| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Immunology Branch (S.K., L.P., J.B., D.S.S.) National Cancer Institute, and Cell Regulation Section Metabolic Diseases Branch (M.S., L.D.K.) National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
,ß, and
(2 ). We have recently proposed that overexpression of class I molecules on the cell surface may trigger certain autoimmune diseases (3 4 5 6 7 8 ). Such inappropriate expression might result in the presentation of aberrantly high levels of self-antigens to the immune system, thereby breaking tolerance and inducing autoimmune reactions. Indeed, whereas the thyroid normally expresses low, but detectable, class I, the level of class I is elevated in autoimmune thyroid disease. Also consistent with this hypothesis, both methimazole, which is used to treat patients with autoimmune thyroid disease, and iodide decrease transcription and cell surface expression of class I (3 9 ). Importantly, mice deficient in class I expression are resistant to the induction of an experimental model of the autoimmune disease, systemic lupus erythematosus, whereas class I+ mice are susceptible to this disease (10 ). Thus class I molecules appear to play an important role in the etiopathology and/or maintenance of some autoimmune diseases.
To understand the molecular basis underlying autoimmune thyroid disease, we have begun to analyze the normal regulatory mechanisms governing MHC class I gene expression. We have demonstrated previously that the pituitary hormone TSH, which stimulates a spectrum of metabolic activities, including transcription of the thyroglobulin and thyroid peroxidase genes, also represses class I and TSHr gene transcription (3 4 7 8 11 ). However, the molecular mechanisms and regulatory factors involved in this repression remained unknown. In the present studies, we have defined the promoter response elements and one of the factors that mediate the hormonal repression of class I transcription.
Repression of class I transcription is triggered by the binding of TSH to its receptor on the thyrocyte cell surface. The TSHr is a G protein-coupled receptor whose engagement results in increased intracellular level of cAMP (12 ). FSK, which also increases cAMP, similarly represses transcription of class I in thyroid cells (4 ) in a manner indistinguishable from TSH. cAMP is known to modulate transcription through tissue-specific modification of an array of transcription factors. Among the best studied examples are the members of the cAMP response element binding protein (CREB)/activating transcription factor (ATF) family, AP2, c-jun, and CREM. Many of these factors belong to the large family of leucine zipper proteins that interact with highly related DNA binding sites (13 14 15 ). Increased intracellular cAMP levels activate protein kinase A (PKA)(16 ), which in turn phosphorylates target transcription factors. For example, CREB is constitutively associated with its cognate DNA sequence element, cAMP response element (CRE), but does not activate transcription. In response to phosphorylation by PKA, it recruits the transcriptional coactivator CREB-binding protein (CBP), thereby stimulating transcription (16 ).
cAMP/PKA also induces transcription of at least one set of transcription repressor factors, namely the ICER (inducible cAMP early response) subfamily of CREM gene products (14 ). The ICER proteins are small (1720 kDa) proteins generated by transcription initiated from an intronic promoter within the CREM gene. ICER is composed of the DNA binding domain and leucine zipper domain of CREM but does not have the transactivation domains, resulting in its repressive function. ICER isoforms are generated by alternative splicing of the transcript (12 17 ). Of interest, ICER has been shown to be induced in thyroid cells by TSH (18 ). However, the functional consequences of ICER induction in thyrocytes are not known.
The present studies were undertaken to elucidate the signal pathways and target DNA sequence elements in the class I promoter region that are responsive to the TSH-stimulated increases in cAMP in the rat thyroid line, FRTL-5. We report that overexpression of PKA can reproduce the effects of TSH/cAMP in reducing class I transcription. Moreover, we show that at least three PKA-responsive elements within the region mapping between -203 and -50 bp of proximal class I promoter sequence function in concert. One of these maps to a CRE-containing element (-127 to -90). In addition, two novel elements map to a 30-bp segment (-160 to -130) that partially overlaps the interferon response element. Further, we describe a novel role for ICER protein, which is induced by TSH/cAMP. ICER associates with both the CRE and 30-bp segment to repress class I transcription. However, ICER binding requires another cellular activity to contribute to the formation of novel TSH-induced regulatory complexes, thereby suppressing class I promoter activity. The identity of this cellular factor is not known, but it is neither CREM nor CREB. Based on these findings, we propose that TSH/cAMP repression of class I transcription occurs through a PKA-dependent pathway that requires a complex set of interactions among transcription factors and DNA sequence elements that is dynamically adjusted in response to external hormonal signals.
| RESULTS |
|---|
|
|
|---|
|
The observed repression of class I transcription was not due to the
global repression of all transcription by PKA. For example, the
activity of a thyroglobulin promoter/CAT reporter construct was
stimulated 2- to 3-fold by cotransfection with the PKA catalytic
subunit or by treatment with TSH or FSK (Fig. 1C
). Thus, PKA mimics the
effects of TSH/cAMP, namely repressing transcription from the class I
promoter, yet stimulating transcription from the thyroglobulin
promoter.
At Least Two Upstream Regulatory Elements Are Involved in
PKA-Mediated Repression of the Class I Promoter
A CRE-like element (-107 bp to -100 bp) in the class I promoter
was previously shown to play a role in the TSH response (11 ). Deletion
of this CRE-like element, generating the construct 203
CRE (Fig. 2A
), renders the promoter refractory to
TSH-mediated repression (Fig. 2B
). The 203
CRE promoter activity is
also not repressed by PKA: indeed, the 203
CRE is modestly enhanced
by PKA. These data demonstrate that the CRE-like element is one target
for PKA-induced repression and suggest the possible presence of a
distinct element that is activated by PKA alone.
|
30,
Fig. 2A
Deletion of either the CRE-like element or the 30-bp segment also
significantly reduced basal promoter activity relative to 203CAT (Fig. 2
), indicating that in the absence of TSH, these elements function as
constitutive enhancers of transcription. However, the decreased basal
transcription of the mutant promoters does not account for the
inability of PKA to further repress them since their basal activities
are still significantly above background; conversely, another class I
promoter construct mutated in the 30-bp region has high basal activity
and is not repressed by PKA (Fig. 2
and see
301 in Table 2
).
|
The CREM Family Member, ICER, Represses Class I Promoter Activity
in FRTL-5 Cells
cAMP, through its activation of PKA, is known to modulate the
activity of a number of different transcription factors, including CREB
and CREM. In FRTL-5 cells, TSH has been shown to induce the
transcriptional repressor, ICER (18 ). However, the function of
ICER in these cells has not been demonstrated. To test the possibility
that ICER may be involved in the PKA-mediated repression of class I
promoter activity, FRTL-5 cells were transfected with the class I
promoter construct, 203CAT, in the presence of either an ICER
expression vector or a control vector. As shown in Fig. 3
, expression of ICER in the FRTL-5 cells
significantly reduced the class I promoter activity, to 0.44 ±
0.13 of the control level. Furthermore, ICER, like TSH and PKA, had no
effect on the activity of either the 203
30 or 203
CRE constructs,
mapping the ICER target to these two elements. These findings are
consistent with the interpretation that TSH/PKA-induced repression of
class I transcription is achieved, at least in part, through the
induction of ICER.
|
|
The PKA-Induced Transcription Factor, ICER, Is a Component of a
Novel TSH-Induced Protein/DNA Complex
The above studies indicate that distinct regulatory elements are
targeted in the response of the class I promoter to TSH/PKA: the
CRE-like element, and elements within the 30-bp segment. These elements
are functionally interdependent, since deletion of either the CRE or
the 30-bp segment eliminates PKA-mediated repression of promoter
activity. Furthermore, ICER, which represses class I promoter activity
and binds to the CRE and 30-bp segment, is induced by cAMP in response
to TSH treatment of FRTL-5 cells (18 ). These findings predict that TSH
treatment of FRTL-5 cells should lead to the induction of a novel
protein/DNA complex, and that this complex should contain ICER binding
to the CRE-like element and the 30-bp segment. Indeed, consistent with
this prediction, as we have previously reported, gel shift assays with
the 168-bp probe and extract derived from FRTL5 cells grown in the
presence of TSH gave rise to two novel complexes (Fig. 5
, lane 2, bands F and G) in addition to
the series of low-mobility bands that are also generated by extract
derived from untreated cells (Fig. 5
, lane 1, bands A, B, and C).
Comparable F and G complexes were formed with extracts from FSK or
(Bu)2 -cAMP treated cells (data not shown). Thus
TSH, FSK, or (Bu)2 cAMP treatment of FRTL-5 cells
led to the induction of novel protein/DNA complexes with the 168-bp
probe. The ability of (Bu)2 cAMP to mimic the
effects of TSH and FSK is consistent with a role for PKA in the
repression of class I transcription. Thus, TSH treatment of FRTL-5
cells either induces de novo expression or posttranslational
activation of DNA-binding factors, which results in the appearance of
novel protein-DNA complexes.
|
|
Surprisingly, the complex generated by the binding of ICER to the
168-bp probe did not correspond in mobility to either of the
TSH-induced F or G complexes. Since leucine zipper family members form
both homo- and heterodimers (12 ), we considered the possibility that
in vivo ICER interacts with a constitutively expressed
cellular factor to generate the novel complexes observed in extracts
after TSH treatment of FRTL-5 cells. To examine this possibility, we
combined recombinant ICER with extracts from cells grown in the absence
of TSH (Fig. 7
). We tested two of the
four known ICER isoforms: ICERII, containing all the exons and
ICERII
from which the
-exon is deleted (12 25 ). The addition of
increasing amounts of FRTL-5 extract to a constant amount of either
recombinant ICER isoform resulted in the formation of a complex
indistinguishable in mobility from that of the G complex (Fig. 7
). This
indicates that formation of the G complex depends upon a constitutively
expressed cellular factor, in addition to the PKA-induced ICER. It is
unlikely that formation of the G complex results from enhanced ICER
binding due to a nonspecific protein effect of the cell extract, since
addition of extracts other than the FRTL-5 do not generate the G
complex (data not shown). Similarly, it is unlikely that G complex
formation is due to a nonspecific effect of addition of bacterial
extract, since the addition of the pGEX (GST) extract had no effect
(Fig. 7
, lanes 1215). It is noteworthy that the addition of extract
to the recombinant ICER did not generate the F complex, suggesting that
TSH may induce an additional cellular activity that is necessary to
generate the F complex.
|
In summary, the data suggest that ICER in combination with a constitutive component in the FRTL-5 extract generates complexes indistinguishable from the TSH-induced complex G. The identity of this cellular factor remains to be determined.
TSH-Induced Complexes Depend on Both the CRE-Like Element and the
30-bp Segment
The above studies demonstrate that ICER represses class I promoter
activity, that this repression depends on both the CRE-like element and
the 30-bp segment, that ICER binds to both these sequences, and that
ICER is a component of TSH-induced complexes formed with the 168-bp
probe and extracts from TSH/FSK-treated cells. These findings predict
that formation of the novel F and G complexes depends on the CRE-like
element and the 30-bp segment. To map the DNA sequence elements
involved in generating both the constitutive and TSH-induced complexes,
we examined the ability of unlabeled double-stranded oligonucleotides
representing sequences within the 168-bp fragment to inhibit complex
formation with extract from TSH-treated or control FRTL-5 cells (Fig. 8
). A DNA fragment spanning the CRE-like
element eliminated both novel TSH-induced complexes, F and G,
demonstrating that the CRE-like element is a binding site within each
complex (Fig. 8
, lane 7). A DNA fragment spanning the 30-bp segment
also completely competed the same two TSH-induced complexes (Fig. 8
, lane 8), demonstrating that sequences within this segment are also
binding sites. These competitions were specific since neither
oligonucleotide competed any of the constitutive complexes A, B, or C
which form in extracts from both control and TSH-treated cells.
Furthermore, an oligonucleotide spanning the basal promoter sequences
(Prm) consistently competed the constitutive complexes, A, B, and C,
but did not affect the TSH-induced complexes, F and G (Fig. 8
, lanes 5
and 9). Neither the 30-bp segment nor the CRE reproducibly affected
complexes formed in the absence of TSH, whereas the promoter
consistently did so (Fig. 8
, lanes 25).
|
|
301,
302 , and
303). The sequences deleted in these constructs are
provided in Table 1
301, with a 5' 13-bp
deletion, nor the
303 construct, with a 3' ll-bp deletion, were
repressed by PKA when transfected into FRTL-5 cells (Fig. 9B
302, with a central 13-bp deletion, remained responsive to PKA
under these conditions. Thus, there are two distinct regulatory
elements contained within the 30-bp segment that are required for
PKA-induced repression of transcription: the 301 element and the
303 element. The failure of the
301 construct to respond to PKA
was not due simply to a change of either spacing or phasing of the
promoter elements, since the deletion in this construct was the same
length as the deletion in the
302 construct, which was repressed
by PKA. The deletion in the
303 construct was only 11 bp, and
therefore an effect of spacing or phasing of the DNA cannot be formally
ruled out. The failure to respond to PKA was not due to the loss of
basal promoter activity: the
301 construct was not repressed by
PKA despite almost normal levels of transcription. Therefore, under
these conditions, both the 30-1 and 30-3 regions
function as PKA-response elements in the repression of class I
transcription.
|
30
construct was 40% that of wild type, mapping a
constitutive enhancer within the 30-bp segment (Fig. 2
303 construct was also markedly reduced relative to that of the
wild-type 203CAT construct, whereas the activities of the
301 and
the
302 constructs were not, the constitutive enhancer maps to the
303 segment between -140 and -130 bp (Table 2
The transfection data indicated that both the 301 and the 303
elements were involved in mediating TSH-induced repression of the class
I promoter (Fig. 9B
). The gel shift experiments demonstrated that the
30-bp segment is involved in the formation of the TSH-induced F and G
complexes (Fig. 8
). Therefore, the role(s) of the 301 and 303
regions in the formation of these complexes was examined in gel shift
competition experiments (Fig. 10
).
Oligonucleotides spanning the 30-bp segment were assayed for their
ability to compete the F and G complexes formed with the 168-bp probe
(Fig. 10
, lanes 911). An oligonucleotide deleted of the 303 segment
(30
3) was unable to compete the TSH-induced bands, indicating that
the 303 sequence participates in complex formation. This is
consistent with the finding that the 303 segment is necessary for the
functional PKA response. In contrast, an oligonucleotide deleted of the
301 segment (30
1) did compete both the F and G complexes,
indicating that sequences necessary for complex formation remain within
this segment. However, deletion of the 301 segment eliminated
TSH/PKA-mediated repression (Fig. 9B
). Similarly, whereas the
302
construct retained a PKA response, the oligonucleotide deleted of the
302 segment (30
2) was unable to compete. Taken together, these
findings suggest that although the 30-bp segment is necessary both for
PKA-induced repression and for the formation of the F and G complexes,
the formation of the F and G complexes may not be sufficient for a PKA
response.
|
| DISCUSSION |
|---|
|
|
|---|
The induction of increased intracellular cAMP by TSH results in a
variety of cellular responses, among them the activation of PKA (26 ).
PKA activation, in turn, results in the induction of the transcription
factor, ICER, which represses class I transcription (Fig. 11
). ICER-mediated repression depends
on three distinct cis-acting response elements in the class
I promoter, all of which function in concert to repress class I
transcription in response to cAMP. One of these elements is a CRE-like
element spanning -107 to -100 bp; the others are novel elements
contained within a 30-bp segment, -160 bp to -130 bp. The elements
contained within the 30-bp segment have not been identified previously
as cAMP/PKA response elements and are not homologous to the CRE.
Although ICER alone binds to both the CRE-like element and the 30-bp
segment, it requires another cellular factor to form the higher-order
repression complexes that are specifically induced in response to TSH.
Thus, hormonal regulation of class I expression is coordinated by the
combinatorial interaction of multiple transcription factors with
multiple response elements that lie within the region -160 bp to -100
bp upstream of the transcription initiation site. In conclusion, we
postulate that PKA mediates the TSH-induced repression of class I gene
transcription.
|
ICER is a truncated product of the CREM gene generated by transcription from an internal start site. It contains CREM DNA binding and leucine zipper domains, but lacks other domains that are involved in transcriptional regulation (12 17 18 ). Thus, ICER can bind to CREs and can dimerize with other leucine zipper-containing proteins, but is unable to transactivate. We speculate that ICER may repress class I transcription by forming higher-order protein/DNA complexes that inhibit transcriptional enhancers.
Dynamic regulation of MHC class I gene expression is achieved by complex interactions among a series of regulatory elements. Further complexity is achieved by the multiple functional activities of each of the regulatory elements. Here we have shown that the 30-bp segment and the CRE-like element each subsume two functions: 1) they are required to respond to PKA; and 2) they function as constitutive enhancers of class I expression; their deletion reduces constitutive class I expression. Indeed within the 30-bp segment we have found that the requirements for transrepression and transactivation only partially overlap. The 301 and 303 elements are both required for PKA-induced repression of class I. But the constitutive enhancer activity of the 30-bp segments maps only to the 303 region. This suggests that ICER binds to the class I promoter in a CRE, 301, and 303 bp dependent manner, thereby leading to the displacement or alteration of transactivating complexes that only require the CRE and 303 segments.
Based on the present findings, as well as our earlier studies, we
propose the following model for regulation of MHC class I
transcription, as depicted in Fig. 11
. In the absence of TSH, FRTL-5
cells express multiple transcription factors that enhance class I
expression. Among these, we have identified a number of ubiquitously
expressed factors. A heterodimer (termed Mod-1), composed of the p50
subunit of NF-
B and the Fos family member Fra2, binds to enhancer A
to increase transcription (9 27 ). Similarly, the factor IRF-1 enhances
expression by binding to the IRE (28 29 ). In previous studies we have
identified several transcription factors that bind to the class I CRE
region; CREB/ATF1 was a minor component of the complexes binding to the
class I CRE using FRTL-5 cell extracts. In contrast, the
thyroid-specific transcription factor TTF-1 was a major component of
the complexes, binding in a CRE-dependent manner to two sites flanking
the CRE (11 ). Both EMSA and functional data support a model in which
TTF-1 rather than CREB/ATF1 is the dominant CRE-binding modulator of
class I activity in FRTL-5 cells in the absence of TSH. All of these
factors, binding to discrete sequence elements, modulate the activity
of the downstream core promoter. The activities of these transcription
factors are likely to be integrated by a large scaffolding protein.
Indeed, recent evidence suggests that the co-activator, CBP/p300,
transduces the regulatory signals governing class I promoter activity
to the preinitiation complex (PIC), in the absence of TSH (S.
Kirshner, J. Weissman, T. K. Howcroft, and D. S. Singer, manuscript
in preparation).
Repression of class I transcription by TSH also involves multiple DNA
sequence elements, transcription factors, and distinct mechanisms that
operate to accomplish the overall repression of promoter
activity (Fig. 11
). TSH binding to the TSHr leads to elevated levels of
cAMP. In turn this leads to the activation of PKA. Active repression is
dependent upon TSH/cAMP-induced ICER, which in association with a
constitutively expressed factor (designated x in Fig. 11
), binds
to the CRE-like element and the 30-bp segment. The direct interaction
of ICER with the class I promoter may displace positive regulatory
factors, as is depicted in Fig. 11
. Alternatively ICER may interfere
with the ability of the positive regulatory factors to interact in a
coordinated manner with the preinitiation complex. Passive"
repression of promoter activity may occur as a result of eliminating
active enhancement. As one example, the TTF-1 mediated enhancer
activity of the CRE-like element is lost in response to TSH/cAMP (11 ).
TSH/cAMP reduces TTF-1 mRNA and protein levels leading to reduced
promoter occupancy and reduced levels of transcription. TSH/cAMP also
increases expression of the transcription factor Pax-8. Pax-8 alone has
no effect on class I transcription. But its binding to the class I
promoter inhibits TTF-1 stimulated class I transcription (11 ). Thus,
ICER and PAX-8 may both inhibit class I expression by interfering with
the binding of trans-activators to the class I promoter,
suggesting that transcriptional repression of class I is mediated by
complex interactions of multiple elements.
The mechanisms of TSH/cAMP repression of class I transcription parallel those previously characterized for the TSHr, which also targets multiple DNA sequence elements and transcription factors (30 31 32 33 34 35 36 37 38 ). Among the transcription factors mobilized by TSH are both thyroid-specific factors (i.e. TTF1) and ubiquitously expressed ones (i.e. CREB, ATF1). In addition, single strand DNA-binding proteins (i.e. SSBP-1 and the Y-box binding protein, TSEP) are also involved in regulating the TSH/cAMP repression of both genes.
It is tempting to speculate that these complex integrated response networks have arisen to broaden the repertoire generated by a finite vocabulary of effectors (transcription factors and DNA response elements). Indeed, the class I CRE, in the context of a heterologous promoter, acts as a constitutive repressor rather that an constitutive enhancer (4 ). Taken together, the present findings indicate that TSH/cAMP regulate class I transcription through the coordinated interaction of multiple target proteins, including the PKA-induced transcription of ICER, and multiple DNA response elements. Moreover, within the region -203 bp to -50 bp, multiple signals that regulate class I transcription in response to dynamic, hormonal stimuli in the cell are integrated. Future studies will be directed toward characterizing the mechanisms of integration of these transcriptional signals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation of Plasmid Constructs
Construction of the CAT chimeras of the swine class I promoter
PD1 5'-flanking sequences p(-203CAT), p(-127)CAT, 203
30, and
203
CRE have been described (9 ). The
301 and
302 constructs
were created by PCR (95 C, 1 min; 54 C, 2 min; 72 C, 3 min; DNA Thermal
Cycler, Perkin-Elmer Cetus, Norwalk, CT) using 100
ng of p(-203)CAT as template and 20 µM of each of the
primer pairs. Round 1 PCR was performed using the round 1 PCR primer
pairs to generate two overlapping fragments spanning from -203 to +1.
Primers 1 and 5 are derived from sequences in the 30-bp segment and
incorporate the
301 and
302 dropout mutations. The PCR
products were purified from a 3% agarose gel, and the pairs of
fragments were annealed and filled in using Klenow large fragment DNA
polymerase. The filled-in fragments were then used as template for a
second round of PCR with the external primers (2 and 4 below) to
generate a single fragment. The products of this reaction were cut with
BamHI and HindIII and ligated into the
promoterless CAT vector pSV3CAT that had been cut with BglII
and HindIII.
Round 1 PCR primer pairs for preparing the
301 construct are: 1)
GGTTGCGAGATGGGGACACG/2) CAGGGCGGAGATCTGGGC, 3) CGTGTCCCCATCTCGCAACC/4)
GAGAAGCTTGAGCAGAGC;
Round 1 PCR primer pairs for preparing the
302 construct are: 5)
ggtcccacacgagaagtgaaac/2) CAGGGCGGAGATCTGGGC, 6)
GTTTCACTTCTCGTGTGGGACC/4) GAGAAGCTTGAGCAGAGC.
The
303 construct was created by BamHI cleavage of
p(-127)CAT and insertion of an oligo spanning from -203 to -127 that
contained the
303 mutation. The sequences of all constructs were
confirmed by standard sequencing methods (19 ).
RSV-Cat-ß (pKß) and RSV-Cat-ß mutant (pKß mutant), mammalian expression vectors for the catalytic subunit of PKA, were kindly provided by Richard Maurer (Oregon Health Sciences University, Portland OR). pKß mutant contains a point mutation that renders the protein catalytically inactive (20 ). Construction of the JL56 and BL46 ICER expression vectors has previously been described (21 22 ).
Transient Expression Analysis
Transient transfections in FRTL-5 cells were performed by
electroporation using either of the following protocols with
comparable results. In the first protocol, cells were cultivated
in 6H medium to approximately 80% confluency, harvested, washed with
cold PBS (pH 7.4; Biofluids, Rockville MD), and
resuspended (3.75 x 107 cells/ml) in 0.80
ml PBS. Plasmid DNA, 20 µg of the CAT chimera together with 20 µg
of either pUC or an expression vector to a total of 40 µg, were added
to a 4-mm gap electroporation cuvette (Bio-Rad Laboratories, Inc., Hercules, CA) and cells were incubated for 10 min on ice.
Thereafter cells were pulsed (300 V; capacitance, 960 µfarad;
Genepulser, Bio-Rad Laboratories, Inc.), plated (7.5
x 106 cells per 10-cm dish) and cultured in 6H
medium. After 24 h the medium was aspirated, the cells were rinsed
with PBS and maintained in medium not supplemented with insulin and
hydrocortisone, and were treated or not with
10-10 M TSH, 10 µM
forskolin (Sigma), or 1 mM
(Bu)2cAMP (Sigma). After two
additional days cells were harvested for CAT and protein assays.
In the second protocol cells were cultivated to approximately 80% confluency in 6H medium. Thereafter they were maintained in medium without TSH and either with or without additional insulin and hydrocortisone, as noted, for 57 days. Twelve to 18 h before transfection the TSH free medium was exchanged for 6H medium. Cells were then harvested, washed in Coons F12 medium buffered with sodium bicarbonate and supplemented with 5% bovine serum (transfection buffer), and resuspended in transfection buffer (57.5 x 107 cells/ml). Plasmid DNA, 10 µg of the CAT chimera together with 10 µg of either pUC or an expression vector were added to a 4-mm gap electroporation cuvette along with 200 µl of the cell preparation. Cells were pulsed (230 V; capacitance, 960 mfarad; Genepulser, Bio-Rad Laboratories, Inc.), plated (7.5 x 106 cells per 10-cm dish) and cultured in 6H medium. Thereafter cells were treated as above.
CAT activity was measured as described (4 ), using 1030 µg cell lysate in a final volume of 130 µl. Incubation was at 37 C for 4 h with additional acetyl-CoA supplementation (20 µl of a 3.5 mg/ml solution) after 2 h. Acetylated chloramphenicol was separated by TLC and quantified using an Ambis (Scanalytics, Billerica, MA). CAT activity was normalized by protein. Protein was determined using the BCA protein assay kit (Pierce Chemical Co., Rockford, IL) according to the manufacturers instructions.
Preparation of Whole Cell Extracts
Cellular extracts were made by a modification of the method of
Dignam et al. (23 ). FRTL-5 cells were harvested by
scraping after being washed twice in ice-cold PBS. The cells were
pelleted and then resuspended in 2 volumes of Dignam Buffer C with
freshly added 0.5 mM phenylmethylsulfonyl
fluoride, 1 mg/ml leupeptin, 1 mg/ml pepstatin, and phosphatase
inhibitor mix [4 mM sodium orthovanadate, 4
mM EDTA, 100 mM sodium
fluoride, 100 mM sodium pyrophosphate (hydrated)
pH 7.6]. Protein concentration was determined using the BCA protein
kit (Pierce Chemical Co.). The supernatant was aliquoted
and stored at -70 C.
Bacterial Expression of ICER Proteins
Competent Escherichia coli BL21 cells were
transformed with pGEX3.1, pGEX3.1JL56 (expressing ICERII), or
pGEX3.1BL46 (expressing ICERII
) as previously described (21 22 ).
After the last wash the beads were resuspended in 1 ml PBS, transferred
to an Eppendorf (Madison, WI) tube, and spun at 4,000 rpm
for 1 min, and the supernatant was discarded.
Thrombin Cleavage of ICER
Since thrombin is inhibited by phenylmethylsulfonyl fluoride,
the pellets were washed three times in 1 ml PBS (150 mM
NaCl, 20 mM NaPO4, pH = 7.3, 0.5
mM EDTA) in the absence of protease inhibitors. Thrombin
protease (Pharmacia Biotech,Piscataway, NJ) was used
according to the manufacturers instructions. Briefly, 50 U of
thrombin protease were added to the beads in 1 ml of PBS. The beads
were rotated overnight at room temperature. Thereafter the beads were
pulsed in a microfuge at maximum speed and the supernatant transferred
to a fresh tube. Glycerol was added to achieve a final concentration of
10%, and the samples were aliquoted and frozen. The purity of the
products was determined by SDS-PAGE.
Electrophoretic Mobility Shift Assay (EMSA).
The following oligonucleotides:
39 mer, TGTCCCCAGTTTCACTTCTCCGTCTCGCAACCT- GGTGTGG;
30 mer, GTTTCACTTCTCCGTCTCGCAACCTGTGTGG;
301, TATGTCCCCAGTCTCGCAACCTGTGTGGCA;
302, TATGTCCCCAGTTTCACTTCTCGTGTGGCA;
303, TATGTCCCCAGTTTCACTTCTCCGTCTCGC;
PD1CRE, CCGTCCTGCCCGGACACTCGTGACGCGACC- CCACTTCTC;
Prm, AGCTTCGGCGCCACTGCCGTTCCCGGTTCTAAAC TCT CCACCCACCCGGCTCTGCTCAGCTTCTCCCCAGA; and
5'CRE, GGGACCCGTCCTGCCCGGACACTC were synthesized using an ABI 380
synthesizer (Perkin-Elmer Corp., Norwalk, CT). The
HTLV-CRE sequence, AAGGCTCTGACGTCTCCCCCC, was synthesized as previously
described (21 22 ). Fragment 168 was prepared by HindIII
digestion of the 168CAT construct. The fragment was purified from a
1.5% agarose gel using a GenElute column (Supelco,
Bellefonte, PA). Probes were end labeled with
-32P-ATP using T4 polynucleotide kinase and
then purified using an Elutip-D column (Schleicher & Schuell, Inc., Keene, NH) according to the manufacturers
instructions.
One to 3 µg of whole cell extract from FRTL-5 cells or 50250 ng of recombinant protein were incubated for 30 min at room temperature, and in 20 µl of binding buffer. Recombinant CREM protein was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). EMSA reaction mixtures included 1.5 fmol of labeled DNA, whole cell extract, or purified protein as indicated, and 3 µg poly(dI-dC) (Roche Molecular Biochemicals) in 10 mM Tris-Hcl (pH 7.9) containing 1 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, and 5% glycerol. For competitions with double-stranded oligonucleotides (oligos), whole cell extract and oligos were incubated in 20 µl of binding buffer without labeled probe for 20 min at room temperature. Thereafter probe was added for a further 20-min incubation at room temperature. For antibody supershift assays, antibody was preincubated with cell extract in 20 µl of binding buffer without probe for 20 min at room temperature. Thereafter probe was added for a further 20-min incubation at room temperature. After incubations, reaction mixes were subjected to electorphoresis on 4% or 6% native polyacrylamide gels at 160 V in 0.5x TBE at room temperature. Gels were dried and autoradiographed.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Current Address: Department of Surgery, Johns Hopkins University,
Ross Building, Room 756, 720 Rutland Avenue, Baltimore, Maryland
21287. ![]()
Received for publication March 26, 1999. Revision received August 10, 1999. Accepted for publication September 22, 1999.
| REFERENCES |
|---|
|
|
|---|
/ß-interferon treatment. Immunogenetics 30:1826[CrossRef][Medline]
B. Mol
Endocrinol 12:1933
B.
J Biol Chem 270:1145311426This article has been cited by other articles:
![]() |
A. Grassadonia, N. Tinari, B. Fiorentino, M. Nakazato, H.-K. Chung, C. Giuliani, G. Napolitano, S. Iacobelli, T. K. Howcroft, D. S. Singer, et al. Upstream Stimulatory Factor Regulates Constitutive Expression and Hormonal Suppression of the 90K (Mac-2BP) Protein Endocrinology, July 1, 2007; 148(7): 3507 - 3517. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Howcroft, J. D. Weissman, A. Gegonne, and D. S. Singer A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression J. Immunol., February 15, 2005; 174(4): 2106 - 2115. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Goffard, L. Jin, H. Mircescu, P. Van Hummelen, C. Ledent, J.-E. Dumont, and B. Corvilain Gene Expression Profile in Thyroid of Transgenic Mice Overexpressing the Adenosine Receptor 2a Mol. Endocrinol., January 1, 2004; 18(1): 194 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, J. M. Suh, E. S. Hwang, D. W. Kim, H. K. Chung, J. H. Song, J. H. Hwang, K. C. Park, H. K. Ro, E.-K. Jo, et al. Thyrotropin-Mediated Repression of Class II Trans-Activator Expression in Thyroid Cells: Involvement of STAT3 and Suppressor of Cytokine Signaling J. Immunol., July 15, 2003; 171(2): 616 - 627. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |