help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirshner, S.
Right arrow Articles by Singer, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirshner, S.
Right arrow Articles by Singer, D. S.
Molecular Endocrinology 14 (1):82
Copyright © 2000 by The Endocrine Society

Major Histocompatibility Class I Gene Transcription in Thyrocytes: A Series of Interacting Regulatory DNA Sequence Elements Mediate Thyrotropin/Cyclic Adenosine 3',5'-Monophosphate Repression

Susan Kirshner, Lisa Palmer, Josef Bodor, Moto Saji1, Leonard D. Kohn and Dinah S. Singer

Experimental Immunology Branch (S.K., L.P., J.B., D.S.S.) National Cancer Institute, and Cell Regulation Section Metabolic Diseases Branch (M.S., L.D.K.) National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In response to TSH, thyroid cells decrease major histocompatibility (MHC) class I expression and transcription, providing an excellent model for studying the dynamic modulation of transcription of MHC class I genes. Here we show that protein kinase A (PKA), a downstream effector of the TSH/cAMP pathway, reproduces the effects of TSH in repressing class I transcription. PKA/cAMP-mediated repression of transcription involves multiple interacting upstream response elements in the class I promoter: an element extending from -127 to -90 bp containing a CRE-like core, and at least two elements within an upstream 30-bp segment (-160 to -130 bp), which overlaps with the interferon regulatory element. ICER (inducible cAMP early response), a transcriptional repressor induced by TSH/cAMP can decrease class I promoter activity when introduced into FRTL-5 thyroid cells in the absence of TSH/cAMP. ICER binds to both the CRE-like element and the upstream 30-bp segment, generating a novel TSH-induced ternary complex. The present studies led to the proposal that TSH-mediated repression of class I transcription is the result of integrating signals from transcription factors through the higher order interactions of multiple regulatory elements.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The major histocompatibility (MHC) class I cell surface molecules are glycoproteins that provide immune surveillance against intracellular pathogens. They are constitutively expressed on most nucleated cells. Levels of class I expression vary among tissues and are also dynamically modulated in response to external stimuli. For example, lymphocytes express high levels of class I while kidney cells express very low levels (1 ). Nevertheless, class I expression is increased in both cell types by interferons {alpha},ß, and {gamma} (2 ).

We have recently proposed that overexpression of class I molecules on the cell surface may trigger certain autoimmune diseases (3 4 5 6 7 8 ). Such inappropriate expression might result in the presentation of aberrantly high levels of self-antigens to the immune system, thereby breaking tolerance and inducing autoimmune reactions. Indeed, whereas the thyroid normally expresses low, but detectable, class I, the level of class I is elevated in autoimmune thyroid disease. Also consistent with this hypothesis, both methimazole, which is used to treat patients with autoimmune thyroid disease, and iodide decrease transcription and cell surface expression of class I (3 9 ). Importantly, mice deficient in class I expression are resistant to the induction of an experimental model of the autoimmune disease, systemic lupus erythematosus, whereas class I+ mice are susceptible to this disease (10 ). Thus class I molecules appear to play an important role in the etiopathology and/or maintenance of some autoimmune diseases.

To understand the molecular basis underlying autoimmune thyroid disease, we have begun to analyze the normal regulatory mechanisms governing MHC class I gene expression. We have demonstrated previously that the pituitary hormone TSH, which stimulates a spectrum of metabolic activities, including transcription of the thyroglobulin and thyroid peroxidase genes, also represses class I and TSHr gene transcription (3 4 7 8 11 ). However, the molecular mechanisms and regulatory factors involved in this repression remained unknown. In the present studies, we have defined the promoter response elements and one of the factors that mediate the hormonal repression of class I transcription.

Repression of class I transcription is triggered by the binding of TSH to its receptor on the thyrocyte cell surface. The TSHr is a G protein-coupled receptor whose engagement results in increased intracellular level of cAMP (12 ). FSK, which also increases cAMP, similarly represses transcription of class I in thyroid cells (4 ) in a manner indistinguishable from TSH. cAMP is known to modulate transcription through tissue-specific modification of an array of transcription factors. Among the best studied examples are the members of the cAMP response element binding protein (CREB)/activating transcription factor (ATF) family, AP2, c-jun, and CREM. Many of these factors belong to the large family of leucine zipper proteins that interact with highly related DNA binding sites (13 14 15 ). Increased intracellular cAMP levels activate protein kinase A (PKA)(16 ), which in turn phosphorylates target transcription factors. For example, CREB is constitutively associated with its cognate DNA sequence element, cAMP response element (CRE), but does not activate transcription. In response to phosphorylation by PKA, it recruits the transcriptional coactivator CREB-binding protein (CBP), thereby stimulating transcription (16 ).

cAMP/PKA also induces transcription of at least one set of transcription repressor factors, namely the ICER (inducible cAMP early response) subfamily of CREM gene products (14 ). The ICER proteins are small (17–20 kDa) proteins generated by transcription initiated from an intronic promoter within the CREM gene. ICER is composed of the DNA binding domain and leucine zipper domain of CREM but does not have the transactivation domains, resulting in its repressive function. ICER isoforms are generated by alternative splicing of the transcript (12 17 ). Of interest, ICER has been shown to be induced in thyroid cells by TSH (18 ). However, the functional consequences of ICER induction in thyrocytes are not known.

The present studies were undertaken to elucidate the signal pathways and target DNA sequence elements in the class I promoter region that are responsive to the TSH-stimulated increases in cAMP in the rat thyroid line, FRTL-5. We report that overexpression of PKA can reproduce the effects of TSH/cAMP in reducing class I transcription. Moreover, we show that at least three PKA-responsive elements within the region mapping between -203 and -50 bp of proximal class I promoter sequence function in concert. One of these maps to a CRE-containing element (-127 to -90). In addition, two novel elements map to a 30-bp segment (-160 to -130) that partially overlaps the interferon response element. Further, we describe a novel role for ICER protein, which is induced by TSH/cAMP. ICER associates with both the CRE and 30-bp segment to repress class I transcription. However, ICER binding requires another cellular activity to contribute to the formation of novel TSH-induced regulatory complexes, thereby suppressing class I promoter activity. The identity of this cellular factor is not known, but it is neither CREM nor CREB. Based on these findings, we propose that TSH/cAMP repression of class I transcription occurs through a PKA-dependent pathway that requires a complex set of interactions among transcription factors and DNA sequence elements that is dynamically adjusted in response to external hormonal signals.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FSK, (Bu)2cAMP, and PKA Decrease MHC Class I Promoter Activity in FRTL-5 Cells
TSH has been shown to decrease the transcription of MHC class I genes via a cAMP signal in the rat thyrocyte line, FRTL-5 (11 24 ). Since among its effects, cAMP is known to activate the serine/threonine kinase PKA, we determined whether PKA could reproduce the effects of TSH/cAMP. To this end, FRTL-5 cells were transiently transfected with a class I promoter/reporter construct (203CAT) consisting of 203 bp of promoter proximal DNA sequences ligated to the chloramphenicol acetyl transferase (CAT) reporter gene (Fig. 1AGo). This segment of the class I promoter region contains the basal promoter as well as a number of upstream regulatory elements including an enhancer (enhancer A, EnhA), an interferon response element (IRE), and a cAMP response element (CRE)-like site (Fig. 1AGo). As previously observed, treatment of FRTL-5 cells with TSH, FSK, or (Bu)2cAMP after transfection with 203 CAT resulted in a significant decrease of normal promoter activity (Fig. 1BGo). (Bu)2cAMP, a cAMP agonist, activates PKA by binding directly to the PKA- regulatory subunits. The ability of (Bu)2cAMP to mimic the effects of the adenylyl cyclase activators TSH and FSK indicates that PKA may be a downstream effector in this pathway leading to repression of class I transcription.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. FSK, (Bu)2cAMP, and PKA Decrease MHC Class I Promoter Activity in FRTL-5 Cells

A, A schematic diagram of the 203CAT construct depicting the upstream regulatory sequences: EnhA, NF-{kappa}B binding site; IRE, interferon response element; 30 bp, novel 30- bp segment involved in PKA-regulated transcription; CRE, cAMP response element; and the core promoter elements: CCAAT, the CAAT box; TCTAA, the noncanonical TATA box of class I; SS, the S box composed of two overlapping Sp1-binding sites; INR, the initiator element. B, FRTL-5 cells were transiently transfected with 10 µg of the 203CAT construct and 10 µg of an empty pUC vector (open bars) or with catalytically active or catalytically inactive ß-isoform of PKA (solid bars). After 24 h, cells were withdrawn into medium that was either supplemented or not with TSH, FSK, or (Bu)2cAMP (but not supplemented with insulin/hydrocortisone) for an additional 48 h before being harvested and assayed. C, Cells were transfected with a thyroglobulin-CAT promoter/reporter construct and were treated as in panel A. CAT activity was normalized for protein and is reported relative to either the untreated cells (open bars) or to cells transfected with catalytically inactive ß-isoform of PKA (solid bars). Each bar represents the average of a minimum of three separate experiments. * P < 0 .001, **, P < 0 .05, when compared with untreated cells.

 
To directly examine the effect of PKA on class I transcription, FRTL-5 cells were cotransfected with 203 CAT and either a vector that expresses an active catalytic subunit of PKA (pKß) or a control vector that expresses an inactive catalytic subunit (pKß mutant). Overexpression of the catalytically active pKß subunit, but not the inactive mutant subunit, significantly repressed class I promoter activity (Fig. 1BGo). The effects of the PKA, TSH , and FSK are comparable to one another in magnitude. Combined treatment of PKA-transfected FRTL-5 cells with TSH or FSK did not enhance repression of class I transcription (data not shown). Taken together these findings suggest that all three agents work through a common cAMP pathway.

The observed repression of class I transcription was not due to the global repression of all transcription by PKA. For example, the activity of a thyroglobulin promoter/CAT reporter construct was stimulated 2- to 3-fold by cotransfection with the PKA catalytic subunit or by treatment with TSH or FSK (Fig. 1CGo). Thus, PKA mimics the effects of TSH/cAMP, namely repressing transcription from the class I promoter, yet stimulating transcription from the thyroglobulin promoter.

At Least Two Upstream Regulatory Elements Are Involved in PKA-Mediated Repression of the Class I Promoter
A CRE-like element (-107 bp to -100 bp) in the class I promoter was previously shown to play a role in the TSH response (11 ). Deletion of this CRE-like element, generating the construct 203{Delta}CRE (Fig. 2AGo), renders the promoter refractory to TSH-mediated repression (Fig. 2BGo). The 203{Delta}CRE promoter activity is also not repressed by PKA: indeed, the 203{Delta}CRE is modestly enhanced by PKA. These data demonstrate that the CRE-like element is one target for PKA-induced repression and suggest the possible presence of a distinct element that is activated by PKA alone.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Both the 30-bp Segment and the CRE Element Are Necessary for TSH- and PKA- Mediated Repression

A, Schematic diagram of the promoter reporter constructs showing: 203{Delta}CRE, the CRE deletion mutant; and 203{Delta}30, the 30-bp segment deletion mutant that also eliminates the 3'-half of the IRE. B, FRTL-5 cells were transiently transfected with 10 µg of the promoter reporter constructs and, where indicated, catalytically active pKß construct (open bars). The construct pSV0 is a promoterless plasmid that contains the CAT gene and establishes background CAT expression. After 24 h cells were withdrawn into medium not supplemented with TSH, insulin, or hydrocortisone and were treated (light gray bars) or not (black and open bars) with TSH for an additional 48 h. CAT activity is reported as in the legend to Fig. 1Go. * , P < 0.001, **, P < 0.05 when activity is compared with the activity of untreated cells transfected with 203CAT.

 
Although the PKA/cAMP effect on class I promoter activity depends on the CRE element, we examined the possibility that additional regulatory elements contribute to TSH-mediated repression. A scan of the proximal promoter region identified an additional TSH-responsive element in a 30-bp segment between -160 and -130 bp (data not shown). Thus a promoter construct from which these 30 bp had been deleted (203{Delta}30, Fig. 2AGo) was not repressed either by TSH treatment or by cotransfection with the PKA expression vector (Fig. 2BGo). Since PKA targets the same elements as TSH, these data indicate that PKA is a major effector of TSH repression. Importantly, these results indicate that the 30-bp region between -160 and -130 is required in addition to the CRE for TSH/PKA-induced repression.

Deletion of either the CRE-like element or the 30-bp segment also significantly reduced basal promoter activity relative to 203CAT (Fig. 2Go), indicating that in the absence of TSH, these elements function as constitutive enhancers of transcription. However, the decreased basal transcription of the mutant promoters does not account for the inability of PKA to further repress them since their basal activities are still significantly above background; conversely, another class I promoter construct mutated in the 30-bp region has high basal activity and is not repressed by PKA (Fig. 2Go and see {Delta}30–1 in Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. A Constitutive Enhancer Maps to the 3D-3 Segment

 
In summary, both the 30-bp segment and the CRE-like element are necessary for TSH/cAMP/PKA-mediated repression of class I transcription. These elements act coordinately since deletion of either one eliminates the response. Further, both elements contribute to establishing constitutive levels of class I transcription in FRTL-5 cells.

The CREM Family Member, ICER, Represses Class I Promoter Activity in FRTL-5 Cells
cAMP, through its activation of PKA, is known to modulate the activity of a number of different transcription factors, including CREB and CREM. In FRTL-5 cells, TSH has been shown to induce the transcriptional repressor, ICER (18 ). However, the function of ICER in these cells has not been demonstrated. To test the possibility that ICER may be involved in the PKA-mediated repression of class I promoter activity, FRTL-5 cells were transfected with the class I promoter construct, 203CAT, in the presence of either an ICER expression vector or a control vector. As shown in Fig. 3Go, expression of ICER in the FRTL-5 cells significantly reduced the class I promoter activity, to 0.44 ± 0.13 of the control level. Furthermore, ICER, like TSH and PKA, had no effect on the activity of either the 203{Delta}30 or 203{Delta}CRE constructs, mapping the ICER target to these two elements. These findings are consistent with the interpretation that TSH/PKA-induced repression of class I transcription is achieved, at least in part, through the induction of ICER.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. ICER Represses Class I Promoter Activity in FRTL-5 Cells

FRTL-5 cells were transiently cotransfected with 10 µg of 203CAT, 203{Delta}30, or 203{Delta}CRE and 10 µg of the vector control pKW10 (open bars) or a vector expressing the PKA-induced transcriptional repressor, ICERII (solid bars). CAT activity is reported as in the legend to Fig. 1Go.

 
ICER Binds to Both the CRE-Like Element and the 30-bp Segment of the Class I Promoter
The above functional data demonstrate a role for ICER in TSH/PKA-mediated repression. However they do not demonstrate whether the mechanism of ICER repression is indirect or a result of a direct interaction with the class I promoter. To determine whether ICER can bind to the proximal class I promoter, we performed gel shift assays using recombinant ICER protein and a radiolabeled class I promoter probe of 168 bp that spans the 30 bp segment (-160 to -130), the CRE-like element (-107 to -100) and the transcription initiation site (-50 to +1) (Fig. 4Go). Recombinant ICER, but not control bacterial lysate, formed a complex with the class I probe (Fig. 4Go, lane 2). Thus, ICER binds to site(s) within the 168-bp sequence.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Recombinant ICER Binds to the 30-bp and CRE Elements of the Class I Promoter

A 32P- radiolabeled fragment spanning 168 bp of PD1 5'-flanking sequence (1.5 fmol) was incubated with recombinant ICERII (200 ng) and 10,000-fold excess of unlabeled competitor DNA: probe alone (lane 1); no competitor (lane 2); self-competition (lane 3); 30-bp segment (-160 to -131, lane 4); PD1CRE (-113 to -94, lane 5), Prm (promoter, -50 to +1, lane 6), HTLVCRE (lane 7). Binding was quantified by densitometry. Activity is expressed relative to ICERII binding in the absence of unlabeled competitor DNA and is an average of five experiments. A map of the 168-bp fragments is depicted in Fig. 5Go. Complexes were evaluated by EMSA on a 6% polyacrylamide gel.

 
To map the ICER-binding site on the radiolabeled 168-bp probe, competition experiments were done with unlabeled double stranded oligonucleotides representing sequences within the 168-bp fragment (Fig. 4Go). Recombinant ICER binding to the 168-bp probe was inhibited by oligonucleotides corresponding to both the CRE-like element and the 30-bp segment as efficiently as by a canonical ICER binding site (the HTLV-1 CRE, a sequence previously shown to bind ICER; Fig. 4Go, lanes 4, 5, and 7). An unlabeled 168- bp fragment also competed ICER binding (lane 3). Surprisingly, none of the small fragments completely inhibited binding, under the conditions tested; the basis for this is unclear. The incomplete competition of the unlabeled 168-bp fragment was most likely due to its low molar excess (100x). In contrast, a fragment spanning the basal promoter region did not compete complex formation at all (lane 6). Consistent with these competitions, protein/DNA complexes were also formed with ICER and labeled 30 bp or CRE region oligos (data not shown).

The PKA-Induced Transcription Factor, ICER, Is a Component of a Novel TSH-Induced Protein/DNA Complex
The above studies indicate that distinct regulatory elements are targeted in the response of the class I promoter to TSH/PKA: the CRE-like element, and elements within the 30-bp segment. These elements are functionally interdependent, since deletion of either the CRE or the 30-bp segment eliminates PKA-mediated repression of promoter activity. Furthermore, ICER, which represses class I promoter activity and binds to the CRE and 30-bp segment, is induced by cAMP in response to TSH treatment of FRTL-5 cells (18 ). These findings predict that TSH treatment of FRTL-5 cells should lead to the induction of a novel protein/DNA complex, and that this complex should contain ICER binding to the CRE-like element and the 30-bp segment. Indeed, consistent with this prediction, as we have previously reported, gel shift assays with the 168-bp probe and extract derived from FRTL5 cells grown in the presence of TSH gave rise to two novel complexes (Fig. 5Go, lane 2, bands F and G) in addition to the series of low-mobility bands that are also generated by extract derived from untreated cells (Fig. 5Go, lane 1, bands A, B, and C). Comparable F and G complexes were formed with extracts from FSK or (Bu)2 -cAMP treated cells (data not shown). Thus TSH, FSK, or (Bu)2 cAMP treatment of FRTL-5 cells led to the induction of novel protein/DNA complexes with the 168-bp probe. The ability of (Bu)2 cAMP to mimic the effects of TSH and FSK is consistent with a role for PKA in the repression of class I transcription. Thus, TSH treatment of FRTL-5 cells either induces de novo expression or posttranslational activation of DNA-binding factors, which results in the appearance of novel protein-DNA complexes.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. TSH Induces Novel Protein/DNA Complexes Involving Both the CRE and 30-mer Elements

A 32P-radiolabeled fragment spanning 168 bp of PD1 5'-flanking sequence (1.5 fmol) was incubated with 3 µg whole cell extracts from FRTL-5 cells treated (right lane) or not (left lane) with TSH for 24 h. The 168-bp fragment spans the upstream regulatory elements IRE, the 30-bp segment, and the CRE, as well as the core promoter elements, the TCTAAA box, the S box, and the INR element. Complexes were evaluated by EMSA on a 4% polyacrylamide gel.

 
To determine whether ICER is present in the F and/or G complexes induced by TSH or FSK treatment of FRTL-5 cells, we performed antibody supershift studies, using an anti-CREM antiserum that cross-reacts with ICER (21 22 ). The anti-CREM antibody binds ICER-containing complexes since a complex consisting of only recombinant ICER and the 168-bp probe is specifically supershifted by the anti-CREM antibodies (Fig. 6Go, lanes 8–10). Importantly, using FRTL-5 extracts, the TSH/FSK-induced complexes, F and G, were eliminated by the anti-CREM antibody (Fig. 6Go, lanes 5–7), which had no effect on complexes A–C. The anti-CREM antiserum also had no effect on the mobility of any of the complexes formed with extracts from untreated FRTL-5 cells. Thus, ICER (or a closely related protein) is a component of both TSH-induced complexes F and G.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 6. Anti-CREM Antiserum Cross-Reacts with ICER and Prevents Formation of the F and G Complexes

Extracts from untreated (lanes 2–4) or FSK-treated (lanes 5–7) FRTL-5 cells, or recombinant ICERII (lanes 8–10), were incubated in the presence of normal rabbit serum (NRS, lanes 3, 6, and 9) or anti-CREM rabbit serum (lanes 4, 7, and 10) for 20 min before the addition of 32P-radiolabeled fragment spanning 168 bp of PD1 5'-flanking sequence (1.5 fmol)(lane 1, probe alone). Complexes were evaluated by EMSA on a 6% polyacrylamide gel.

 
Several lines of evidence suggest that neither TSH-induced complex is likely to contain CREM. First, CREM is a constitutively expressed protein. In vitro PKA treatment of FRTL-5 extracts from cells that had not been exposed to TSH/FSK in vivo did not generate either the F or G complex formation, suggesting that complex formation is not generated by posttranslational phosphorylation of CREM or another preexisting factor (data not shown). Second, although purified CREM binds to the 168-bp probe, the complexes generated by CREM alone or in combination with ICER do not correspond in mobility to either of the TSH-induced F and G complexes (data not shown). Finally, addition of recombinant CREM to extracts from untreated FRTL-5 cells did not generate complexes that migrate with the same mobility as the TSH-induced complexes (data not shown). Taken together these results suggest that it is unlikely that CREM is a constituent of the TSH-induced complexes.

Surprisingly, the complex generated by the binding of ICER to the 168-bp probe did not correspond in mobility to either of the TSH-induced F or G complexes. Since leucine zipper family members form both homo- and heterodimers (12 ), we considered the possibility that in vivo ICER interacts with a constitutively expressed cellular factor to generate the novel complexes observed in extracts after TSH treatment of FRTL-5 cells. To examine this possibility, we combined recombinant ICER with extracts from cells grown in the absence of TSH (Fig. 7Go). We tested two of the four known ICER isoforms: ICERII, containing all the exons and ICERII{gamma} from which the {gamma}-exon is deleted (12 25 ). The addition of increasing amounts of FRTL-5 extract to a constant amount of either recombinant ICER isoform resulted in the formation of a complex indistinguishable in mobility from that of the G complex (Fig. 7Go). This indicates that formation of the G complex depends upon a constitutively expressed cellular factor, in addition to the PKA-induced ICER. It is unlikely that formation of the G complex results from enhanced ICER binding due to a nonspecific protein effect of the cell extract, since addition of extracts other than the FRTL-5 do not generate the G complex (data not shown). Similarly, it is unlikely that G complex formation is due to a nonspecific effect of addition of bacterial extract, since the addition of the pGEX (GST) extract had no effect (Fig. 7Go, lanes 12–15). It is noteworthy that the addition of extract to the recombinant ICER did not generate the F complex, suggesting that TSH may induce an additional cellular activity that is necessary to generate the F complex.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 7. ICER Forms a Complex with a Cellular Activity That Migrates with Complex G

The 32P-radiolabeled fragment spanning 168 bp of PD1 5'-flanking sequence (1.5 fmol) was incubated with whole cell extracts from FRTL-5 cells (3 µg) treated (lane 3) or not (lane 2) with TSH for 24 h; recombinant ICERII alone (200 ng, lane 4); recombinant ICERII (200 ng) supplemented with increasing amounts of whole cell extract from FRTL-5 cells grown in the absence of TSH (1–3 µg, lanes 5–7); recombinant ICERII{gamma} alone (200 ng, an isoform from which the {gamma}-exon is excluded) (lane 8) ; recombinant ICERII{gamma} (200 ng) supplemented with increasing amounts of whole cell extract from FRTL-5 cells grown in the absence of TSH (1–3 µg, lanes 9–11); recombinant pGEX alone (200 ng, vector control) (lane 12); and recombinant pGEX (200 ng) supplemented with increasing amounts of whole cell extract from FRTL-5 cells grown in the absence of TSH (1–3 µg, lanes 13–15). The map of the 168-bp fragment is described in the legend to Fig. 5Go. Complexes were evaluated by EMSA on a 6% polyacrylamide gel.

 
The addition of increasing amounts of FRTL-5 extract also appeared to augment the ICER/DNA complex. Although the basis for this enhancement is not known, it may reflect a nonspecific stabilization of the complex by cellular proteins. Alternatively, it may reflect a specific stabilization of the sort that has been observed with other transcription factors, such as HMG I/Y (39 ).

In summary, the data suggest that ICER in combination with a constitutive component in the FRTL-5 extract generates complexes indistinguishable from the TSH-induced complex G. The identity of this cellular factor remains to be determined.

TSH-Induced Complexes Depend on Both the CRE-Like Element and the 30-bp Segment
The above studies demonstrate that ICER represses class I promoter activity, that this repression depends on both the CRE-like element and the 30-bp segment, that ICER binds to both these sequences, and that ICER is a component of TSH-induced complexes formed with the 168-bp probe and extracts from TSH/FSK-treated cells. These findings predict that formation of the novel F and G complexes depends on the CRE-like element and the 30-bp segment. To map the DNA sequence elements involved in generating both the constitutive and TSH-induced complexes, we examined the ability of unlabeled double-stranded oligonucleotides representing sequences within the 168-bp fragment to inhibit complex formation with extract from TSH-treated or control FRTL-5 cells (Fig. 8Go). A DNA fragment spanning the CRE-like element eliminated both novel TSH-induced complexes, F and G, demonstrating that the CRE-like element is a binding site within each complex (Fig. 8Go, lane 7). A DNA fragment spanning the 30-bp segment also completely competed the same two TSH-induced complexes (Fig. 8Go, lane 8), demonstrating that sequences within this segment are also binding sites. These competitions were specific since neither oligonucleotide competed any of the constitutive complexes A, B, or C which form in extracts from both control and TSH-treated cells. Furthermore, an oligonucleotide spanning the basal promoter sequences (Prm) consistently competed the constitutive complexes, A, B, and C, but did not affect the TSH-induced complexes, F and G (Fig. 8Go, lanes 5 and 9). Neither the 30-bp segment nor the CRE reproducibly affected complexes formed in the absence of TSH, whereas the promoter consistently did so (Fig. 8Go, lanes 2–5).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 8. TSH Induces Novel Protein/DNA Complexes Involving Both the CRE and 30-mer Elements

The 32P-radiolabeled fragment covering 168 bp of PD1 5'-flanking sequence (1.5 fmol) was incubated with whole cell extract (3 µg) from FRTL-5 cells treated or not with TSH for 24 h. Before addition of the labeled probe, extracts were incubated with unlabeled double-stranded oligonucleotides as indicated. The schematic diagram depicts the 168-bp probe and the regions covered by the oligonucleotides. Complexes were evaluated by EMSA on a 6% polyacrylamide gel. In these studies cells were grown in medium supplemented with insulin and hydrocortisone.

 
It is striking that the 30-bp segment and the CRE-like element are both capable of competing the TSH-induced complexes since their sequences are completely dissimilar (see Table 1Go). This suggests that these DNA elements are involved in a ternary complex containing both DNA elements and cellular factors, whose formation is induced by TSH/PKA. Since ICER is present in the TSH-induced complexes and binds to both the CRE-like element and the 30-bp segment, it is likely that ICER bridges the interaction of these elements in the TSH-induced complexes.


View this table:
[in this window]
[in a new window]
 
Table 1. Sequences in the 30-bp Segment and CRE-Like Element

 
Mapping of the PKA Response Elements within the 30-bp Segment
The above studies have identified the 30-bp segment as a pivotal target element in the TSH/PKA regulatory pathway. To identify the DNA sequences within the 30-bp segment required for PKA-dependent transcriptional repression, we generated three promoter/reporter constructs with smaller deletions across the 30-bp region (Fig. 9AGo; the constructs are labeled {Delta}30–1, {Delta}30–2 , and {Delta}30–3). The sequences deleted in these constructs are provided in Table 1Go and are denoted as 30–1, 30–2, and 30–3, respectively. Surprisingly, neither the {Delta}30–1, with a 5' 13-bp deletion, nor the {Delta}30–3 construct, with a 3' ll-bp deletion, were repressed by PKA when transfected into FRTL-5 cells (Fig. 9BGo). Only the {Delta}30–2, with a central 13-bp deletion, remained responsive to PKA under these conditions. Thus, there are two distinct regulatory elements contained within the 30-bp segment that are required for PKA-induced repression of transcription: the 30–1 element and the 30–3 element. The failure of the {Delta}30–1 construct to respond to PKA was not due simply to a change of either spacing or phasing of the promoter elements, since the deletion in this construct was the same length as the deletion in the {Delta}30–2 construct, which was repressed by PKA. The deletion in the {Delta}30–3 construct was only 11 bp, and therefore an effect of spacing or phasing of the DNA cannot be formally ruled out. The failure to respond to PKA was not due to the loss of basal promoter activity: the {Delta}30–1 construct was not repressed by PKA despite almost normal levels of transcription. Therefore, under these conditions, both the 30-1 and 30-3 regions function as PKA-response elements in the repression of class I transcription.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 9. The 30-bp Segment Contains Two PKA-Responsive Elements

A, A schematic diagram of the promoter/reporter constructs. The dips in the pictures indicate the segments deleted from the mutant constructs. B, FRTL-5 cells were transiently cotransfected with 10 µg of the indicated promoter/reporter construct and 10 µg of catalytically inactive (open bars) or catalytically active (closed bars) ß-isoform of PKA. CAT activity was determined as in the legend to Fig. 1Go. Each bar represents the average of a minimum of three separate experiments. * , P < 0.001, **, P < 0.05, when compared with untreated cells.

 
As discussed above, the basal promoter activity of the 203{Delta}30 construct was 40% that of wild type, mapping a constitutive enhancer within the 30-bp segment (Fig. 2Go and Table 2Go). Since basal promoter activity of the {Delta}30–3 construct was also markedly reduced relative to that of the wild-type 203CAT construct, whereas the activities of the {Delta}30–1 and the {Delta}30–2 constructs were not, the constitutive enhancer maps to the 30–3 segment between -140 and -130 bp (Table 2Go). A comparative search of the sequence of the 30-bp segment in the Transfac Matrix TableGo did not reveal homology to previously reported transcription factor-binding sites, suggesting that the 30–3 segment is a novel enhancer element.

The transfection data indicated that both the 30–1 and the 30–3 elements were involved in mediating TSH-induced repression of the class I promoter (Fig. 9BGo). The gel shift experiments demonstrated that the 30-bp segment is involved in the formation of the TSH-induced F and G complexes (Fig. 8Go). Therefore, the role(s) of the 30–1 and 30–3 regions in the formation of these complexes was examined in gel shift competition experiments (Fig. 10Go). Oligonucleotides spanning the 30-bp segment were assayed for their ability to compete the F and G complexes formed with the 168-bp probe (Fig. 10Go, lanes 9–11). An oligonucleotide deleted of the 30–3 segment (30{Delta}3) was unable to compete the TSH-induced bands, indicating that the 30–3 sequence participates in complex formation. This is consistent with the finding that the 30–3 segment is necessary for the functional PKA response. In contrast, an oligonucleotide deleted of the 30–1 segment (30{Delta}1) did compete both the F and G complexes, indicating that sequences necessary for complex formation remain within this segment. However, deletion of the 30–1 segment eliminated TSH/PKA-mediated repression (Fig. 9BGo). Similarly, whereas the {Delta}30–2 construct retained a PKA response, the oligonucleotide deleted of the 30–2 segment (30{Delta}2) was unable to compete. Taken together, these findings suggest that although the 30-bp segment is necessary both for PKA-induced repression and for the formation of the F and G complexes, the formation of the F and G complexes may not be sufficient for a PKA response.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 10. The TSH-Induced Novel Protein/DNA Complexes Involve Sequences from the 3'-End of the 30-bp Segment, Not the IRE

EMSA was performed as indicated in the legend to Fig. 8Go.

 
In summary, the 30-bp segment contains two functionally defined PKA response elements: 30–1 and 30–3. The 30–3 also provides the DNA sequence element that contributes to the formation of the TSH-induced complexes, F and G.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid function is regulated by the pituitary hormone TSH. TSH binding to its receptor on thyrocytes – either in situ or in cell culture – stimulates increased intracellular cAMP and Ca+2 and triggers a broad spectrum of metabolic events (12 ). Among these are the induction of transcription and translation of various thyroid-specific genes such as thyroglobulin, thyroid peroxidase, and iodide porter. Concomitantly, the transcription of the MHC class I genes is repressed. In the present study, we have delineated the signal transduction pathway and the molecular mechanisms that lead to this repression.

The induction of increased intracellular cAMP by TSH results in a variety of cellular responses, among them the activation of PKA (26 ). PKA activation, in turn, results in the induction of the transcription factor, ICER, which represses class I transcription (Fig. 11Go). ICER-mediated repression depends on three distinct cis-acting response elements in the class I promoter, all of which function in concert to repress class I transcription in response to cAMP. One of these elements is a CRE-like element spanning -107 to -100 bp; the others are novel elements contained within a 30-bp segment, -160 bp to -130 bp. The elements contained within the 30-bp segment have not been identified previously as cAMP/PKA response elements and are not homologous to the CRE. Although ICER alone binds to both the CRE-like element and the 30-bp segment, it requires another cellular factor to form the higher-order repression complexes that are specifically induced in response to TSH. Thus, hormonal regulation of class I expression is coordinated by the combinatorial interaction of multiple transcription factors with multiple response elements that lie within the region -160 bp to -100 bp upstream of the transcription initiation site. In conclusion, we postulate that PKA mediates the TSH-induced repression of class I gene transcription.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 11. Schematic Diagram of the Class I Promoter in FRTL-5 Cells

The model on the left, representing the interaction of upstream regulatory factors with the PIC in a thyrocyte in the absence of TSH, was developed based on previous studies as described in the Discussion. Positive regulatory factors TTF-1, thyroid transcription factor-1; CREB, cAMP response element binding protein; ATF, activating transcription factor; IRF-1, interferon regulatory factor-1; Mod-1, modulatory element 1. We hypothesize that the activity of these factors is coordinated by the large scaffolding proteins CBP or p300 (Kirshner et al., manuscript in preparation). The diagram on the right is a model summarizing the data presented here on TSH-induced repression of class I transcription in thyroid cells. TSH binding to the TSH receptor results in elevated intracellular cAMP concentrations. cAMP activates PKA, which induces the transcriptional repressor ICER. ICER interacts with the class I CRE and the 30-bp segment in conjunction with an, as yet unidentified, cellular factor X. Pax-1 reverses TTF-1-stimulated transcription. The binding of these factors to the class I promoter interferes with the ability of the transactivating complex to stimulate the PIC, thereby repressing transcription.

 
A primary role of cAMP in the repression of class I transcription is the induction of ICER, as evidenced by the finding that expression of ICER alone in FRTL-5 cells represses transcription of class I. Consistent with these observations, it has been reported that ICER is induced in TSH-treated FRTL-5 cells. Although no specific ICER function was described, Lalli et al. (18 ) found that TSHr message decreased in FRTL-5 cells subsequent to ICER induction . We have previously reported that TSHr and MHC class I transcription decrease concomitantly over 24 h in TSH-treated FRTL-5 cells (4 ). Taken together these data indicate that ICER is induced by TSH before the repression of TSHr and class I transcription. It should be noted that the present data do not preclude a role for the direct phosphorylation by PKA of transcription factors bound to the class I promoter, although such activity is not necessary in the TSH/cAMP/PKA/ICER pathway.

ICER is a truncated product of the CREM gene generated by transcription from an internal start site. It contains CREM DNA binding and leucine zipper domains, but lacks other domains that are involved in transcriptional regulation (12 17 18 ). Thus, ICER can bind to CREs and can dimerize with other leucine zipper-containing proteins, but is unable to transactivate. We speculate that ICER may repress class I transcription by forming higher-order protein/DNA complexes that inhibit transcriptional enhancers.

Dynamic regulation of MHC class I gene expression is achieved by complex interactions among a series of regulatory elements. Further complexity is achieved by the multiple functional activities of each of the regulatory elements. Here we have shown that the 30-bp segment and the CRE-like element each subsume two functions: 1) they are required to respond to PKA; and 2) they function as constitutive enhancers of class I expression; their deletion reduces constitutive class I expression. Indeed within the 30-bp segment we have found that the requirements for transrepression and transactivation only partially overlap. The 30–1 and 30–3 elements are both required for PKA-induced repression of class I. But the constitutive enhancer activity of the 30-bp segments maps only to the 30–3 region. This suggests that ICER binds to the class I promoter in a CRE, 30–1, and 30–3 bp dependent manner, thereby leading to the displacement or alteration of transactivating complexes that only require the CRE and 30–3 segments.

Based on the present findings, as well as our earlier studies, we propose the following model for regulation of MHC class I transcription, as depicted in Fig. 11Go. In the absence of TSH, FRTL-5 cells express multiple transcription factors that enhance class I expression. Among these, we have identified a number of ubiquitously expressed factors. A heterodimer (termed Mod-1), composed of the p50 subunit of NF-{kappa}B and the Fos family member Fra2, binds to enhancer A to increase transcription (9 27 ). Similarly, the factor IRF-1 enhances expression by binding to the IRE (28 29 ). In previous studies we have identified several transcription factors that bind to the class I CRE region; CREB/ATF1 was a minor component of the complexes binding to the class I CRE using FRTL-5 cell extracts. In contrast, the thyroid-specific transcription factor TTF-1 was a major component of the complexes, binding in a CRE-dependent manner to two sites flanking the CRE (11 ). Both EMSA and functional data support a model in which TTF-1 rather than CREB/ATF1 is the dominant CRE-binding modulator of class I activity in FRTL-5 cells in the absence of TSH. All of these factors, binding to discrete sequence elements, modulate the activity of the downstream core promoter. The activities of these transcription factors are likely to be integrated by a large scaffolding protein. Indeed, recent evidence suggests that the co-activator, CBP/p300, transduces the regulatory signals governing class I promoter activity to the preinitiation complex (PIC), in the absence of TSH (S. Kirshner, J. Weissman, T. K. Howcroft, and D. S. Singer, manuscript in preparation).

Repression of class I transcription by TSH also involves multiple DNA sequence elements, transcription factors, and distinct mechanisms that operate to accomplish the overall repression of promoter activity (Fig. 11Go). TSH binding to the TSHr leads to elevated levels of cAMP. In turn this leads to the activation of PKA. Active repression is dependent upon TSH/cAMP-induced ICER, which in association with a constitutively expressed factor (designated x in Fig. 11Go), binds to the CRE-like element and the 30-bp segment. The direct interaction of ICER with the class I promoter may displace positive regulatory factors, as is depicted in Fig. 11Go. Alternatively ICER may interfere with the ability of the positive regulatory factors to interact in a coordinated manner with the preinitiation complex. Passive" repression of promoter activity may occur as a result of eliminating active enhancement. As one example, the TTF-1 mediated enhancer activity of the CRE-like element is lost in response to TSH/cAMP (11 ). TSH/cAMP reduces TTF-1 mRNA and protein levels leading to reduced promoter occupancy and reduced levels of transcription. TSH/cAMP also increases expression of the transcription factor Pax-8. Pax-8 alone has no effect on class I transcription. But its binding to the class I promoter inhibits TTF-1 stimulated class I transcription (11 ). Thus, ICER and PAX-8 may both inhibit class I expression by interfering with the binding of trans-activators to the class I promoter, suggesting that transcriptional repression of class I is mediated by complex interactions of multiple elements.

The mechanisms of TSH/cAMP repression of class I transcription parallel those previously characterized for the TSHr, which also targets multiple DNA sequence elements and transcription factors (30 31 32 33 34 35 36 37 38 ). Among the transcription factors mobilized by TSH are both thyroid-specific factors (i.e. TTF1) and ubiquitously expressed ones (i.e. CREB, ATF1). In addition, single strand DNA-binding proteins (i.e. SSBP-1 and the Y-box binding protein, TSEP) are also involved in regulating the TSH/cAMP repression of both genes.

It is tempting to speculate that these complex integrated response networks have arisen to broaden the repertoire generated by a finite vocabulary of effectors (transcription factors and DNA response elements). Indeed, the class I CRE, in the context of a heterologous promoter, acts as a constitutive repressor rather that an constitutive enhancer (4 ). Taken together, the present findings indicate that TSH/cAMP regulate class I transcription through the coordinated interaction of multiple target proteins, including the PKA-induced transcription of ICER, and multiple DNA response elements. Moreover, within the region -203 bp to -50 bp, multiple signals that regulate class I transcription in response to dynamic, hormonal stimuli in the cell are integrated. Future studies will be directed toward characterizing the mechanisms of integration of these transcriptional signals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
FRTL-5 rat thyroid cells (Interthyr Research Foundation, Baltimore, MD; ATCC no. CRL 8305) were a fresh subclone (F1) that had all the properties previously detailed (3 4 ). They were grown in six-hormone (6H) medium consisting of Coon’s modified F12 (Sigma, St. Louis, MO) as previously detailed (3 4 ). Fresh medium was added every 2 to 3 days and cells were passaged every 7–10 days. In different experiments, as noted, cells were maintained in medium devoid of TSH or in medium that was not supplemented with TSH, insulin , or hydrocortisone.

Preparation of Plasmid Constructs
Construction of the CAT chimeras of the swine class I promoter PD1 5'-flanking sequences p(-203CAT), p(-127)CAT, 203{Delta}30, and 203{Delta}CRE have been described (9 ). The {Delta}30–1 and {Delta}30–2 constructs were created by PCR (95 C, 1 min; 54 C, 2 min; 72 C, 3 min; DNA Thermal Cycler, Perkin-Elmer Cetus, Norwalk, CT) using 100 ng of p(-203)CAT as template and 20 µM of each of the primer pairs. Round 1 PCR was performed using the round 1 PCR primer pairs to generate two overlapping fragments spanning from -203 to +1. Primers 1 and 5 are derived from sequences in the 30-bp segment and incorporate the {Delta}30–1 and {Delta}30–2 dropout mutations. The PCR products were purified from a 3% agarose gel, and the pairs of fragments were annealed and filled in using Klenow large fragment DNA polymerase. The filled-in fragments were then used as template for a second round of PCR with the external primers (2 and 4 below) to generate a single fragment. The products of this reaction were cut with BamHI and HindIII and ligated into the promoterless CAT vector pSV3CAT that had been cut with BglII and HindIII.

Round 1 PCR primer pairs for preparing the {Delta}30–1 construct are: 1) GGTTGCGAGATGGGGACACG/2) CAGGGCGGAGATCTGGGC, 3) CGTGTCCCCATCTCGCAACC/4) GAGAAGCTTGAGCAGAGC;

Round 1 PCR primer pairs for preparing the {Delta}30–2 construct are: 5) ggtcccacacgagaagtgaaac/2) CAGGGCGGAGATCTGGGC, 6) GTTTCACTTCTCGTGTGGGACC/4) GAGAAGCTTGAGCAGAGC.

The {Delta}30–3 construct was created by BamHI cleavage of p(-127)CAT and insertion of an oligo spanning from -203 to -127 that contained the {Delta}30–3 mutation. The sequences of all constructs were confirmed by standard sequencing methods (19 ).

RSV-Cat-ß (pKß) and RSV-Cat-ß mutant (pKß mutant), mammalian expression vectors for the catalytic subunit of PKA, were kindly provided by Richard Maurer (Oregon Health Sciences University, Portland OR). pKß mutant contains a point mutation that renders the protein catalytically inactive (20 ). Construction of the JL56 and BL46 ICER expression vectors has previously been described (21 22 ).

Transient Expression Analysis
Transient transfections in FRTL-5 cells were performed by electroporation using either of the following protocols with comparable results. In the first protocol, cells were cultivated in 6H medium to approximately 80% confluency, harvested, washed with cold PBS (pH 7.4; Biofluids, Rockville MD), and resuspended (3.75 x 107 cells/ml) in 0.80 ml PBS. Plasmid DNA, 20 µg of the CAT chimera together with 20 µg of either pUC or an expression vector to a total of 40 µg, were added to a 4-mm gap electroporation cuvette (Bio-Rad Laboratories, Inc., Hercules, CA) and cells were incubated for 10 min on ice. Thereafter cells were pulsed (300 V; capacitance, 960 µfarad; Genepulser, Bio-Rad Laboratories, Inc.), plated (7.5 x 106 cells per 10-cm dish) and cultured in 6H medium. After 24 h the medium was aspirated, the cells were rinsed with PBS and maintained in medium not supplemented with insulin and hydrocortisone, and were treated or not with 10-10 M TSH, 10 µM forskolin (Sigma), or 1 mM (Bu)2cAMP (Sigma). After two additional days cells were harvested for CAT and protein assays.

In the second protocol cells were cultivated to approximately 80% confluency in 6H medium. Thereafter they were maintained in medium without TSH and either with or without additional insulin and hydrocortisone, as noted, for 5–7 days. Twelve to 18 h before transfection the TSH free medium was exchanged for 6H medium. Cells were then harvested, washed in Coons F12 medium buffered with sodium bicarbonate and supplemented with 5% bovine serum (transfection buffer), and resuspended in transfection buffer (5–7.5 x 107 cells/ml). Plasmid DNA, 10 µg of the CAT chimera together with 10 µg of either pUC or an expression vector were added to a 4-mm gap electroporation cuvette along with 200 µl of the cell preparation. Cells were pulsed (230 V; capacitance, 960 mfarad; Genepulser, Bio-Rad Laboratories, Inc.), plated (7.5 x 106 cells per 10-cm dish) and cultured in 6H medium. Thereafter cells were treated as above.

CAT activity was measured as described (4 ), using 10–30 µg cell lysate in a final volume of 130 µl. Incubation was at 37 C for 4 h with additional acetyl-CoA supplementation (20 µl of a 3.5 mg/ml solution) after 2 h. Acetylated chloramphenicol was separated by TLC and quantified using an Ambis (Scanalytics, Billerica, MA). CAT activity was normalized by protein. Protein was determined using the BCA protein assay kit (Pierce Chemical Co., Rockford, IL) according to the manufacturer’s instructions.

Preparation of Whole Cell Extracts
Cellular extracts were made by a modification of the method of Dignam et al. (23 ). FRTL-5 cells were harvested by scraping after being washed twice in ice-cold PBS. The cells were pelleted and then resuspended in 2 volumes of Dignam Buffer C with freshly added 0.5 mM phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin, 1 mg/ml pepstatin, and phosphatase inhibitor mix [4 mM sodium orthovanadate, 4 mM EDTA, 100 mM sodium fluoride, 100 mM sodium pyrophosphate (hydrated) pH 7.6]. Protein concentration was determined using the BCA protein kit (Pierce Chemical Co.). The supernatant was aliquoted and stored at -70 C.

Bacterial Expression of ICER Proteins
Competent Escherichia coli BL21 cells were transformed with pGEX3.1, pGEX3.1JL56 (expressing ICERII), or pGEX3.1BL46 (expressing ICERII{gamma}) as previously described (21 22 ). After the last wash the beads were resuspended in 1 ml PBS, transferred to an Eppendorf (Madison, WI) tube, and spun at 4,000 rpm for 1 min, and the supernatant was discarded.

Thrombin Cleavage of ICER
Since thrombin is inhibited by phenylmethylsulfonyl fluoride, the pellets were washed three times in 1 ml PBS (150 mM NaCl, 20 mM NaPO4, pH = 7.3, 0.5 mM EDTA) in the absence of protease inhibitors. Thrombin protease (Pharmacia Biotech,Piscataway, NJ) was used according to the manufacturer’s instructions. Briefly, 50 U of thrombin protease were added to the beads in 1 ml of PBS. The beads were rotated overnight at room temperature. Thereafter the beads were pulsed in a microfuge at maximum speed and the supernatant transferred to a fresh tube. Glycerol was added to achieve a final concentration of 10%, and the samples were aliquoted and frozen. The purity of the products was determined by SDS-PAGE.

Electrophoretic Mobility Shift Assay (EMSA).
The following oligonucleotides:

39 mer, TGTCCCCAGTTTCACTTCTCCGTCTCGCAACCT- GGTGTGG;

30 mer, GTTTCACTTCTCCGTCTCGCAACCTGTGTGG;

{Delta}30–1, TATGTCCCCAGTCTCGCAACCTGTGTGGCA;

{Delta}30–2, TATGTCCCCAGTTTCACTTCTCGTGTGGCA;

{Delta}30–3, TATGTCCCCAGTTTCACTTCTCCGTCTCGC;

PD1CRE, CCGTCCTGCCCGGACACTCGTGACGCGACC- CCACTTCTC;

Prm, AGCTTCGGCGCCACTGCCGTTCCCGGTTCTAAAC TCT CCACCCACCCGGCTCTGCTCAGCTTCTCCCCAGA; and

5'CRE, GGGACCCGTCCTGCCCGGACACTC were synthesized using an ABI 380 synthesizer (Perkin-Elmer Corp., Norwalk, CT). The HTLV-CRE sequence, AAGGCTCTGACGTCTCCCCCC, was synthesized as previously described (21 22 ). Fragment 168 was prepared by HindIII digestion of the 168CAT construct. The fragment was purified from a 1.5% agarose gel using a GenElute column (Supelco, Bellefonte, PA). Probes were end labeled with {gamma}-32P-ATP using T4 polynucleotide kinase and then purified using an Elutip-D column (Schleicher & Schuell, Inc., Keene, NH) according to the manufacturer’s instructions.

One to 3 µg of whole cell extract from FRTL-5 cells or 50–250 ng of recombinant protein were incubated for 30 min at room temperature, and in 20 µl of binding buffer. Recombinant CREM protein was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). EMSA reaction mixtures included 1.5 fmol of labeled DNA, whole cell extract, or purified protein as indicated, and 3 µg poly(dI-dC) (Roche Molecular Biochemicals) in 10 mM Tris-Hcl (pH 7.9) containing 1 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, and 5% glycerol. For competitions with double-stranded oligonucleotides (oligos), whole cell extract and oligos were incubated in 20 µl of binding buffer without labeled probe for 20 min at room temperature. Thereafter probe was added for a further 20-min incubation at room temperature. For antibody supershift assays, antibody was preincubated with cell extract in 20 µl of binding buffer without probe for 20 min at room temperature. Thereafter probe was added for a further 20-min incubation at room temperature. After incubations, reaction mixes were subjected to electorphoresis on 4% or 6% native polyacrylamide gels at 160 V in 0.5x TBE at room temperature. Gels were dried and autoradiographed.


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Richard Maurer for the PKA constructs. We would also like to thank Dr. T. Kevin Howcroft, Dr. Kevin Gardner, Dr. Anne Gegonne, and Dr. Remy Bosselut for their critical reading of this manuscript and Jocelyn Weissman for many helpful discussions.


    FOOTNOTES
 
Address requests for reprints to: Dinah S. Singer, Experimental Immunology Branch, Building 10, Room 4B-36, National Institutes of Health, Bethesda, Maryland 20892-1360.

1 Current Address: Department of Surgery, Johns Hopkins University, Ross Building, Room 756, 720 Rutland Avenue, Baltimore, Maryland 21287. Back

Received for publication March 26, 1999. Revision received August 10, 1999. Accepted for publication September 22, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Singer DS, Frels WI, Ehrlich R 1991 Regulation of expression of a class I MHC transgene. Biotechnology 16:153–159[Medline]
  2. Ehrlich R, Sharrow SO, Maguire JE, Singer DS 1989 Expression of a class I MHC transgene: effects of in vivo {alpha}/ß-interferon treatment. Immunogenetics 30:18–26[CrossRef][Medline]
  3. Saji M, Moriarty J, Ban T, Singer DS, Kohn LD 1992 Major histocompatibility complex class I gene expression in rat thyroid cells is regulated by hormones, methimazole, and iodide as well as interferon. J Clin Endocrinol Metab 75:871–878[Abstract]
  4. Saji M, Moriarty J, Ban T, Kohn LD, Singer DS 1992 Hormonal regulation of major histocompatibility complex class I genes in rat thyroid FRTL-5 cells: thyroid-stimulating hormone induces a cAMP-mediated decrease in class I expression. Proc Natl Acad Sci USA 89:1944–1948[Abstract/Free Full Text]
  5. Singer DS, Mozes E, Kirshner S, Kohn LD 1997 Role of MHC class I molecules in autoimmune disease. Crit Rev Immunol 17:463–468[Medline]
  6. Kohn LD, Kosugi S, Ban T, Saji M, Ikuyama S, Giuliani C, Hidaka A, Shimura H, Akamizu T, Tahara K 1992 Molecular basis for the autoreactivity against thyroid stimulating hormone receptor. Int Rev Immunol 9:135–165[Medline]
  7. Kohn LD, Shimura H, Shimura Y, Hidaka A, Giuliani C, Napolitano G, Ohmori M, Laglia G, Saji M 1995 The thyrotropin receptor. Vitam Horm 50:287–384[Medline]
  8. Kohn LD, Giuliani C, Montani V, et al. 1995 In: Rayner D, Champion B (eds) Thyroid Autoimmunity. Landes Biomedical Publishers, Austin, TX, pp 115–170
  9. Taniguchi SI, Shong M, Giuliani C, Napolitano G, Saji M, Montani V, Suzuki K, Singer DS, Kohn LD 1998 Iodide suppression of major histocompativility class I gene expression in thyroid cells involves enhancer A and the transcription factor NF-{kappa} B. Mol Endocrinol 12:19–33[Abstract/Free Full Text]
  10. Mozes E, Kohn LD, Hakim F, Singer DS 1993 Resistance of MHC class I-deficient mice to experimental systemic lupus erythematosus. Science 261:91–93[Abstract/Free Full Text]
  11. Saji M, Shong M, Napolitano G, Palmer LA, Taniguchi SI, Ohmori M, Ohta M, Suzuki K, Kirshner SL, Giuliani C, Singer DS, Kohn LD 1997 Regulation of major histocompatibility complex class I gene expression in thyroid cells. Role of the cAMP response element-like sequence. J Biol Chem 272:20096–20107[Abstract/Free Full Text]
  12. Sassone-Corsi P 1995 Transcription factors responsive to cAMP. Annu Rev Cell Dev Biol 11:355–377[CrossRef][Medline]
  13. Della Facia MA, Servillo G, Sassone-Corsi P 1997 Cyclic AMP signalling and cellular proliferation: regulation of CREB and CREM. FEBS Lett 410:22–24[CrossRef][Medline]
  14. Brindle P, Nakajima T, Montiminy MR 1995 Multiple protein kinase A-regulated events are required for transcriptional induction by cAMP. Proc Natl Acad Sci USA 92:10521–10525[Abstract/Free Full Text]
  15. de Groot R, Auwerx J, Karperien M, Staels B, Kruijer W 1991 Activation of junB by PKC and PKA signal transduction through a novel cis-acting element. Nucleic Acids Res 19:775–781[Abstract/Free Full Text]
  16. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montiminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855–859[CrossRef][Medline]
  17. Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor. Cell 75:875–886[CrossRef][Medline]
  18. Lalli E, Sassone-Corsi P 1995 Thyroid-stimulating hormone (TSH)-directed induction of the CREM gene in the thyroid gland participates in the long-term desensitization of the TSH receptor. Proc Natl Acad Sci USA 92:9633–9637[Abstract/Free Full Text]
  19. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  20. Maurer RA 1989 Both isoforms of the cAMP-dpendent protein kinase catalytic subunit can activate transcription of the prolactin gene. J Biol Chem 264:6870–6873[Abstract/Free Full Text]
  21. Bodor J, Spetz AL, Strominger JL, Habener JF 1996 cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes. Proc Natl Acad Sci USA 93:3536–3541[Abstract/Free Full Text]
  22. Bodor J, Habener JF 1998 Role of transcriptional repressor ICER in cyclic AMP-mediated attenuation of cytokine gene expression in human thymocytes. J Biol Chem 273:9544–9551[Abstract/Free Full Text]
  23. Dignam J, Lebovitz R, Roeder R 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  24. Singer DS, Kohn LD, Zinger H, Mozes E 1994 Methimazole prevents induction of experimental systemic lupus erythematosus in mice. J Immunol 153:873–880[Abstract]
  25. Masquilier D, Foulkes NS, Mattei MG, Sassone-Corsi P 1993 Human CREM gene: evolutionary conservation, chromosomal localization, and inducibility of the transcript. Cell Growth Differ 4:931–937[Abstract]
  26. Woloshin PI, Walton KM, Rehfuss RP, Goodman RH, Cone RD 1992 3'5'-cyclic adenosine monophosphate-regulated enhancer binding (CREB) activity is required for normal growth and differentiated phenotype in the FRTL5 thyroid follicular cell line. Mol Endocrinol 6:1725–1733[Abstract/Free Full Text]
  27. Giuliani C, Saji M, Napolitano G, Palmer LA, Taniguchi SI, Shong M, Singer DS, Kohn LD 1995 Hormonal modulation of major histocompatibility complex class I gene expression involves an enhancer A-binding complex consisting of Fra-2 and the p50 subunit of NF-{kappa}B. J Biol Chem 270:11453–11426[Abstract/Free Full Text]
  28. Chang CH, Hammer J, Loh JE, Fodor W, Flavell RA 1992 The activation of major histocompatibility complex class I genes by interferon regulatory factor-1 (IRF-1). Immunogenetics 35:378–384[Medline]
  29. Drew PD, Franzoso G, Becker KG, Bours V, Carlson LM, Siebenlist U, Ozato K 1995 NF kappa B and interferon regulatory factor 1 physically interact and synergistically induce major histocompatibility class I gene expression. J Interferon Cytokine Res 15:1037–1045[Medline]
  30. Ikuyama, S, Niller, HH, Shimura, H, Akamizu, T, Kohn LD 1992 Characterization of the 5'-flanking region of the rat thyrotropin receptor gene. Mol Endocrinol 6: 793–804
  31. Ikuyama, S, Shimura, H, Hoeffler, JP, Kohn LD 1992 Role of the cyclic AMP response element in efficient expression of the rat thyrotropin receptor. Mol Endocrinol 6:1701–1715[Abstract/Free Full Text]
  32. Shimura, H, Ikuyama, S, Shimura, Y, Kohn, LD 1993 The cAMP response element in the rat thyrotropin receptor promoter: regulation by each decanucleotide of a flanking tandem repeat uses different, additive, and novel mechanisms. J Biol Chem 268:24125–24137[Abstract/Free Full Text]
  33. Shimura, H, Okajima, F, Ikuyama, S, Shimura, Y, Saji, M, Kohn LD 1994 Thyroid-specific expression of the thyrotropin receptor promoter and autoregulation of the thyrotropin receptor gene by cAMP involves thyroid transcription factor-1 (TTF-1). Mol Endocrinol 8:1049–1069[Abstract/Free Full Text]
  34. Shimura, Y, Shimura, H, Ohmori, M, Ikuyama, S, Kohn, LD 1994 Identification of a novel insulin-response element in the rat thyrotropin receptor promoter. J Biol Chem 269:31908–31914[Abstract/Free Full Text]
  35. Ohmori, M, Shimura, H, Shimura, Y, Ikuyama, S, Kohn, LD 1995 Identification and characterization of an upstream thyroid transcription factor-1 binding site in the rat thyrotropin receptor promoter. Endocrinology 136:269–282[Abstract]
  36. Shimura, H, Shimura, Y, Ohmori, M, Ikuyama, S, Kohn, LD 1995 Single strand DNA-binding proteins and thyroid transcription factor-1 conjointly regulate thyrotropin gene expression. Mol Endocrinol 9:527–539[Abstract/Free Full Text]
  37. Ohmori, M, Ohta, M, Shimura, H, Shimura, Y, Suzuki, K, Kohn, LD 1996 Cloning of the single strand DNA-binding protein important for maximal expression and thyrotropin-induced negative regulation of the thyrotropin receptor. Mol Endocrinol 10: 1407–1424
  38. Ohmori, M, Shimura, H, Shimura, Y, Kohn, LD 1996 A Y-Box protein is a suppressor factor which decreases thyrotropin receptor (TSHR) gene expression. Mol Endocrinol 10:76–89[Abstract/Free Full Text]
  39. Chin, M, Pellacani, A, Wang, H, Lin, S, Jain, M, Perrella, M, Lee, M 1998 Enhancement of serum-response factor dependent transcription and DNA binding by the architectural transcription factor HMG-I(Y). J Biol Chem 273: 9755–9760



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. Grassadonia, N. Tinari, B. Fiorentino, M. Nakazato, H.-K. Chung, C. Giuliani, G. Napolitano, S. Iacobelli, T. K. Howcroft, D. S. Singer, et al.
Upstream Stimulatory Factor Regulates Constitutive Expression and Hormonal Suppression of the 90K (Mac-2BP) Protein
Endocrinology, July 1, 2007; 148(7): 3507 - 3517.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Howcroft, J. D. Weissman, A. Gegonne, and D. S. Singer
A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression
J. Immunol., February 15, 2005; 174(4): 2106 - 2115.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-C. Goffard, L. Jin, H. Mircescu, P. Van Hummelen, C. Ledent, J.-E. Dumont, and B. Corvilain
Gene Expression Profile in Thyroid of Transgenic Mice Overexpressing the Adenosine Receptor 2a
Mol. Endocrinol., January 1, 2004; 18(1): 194 - 213.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kim, J. M. Suh, E. S. Hwang, D. W. Kim, H. K. Chung, J. H. Song, J. H. Hwang, K. C. Park, H. K. Ro, E.-K. Jo, et al.
Thyrotropin-Mediated Repression of Class II Trans-Activator Expression in Thyroid Cells: Involvement of STAT3 and Suppressor of Cytokine Signaling
J. Immunol., July 15, 2003; 171(2): 616 - 627.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirshner, S.
Right arrow Articles by Singer, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirshner, S.
Right arrow Articles by Singer, D. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals