27709
Department of Drug Delivery and Disposition (G.A.H., E.L.L.) School of Pharmacy University of North Carolina at Chapel Hill Chapel Hill, North Carolina 27599


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Transcription of genes encoding cytochrome P450 3A (CYP3A) monooxygenases is induced by a variety of xenobiotics and natural steroids. There are marked differences in the compounds that induce CYP3A gene expression between species. Recently, the mouse and human pregnane X receptor (PXR) were shown to be activated by compounds that induce CYP3A expression. However, most studies of CYP3A regulation have been performed using rabbit and rat hepatocytes. Here, we report the cloning and characterization of PXR from these two species. PXR is remarkably divergent between species, with the rabbit, rat, and human receptors sharing only approximately 80% amino acid identity in their ligand-binding domains. This sequence divergence is reflected by marked pharmacological differences in PXR activation profiles. For example, the macrolide antibiotic rifampicin, the antidiabetic drug troglitazone, and the hypocholesterolemic drug SR12813 are efficacious activators of the human and rabbit PXR but have little activity on the rat and mouse PXR. Conversely, pregnane 16{alpha}-carbonitrile is a more potent activator of the rat and mouse PXR than the human and rabbit receptor. The activities of xenobiotics in PXR activation assays correlate well with their ability to induce CYP3A expression in primary hepatocytes. Through the use of a novel scintillation proximity binding assay, we demonstrate that many of the compounds that induce CYP3A expression bind directly to human PXR. These data establish PXR as a promiscuous xenobiotic receptor that has diverged during evolution.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The liver and intestine are important sites for the metabolism of both endogenous and exogenous chemicals. Members of the cytochrome P450 (CYP) superfamily of hemoproteins play critical roles in the oxidative metabolism of compounds in both of these tissues. The CYP3A gene products are among the most abundant of the monooxygenases in mammalian liver and intestine. In humans, CYP3A4 is involved in the metabolism of more than 50% of all drugs as well as a variety of other xenobiotics and endogenous substances, including steroids (1 ).

Expression of CYP3A genes is induced by a variety of compounds, including many drugs (1 2 ). The induction of CYP3A transcription represents the basis for a number of common drug-drug interactions. Many xenobiotics have been profiled for their effects on CYP3A expression in primary hepatocytes from rabbits or rats (3 4 5 ). These studies have revealed marked species differences and called into question the validity of using animal models or nonhuman hepatocytes for predicting the effects of xenobiotics on CYP3A transcription in humans. Transfection studies in which reporter genes driven by CYP3A promoter sequences were introduced into rabbit or rat hepatocytes showed these differences were a consequence of host cell factors rather than differences in cis-acting sequences in the CYP3A gene promoters (5 ). However, the molecular basis for these species differences had remained in question.

We and others recently cloned novel mouse and human orphan members of the nuclear hormone receptor superfamily and showed that they are activated by a variety of known inducers of CYP3A expression (6 7 8 9 10 ). We have named these orphan nuclear receptors pregnane X receptors (PXRs) based upon their efficacious activation by natural C21 steroids (pregnanes). Mouse and human PXR are predominantly expressed in liver and intestine and bind to xenobiotic response elements previously identified in the human and rat CYP3A promoters (6 7 8 9 ). Based upon these data, PXR has been suggested to serve as a key regulator of CYP3A expression. The human and mouse PXR share only 76% amino acid identity in their ligand-binding domains (LBDs) and display markedly different activation profiles in response to xenobiotics. Thus, it has remained an open question whether these receptors are bona fide orthologs or members of a broader subfamily of closely related orphan nuclear receptors.

We now report the cloning and characterization of PXR from rabbit and rat, two species that are frequently used for studies of drug metabolism and CYP3A regulation. Although PXR has diverged significantly during the course of evolution, our results provide evidence that it has an important role in CYP3A regulation in multiple species. In addition, we also report the development of a scintillation proximity binding assay for human PXR and show for the first time that structurally diverse compounds bind directly to this orphan nuclear receptor.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning and Characterization of the Rabbit and Rat PXR
Because pharmacological and toxicological studies are often conducted in rabbits and rats, we sought to clone PXR from these species. PCR strategies were employed using oligonucleotides derived from the mouse and human PXR and cDNA prepared from either rat or rabbit liver. The resulting rat and rabbit PXR clones encode proteins of 431 and 411 amino acids, respectively (Fig. 1AGo). Rat PXR is closely related to its mouse ortholog, sharing 97% amino acid identity throughout. Alignment of the PXR sequences revealed interesting differences between species. Although their DNA-binding domains (DBDs) are approximately 95% identical, the LBDs of the rabbit, rodent, and human PXR share only about 80% amino acid identity (Fig. 1Go). Notably, the rabbit PXR is roughly equally divergent from the human and rodent PXR (Fig. 1BGo). This degree of divergence is unprecedented for nuclear receptor orthologs. Secondary structure prediction within the LBD suggested that several of the residues that differ between species might affect the ligand-binding properties of the receptor (Fig. 1AGo). This analysis also revealed the presence of a large insert between the predicted H2 and H3, similar to that observed in the peroxisome proliferator-activated receptors (PPARs) but not the classical steroid receptors (11 12 13 ).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 1. Sequence Comparison of PXR among Species

A, Alignment of the rabbit, rat, human, and mouse PXR amino acid sequences. Residues that differ from the consensus are boxed in black. The DBD and the predicted {alpha}-helices in the LBD are indicated. B, The percent amino acid identities and differences are indicated for the PXR DBD and LBD. 1, Rabbit; 2 , rat; 3, mouse; 4, human.

 
The tissue expression patterns of rat and rabbit PXR were determined by Northern analysis using blots containing poly(A)+ RNA from a variety of adult tissues. Rat and rabbit PXR are most abundantly expressed in the liver, with PXR mRNA also detected in tissues of the gastrointestinal tract (Fig. 2Go). Two distinct transcripts of approximately 2.5 and 4.0 kb were seen in rat liver. The 2.5-kb transcript is also observed in rat stomach and small intestine. PXR transcripts of 2.6, 4.5, and 5.0 kb were detected in rabbit liver, small intestine, and kidney. We did not detect PXR in rat kidney, even in longer exposures of the blot. This was surprising since PXR was previously observed in mouse kidney (6 ). We conclude that PXR is most abundantly expressed in liver in all four species, but that differences exist in PXR transcript size and extrahepatic tissue expression.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. Northern Blot Analysis of Rat and Rabbit PXR Expression Patterns in Adult Tissues

RNA size markers (in kilobases) are indicated on the left.

 
Differential Activation of Mouse, Rat, Rabbit, and Human PXR
A variety of different xenobiotics were previously tested for their ability to induce CYP3A expression in primary hepatocytes from either rabbits or rats (3 4 5 ). Many of these compounds, including dexamethasone, phenobarbital, RU486, spironolactone, clotrimazole, and trans-nonachlor, induced CYP3A expression in hepatocytes from both species (4 ). However, there were notable differences. For example, the macrolide antibiotic rifampicin was a much more efficacious inducer of CYP3A expression in rabbit hepatocytes than rat hepatocytes. Conversely, pregnenolone 16{alpha}-carbonitrile (PCN) induced CYP3A expression in rat hepatocytes but not rabbit hepatocytes. We tested this same panel of compounds for activation of the rabbit and rat PXR. PXR expression plasmids were cotransfected into CV-1 cells together with a reporter plasmid containing two copies of the CYP3A1 direct repeat 3 (DR-3) PXR response element upstream of the minimal thymidine kinase promoter and chloramphenicol acetyltransferase (CAT) gene. The cells were then treated with 10 µM concentrations of each compound except for phenobarbital, which was tested at 1 mM. Both the rabbit and rat PXR responded to xenobiotics. Rifampicin and dexamethasone were the most efficacious activators of rabbit PXR, inducing reporter levels more than 15-fold over the basal level (Fig. 3AGo). The synthetic steroids PCN, RU486, cyproterone acetate (CPA), and spironolactone were efficacious activators of rat PXR, increasing reporter levels more than 7-fold (Fig. 3AGo). In general, activation of the rat and rabbit PXR agreed with the reported induction of CYP3A expression in primary hepatocytes from these same species (4 ). Rifampicin was an efficacious activator of rabbit PXR but had no effect on rat PXR (Fig. 3AGo). Although both receptors were activated by 10 µM concentrations of PCN, full dose-response analysis revealed that PCN was roughly 1 order of magnitude more potent on rat PXR than rabbit PXR (Fig. 3BGo). These data suggest that PXR has an important role in the regulation of CYP3A expression in multiple species.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. The Human, Rabbit, Rat, and Mouse PXR Are Activated by Xenobiotics

A, CV-1 cells were transfected with expression plasmids for PXR from the different species and the (CYP3A1 DR3)2-tk-CAT reporter. Cells were treated with 10 µM of each compound, except for phenobarbital, which was tested at 1 mM. Cell extracts were subsequently assayed for CAT activity. Data represent the mean of assays performed in triplicate ± SE. B, CV-1 cells were transfected with expression plasmids for rabbit or rat PXR and the reporter (CYP3A1 DR3)2-tk-CAT. Cells were treated with the indicated concentrations of PCN, and cell extracts were subsequently assayed for CAT activity. Data points represent the mean of assays performed in duplicate.

 
The same panel of CYP3A inducers was also tested on the human and mouse PXR (Fig. 3AGo). Based on the finding that rifampicin is a much more efficacious activator of CYP3A expression in hepatocytes from rabbits and humans than from rats (4 5 ), together with the observation that rifampicin is an efficacious activator of human PXR (7 8 9 ), it had been suggested that the activation profiles of the rabbit and human PXR were likely to be similar. Indeed, the human and rabbit PXR were both efficiently activated by rifampicin as well as by RU486, clotrimazole, trans-nonachlor, and phenobarbital (Fig. 3AGo). However, the rabbit PXR was much more sensitive than its human ortholog to activation by the synthetic steroids dexamethasone, PCN, CPA, and spironolactone (Fig. 3AGo). Thus, there are clear differences in responsiveness of rabbit and human PXR to xenobiotics. Given their high degree of sequence identity, it was not surprising that the rat and mouse PXR had very similar activation profiles, although there were subtle differences (Fig. 3AGo). We conclude from these studies that although the human, rabbit, rat, and mouse PXR are activated by several of the same compounds, each is pharmacologically distinct.

Among the established inducers of CYP3A expression that we tested for PXR activation was troglitazone. Troglitazone is a member of the thiazolidinedione class of insulin-sensitizing drugs that lower glucose, lipid, and insulin levels in patients with type 2 diabetes. Thiazolidinediones mediate their therapeutic effects by binding and activating the nuclear receptor PPAR{gamma} (14 ). Troglitazone is known to increase CYP3A4 activity and to enhance the metabolism of other drugs in patients (15 ). Consistent with this, we found that troglitazone activated both the human and rabbit PXR (Fig. 3AGo). Full dose-response analysis showed that troglitazone activated human PXR with an EC50 value of approximately 3 µM, which is comparable to the concentration required to activate PPAR{gamma} (data not shown). Thus, the interaction of troglitazone with other drugs is likely to result from its activation of PXR. Interestingly, troglitazone had little effect on the rat and mouse PXR.

Rexinoids Activate PXR
Like many of the other orphan nuclear receptors, PXR binds to its hormone response elements as a heterodimer with retinoid X receptor (RXR) (6 7 8 9 ). These heterodimers have been classified as either permissive or nonpermissive depending on whether they are activated by RXR ligands (rexinoids) (16 ). To test whether the PXR/RXR heterodimer is permissive for activation by rexinoids, we performed cotransfection assays with PXR from the four species in CV-1 cells in the presence of the natural RXR ligand 9-cis-retinoic acid and the synthetic, RXR-selective compounds LGD1069 and LG100268 (17 18 ). The RXR ligands did not activate the PXR/RXR heterodimer at the nanomolar concentrations that are typically required to activate the RXR homodimer or the permissive RXR heterodimers. However, micromolar concentrations of the rexinoids did weakly activate the heterodimers formed between either the human or rabbit PXR and RXR (Fig. 4Go). Transfection experiments performed with saturating concentrations of a PXR ligand showed that LG100268 did not further activate the human PXR/RXR heterodimer (data not shown). Notably, the rexinoids had no effect on the rat or mouse PXR heterodimers with RXR (data not shown), suggesting that these compounds might not mediate their effects through RXR but rather via the rabbit and human PXR. Consistent with this idea, we have shown that RXR ligands bind directly to human PXR at micromolar concentrations (see below). Thus, our data indicate that the heterodimers formed between either the human or rabbit PXR and RXR can be activated by micromolar concentrations of rexinoids that cross-react with PXR.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Rexinoids Activate Human and Rabbit PXR. CV-1 Cells Were Transfected with Expression Plasmids for Human (A) or Rabbit (B) PXR and the Reporter (CYP3A1 DR3)2-tk-CAT

Cells were treated with the indicated concentrations of rifampicin (open circles), LGD1069 (closed circles), LG100268 (open squares), or 9-cis-retinoic acid (closed squares). Cell extracts were subsequently assayed for CAT activity. Data points represent the mean of assays performed in duplicate.

 
SR12813 Is a Potent PXR Activator
The bisphosphonate ester SR12813 lowers cholesterol levels in a range of species including rats, dogs, and primates (19 20 ). The molecular mechanism for these hypocholesterolemic effects has remained unclear. Since SR12813 has been reported to increase CYP3A protein levels in rat hepatocytes (21 ), we tested its ability to activate PXR. SR12813 was a very potent and efficacious activator of both the human and rabbit PXR, with EC50 values of approximately 200 nM and 700 nM, respectively (Fig. 5AGo). This is the most potent PXR activator to be identified to date. By contrast, SR12813 was only a very weak activator of the rat and mouse PXR (Fig. 5AGo).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Bisphosphonate Ester SR12813 Is a Potent Activator of Human and Rabbit PXR 32P-labeled fragments of CYP3A1 (rat), CYP3A6 (rabbit), or CYP3A4 (human). Pictures of the ethidium bromide-stained total RNA, including the 18S and 28S ribosomal RNA bands, used to generate each blot are shown.

A, CV-1 cells were transfected with expression plasmids for PXR from the different species and the (CYP3A1 DR3)2-tk-CAT reporter. Cells were treated with the indicated concentrations of SR12813, and cell extracts were subsequently assayed for CAT activity. Data points represent the mean of assays performed in duplicate. B, Northern blot analysis was performed with total RNA (10 µg) prepared from primary rat, rabbit, or human hepatocytes that had been treated for 24 h with vehicle alone (0.1% dimethylsulfoxide), 10 µM rifampicin, 5 µM PCN, or 10 µM SR12813. Blots were probed with

 
We next tested whether the differences between rat, rabbit, and human PXR in response to SR12813 would be reflected at the level of CYP3A induction in primary hepatocytes derived from each of these species. Hepatocytes were treated with vehicle alone, SR12813, PCN, or rifampicin, and CYP3A mRNA levels were determined by Northern blot analysis using probes for CYP3A1, CYP3A4,and CYP3A6, major inducible CYP3A family members in rat, human, and rabbit, respectively. As expected, rifampicin was an efficacious inducer of CYP3A expression in human and rabbit hepatocytes, but not rat hepatocytes (Fig. 5BGo). Conversely, PCN induced CYP3A expression in rat but not human or rabbit hepatocytes. In agreement with the results from the transfection studies, SR12813 induced CYP3A expression in human and rabbit hepatocytes but only weakly in rat hepatocytes (Fig. 5BGo). These results demonstrate that the PXR activation profile is predictive of the effects of SR12813 on CYP3A expression in primary hepatocytes from different species.

Structurally Diverse Xenobiotics Are PXR Ligands
The structural diversity of the compounds that activate PXR is unprecedented for a nuclear receptor. Do these xenobiotics, which range in mol wt from 232 (phenobarbital) to 823 (rifampicin), mediate their effects through direct interactions with PXR? We set out to address this issue by establishing a competition binding assay employing [3H]SR12813 as a radioligand. Initial attempts to express the LBD of human PXR in Escherichia coli were unsuccessful due to its lack of solubility. However, coexpression of an 88-amino acid region of the steroid coactivator protein 1 (SRC-1) with the human PXR LBD resulted in soluble protein that was purified to homogeneity and biotinylated for use in ligand-binding assays. A scintillation proximity-binding assay was developed using streptavidin-coated polyvinyltoluene beads and the biotinylated human PXR. [3H]SR12813 interacted specifically with human PXR with a dissociation constant (Kd) of 40 nM (Fig. 6AGo). This value is in good agreement with the EC50 value for SR12813 for activation of human PXR in the transfection assay (Fig. 5AGo). These data demonstrate that [3H]SR12813 binds directly to human PXR.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. SR12813 and Other Xenobiotics Bind to Human PXR

A, Purified human PXR LBD immobilized on SPA beads was incubated with concentrations of [3H]SR12813 ranging from 0.5 nM to 1000 nM in the absence (total binding, open squares) or presence (specific binding, closed triangles) of 10 µM clotrimazole to define nonspecific binding. Data points represent the mean of assays performed in triplicate. The Kd value for [3H]SR12813 binding to human PXR was 41 nM as calculated by nonlinear regression. B, Competition binding assays were performed with 10 nM [3H]SR12813 and 10 µM of each of the xenobiotics, except phenobarbital, which was tested at 1 mM. Data represent the mean of assays performed in duplicate ± SE and are plotted as percent inhibition of [3H]SR12813 binding where competition with unlabeled SR12813 is defined as 100%.

 
We next tested various PXR activators for their ability to compete with [3H]SR12813 for binding to human PXR. Each compound was tested at 10 µM except for phenobarbital, which was tested at the 1 mM concentration required to activate human PXR. Notably, all the xenobiotics that activated human PXR in the transfection assay displaced [3H]SR12813 from the receptor (Fig. 6BGo). The compounds that interacted with human PXR included the thiazolidinedione trolitazone and the rexinoids 9-cis retinoic acid, LGD1069, and LG100268. Consistent with their relative inactivity in the transfection assay, the synthetic steroids PCN, CPA, spironolactone, and dexamethasone competed only weakly with [3H]SR12813 for binding to human PXR (Fig. 6BGo). These data demonstrate that a variety of xenobiotics are capable of interacting with the PXR LBD at concentrations that are consistent with those required to activate the receptor in transfection assays. Given the high concentration of phenobarbital that is required for competition in the binding assay and the fact that it is known to mediate effects through other mechanisms (22 ), we cannot rule out the possibility that this barbiturate activates PXR through other signaling pathways.

Natural Steroids Are PXR Ligands
Human and mouse PXR are activated by a variety of naturally occurring steroids, among which C21 steroids (pregnanes) are the most potent (6 7 8 9 ). We tested various pregnanes and other steroids for their activities on the human, rabbit, rat, and mouse PXR in the transfection assay. Each PXR displayed a distinct activation profile (Fig. 7AGo). However, in each case, the most efficacious activator was a pregnane. 5ß-Pregnane-3,20-dione was the most efficacious natural activator of the human, rat, and mouse PXR (Fig. 7AGo). Although 5ß-pregnane-3,20-dione also activated the rabbit PXR, the closely related compound 17-OH progesterone was the most efficacious activator of the rabbit receptor. Weaker activation of PXR was also seen with other steroids, including corticosterone, dihydrotestosterone, and estradiol (Fig. 7AGo), as previously described (8 9 ).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Natural Steroids Are PXR Ligands

A, CV-1 cells were transfected with expression plasmids for PXR from the different species and the (CYP3A1 DR3)2-tk-CAT reporter. Cells were treated with 10 µM of each steroid. Cell extracts were subsequently assayed for CAT activity. Data represent the mean of assays performed in triplicate ±SE. B, Competition binding assays were performed with purified human PXR LBD immobilized on SPA beads, 10 nM [3H]SR12813, and 10 µM of each steroid. Data represent the mean of assays performed in duplicate ± SE and are plotted as percent inhibition of [3H]SR12813 binding where competition with 10 µM unlabeled SR12813 is defined as 100%.

 
We examined whether these naturally occurring steroids interacted directly with human PXR. In agreement with the transfection data, 5ß-pregnane-3,20-dione competed most efficiently with [3H]SR12813 for binding to human PXR (Fig. 7BGo). Full dose-response analysis showed that 5ß-pregnane-3,20-dione bound to human PXR with an IC50 value of approximately 400 nM (data not shown). Competition was also seen with 10 µM concentrations of other natural steroids that activate human PXR including corticosterone and estradiol (Fig. 7BGo). These data demonstrate that natural steroids can bind directly to human PXR and, furthermore, suggest that the natural PXR ligand is likely to be a metabolite or close analog of 5ß-pregnane-3,20- dione.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Studies performed over the past 20 yr have revealed marked species differences in the induction of CYP3A expression in response to xenobiotics. These differences have complicated the development of assays to identify compounds that modulate CYP3A transcription. It was recently shown that the human and mouse orthologs of PXR are activated by compounds that induce CYP3A expression (6 7 8 9 ). We have now extended these earlier analyses to include rabbit and rat PXR. The characterization of PXR from these two species was of particular interest since a number of inducers of CYP3A expression have been studied in rabbit and rat hepatocytes, which are readily available. Overall, we find that there is a good correlation between PXR activation and the induction of CYP3A transcription in rat and rabbit hepatocytes. These data provide strong evidence that PXR is a key regulator of CYP3A transcription in a range of species, and that much of the cross-species variability in CYP3A regulation can be accounted for at the level of PXR activation. We note that several of the xenobiotics that induce CYP3A expression, including dexamethasone and phenobarbital, activate other nuclear receptors (22 ). Thus, other signaling pathways are also likely to contribute to the regulation of CYP3A expression.

Since rifampicin is an efficacious inducer of CYP3A expression in human and rabbit but not in rat, it was recently postulated that the rabbit PXR might be more closely related to its human ortholog than the rat PXR (9 ). In fact, the human, rabbit, and mouse/rat PXR are all roughly equally divergent, sharing only approximately 80% amino acid identity in their LBDs. Although both the rabbit and human PXR are activated by rifampicin, there are marked differences in their responsiveness to synthetic steroids such as dexamethasone and CPA. These differences in PXR activation profiles are likely to be reflected at the level of CYP3A expression in vivo. Thus, caution must be exercised in extrapolating CYP3A induction data for a particular compound from rabbit to man. Despite their divergence, several lines of evidence suggest that that PXRs are orthologs and not closely related members of a subfamily of nuclear receptors. First, each PXR is most abundantly expressed in the liver and tissues of the gastrointestinal tract. Second, our pharmacological data strongly suggest that each PXR regulates CYP3A expression in its respective species. Finally, our searches of the expressed sequence tag (EST) databases have not revealed any other PXR-like sequences (J. T. Moore, unpublished results). The divergence in PXR could represent either an adaptive response to different environmental xenobiotic challenges or differences in natural PXR ligands between species. Although pregnanes are the most efficacious natural activators of PXR from each of the species, we have observed cross-species differences in PXR activation by natural steroids. However, the concentrations of these steroids required to activate PXR are superphysiological, and the natural ligand for PXR remains to be determined.

The known ligands for nuclear receptors are all small molecules with similar volumes and molecular weights (23 ). Larger molecules, such as growth factors, can also activate nuclear receptors through binding to cell surface receptors and activation of their second messenger-signaling cascades (24 ). The observation that rifampicin, a macrolide antibiotic with a mol wt of 823, activated human PXR and promoted its interaction with the coactivator SRC-1 in an in vitro coprecipitation assay was surprising (7 8 9 ). Could PXR bind to a ligand as large as rifampicin? The development of a radioligand competition binding assay for this orphan receptor has allowed us to address this question. Using [3H]SR12813 in a scintillation proximity assay, we have demonstrated that many of the xenobiotics, including rifampicin, that induce CYP3A4 expression bind directly to PXR. The interaction of rifampicin with PXR suggests that its ligand-binding pocket must be very large in comparison with other nuclear receptors. The only other nuclear receptors that are known to have such large ligand-binding pockets are the PPARs (11 12 13 ). x-Ray crystallography has established that the large cavities in the PPARs are due, in part, to the presence of an {alpha}-helix termed H2' that is not present in other nuclear receptors. Sequence alignment suggests that PXR has an even larger insert in the H2' region than the PPARs (Fig. 1AGo). Thus, it is possible that the promiscuity of PXR is due to the presence of a ligand-binding pocket that is larger than those of other nuclear receptors.

SR12813 lowers plasma cholesterol levels in a number of species including primates (19 20 ). Although SR12813 has been reported to reduce cholesterol biosynthesis, by increasing the degradation of hydroxy-methylglutarate-coenzyme A reductase (20 ), the molecular target for its actions remains unknown. Despite its potency in activating human and rabbit PXR, we believe it unlikely that SR12813 mediates its hypocholesterolemic effects exclusively through PXR. PCN is a potent activator of the mouse and rat PXR and has effects on bile composition in rats (25 ). However, in agreement with previous studies (25 ), we have found that treatment of wild-type rats with PCN does not decrease serum cholesterol levels (J. L. Shenk and D. Winegar, unpublished data). Under these same conditions, SR12813, which is only a very weak activator of rat PXR, effectively lowers cholesterol levels. Moreover, rifampicin, which is widely used to treat tuberculosis at doses that induce CYP3A4 expression, has not been associated with reductions in cholesterol levels. These results suggest that PXR activation alone is unlikely to account for the hypocholesterolemic actions of SR12813. It was recently shown that micromolar concentrations of SR12813 activate the related nuclear receptor farnesoid X receptor (FXR) (26 ). FXR is a bile acid receptor that regulates genes such as cholesterol 7{alpha}-hydroxylase that are involved in cholesterol homeostasis (27 28 29 ). Thus, SR12813 may exert its hypocholesterolemic effects through FXR or other cellular receptors.

The thiazolidinedione antidiabetic drugs were developed using rodent models of insulin resistance, without knowledge of their cellular target. It is now known that these insulin sensitizers mediate their effects through activation of the PPAR{gamma}/RXR heterodimer (30 31 ). Troglitazone is the first of these drugs to be marketed for the treatment of type 2 diabetes. Although the drug is devoid of serious side effects in rodents, in humans it has been shown to increase CYP3A4 activity (15 ) and is also associated with an idiosyncratic hepatotoxicity (32 ). Our data showing that troglitazone activates human PXR at concentrations similar to those required to activate PPAR{gamma} provides an explanation for its interactions with other drugs, including oral contraceptives. Interestingly, the relative lack of activity of troglitazone on the mouse or rat PXR may explain why these effects were not reported in animal toxicology studies. Additional studies will be required to determine whether PXR also plays a role in the hepatotoxicity observed with troglitazone. In this regard, it is interesting that the PXR ligand rifampicin has also been associated with hepatotoxicity in humans (33 34 ). Our data suggest that certain rexinoids, which have been proposed as diabetes drugs (35 ), may show side effects similar to troglitazone through activation of PXR. The availability of PXR screening assays should allow for the development of new drugs for type 2 diabetes with increased selectivity for their cellular target, the PPAR{gamma}/RXR heterodimer.

In summary, we have demonstrated that PXR is a promiscuous nuclear xenobiotic receptor with an LBD that has diverged considerably during the course of evolution. This divergence in the PXR LBD accounts in large part for the differential effects of various compounds on CYP3A expression across species. Comparative functional studies using rabbit and rat PXR will increase our ability to evaluate metabolism data from relevant nonhuman pharmacological model systems. Moreover, the availability of PXR in a high throughput binding format provides a valuable tool for the rapid identification of compounds that will induce CYP3A expression and interact with other drugs. Through the early elimination of these compounds from the drug discovery process, these assays will aid in the development of safer medicines.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
ITS+ (insulin, transferrin, selenium, linoleic acid, and BSA supplement), rat tail collagen, type I, and Matrigel were purchased from Collaborative Biomedical Research Instruments, Inc. (Bedford, MA). Collagenase (CLS2) was obtained from Worthington Biochemical Corp. (Freehold, NJ). Petri dishes (60 mm, Permanox) were purchased from NUNC (Naperville, IL). All other media and culture reagents were purchased from Life Technologies, Inc. (Gaithersburg, MD). All solvents and other chemicals used were of HPLC grade or the highest purity available. Troglitazone, SR12813, LGD1069, and LG100268 were synthesized in house. RU486 and trans-nonachlor were purchased from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA) and Velsicol (Chicago, IL), respectively. All other xenobiotics and steroids used in the transfection and binding assays were purchased from either Sigma (St. Louis, MO) or Steraloids, Inc. (Wilton, NH).

Cloning of Rabbit and Rat PXR
The full-length coding region of rabbit PXR was derived from a {lambda}gt11 phage rabbit liver cDNA library (CLONTECH Laboratories, Inc. Palo Alto, CA). An internal 861-bp rabbit PXR fragment was first obtained by PCR using oligonucleotides derived from the mouse PXR LBD sequence (6 ). The forward oligonucleotide sequence was 5'-AAGTGCCTGGAGAGTGGCATG, and the reverse primer was 5'- TCGCAGCTCAGTGAGGACGGC. The remainder of the rabbit PXR 5'- and 3'-coding sequence was obtained by nested PCR using oligonucleotides within the 861-bp internal rabbit PXR sequence and oligonucleotides within {lambda}gt11, which flank the EcoRI cloning site. The oligonucleotides used for the nesting were: Nest 1: 5' CTGAGCCTCCATCCGTTCTCTC and 5' AGGTGTGGTGCAGCGTGAAG; Nest 2: 5' ACGGCCACATCGGACATGATC and 5'GATCATGGCCGTCCTCACTGAG. After obtaining the full-length rabbit PXR sequence by this method, the entire coding region was amplified and cloned again from rabbit liver cDNA to confirm the original sequence. The primers used in this step contained flanking EcoRI restriction sites for subcloning the PCR product into the mammalian expression vector pSG5 as well as a consensus Kozak sequence preceding the ATG to optimize mammalian expression. The forward primer sequence used was 5'- TCCACCGAATTCACCACCATGGGTGGAAAGCCCACCATCAGTGCAGAT and the reverse primer was 5'- TCCACCGAATTCTCAGTCATCTGTGGTGCTGAACAGCTCCCG. The sequences obtained in both cloning steps agreed over the entire coding region. The sequence of rabbit PXR has been deposited in GenBank (accession number AF188476).

The coding region of rat PXR was obtained by PCR amplification using rat liver cDNA (CLONTECH Laboratories, Inc.) and oligonucleotides derived from the 5'- and 3'-flanking regions of the mouse PXR. The forward primer sequence was 5'-TGATTCTTCAAGGTGGACCCC, and the reverse primer was 5'-GCAATTCAGAATGTCTGGGTCTAGC. Clones derived from three independent PCR reactions were sequenced. We note that while this work was in progress, the rat PXR clone was reported by another group (36 ).

Sequence Alignment
The program MVP (37 ) was used to align the PXR sequences with the human PPAR{gamma} sequence. Most of the secondary structure was identified from the x-ray structure of the PPAR{gamma} LBD (11 ). The region between helix-1 and helix-3 failed to give a clear alignment, so the PRISM secondary structure prediction procedure, as implemented in MVP, was used to predict helix-2, helix-2', and ß-strands a and b.

Northern Analysis
Primary human, rabbit, and rat hepatocytes were treated for 24 h with the respective compounds, and total RNA was isolated using Trizol reagent (Life Technologies, Inc.). Rabbit RNA was isolated from normal rabbit tissues using Trizol reagent. Total RNA from each sample (10 µg) was resolved on a 2.2 M formaldehyde denaturing gel. The gels were stained with ethidium bromide to examine for equal loading. The RNA was subsequently transferred onto Nytran nylon membrane from Schleicher & Schuell, Inc. (Keene, NH). Rat blots were purchased from OriGene (Rockville, MD). Blots were hybridized with 32P-labeled CYP3A1, CYP3A4, CYP3A6, rat PXR, or rabbit PXR cDNA probes.

Cotransfection Assays
CV-1 cells were plated in 96-well plates at a density of 20,000 cells per well in high glucose DMEM supplemented with 10% charcoal/dextran-treated FBS (HyClone Laboratories, Inc. Logan, UT). Transfection mixes contained 5 ng of receptor expression vector, 12 ng of reporter plasmid, 25 ng of ß-galactosidase expression vector pCH110 (Amersham Pharmacia Biotech, Piscataway, NJ) as internal control, and 38 ng of carrier plasmid. Human and mouse PXR expression plasmids and the (CYP3A1 DR3)2-tk-CAT reporter were previously described (6 7 ). Transfections were performed with Lipofectamine (Life Technologies, Inc.) essentially according to the manufacturer’s instructions. Drug dilutions were prepared in phenol red-free DMEM/F-12 with 15 mM HEPES supplemented with 10% charcoal-stripped, delipidated calf serum (Sigma). Cells were incubated for 24 h in the presence of drugs, and then cell extracts were prepared and assayed for CAT and ß-galactosidase activities as previously described (30 ).

Primary Hepatocytes
Hepatocytes were isolated from human liver tissue obtained as surgical biopsy samples or from rejected donor livers by the two-step collagenase digestion method (38 ) with minor modifications as previously described (39 ). In most cases, encapsulated liver tissue (25–100 g) was perfused with calcium-free buffer containing 5.5 mM glucose, 5% BSA, ascorbic acid (50 mg/ml), and 0.5 mM EGTA for 10–15 min at a flow rate of 25–35 ml/min followed by perfusion with DMEM containing 1.5 mM calcium, 5% BSA, ascorbic acid (50 mg/ml), and collagenase (0.3–0.4 mg/ml) for 15–20 min. Hepatocytes were dispersed from the digested liver in DMEM containing 5% FBS, insulin (4 µg/ml), and dexamethasone (1 µM) and washed by low-speed centrifugation (70 x g, 4 min). Cell pellets were resuspended in supplemented DMEM and 90% isotonic Percoll (3:1 vol:vol) and centrifuged at 100 x g for 5 min. The resulting pellets were washed with fresh medium by low-speed centrifugation and resuspended in supplemented DMEM. Viability was determined by trypan blue exclusion and was typically between 80 and 90%. Human, rabbit, and rat hepatocytes were cultured according to the method of LeCluyse et al. (39 ). Briefly, approximately 4.5 x 106 hepatocytes were added to 60-mm NUNC Permanox culture dishes coated with a rigid collagen substratum in 3 ml of supplemented DMEM and allowed to attach for 2–4 h at 37 C in a humidified chamber with 95%/5%, air/CO2. Culture dishes were gently swirled and medium containing unattached cells was then aspirated. Fresh ice-cold serum-free modified Chee’s medium containing 0.1 µM dexamethasone, 6.25 µg/ml insulin, 6.25 µg/ml transferrin, and 6.25 ng/ml selenium (ITS+) and 0.25 mg/ml Matrigel were added to each dish and cultures were returned to the humidified chamber (40 ). Medium was changed on a daily basis thereafter. Unless otherwise specified, primary cultures of human, rabbit, and rat hepatocytes were maintained for 36–48 h before treatment with test compounds was initiated.

Synthesis of [3H]SR1281
[3H]SR12813 with a specific activity of 23 Ci/mmol was prepared by Amersham International plc (Cardiff, UK) from [3H]3,5-ditertbutyl-4-hydroxy benzaldehyde by modification of the published procedure (41 ).

Expression of Recombinant Human PXR LBD
The LBD of human PXR (amino acids 130–434) was expressed as an amino-terminal polyhistidine-tagged fusion protein. The PXR LBD was subcloned into the pRSETa bacterial expression vector (Invitrogen, San Diego, CA). Sequence encoding a polyhistidine tag derived from an N-terminal PCR primer (MKKGHHHHHHG) was fused in frame to the PXR LBD. To enhance its solubility, the PXR LBD was coexpressed with an 88-amino acid fragment of SRC-1 (42 43 ). The human SRC-1 expression construct was created by insertion of a fragment of SRC-1 encoding amino acids 623–710 (43 ) flanked by NdeI-BamHI restriction sites into the pACYC184 vector (New England Biolabs, Inc., Beverly, MA) containing the T7 promoter region of the pRSETA vector (Invitrogen). PCR primers were designed to amplify an 88-amino acid region of the human SRC-1 gene (p160), which encodes two of the LXXLL motifs (motifs 1 and 2) along with an N-terminal tag (MKK). The resulting SRC-1/pACYC184 plasmid was cotransformed with PXRLBD/pRSETa into the BL21(DE3) E. coli strain. One-liter shake flask liquid cultures containing standard Luria-Bertani (LB) broth with 0.05 mg/ml ampicillin and 0.05 mg/ml chloramphenicol were inoculated and grown at 22 C for 24 h. The cells were induced with 0.05 mM isopropyl ß-D-thiogalactopyranoside for 4–6 h at 22 C after which the cells were harvested by centrifugation (20 min, 3,500 x g, 4 C). The cell pellet was stored at -80 C. The cell pellet was resuspended in 250 ml buffer A (50 mM Tris-Cl pH 8.0, 250 mM NaCl, 50 mM Imidazole, pH 7.5). Cells were sonicated for 3–5 min on ice and the cell debris was removed by centrifugation (45 min, 20,000 x g, 4 C). The cleared supernatant was filtered through a 0.45 µM filter and loaded on to a 50 ml Ni++-charged ProBond Chelation resin (Invitrogen). After washing to baseline with buffer A, the column was washed with buffer A containing 125 mM Imidazole, pH 7.5. The PXRLBD/SRC-1 complex was eluted from the column using buffer A with 300 mM Imidazole, pH 7.5. Column fractions were pooled and concentrated using Centri-prep 30K (Amicon, Beverly, MA) units. The protein was subjected to size exclusion, using a column (26 mm x 90 cm) packed with Sepharose S-75 resin (Amersham Pharmacia Biotech, Piscataway, NJ) preequilibrated with 20 mM Tris-Cl, pH 8.0, 200 mM NaCl, 5 mM dithiothreitol, 2.5 mM EDTA, pH 8.0. Column fractions were pooled and concentrated.

Scintillation Proximity Binding Assay
A scintillation proximity binding assay (44 ) was developed using purified human PXR/SRC-1. Streptavidin-PVT scintillation proximity assay (SPA) beads (Amersham Pharmacia Biotech RPNQ0007) were suspended in assay buffer (50 mM Tris, pH 8.0, 50 mM KCl, 1 mM EDTA, 1 mM 3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate,1 mM dithiothreitol, 0.1 mg BSA/ml) at 0.5 mg/ml. Biotinylated human PXR was added to a final concentration of 75 nM. The receptor/bead mix was allowed to incubate for 30 min at room temperature. Uncoupled receptor was removed by centrifuging the receptor/bead mixture at 3,000 rpm for 10 min and pouring off the supernatant. The receptor-coupled beads were resuspended in assay buffer. All experiments were run in Packard Optiplates (Packard 6005190, Packard Instruments, Meriden, CT) using 25 µg bead/well and an assay volume of 100 µl. Twelve-point saturation curves were generated in triplicate using 10 µM clotrimazole to define nonspecific binding. [3H]SR12813 was added such that the final concentration of radioligand ranged from 0.5 to 1,000 nM. The Kd value was determined by nonlinear regression. In competition experiments, test compounds were diluted in 100% dimethylsulfoxide and added to the wells in 1 µl-aliquots. [3H]SR12813 was added to a final concentration of 10 nM. The plates were shaken momentarily to ensure complete mixing. After a 2-h incubation at room temperature, the plates were counted on a Packard TopCount, which was programmed to compensate for color quenching.


    ACKNOWLEDGMENTS
 
We thank Tom Consler for biotinylation and analysis of the purified human PXR; Ian Fellows for assistance in the preparation of [3H]SR12813; D. James Coon for assistance with the perfusion of human liver samples and isolation of hepatocytes; and Summer Jolley for assistance with the maintenance and treatment of hepatocyte cultures.


    FOOTNOTES
 
Address requests for reprints to: Steven A. Kliewer, Department of Molecular Endocrinology, Room 3.3124, Glaxo Wellcome Inc. Research and Development, Five Moore Drive, Research Triangle Park, North Carolina 27709.

1 Equal contributions were made by these authors. Back

Received for publication August 27, 1999. Revision received September 21, 1999. Accepted for publication September 28, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Maurel P 1996 The CYP3A family. In: Ioannides C (ed) Cytochromes P450: Metabolic and Toxicological Aspects. CRC Press, Inc., Boca Raton, FL, pp 241–270
  2. Guzelian PS 1988 Regulation of the glucocorticoid-inducible cytochromes P450. In: Miners JO, Birkett DJ, Drew R, McManus M (eds) Microsomes and Drug Oxidations. Taylor and Francis, London, pp 148–155
  3. Kocarek TA, Schuetz EG, Guzelian PS 1993 Regulation of phenobarbital-inducible cytochrome P450 2B1/2 mRNA by lovastatin and oxysterols in primary cultures of adult rat hepatocytes. Toxicol Appl Pharmacol 120:298–307[CrossRef][Medline]
  4. Kocarek TA, Schuetz EG, Strom SC, Fisher RA, Guzelian PS 1995 Comparative analysis of cytochrome P4503A induction in primary cultures of rat, rabbit, and human hepatocyes. Drug Met Dispos 23:415–421[Abstract]
  5. Barwick JL, Quattrochi LC, Mills AS, Potenza C, Tukey RH, Guzelian PS 1996 Trans-species gene transfer for analysis of glucocorticoid-inducible transcriptional activation of transiently expressed human CYP3A4 and rabbit CYP3A6 in primary cultures of adult rat and rabbit hepatocytes. Mol Pharmacol 50:10–16[Abstract]
  6. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB, Willson TM, Zetterstrom RH, Perlmann T, Lehmann JM 1998 An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 92:73–82[CrossRef][Medline]
  7. Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, Kliewer SA 1998 The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest 102:1016–1023[Medline]
  8. Bertilsson G, Heidrich J, Svensson K, Asman M, Jendeberg L, Sydowbackman M, Ohlsson R, Postlind H, Blomquist P, Berkenstam A 1998 Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad USA 95:12208–12213[Abstract/Free Full Text]
  9. Blumberg B, Sabbagh W, Juguilon H, Bolado J, Vanmeter CM, Ong E, Evans RM 1998 SXR, a novel steroid and xenobiotic sensing nuclear receptor. Genes Dev 12:3195–3205[Abstract/Free Full Text]
  10. Schuetz EG, Brimer C, Schuetz JD 1998 Environmental xenobiotics and the antihormones cyproterone acetate and spironolactone use the nuclear hormone receptor pregnenolone X receptor to activate the CYP3A23 hormone response element. Mol Pharmacol 54:1113–1117[Abstract/Free Full Text]
  11. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–143[CrossRef][Medline]
  12. Uppenberg J, Svensson C, Jaki M, Bertilsson G, Jendeberg L, Berkenstam A 1998 Crystal structure of the ligand binding domain of the human nuclear receptor PPAR{gamma}. J Biol Chem 273:31108–31112[Abstract/Free Full Text]
  13. Xu HE, Lambert MH, Montana VG, Parks DJ, Blanchard SG, Brown PJ, Sternbach DD, Lehmann JM, Wisely GB, Willson TM, Kliewer SA, Milburn MV 1999 Molecular recognition of fatty acids by peroxisome proliferator-activated receptors. Mol Cell 3:397–403[CrossRef][Medline]
  14. Kliewer SA, Willson TM 1998 The nuclear receptor PPAR{gamma} - bigger than fat. Curr Opin Gen Dev 8:576–581[CrossRef][Medline]
  15. Michalets EL 1998 Update: clinically significant cytochrome P-450 drug interactions. Pharmacotherapy 18:84–112[Medline]
  16. Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
  17. Boehm MF, Zhang L, Badea BA, White SK, Mais DE, Berger E, Suto CM, Goldman ME, Heyman RA 1994 Synthesis and structure-activity relationships of novel retinoid X receptor-selective retinoids. J Med Chem 37:2930–2941[CrossRef][Medline]
  18. Boehm MF, Zhang L, Zhi L, McClurg MR, Berger E, Wagoner M, Mais DE, Suto CM, Davies JA, Heyman RA 1995 Design and synthesis of potent retinoid X receptor selective ligands that induce apoptosis in leukemia cells. J Med Chem 38:3146–3155[CrossRef][Medline]
  19. Berkhout TA, Simon HM, Patel DD, Bentzen C, Niesor E, Jackson B, Suckling KE 1996 The novel cholesterol-lowering drug SR-12813 inhibits cholesterol synthesis via an increased degradation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase. J Biol Chem 271:14376–14382[Abstract/Free Full Text]
  20. Berkhout TA, Simon HM, Jackson B, Yates J, Pearce N, Groot PH, Bentzen C, Niesor E, Kerns WD, Suckling KE 1997 SR-12813 lowers plasma cholesterol in beagle dogs by decreasing cholesterol biosynthesis. Atherosclerosis 133:203–212[CrossRef][Medline]
  21. Williams JA, Chenery RJ, Berkhout TA, Hawksworth GM 1997 Induction of cytochrome P4503A by the antiglucocorticoid mifepristone and a novel hypocholesterolaemic drug. Drug Metab Dispos 25:757–761[Abstract/Free Full Text]
  22. Honkakoski P, Zelko I, Sueyoshi T, Negishi M 1998 The nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital-responsive enhancer module of the CYP2B gene. Mol Cell Biol 18:5652–5658[Abstract/Free Full Text]
  23. Bogan AA, Cohen FE, Scanlan TS 1998 Natural ligands of nuclear receptors have conserved volumes. Nat Struct Biol 5:679–681[CrossRef][Medline]
  24. Weigel NL, Zhang Y 1998 Ligand-independent activation of steroid hormone receptors. J Mol Med 76:469–479[CrossRef][Medline]
  25. Turley SD, Dietschy JM 1984 Modulation of the stimulatory effect of pregnenolone-16{alpha}-carbonitrile on biliary cholesterol output in the rat by the manipulation of the rate of hepatic cholesterol synthesis. Gastroenterology 87:284–292[Medline]
  26. Niesor EJ, Flach J, Weinberger C, Bentzen CL 1999 Syntheic farnesoid X receptor (FXR) agonists: a new class of cholesterol synthesis inhibitors and antiproliferative drugs. Drugs Future 24:431–438[CrossRef]
  27. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM 1999 Bile acids: natural ligands for an orphan nuclear receptor. Science 284:1365–1368[Abstract/Free Full Text]
  28. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned M, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B 1999 Identification of a nuclear receptor for bile acids. Science 284:1362–1365[Abstract/Free Full Text]
  29. Wang H, Chen J, Hollister K, Sowers LC, Forman BM 1999 Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 3:543–553[Medline]
  30. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  31. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM 1996 The structure-activity relationship between peroxisome proliferator-activated receptor {gamma} agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665–668[CrossRef][Medline]
  32. Watkins PB, Whitcomb RW 1998 Hepatic dysfunction associated with troglitazone. N Engl J Med 338:916–917[Free Full Text]
  33. 1998 Physicians Desk Reference. Medical Economics Data, Montvale, NJ
  34. Durand F, Jebrak G, Pessayre D, Founier M, Berneau J 1996 Hepatotoxicity of antitubercular treatments. Rationale for monitoring liver status. Drug Safety 15:394–405[Medline]
  35. Mukherjee R, Davies PJA, Crombie DL, Bischoff ED, Cesario RM, Jow L, Hamann LG, Boehm MF, Mondon CE, Nadzan AM, Paterniti Jr JR, Heyman RA 1997 Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature 386:407–410[CrossRef][Medline]
  36. Zhang H, LeCluyse E, Liu L, Hu M, Matoney L, Zhu W, Yan B 1999 Rat pregnane X receptor: molecular cloning, tissue distribution, and xenobiotic regulation. Arch Biochem Biophys 368:14–22[CrossRef][Medline]
  37. Lambert MH 1997 Docking conformationally flexible molecules into protein binding sites. In: Charifson PS (ed) Practical Application of Computer-Aided Drug Design. Marcel-Dekker, New York, pp 243–303
  38. Li AP, Roque MA, Beck DJ, Kaminski DL 1992 Isolation and culturing of hepatocytes from human livers. J Tissue Culture Methods 14:139–146
  39. LeCluyse E, Bullock P, Parkinson A, Hochman JH 1996 Cultured rat hepatocytes. In: Borchardt RT, Wilson G, Smith P (eds) Model Systems for Biopharmaceutical Assessment of Drug Absorption and Metabolism. Plenum, New York, pp 121–159
  40. Sidhu JS, Farin FM, Omiecinski CJ 1993 Influence of extracellular matrix overlay on phenobarbital-mediated induction of CYP2B1, 2B2, and 3A1 genes in primary adult rat hepatocyte culture. Arch Biochem Biophys 30:103–113
  41. Nguyen LM, Niesor E, Phan HT, Maechler P, Bentzen CL Phenol substituted gem-biphosphonate derivatives, process for their preparation, pharmaceutical compositions containing them. US Patent 9011247
  42. Onate SA, Tsai SY, Tsai M-J, O’Malley BM 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  43. Takeshita A, Yen PM, Misiti S, Cardona GR, Liu Y, Chin WW 1996 Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology 137:3594–3597[Abstract]
  44. Nichols JS, Parks DJ, Consler TG, Blanchard SG 1998 Development of a scintillation proximity assay for peroxisome proliferator-activated receptor gamma ligand binding domain. Anal Biochem 257:112–119[CrossRef][Medline]



This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
Y. S. Lin, K. Yasuda, M. Assem, C. Cline, J. Barber, C.-W. Li, V. Kholodovych, N. Ai, J. D. Chen, W. J. Welsh, et al.
The Major Human Pregnane X Receptor (PXR) Splice Variant, PXR.2, Exhibits Significantly Diminished Ligand-Activated Transcriptional Regulation
Drug Metab. Dispos., June 1, 2009; 37(6): 1295 - 1304.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y. Li, J. S. Ross-Viola, N. F. Shay, D. D. Moore, and M.-L. Ricketts
Human CYP3A4 and Murine Cyp3A11 Are Regulated by Equol and Genistein via the Pregnane X Receptor in a Species-Specific Manner
J. Nutr., May 1, 2009; 139(5): 898 - 904.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
Z. Duniec-Dmuchowski, H.-L. Fang, S. C. Strom, E. Ellis, M. Runge-Morris, and T. A. Kocarek
Human Pregnane X Receptor Activation and CYP3A4/CYP2B6 Induction by 2,3-Oxidosqualene:Lanosterol Cyclase Inhibition
Drug Metab. Dispos., April 1, 2009; 37(4): 900 - 908.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Ott, G. Fricker, and B. Bauer
Pregnane X Receptor (PXR) Regulates P-Glycoprotein at the Blood-Brain Barrier: Functional Similarities between Pig and Human PXR
J. Pharmacol. Exp. Ther., April 1, 2009; 329(1): 141 - 149.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. Toriyabe, K. Nagata, T. Takada, Y. Aratsu, T. Matsubara, K. Yoshinari, and Y. Yamazoe
Unveiling a New Essential Cis Element for the Transactivation of the CYP3A4 Gene by Xenobiotics
Mol. Pharmacol., March 1, 2009; 75(3): 677 - 684.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
X. Ma, C. Cheung, K. W. Krausz, Y. M. Shah, T. Wang, J. R. Idle, and F. J. Gonzalez
A Double Transgenic Mouse Model Expressing Human Pregnane X Receptor and Cytochrome P450 3A4
Drug Metab. Dispos., December 1, 2008; 36(12): 2506 - 2512.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
M. Shou, M. Hayashi, Y. Pan, Y. Xu, K. Morrissey, L. Xu, and G. L. Skiles
Modeling, Prediction, and in Vitro in Vivo Correlation of CYP3A4 Induction
Drug Metab. Dispos., November 1, 2008; 36(11): 2355 - 2370.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Cheung and F. J. Gonzalez
Humanized Mouse Lines and Their Application for Prediction of Human Drug Metabolism and Toxicological Risk Assessment
J. Pharmacol. Exp. Ther., November 1, 2008; 327(2): 288 - 299.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
E. Y. H. Yeung, T. Sueyoshi, M. Negishi, and T. K. H. Chang
Identification of Ginkgo biloba as a Novel Activator of Pregnane X Receptor
Drug Metab. Dispos., November 1, 2008; 36(11): 2270 - 2276.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pettersson, N. Hanna, M. Lagodich, D. Dupere-Richer, M.-C. Couture, C. Choi, and W. H. Miller Jr.
Rexinoids Modulate Steroid and Xenobiotic Receptor Activity by Increasing Its Protein Turnover in a Calpain-dependent Manner
J. Biol. Chem., August 8, 2008; 283(32): 21945 - 21952.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. S. Miller, B. Bauer, and A. M. S. Hartz
Modulation of P-Glycoprotein at the Blood-Brain Barrier: Opportunities to Improve Central Nervous System Pharmacotherapy
Pharmacol. Rev., June 1, 2008; 60(2): 196 - 209.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Wang, H. Li, L. B. Moore, M. D. L. Johnson, J. M. Maglich, B. Goodwin, O. R. R. Ittoop, B. Wisely, K. Creech, D. J. Parks, et al.
The Phytoestrogen Coumestrol Is a Naturally Occurring Antagonist of the Human Pregnane X Receptor
Mol. Endocrinol., April 1, 2008; 22(4): 838 - 857.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
K. Kohalmy, V. Tamasi, L. Kobori, E. Sarvary, J.-M. Pascussi, P. Porrogi, D. Rozman, R. A. Prough, U. A. Meyer, and K. Monostory
Dehydroepiandrosterone Induces Human CYP2B6 through the Constitutive Androstane Receptor
Drug Metab. Dispos., September 1, 2007; 35(9): 1495 - 1501.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
G. Lemaire, C. Benod, V. Nahoum, A. Pillon, A.-M. Boussioux, J.-F. Guichou, G. Subra, J.-M. Pascussi, W. Bourguet, A. Chavanieu, et al.
Discovery of a Highly Active Ligand of Human Pregnane X Receptor: A Case Study from Pharmacophore Modeling and Virtual Screening to "In Vivo" Biological Activity
Mol. Pharmacol., September 1, 2007; 72(3): 572 - 581.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
L. Cerveny, L. Svecova, E. Anzenbacherova, R. Vrzal, F. Staud, Z. Dvorak, J. Ulrichova, P. Anzenbacher, and P. Pavek
Valproic Acid Induces CYP3A4 and MDR1 Gene Expression by Activation of Constitutive Androstane Receptor and Pregnane X Receptor Pathways
Drug Metab. Dispos., July 1, 2007; 35(7): 1032 - 1041.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
C. G. Woods, J. P. Vanden Heuvel, and I. Rusyn
Genomic Profiling in Nuclear Receptor-Mediated Toxicity
Toxicol Pathol, June 1, 2007; 35(4): 474 - 494.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
E. K. Pacyniak, X. Cheng, M. L. Cunningham, K. Crofton, C. D. Klaassen, and G. L. Guo
The Flame Retardants, Polybrominated Diphenyl Ethers, Are Pregnane X Receptor Activators
Toxicol. Sci., May 1, 2007; 97(1): 94 - 102.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Xue, L. B. Moore, J. Orans, L. Peng, S. Bencharit, S. A. Kliewer, and M. R. Redinbo
Crystal Structure of the Pregnane X Receptor-Estradiol Complex Provides Insights into Endobiotic Recognition
Mol. Endocrinol., May 1, 2007; 21(5): 1028 - 1038.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
X. Ma, Y. Shah, C. Cheung, G. L. Guo, L. Feigenbaum, K. W. Krausz, J. R. Idle, and F. J. Gonzalez
The Pregnane X Receptor Gene-Humanized Mouse: A Model for Investigating Drug-Drug Interactions Mediated by Cytochromes P450 3A
Drug Metab. Dispos., February 1, 2007; 35(2): 194 - 200.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Y. Ung, H. Li, C. W. Yap, and Y. Z. Chen
In Silico Prediction of Pregnane X Receptor Activators by Machine Learning Approache
Mol. Pharmacol., January 1, 2007; 71(1): 158 - 168.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Zhou, E.-J. Poulton, F. Grun, T. K. Bammler, B. Blumberg, K. E. Thummel, and D. L. Eaton
The Dietary Isothiocyanate Sulforaphane Is an Antagonist of the Human Steroid and Xenobiotic Nuclear Receptor
Mol. Pharmacol., January 1, 2007; 71(1): 220 - 229.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. N. Urs, E. Dammer, and M. B. Sewer
Sphingosine Regulates the Transcription of CYP17 by Binding to Steroidogenic Factor-1
Endocrinology, November 1, 2006; 147(11): 5249 - 5258.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
P. He, M. H. Court, D. J. Greenblatt, and L. L. von Moltke
Human Pregnane X Receptor: Genetic Polymorphisms, Alternative mRNA Splice Variants, and Cytochrome P450 3A Metabolic Activity.
J. Clin. Pharmacol., November 1, 2006; 46(11): 1356 - 1369.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Bauer, X. Yang, A. M. S. Hartz, E. R. Olson, R. Zhao, J. C. Kalvass, G. M. Pollack, and D. S. Miller
In Vivo Activation of Human Pregnane X Receptor Tightens the Blood-Brain Barrier to Methadone through P-Glycoprotein Up-Regulation
Mol. Pharmacol., October 1, 2006; 70(4): 1212 - 1219.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B.-L. Song and R. A. DeBose-Boyd
Insig-dependent Ubiquitination and Degradation of 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase Stimulated by {delta}- and {gamma}-Tocotrienols
J. Biol. Chem., September 1, 2006; 281(35): 25054 - 25061.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Jung, D. J. Mangelsdorf, and U. A. Meyer
Pregnane X Receptor Is a Target of Farnesoid X Receptor
J. Biol. Chem., July 14, 2006; 281(28): 19081 - 19091.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. Wang, A. J. Mendy, G. Dai, H.-R. Luo, L. He, and Y.-J. Y. Wan
Retinoids Activate the RXR/SXR-Mediated Pathway and Induce the Endogenous CYP3A4 Activity in Huh7 Human Hepatoma Cells
Toxicol. Sci., July 1, 2006; 92(1): 51 - 60.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
G. Lemaire, W. Mnif, J.-M. Pascussi, A. Pillon, F. Rabenoelina, H. Fenet, E. Gomez, C. Casellas, J.-C. Nicolas, V. Cavailles, et al.
Identification of New Human Pregnane X Receptor Ligands among Pesticides Using a Stable Reporter Cell System
Toxicol. Sci., June 1, 2006; 91(2): 501 - 509.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. R. Johnson, C.-W. Li, L.-Y. Chen, J. C. Ghosh, and J. D. Chen
Regulation and Binding of Pregnane X Receptor by Nuclear Receptor Corepressor Silencing Mediator of Retinoid and Thyroid Hormone Receptors (SMRT)
Mol. Pharmacol., January 1, 2006; 69(1): 99 - 108.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Orans, D. G. Teotico, and M. R. Redinbo
The Nuclear Xenobiotic Receptor Pregnane X Receptor: Recent Insights and New Challenges
Mol. Endocrinol., December 1, 2005; 19(12): 2891 - 2900.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. J. Komoroski, R. A. Parise, M. J. Egorin, S. C. Strom, and R. Venkataramanan
Effect of the St. John's Wort Constituent Hyperforin on Docetaxel Metabolism by Human Hepatocyte Cultures
Clin. Cancer Res., October 1, 2005; 11(19): 6972 - 6979.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
K. Kobayashi, Y. Yamanaka, N. Iwazaki, I. Nakajo, M. Hosokawa, M. Negishi, and K. Chiba
IDENTIFICATION OF HMG-CoA REDUCTASE INHIBITORS AS ACTIVATORS FOR HUMAN, MOUSE AND RAT CONSTITUTIVE ANDROSTANE RECEPTOR
Drug Metab. Dispos., July 1, 2005; 33(7): 924 - 929.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. M. Maher, X. Cheng, A. L. Slitt, M. Z. Dieter, and C. D. Klaassen
INDUCTION OF THE MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN FAMILY OF TRANSPORTERS BY CHEMICAL ACTIVATORS OF RECEPTOR-MEDIATED PATHWAYS IN MOUSE LIVER
Drug Metab. Dispos., July 1, 2005; 33(7): 956 - 962.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. D. Krasowski, K. Yasuda, L. R. Hagey, and E. G. Schuetz
Evolution of the Pregnane X Receptor: Adaptation to Cross-Species Differences in Biliary Bile Salts
Mol. Endocrinol., July 1, 2005; 19(7): 1720 - 1739.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
O. Burk, K. A. Arnold, A. K. Nussler, E. Schaeffeler, E. Efimova, B. A. Avery, M. A. Avery, M. F. Fromm, and M. Eichelbaum
Antimalarial Artemisinin Drugs Induce Cytochrome P450 and MDR1 Expression by Activation of Xenosensors Pregnane X Receptor and Constitutive Androstane Receptor
Mol. Pharmacol., June 1, 2005; 67(6): 1954 - 1965.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
C. Tang, J. H. Lin, and A. Y. H. Lu
METABOLISM-BASED DRUG-DRUG INTERACTIONS: WHAT DETERMINES INDIVIDUAL VARIABILITY IN CYTOCHROME P450 INDUCTION?
Drug Metab. Dispos., May 1, 2005; 33(5): 603 - 613.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. E. Chrencik, J. Orans, L. B. Moore, Y. Xue, L. Peng, J. L. Collins, G. B. Wisely, M. H. Lambert, S. A. Kliewer, and M. R. Redinbo
Structural Disorder in the Complex of Human Pregnane X Receptor and the Macrolide Antibiotic Rifampicin
Mol. Endocrinol., May 1, 2005; 19(5): 1125 - 1134.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. V. Boekschoten, M. K. Hofman, R. Buytenhek, E. G. Schouten, H. M. G. Princen, and M. B. Katan
Coffee Oil Consumption Increases Plasma Levels of 7{alpha}-Hydroxy-4-cholesten-3-one in Humans
J. Nutr., April 1, 2005; 135(4): 785 - 789.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
B. Bauer, A. M. S. Hartz, G. Fricker, and D. S. Miller
Modulation of p-Glycoprotein Transport Function at the Blood-Brain Barrier
Experimental Biology and Medicine, February 1, 2005; 230(2): 118 - 127.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
N. Hariparsad, S. C. Nallani, R. S. Sane, D. J. Buckley, A. R. Buckley, and P. B. Desai
Induction of CYP3A4 by Efavirenz in Primary Human Hepatocytes: Comparison With Rifampin and Phenobarbital
J. Clin. Pharmacol., November 1, 2004; 44(11): 1273 - 1281.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. Yoshinari, T. Sato, N. Okino, J. Sugatani, and M. Miwa
Expression and Induction of Cytochromes P450 in Rat White Adipose Tissue
J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 147 - 154.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
C. Zhou, M. M. Tabb, A. Sadatrafiei, F. Grun, and B. Blumberg
TOCOTRIENOLS ACTIVATE THE STEROID AND XENOBIOTIC RECEPTOR, SXR, AND SELECTIVELY REGULATE EXPRESSION OF ITS TARGET GENES
Drug Metab. Dispos., October 1, 2004; 32(10): 1075 - 1082.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
Z. Zhu, S. Kim, T. Chen, J.-H. Lin, A. Bell, J. Bryson, Y. Dubaquie, N. Yan, J. Yanchunas, D. Xie, et al.
Correlation of High-Throughput Pregnane X Receptor (PXR) Transactivation and Binding Assays
J Biomol Screen, September 1, 2004; 9(6): 533 - 540.
[Abstract] [PDF]


Home page
Mol. Pharmacol.Home page
B. Bauer, A. M. S. Hartz, G. Fricker, and D. S. Miller
Pregnane X Receptor Up-Regulation of P-Glycoprotein Expression and Transport Function at the Blood-Brain Barrier
Mol. Pharmacol., September 1, 2004; 66(3): 413 - 419.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Podvinec, C. Handschin, R. Looser, and U. A. Meyer
Identification of the xenosensors regulating human 5-aminolevulinate synthase
PNAS, June 15, 2004; 101(24): 9127 - 9132.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K.-O. Chang, S. V. Sosnovtsev, G. Belliot, Y. Kim, L. J. Saif, and K. Y. Green
Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1
PNAS, June 8, 2004; 101(23): 8733 - 8738.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. P. Hartley, X. Dai, Y. D. He, E. J. Carlini, B. Wang, S.-e. W. Huskey, R. G. Ulrich, T. H. Rushmore, R. Evers, and D. C. Evans
Activators of the Rat Pregnane X Receptor Differentially Modulate Hepatic and Intestinal Gene Expression
Mol. Pharmacol., May 1, 2004; 65(5): 1159 - 1171.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
K. Kobayashi, S. Yamagami, T. Higuchi, M. Hosokawa, and K. Chiba
KEY STRUCTURAL FEATURES OF LIGANDS FOR ACTIVATION OF HUMAN PREGNANE X RECEPTOR
Drug Metab. Dispos., April 1, 2004; 32(4): 468 - 472.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. R. Faucette, H. Wang, G. A. Hamilton, S. L. Jolley, D. Gilbert, C. Lindley, B. Yan, M. Negishi, and E. L. LeCluyse
REGULATION OF CYP2B6 IN PRIMARY HUMAN HEPATOCYTES BY PROTOTYPICAL INDUCERS
Drug Metab. Dispos., March 1, 2004; 32(3): 348 - 358.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Roitelman, D. Masson, R. Avner, C. Ammon-Zufferey, A. Perez, Y. Guyon-Gellin, C. L. Bentzen, and E. J. Niesor
Apomine, a Novel Hypocholesterolemic Agent, Accelerates Degradation of 3-Hydroxy-3-methylglutaryl-coenzyme A Reductase and Stimulates Low Density Lipoprotein Receptor Activity
J. Biol. Chem., February 20, 2004; 279(8): 6465 - 6473.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
W. Zhang, A. F. Purchio, R. Coffee, and D. B. West
DIFFERENTIAL REGULATION OF THE HUMAN CYP3A4 PROMOTER IN TRANSGENIC MICE AND RATS
Drug Metab. Dispos., February 1, 2004; 32(2): 163 - 167.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. Koyano, K. Kurose, Y. Saito, S. Ozawa, R. Hasegawa, K. Komamura, K. Ueno, S. Kamakura, M. Kitakaze, T. Nakajima, et al.
FUNCTIONAL CHARACTERIZATION OF FOUR NATURALLY OCCURRING VARIANTS OF HUMAN PREGNANE X RECEPTOR (PXR): ONE VARIANT CAUSES DRAMATIC LOSS OF BOTH DNA BINDING ACTIVITY AND THE TRANSACTIVATION OF THE CYP3A4 PROMOTER/ENHANCER REGION
Drug Metab. Dispos., January 1, 2004; 32(1): 149 - 154.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. G. Tirona, B. F. Leake, L. M. Podust, and R. B. Kim
Identification of Amino Acids in Rat Pregnane X Receptor that Determine Species-Specific Activation
Mol. Pharmacol., January 1, 2004; 65(1): 36 - 44.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C. Handschin and U. A. Meyer
Induction of Drug Metabolism: The Role of Nuclear Receptors
Pharmacol. Rev., December 1, 2003; 55(4): 649 - 673.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Luo, R. Sladek, J. Carrier, J.-A. Bader, D. Richard, and V. Giguere
Reduced Fat Mass in Mice Lacking Orphan Nuclear Receptor Estrogen-Related Receptor {alpha}
Mol. Cell. Biol., November 15, 2003; 23(22): 7947 - 7956.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Tabb, A. Sun, C. Zhou, F. Grun, J. Errandi, K. Romero, H. Pham, S. Inoue, S. Mallick, M. Lin, et al.
Vitamin K2 Regulation of Bone Homeostasis Is Mediated by the Steroid and Xenobiotic Receptor SXR
J. Biol. Chem., November 7, 2003; 278(45): 43919 - 43927.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
W. Zhang, A. F. Purchio, K. Chen, J. Wu, L. Lu, R. Coffee, P. R. Contag, and D. B. West
A TRANSGENIC MOUSE MODEL WITH A LUCIFERASE REPORTER FOR STUDYING IN VIVO TRANSCRIPTIONAL REGULATION OF THE HUMAN CYP3A4 GENE
Drug Metab. Dispos., August 1, 2003; 31(8): 1054 - 1064.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. M. Maglich, J. A. Caravella, M. H. Lambert, T. M. Willson, J. T. Moore, and L. Ramamurthy
The first completed genome sequence from a teleost fish (Fugu rubripes) adds significant diversity to the nuclear receptor superfamily
Nucleic Acids Res., July 15, 2003; 31(14): 4051 - 4058.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
T. K. Tippin, G. Hamilton, L. Moore, E. J. Beaudet, S. Jolley, T. A. Brodie, R. C. Andrews, J. D. Becherer, D. L. McDougald, M. D. Gaul, et al.
CYP3A INDUCTION BY N-HYDROXYFORMAMIDE TUMOR NECROSIS FACTOR-{alpha} CONVERTING ENZYME/MATRIX METALLOPROTEINASE INHIBITORS: USE OF A PREGNANE X RECEPTOR ACTIVATION ASSAY AND PRIMARY HEPATOCYTE CULTURE FOR ASSESSING INDUCTION POTENTIAL IN HUMANS
Drug Metab. Dispos., July 1, 2003; 31(7): 870 - 877.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. A. Kliewer
The Nuclear Pregnane X Receptor Regulates Xenobiotic Detoxification
J. Nutr., July 1, 2003; 133(7): 2444S - 2447.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. K. Whitfield, H. T. L. Dang, S. F. Schluter, R. M. Bernstein, T. Bunag, L. A. Manzon, G. Hsieh, C. Encinas Dominguez, J. H. Youson, M. R. Haussler, et al.
Cloning of a Functional Vitamin D Receptor from the Lamprey (Petromyzon marinus), an Ancient Vertebrate Lacking a Calcified Skeleton and Teeth
Endocrinology, June 1, 2003; 144(6): 2704 - 2716.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Maglich, D. J. Parks, L. B. Moore, J. L. Collins, B. Goodwin, A. N. Billin, C. A. Stoltz, S. A. Kliewer, M. H. Lambert, T. M. Willson, et al.
Identification of a Novel Human Constitutive Androstane Receptor (CAR) Agonist and Its Use in the Identification of CAR Target Genes
J. Biol. Chem., May 2, 2003; 278(19): 17277 - 17283.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. L. Raucy
Regulation of CYP3A4 Expression in Human Hepatocytes by Pharmaceuticals and Natural Products
Drug Metab. Dispos., May 1, 2003; 31(5): 533 - 539.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. C. Nallani, B. Goodwin, J. M. Maglich, D. J. Buckley, A. R. Buckley, and P. B. Desai
Induction of Cytochrome P450 3A by Paclitaxel in Mice: Pivotal Role of the Nuclear Xenobiotic Receptor, Pregnane X Receptor
Drug Metab. Dispos., May 1, 2003; 31(5): 681 - 684.
[Abstract] [Full Text] [PDF]


Home page
International Journal of ToxicologyHome page
M. R. Lee, Y. J. Kim, D. Y. Hwang, T. S. Kang, J. H. Hwang, C. H. Lim, H. K. Kang, J. S. Goo, H. J. Lim, K. S. Ahn, et al.
An In Vitro Bioassay for Xenobiotics Using the SXR-Driven Human CYP3A4/lac Z Reporter Gene
International Journal of Toxicology, May 1, 2003; 22(3): 207 - 213.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M.-F. Yueh, Y.-H. Huang, A. Hiller, S. Chen, N. Nguyen, and R. H. Tukey
Involvement of the Xenobiotic Response Element (XRE) in Ah Receptor-mediated Induction of Human UDP-glucuronosyltransferase 1A1
J. Biol. Chem., April 18, 2003; 278(17): 15001 - 15006.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. Sahi, C. B. Black, G. A. Hamilton, X. Zheng, S. Jolley, K. A. Rose, D. Gilbert, E. L. LeCluyse, and M. W. Sinz
Comparative Effects of Thiazolidinediones on in Vitro P450 Enzyme Induction and Inhibition
Drug Metab. Dispos., April 1, 2003; 31(4): 439 - 446.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kawamata, R. Fujii, M. Hosoya, M. Harada, H. Yoshida, M. Miwa, S. Fukusumi, Y. Habata, T. Itoh, Y. Shintani, et al.
A G Protein-coupled Receptor Responsive to Bile Acids
J. Biol. Chem., March 7, 2003; 278(11): 9435 - 9440.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Dussault, H.-D. Yoo, M. Lin, E. Wang, M. Fan, A. K. Batta, G. Salen, S. K. Erickson, and B. M. Forman
Identification of an endogenous ligand that activates pregnane X receptor-mediated sterol clearance
PNAS, February 4, 2003; 100(3): 833 - 838.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Goodwin, K. C. Gauthier, M. Umetani, M. A. Watson, M. I. Lochansky, J. L. Collins, E. Leitersdorf, D. J. Mangelsdorf, S. A. Kliewer, and J. J. Repa
Identification of bile acid precursors as endogenous ligands for the nuclear xenobiotic pregnane X receptor
PNAS, January 7, 2003; 100(1): 223 - 228.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
T. A. Kocarek, M. S. Dahn, H. Cai, S. C. Strom, and N. A. Mercer-Haines
Regulation of CYP2B6 and CYP3A Expression by Hydroxymethylglutaryl Coenzyme A Inhibitors in Primary Cultured Human Hepatocytes
Drug Metab. Dispos., December 1, 2002; 30(12): 1400 - 1405.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. A. Kliewer, B. Goodwin, and T. M. Willson
The Nuclear Pregnane X Receptor: A Key Regulator of Xenobiotic Metabolism
Endocr. Rev., October 1, 2002; 23(5): 687 - 702.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. Raucy, L. Warfe, M.-F. Yueh, and S. W. Allen
A Cell-Based Reporter Gene Assay for Determining Induction of CYP3A4 in a High-Volume System
J. Pharmacol. Exp. Ther., October 1, 2002; 303(1): 412 - 423.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Takeshita, M. Taguchi, N. Koibuchi, and Y. Ozawa
Putative Role of the Orphan Nuclear Receptor SXR (Steroid and Xenobiotic Receptor) in the Mechanism of CYP3A4 Inhibition by Xenobiotics
J. Biol. Chem., August 30, 2002; 277(36): 32453 - 32458.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Handschin, M. Podvinec, R. Amherd, R. Looser, J.-C. Ourlin, and U. A. Meyer
Cholesterol and Bile Acids Regulate Xenosensor Signaling in Drug-mediated Induction of Cytochromes P450
J. Biol. Chem., August 9, 2002; 277(33): 29561 - 29567.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
H. Xiong, K. Yoshinari, K. L. R. Brouwer, and M. Negishi
Role of Constitutive Androstane Receptor in the In Vivo Induction of Mrp3 and CYP2B1/2 by Phenobarbital
Drug Metab. Dispos., August 1, 2002; 30(8): 918 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. L. Raucy, L. Mueller, K. Duan, S. W. Allen, S. Strom, and J. M. Lasker
Expression and Induction of CYP2C P450 Enzymes in Primary Cultures of Human Hepatocytes
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 475 - 482.
[Abstract] [Full Text] [PDF]


Home page
Hum Exp ToxicolHome page
J D Tugwood and C T Montague
Biology and toxicology of PPARg ligands
Human and Experimental Toxicology, August 1, 2002; 21(8): 429 - 437.
[Abstract] [PDF]


Home page
Drug Metab. Dispos.Home page
G. Luo, M. Cunningham, S. Kim, T. Burn, J. Lin, M. Sinz, G. Hamilton, C. Rizzo, S. Jolley, D. Gilbert, et al.
CYP3A4 Induction by Drugs: Correlation between a Pregnane X Receptor Reporter Gene Assay and CYP3A4 Expression in Human Hepatocytes
Drug Metab. Dispos., July 1, 2002; 30(7): 795 - 804.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Wu, C. Xia, J. Meier, S. Li, X. Hu, and D. S. Lala
The Hypolipidemic Natural Product Guggulsterone Acts as an Antagonist of the Bile Acid Receptor
Mol. Endocrinol., July 1, 2002; 16(7): 1590 - 1597.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. M. Willson and J. T. Moore
Minireview: Genomics Versus Orphan Nuclear Receptors--A Half-Time Report
Mol. Endocrinol., June 1, 2002; 16(6): 1135 - 1144.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. R. Johnson and C. D. Klaassen
Regulation of Rat Multidrug Resistance Protein 2 by Classes of Prototypical Microsomal Enzyme Inducers That Activate Distinct Transcription Pathways
Toxicol. Sci., June 1, 2002; 67(2): 182 - 189.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. L. Ripp, J. L. Fitzpatrick, J. M. Peters, and R. A. Prough
Induction of CYP3A Expression by Dehydroepiandrosterone: Involvement of the Pregnane X Receptor
Drug Metab. Dispos., May 1, 2002; 30(5): 570 - 575.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
P. B. Desai, S. C. Nallani, R. S. Sane, L. B. Moore, B. J. Goodwin, D. J. Buckley, and A. R. Buckley
Induction of Cytochrome P450 3A4 in Primary Human Hepatocytes and Activation of the Human Pregnane X Receptor by Tamoxifen and 4-Hydroxytamoxifen
Drug Metab. Dispos., May 1, 2002; 30(5): 608 - 612.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. B. Moore, J. M. Maglich, D. D. McKee, B. Wisely, T. M. Willson, S. A. Kliewer, M. H. Lambert, and J. T. Moore
Pregnane X Receptor (PXR), Constitutive Androstane Receptor (CAR), and Benzoate X Receptor (BXR) Define Three Pharmacologically Distinct Classes of Nuclear Receptors
Mol. Endocrinol., May 1, 2002; 16(5): 977 - 986.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
G. L. Guo, J. Staudinger, K. Ogura, and C. D. Klaassen
Induction of Rat Organic Anion Transporting Polypeptide 2 by Pregnenolone-16alpha -carbonitrile Is via Interaction with Pregnane X Receptor
Mol. Pharmacol., April 1, 2002; 61(4): 832 - 839.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
G. L. Guo, D. R. Johnson, and C. D. Klaassen
Postnatal Expression and Induction by Pregnenolone-16alpha -Carbonitrile of the Organic Anion-Transporting Polypeptide 2 in Rat Liver
Drug Metab. Dispos., March 1, 2002; 30(3): 283 - 288.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. A. Kliewer and T. M. Willson
Regulation of xenobiotic and bile acid metabolism by the nuclear pregnane X receptor
J. Lipid Res., March 1, 2002; 43(3): 359 - 364.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. Ekins and J. A. Erickson
A Pharmacophore for Human Pregnane X Receptor Ligands
Drug Metab. Dispos., January 1, 2002; 30(1): 96 - 99.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. L. Guo, S. Choudhuri, and C. D. Klaassen
Induction Profile of Rat Organic Anion Transporting Polypeptide 2 (oatp2) by Prototypical Drug-Metabolizing Enzyme Inducers That Activate Gene Expression through Ligand-Activated Transcription Factor Pathways
J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 206 - 212.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
E. Hustert, A. Zibat, E. Presecan-Siedel, R. Eiselt, R. Mueller, C. Fu{beta}, I. Brehm, U. Brinkmann, M. Eichelbaum, L. Wojnowski, et al.
Natural Protein Variants of Pregnane X Receptor with Altered Transactivation Activity Toward CYP3A4
Drug Metab. Dispos., November 1, 2001; 29(11): 1454 - 1459.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. Staudinger, Y. Liu, A. Madan, S. Habeebu, and C. D. Klaassen
Coordinate Regulation of Xenobiotic and Bile Acid Homeostasis by Pregnane X Receptor
Drug Metab. Dispos., November 1, 2001; 29(11): 1467 - 1472.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. G. Schuetz, S. Strom, K. Yasuda, V. Lecureur, M. Assem, C. Brimer, J. Lamba, R. B. Kim, V. Ramachandran, B. J. Komoroski, et al.
Disrupted Bile Acid Homeostasis Reveals an Unexpected Interaction among Nuclear Hormone Receptors, Transporters, and Cytochrome P450
J. Biol. Chem., October 12, 2001; 276(42): 39411 - 39418.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Nugent, J. B. Prins, J. P. Whitehead, D. Savage, J. M. Wentworth, V. K. Chatterjee, and S. O'Rahilly
Potentiation of Glucose Uptake in 3T3-L1 Adipocytes by PPAR{gamma} Agonists Is Maintained in Cells Expressing a PPAR{gamma} Dominant-Negative Mutant: Evidence for Selectivity in the Downstream Responses to PPAR{gamma} Activation
Mol. Endocrinol., October 1, 2001; 15(10): 1729 - 1738.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Handschin, M. Podvinec, R. Looser, R. Amherd, and U. A. Meyer
Multiple Enhancer Units Mediate Drug Induction of CYP2H1 by Xenobiotic-Sensing Orphan Nuclear Receptor Chicken Xenobiotic Receptor
Mol. Pharmacol., October 1, 2001; 60(4): 681 - 689.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Handschin, M. Podvinec, J. Stockli, K. Hoffmann, and U. A. Meyer
Conservation of Signaling Pathways of Xenobiotic-Sensing Orphan Nuclear Receptors, Chicken Xenobiotic Receptor, Constitutive Androstane Receptor, and Pregnane X Receptor, from Birds to Humans
Mol. Endocrinol., September 1, 2001; 15(9): 1571 - 1585.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Goodwin, L. B. Moore, C. M. Stoltz, D. D. McKee, and S. A. Kliewer
Regulation of the Human CYP2B6 Gene by the Nuclear Pregnane X Receptor
Mol. Pharmacol., September 1, 2001; 60(3): 427 - 431.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. C. Falkner, J. A. Pinaire, G.-H. Xiao, T. E. Geoghegan, and R. A. Prough
Regulation of the Rat Glutathione S-Transferase A2 Gene by Glucocorticoids: Involvement of Both the Glucocorticoid and Pregnane X Receptors
Mol. Pharmacol., September 1, 2001; 60(3): 611 - 619.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
L. C. Quattrochi and P. S. Guzelian
CYP3A Regulation: From Pharmacology to Nuclear Receptors
Drug Metab. Dispos., April 13, 2001; 29(5): 615 - 622.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, S. A.
Right arrow Articles by Moore, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, S. A.
Right arrow Articles by Moore, J. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals