| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
B1 Isoforms to Bind the Angiotensinogen Gene Acute-Phase Response Element: A Stimulus-Specific Pathway for NF-B Activation
Department of Internal Medicine (M.J., T.M., J.S., Y.H., A.R.B.) Department of Microbiology & Immunology (I.B.) Sealy Center for Molecular Sciences (A.R.B.) University of Texas Medical Branch Galveston, Texas 77555-1060
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(TNF)]-
inducible enhancer by binding the heterodimeric nuclear factor-
B
(NF-B) complex Rel A•NF-B1. Here, we compare the mechanism for
NF-B activation by the AII agonist, Sar1
AII, with TNF in HepG2 hepatocytes. Although
Sar1 AII and TNF both rapidly activate
APRE-driven transcription within 3 h of treatment, the pattern of
inducible NF-B binding activity in electrophoretic mobility shift
assay is distinct. In contrast to the TNF mechanism, which strongly
induces Rel A•NF-B1 binding, Sar1
AII selectively activates a heterogenous pattern of NF-B1 binding.
Using a two-step microaffinity DNA binding assay, we observe that
Sar1 AII recruits 50-, 56-, and 96-kDa NF-B1
isoforms to bind the APRE. Binding of all three NF-B1 isoforms
occurs independently of changes in their nuclear abundance or
proteolysis of cytoplasmic IB inhibitors. Phorbol ester-sensitive
protein kinase C (PKC) isoforms are required because PKC
down-regulation completely blocks AII-inducible transcription and
inducible NF-B1 binding. We conclude that AII stimulates the NF-B
transcription factor pathway by activating latent DNA-binding activity
of NF-B subunits through a phorbol ester-sensitive (PKC-dependent)
mechanism. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The intravascular renin-angiotensin system (RAS) is a cardiovascular homeostatic system that produces peptides such as the vasopressor, angiotensin II (AII), in the intravascular space (1 2 ) as a response to cardiovascular stress. In response to hypotensive stimuli, for example, the kidney secretes an aminopeptidase (renin), an enzyme that catalyzes the first (rate-limiting) cleavage of the angiotensinogen (AGT) precursor into angiotensin I. After its rapid and stoichiometric conversion to AII, AII restores cardiovascular homeostasis through its potent vasoconstrictive and salt-retaining properties, mediated through binding the type 1 AII receptor (AT1, Ref. 3 ). Recently increased attention has been paid to the concept that intravascular AII formation activates genetic changes in responsive tissues (Refs. 4 5 and reviewed in Ref. 6 ). Through AT1 binding, AII activates the expression of early response and inflammatory genes, including immediate-early transcription factors [AP-1 (7 8 )], tyrosine receptor- coupled transcription factors [STAT (9 )], and Egr-1 (10 ) in vascular smooth muscle cells and the adrenal cortex.
Activation of the intravascular RAS, in addition, initiates a biological positive feedback loop in the hepatocyte, stimulating the synthesis of its own precursor, AGT, by a mechanism involving enhanced mRNA production (4 11 12 ). Nuclear run-on assays (5 ) and promoter mapping studies (13 ) have demonstrated that AII activates AGT transcription over physiologically relevant concentrations of hormone. Previously, we reported the surprising findings that the AII-inducible cis-element mediating AGT transcription was a well characterized cytokine-inducible enhancer responsible for mediating the transcriptional induction of AGT during the acute phase response (this element is termed the acute phase response element (APRE) (Ref. 13 ; reviewed in Ref. 6 ).
Cytokines and AII stimulate transcription of AGT in a manner dependent
on binding the potent NF-B transcription factor (13 ). NF-B is a
family of homo- and heterodimeric proteins containing a homologous
NH2-terminal Rel homology domain (14 ) tethered in
the cytoplasm of unstimulated cells by hormone-regulated association
with the IB inhibitors. The NF-B DNA-binding subunits are
NF-B1 p50 (50 kDa) and NF-B2 p49, encoded by proteolytically
processed precursor proteins of approximately 105 and 100 kDa,
respectively (reviewed in Ref. 14 ). The transcription-activating
subunits of NF-B are Rel A and c-Rel; these bind DNA weakly. To
activate, Rel A and c-Rel are targeted to some NF-B binding sites as
heterodimers with the NF-B1- or NF-B2 binding subunits (16 22 ).
Because the transcription-activating NF-B subunits associate with
the cytoplasmic IB inhibitors, heterodimeric Rel A and c-Rel
complexes are inducible by cytoplasmic-to-nuclear translocation. For
example, the potent transactivator, Rel A•NF-B1, rapidly
translocates from the cytoplasm into the nucleus after cytokine-induced
IB proteolysis. In contrast, NF-B1 p50 homodimers are
constitutively nuclear and bind DNA avidly, yet activate transcription
weakly, if at all (6 14 15 ). A number of studies, including UV
cross-linking (16 ), gel mobility supershift assays with
isoform-specific NF-B antibodies (17 ), and transient overexpression
assays (15 ), indicate that the Rel A•NF-B1 p50 heterodimer is the
primary cytokine-inducible NF-B subunit binding the APRE in
hepatocytes. The mode of NF-B regulation by AII is unknown.
Here we report observations that AII-inducible gene activation occurs
through an mechanism independent from that used by cytokines. High
resolution gel mobility shift assays show that AII induces a pattern of
NF-B binding complexes different from that produced by TNF. Using
a specific biotinylated DNA binding/Western immunoblot assay, we
demonstrate that, in contrast to TNF, AII does not increase Rel A
binding but, rather, selectively increases binding of larger 96-kDa and
56-kDa NF-B1 isoforms. Binding of the larger NF-B1 isoforms
occurs without steady-state changes in their nuclear abundance and is
independent of IB proteolysis. AII-induced recruitment of
NF-B1 p50, p56, and p96 kDa isoforms is dependent on activity of
phorbol ester- sensitive protein kinase C (PKC) isoforms. These data
indicate that AII activates NF-B through a separate pathway than
that used by cytokines and involves inducible recruitment of previously
uncharacterized latent NF-B1 binding isoforms.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B binding [by activating APRE WT-LUC
reporter activity, but not the NF-B binding site mutations
(e.g. APRE M2 or APRE M6)] with an apparent peak at 6
h and falling thereafter (13 ). To further study the mechanism for
transcriptional induction, we compared the early kinetics of
APRE-driven transcription in response to maximal doses of the agonists
TNF (30 ng/ml) and Sar1 AII (100
nM from 0–6 h (Fig. 1
). Luciferase was selected as a reporter
because its rapid turnover closely monitors changes in transcription of
endogenous genes, where, after gene activation, changes in luciferase
activity can be measured within 2 h (18 ). In HepG2 cells
transiently transfected with APRE-LUC, Sar1 AII
begins to increase transcriptional activity at statistically
significant levels at 1 h and plateaus at a 7.6 ± 4-fold
(x ± SEM, n = 11) from 3–6 h. In
contrast, although TNF also produces a similar rapid induction, the
level of activity at 6 h is significantly higher than that
produced by Sar1 AII, peaking at 20 ± 5
fold (x ± SEM, n = 12,
P < 0.05 compared with Sar1
AII). As additional demonstration that the Sar1
AII effect on APRE-driven transcription is mediated through the
AT1 receptor, increasing concentrations of the
specific (competitive) AT1 receptor antagonist,
Dup 753 (19 ) were included in the transfection (Fig. 1B). Although only
4% inhibition was seen at 0.01 µM Dup753, 64%
inhibition was seen at 0.1 µM Dup753, and 72%
inhibition was seen at 1.0 µM Dup753 (10-fold
excess relative to agonist), a concentration well within the
IC50 of the antagonist (3 ). Together, these data
indicate that Sar1 AII activates APRE-driven
transcription through an AT1-dependent
pathway.
|
-subunit) is used to positively select transient
transfectants. Under these conditions, 99% of reporter gene activity
is bound to the magnetic beads representing a 19- to 30-fold enrichment
in specific activity (Table 1). We interpret these data
to indicate that the bound cells are a nearly homogeneous population of
transient transfectants. After this isolation, sucrose cushion-purified
nuclear extracts were prepared and APRE-binding activity assayed in
electrophoretic mobility shift assay (EMSA). Figure 2 represents time course experiments of
control and stimulated HepG2 cells assayed by EMSA under conditions
where individual heterodimeric NF-B complexes can be resolved. In
control cells, we routinely detect two NF-B-specific complexes,
complex 2 (C2) and C4. Based on antibody supershifting experiments, we
have previously reported that the complex C2 represents the Rel
A•NF-B1 heterodimer, and that the C4 complex represents NF-B1
homodimers (17 ). In control extracts, a faint C2 pattern and a strong
C4 binding pattern are seen (Fig. 2A, top and bottom panels,
lane 1) indicating that APRE binding activity is predominately that of
NF-B1 (with lesser, but detectable, Rel A binding).
Sar1AII treatment weakly increased (2- to 4-fold)
the binding of the C4 complex over the 6-h time course (although C2
apparently decreased in this particular experiment, in four independent
experiments, there was no consistent effect on C2 binding).
|
|
(Fig. 2A
, bottom panel). Upon TNF stimulation, the C2 and C4
complexes are rapidly induced at 15 and 30 min, followed by a nadir at
1 h (Fig. 2A, bottom panel, lanes 2–4). Induction of
C2 and C4 binding is due to rapid increase in nuclear abundance of Rel
A and NF-B1, whereas the 1-h nadir in C2 binding is due to overshoot
resynthesis of the IB inhibitor (17 ). Although the C2 binding
returns at 3 and 6 h, the abundance is weaker than the 15-min time
point due to partial cytoplasmic sequestration of Rel A (17 ). These
data indicate that the two agonists induce qualitatively distinct
NF-B binding profiles.
To verify that the Sar1 AII-inducible C4 complex
binds with NF-B binding specificity, competition analysis was
performed using previously characterized APRE site mutations (Fig. 2B
and Materials and Methods). Inducible C4 binding is
efficiently competed with 10-fold molar excess of either homologous
probe (APRE WT) or BPi, a mutation that binds
NF-B but selectively disrupts C/EBP binding (20 ) and is not competed
by the NF-B-disruptive APRE M6 or M2 mutations (20 ).
Sar1 AII Induces NF-B1 Binding
Activity
These data indicated that Sar1 AII may
activate a different subset of NF-B complexes than those regulated
by TNF. Supershifting assays were next used to qualitatively compare
the NF-B subunits binding the APRE from Sar1
AII-stimulated cells. In AII-stimulated extracts, anti-NF-B1
antibody produced a strong supershift of two separate bands.
Surprisingly, weak supershifted bands were seen with the addition of
Rel A and NF-B2 antibodies in a manner that did not differ from that
of control extracts (data not shown). These data indicated that AII
induced primarily the binding of NF-B1 proteins. As a direct
comparison, control and Sar1 AII-treated extracts
were supershifted in parallel with the addition of nuclear localization
signal (NLS)-directed NF-B1 antibody. This antibody produced a
strong supershift of two NF-B1 bands whose intensities were
increased after Sar1 AII treatment (Fig. 3). These data indicated that
Sar1 AII activates binding of NF-B1 in a
qualitatively distinct pattern from NF-B proteins induced by TNF.
Moreover, the presence of multiple supershifted bands suggest a
heterogeneous population of NF-B1 isoforms are binding the APRE.
|
B SubunitsB subunits
regulated by hormone, we applied a technique for microaffinity capture
of DNA binding proteins followed by their detection using Western
blotting (18 ). This specific technique avoids inherent problems
associated with epitope masking in native complexes and can detect
NF-B isoforms without the bias introduced by UV cross-linking. Using
this two-step microaffinity isolation technique, we analyzed the
patterns of TNF-inducible NF-B proteins binding to the APRE (Fig. 4A). Affinity-isolated APRE-binding
proteins from control and TNF-stimulated cells were probed with a
panel of anti-NF-B antibodies. Although the inducible binding
protein Rel A and c-Rel are primarily cytoplasmic, in situations where
the abundance of these proteins are systematically analyzed, a small
fraction is nuclear [even in unstimulated cells (17 )]. We observed
staining of 65-kDa Rel A, 50-kDa NF-B1, 68-kDa c-Rel, and 50-kDa
NF-B2, indicating their presence in unstimulated HepG2 nuclear
extracts (17 ). These data are consistent with the presence of Rel
A-containing C2 binding in EMSA (c.f. Fig. 2A). However,
after TNF stimulation, a strong induction of Rel A, NF-B1, c-Rel,
and a weaker induction of NF-B2 binding occurred on the APRE (Fig. 4A). We have shown that this increase is due to changes in steady state
abundance of these proteins in the nuclear compartment (17 ).
|
B1 p50 complexes
was demonstrated by competition assay where nonbiotinylated DNA
competitors were added to the initial binding reaction (Fig. 4B).
Detection of both Rel A and NF-B1 binding is specifically reduced
with the WT oligonucleotide competitor, but not the NF-B mutant,
APRE M6, indicating that the binding of these isoforms is
NF-B-specific (c.f. Fig 2B and Refs. 17 20 ).
The Bt-microaffinity isolation/Western blot technique was applied to
nuclear extract from the Sar1 AII-treated cells;
a pattern of inducible complexes was produced that was distinct from
that seen for TNF (Fig. 5). No
relative change in Rel A binding was observed, but inducible binding of
both NF-B2 and NF-B1 was seen. Surprisingly, in addition to the
NF-B1 p50 subunit, several additional, larger complexes induced by
Sar1 AII were specifically detected by the
NF-B1 antibody (of 56 and 96 kDa). Together, these data indicate
Sar1 AII induces NF-B1 isoform binding to the
APRE (without changes in Rel A binding).
|
B1 Binding Is
Independent Of IB ProteolysisB levels [as most NF-B activators
induce IB proteolysis (14 )]; of the isoforms expressed in
hepatocytes, IB is the most abundant (17 21 ). In our hands, the
Western immunoblot signal for IB was proportional to input
protein over a 4-fold concentration of cytoplasmic extract (50–200
µg; Fig. 6A, top panel). In
nonselected HepG2 cell populations, we previously demonstrated that
TNF induces a biphasic pattern of IB proteolysis and
resynthesis. This phenomenon is part of an NF-B-IB autoregulatory
feedback loop that accounts for nadir in C2 binding at 1 h (Ref s.
19 and 24 and Fig. 2). To confirm that the immunoaffinity isolation
does not produce systematic artifacts in our ability to detect changes
in IB abundance, dynamic changes in cytoplasmic IB levels
were measured after immunoaffinity isolation of TNF-stimulated cells
(Fig. 6A, bottom). In control cells, IB abundance is
easily detected as a 37-kDa band. Within 15 min of TNF stimulation,
IB is rapidly proteolyzed and is undetectable. Thereafter the
abundance of IB increases, and after 1 h stimulation,
IB is resynthesized to 2-fold greater than control levels (17 21 ). Because the pattern of IB proteolysis (and resynthesis) is
identical to our previous observations in populations of
TNF-stimulated HepG2 cells, the immunoaffinity isolation/Western
immunoblot assay is suitable for detection of dynamic changes in
IB abundance. This assay was then applied to cytoplasmic extracts
of cells stimulated by Sar1 AII. Surprisingly, in
contrast to those effects induced by TNF, Sar1
AII treatment did not produce detectable changes in either IB or
IBß steady-state levels in the cytoplasm (Fig. 6B), even though
the assay was done at identical time points when inducible C4 binding
was observed in EMSA (c.f. Fig 2A). These data, repeated
three times in independent experiments, indicate that
Sar1 AII activates NF-B1 binding independently
of detectable changes in cytoplasmic IB abundance.
|
B1 Binding Occurs Independently of Changes in
Either NF-B1 Processing or Nuclear AbundanceB1 processing has previously been shown to occur through the
ubiquitin-proteasome pathway and is sensitive to the effect of the
proteasome inhibitor, MG132 [Z-Leu-Leu-Leucinal, (22 )]. Because our
data indicated Sar1 AII stimulated binding of
NF-B1 isoforms to the APRE, perhaps through a mechanism involving
NF-B1 p105 processing, we asked whether MG132 would interfere with
APRE-driven transcription. Transient HepG2 transfectants were treated
with nothing, Sar1-AII, or
Sar1 AII + MG132 before harvest for luciferase
reporter activity. We observed that pretreatment of with MG132 (25
µM, 30 min before stimulation) completely blocked
inducible reporter activity (Fig. 7A). To
investigate the mechanism for the inhibitory effect of MG132, Western
immunoblots for the NF-B subunits were performed on nuclear extracts
from the homogeneous population of immunoaffinity isolated cells.
First, changes in Rel A were examined. As shown in Fig. 7B, Sar1 AII stimulation had no effect on the
constitutive abundance of nuclear Rel A. Moreover, the inhibitory
effects of MG132 are not mediated through detectable changes in
abundance of the 65-kDa transactivatory subunit Rel A, as its nuclear
level was not influenced by MG132 treatment (Fig. 7B).
|
B1 p50, p56, and p96 isoforms
(Fig. 7C). In this experiment, control cytoplasmic extracts were
coelectrophoresed with nuclear extracts from control,
Sar1 AII- and Sar1 AII +
MG132-treated cells. In the (overexposed) cytoplasmic lane,
the p105 precursor and the 50- and 56-kDa NF-B1 isoforms were
detected, but not the 96-kDa NF-B1 isoform (Fig. 7C, lane 1). In
contrast, in the nuclear fraction, the p96, p56, and NF-B1 p50
isoforms were all detected in control cells (Fig. 7C, lanes 2–4).
Surprisingly, after Sar1 AII treatment, no
measurable increase in the steady-state nuclear abundance of any of the
three isoforms could be detected. In addition, the potent
transcriptional inhibitor MG132 did not detectably influence the
steady-state levels of any isoform. The specificity of nuclear NF-B1
species was further examined in control experiments in Fig. 7C
(right panels). Preadsorption with the immunizing NF-B1
peptide blocks staining of p96, p56, and p50 NF-B1 isoforms.
Moreover, Western blots of nuclear fraction using an NF-B
p105-specific antibody stains selectively NF-B1 p96. This NF-B1
p96 staining is also selective because preadsorption of the p105
antibody blocks its recognition of NF-B1 p96. Together, these data
indicate that 1) NF-B1 species do not change nuclear abundance after
Sar1 AII treatment; 2) the effect of MG132 on APRE- dependent
transcription occurs without measurable changes in steady state
abundance of nuclear Rel A or the NF-B1 isoforms; and 3) the
abundance of NF-B1 p96 appears to be independent of p105
processing (see Discussion).
Proteasome Activity Is Required for Inducible NF-B1 P96
Binding
We next analyzed whether MG132 treatment
influenced recruitment of NF-B1 DNA binding as a mechanism for
blocking AII-inducible transcription. Nuclear proteins from treated
cells were assayed for Bt-APRE WT binding using the two-step
microaffinity isolation assay. As before, Sar1
AII treatment induced NF-B1 p50, 56, and p96 isoforms to the APRE
(Fig. 7D, lane 1 and 2). Coincubation with MG132 selectively blocked
the Sar1 AII-induced binding of NF-B1 p50, 56,
and p96 isoforms to the APRE (Fig. 7D, lane 3). Together these data
indicate that Sar1 AII induces NF-B1 binding
on the APRE without detectable changes in their steady-state nuclear
abundance through an proteasome-sensitive mechanism.
Inducible Binding of NF-B1 Species Can Be Mediated by the
Diacylglycerol (DAG) Agonist, PMA
Sar1 AII is a potent
activator of DAG production, intracellular calcium concentration, and
PKC activity in responsive cells (23 24 ). To investigate the potential
role of DAG-sensitive PKC isoforms in inducible NF-B1 binding, we
assayed for the acute effects of the DAG agonist, phorbol 12-myristate
13-acetate (PMA) on recruitment of NF-B1 binding. At various times
after PMA exposure, APRE binding was measured by two-step microaffinity
assay. PMA rapidly (and transiently) induced NF-B1 p50 and p96
isoform binding within 30 min of treatment; however, p56 was only
weakly detected (Fig. 8A). At later
times, NF-B1 p96 binding activity is down-regulated. These data
indicate DAG is sufficient to induce rapid NF-B1 binding.
|
,
ßII , and 
(21 ). Accordingly, we used
Western immunoblots of PKC as a marker for whether we successfully
hydrolyzed PKC. As shown in Fig. 8B, we observed that chronic treatment
with PMA completely hydrolyzed cytoplasmic PKC. As a control for
protein loading, the lanes were stained for cytoplasmic ß-actin,
where a similar band intensity was observed (Fig. 8B, bottom
panel). The effect of Sar1 AII on APRE
transcription was next investigated in PKC-down-regulated HepG2 cells.
PKC down-regulation completely abolished both
Sar1 AII- and PMA-induced APRE transcription
(Fig. 8C). Nuclear extracts from PKC down-regulated cells were then
assayed for changes in APRE binding in the microaffinity isolation
assay. PKC hydrolysis blocked inducible NF-B1 p96, p56 , and p50
binding (Fig. 8D), indicating an absolute requirement for the
DAG-sensitive PKC isoforms in Sar1
AII-induced NF-B1 binding. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B is a potent and highly inducible transcription factor
family that functions as a signal mediator in activating inducible
acute phase reactant and cytokine gene expression. Many NF-B
activators, including TNF (19 22 ), interleukin-1 (IL-1) (21 ), and
viral infections (25 ), produce cytoplasmic-to-nuclear translocation of
the potent Rel A•NF-B1 transactivator (reviewed in Ref. 14 ). In
this pathway, NF-B agonists stimulate activity of the ubiquitous
IB kinases, resulting in serine phosphorylation of the
NH2-terminal regulatory domain of IB (26 ).
Once phosphorylated, IB is inducibly proteolyzed (26 27 ),
allowing Rel A•NF-B1 p50 to be liberated and to translocate into
the nucleus where it activates transcription through high-affinity
genomic binding sites. Here, we report observations for an alternative
mode of NF-B activation induced by AT1
receptor signaling in hepatocytes, where Sar1 AII
induces apparent activation of latent NF-B1 binding isoforms to bind
the angiotensinogen promoter sequence. This phenomenon occurs without
requiring changes in steady-state concentrations of Rel A or NF-B1
in the nucleus. Moreover, our results imply dependence on DAG-sensitive
PKC isoforms for inducible NF-B1 binding. These pathways are
schematically diagrammed in Fig. 9.
|
B1 isoforms as a potential mechanism for
AII-inducible APRE-dependent transcription. Evidence that AII induces
multiple NF-B1 isoforms to bind the APRE come from the distinct EMSA
binding pattern (Fig. 2A) and the unanticipated behavior of the
NF-B1 supershift in AII-stimulated extracts. Here, an NLS-directed
NF-B1 antibody produces two strong supershifted complexes that are
enhanced after Sar1 AII treatment (Fig. 3) and
are not seen in the TNF-treated extracts; we interpret this to mean
that the nature of the AII-stimulated C4 complex is qualitatively
distinct from the other treatment conditions. This may be due to the
presence of the larger NF-B1 isoforms, p56 and p96, in the C4
complex. In a previous study, we demonstrated the requirement for
NF-B in AII-stimulated AGT transcription (13 ). However, definitive
detection of alternative sized NF-B1 isoforms was not possible
because of the qualitative nature of EMSA. Specific detection of
individual NF-B isoforms has been made possible by the application
of the Bt-streptavidin capture assay; this assay has provided new
insight into the identity of AII-inducible NF-B1 complexes. That the
inducible 50-, 56-, and 96-kDa APRE-binding isoforms detected in the
Bt-streptavidin capture assay represent bona fide NF-B1
is based on the observation that their staining in Western immunoblots
is selectively inhibited by preabsorption of the immune antibody, and
that the p96 isoform is recognized selectively by both
NH2 and COOH-directed anti-NF-B1 antibodies
(Fig. 7C, right panel).
Mechanisms for NF-B1 Transactivation of Target Genes
The 50-kDa NF-B1 isoform is an inert DNA binding subunit that
activates transcription indirectly through its association with the
potent Rel A transactivator (reviewed in Ref. 14 ). By contrast, Rel A
is a weak DNA binding subunit that relies on NF-B1 for stable
binding to asymmetric NF-B binding sites. Rel A activates target
genes through a direct association of its COOH-terminal transactivating
domain with the coactivator proteins, CREB binding protein/p300
(CBP/p300) (28 ). CBP/p300 are multifunctional proteins that contain
strong histone acetyl transferase activity (implicated in chromatin
remodeling during transcriptional activation) and provide additional
protein-protein interactions for efficient coupling of Rel A with the
preinitiation complex. Because we have observed that overexpression of
NF-B1 p50 fails to activate APRE transcription, whereas
overexpression of Rel A produces strong activation, we believe that
inducible NF-B1 p50 binding alone is unlikely to induce APRE
transcription after Sar1 AII stimulation
(References 13 and15 and data not shown). Our data indicate inducible
binding of larger NF-B1 isoforms as a potential mechanism for
promoter activation. In support of this mechanism, others have shown
that p105 NF-B1 precursor contains latent transcriptional activation
domains. For example, expression of a fusion protein between the
GAL4 DNA-binding domain with the COOH terminus of NF-B1 potently
activates GAL4 DNA binding sites (29 ). Importantly, this
COOH-terminal region of NF-B1, containing the ankyrin repeat
domains, is recognized by the -p105 antibody that selectively binds
NF-B1 p96 (Fig. 7C). For this reason, we believe it possible that
the NF-B1 p96 contains a COOH-terminal transactivation domain and
could be responsible for AII-inducible APRE activation. In separate
studies, others have demonstrated the presence of a widely expressed,
alternatively spliced murine NF-B1 98-kDa isoform (muNF-B1 p98),
an isoform disrupted in its ability to be retained in the cytoplasm
(30 ). Expression of muNF-B1 transactivates NF-B-driven reporter
genes. Together, these observations indicate that NF-B1 isoforms
containing the COOH terminus also contain latent transcriptional
activity (and may indicate a mechanism by which NF-B1 p96 could
activate the APRE). The mechanism by which the COOH-terminal
transactivation domain of NF-B1 activates transcription has not been
further investigated. These forms may also directly associate with the
CBP/p300 coactivators.
Other mechanisms for Sar1 AII-inducible
transcription are possible. NF-B1 activation could include indirect
recruitment of Rel A to the APRE complex; however, we think this is
unlikely. Although Rel A binding the APRE can be detected, its
abundance also does not change after Sar1 AII
stimulation (Figs. 5 and 7B) as it does after TNF stimulation (Fig. 2 and Ref. 17 ). We interpret these data to exclude Rel A recruitment as
a primary mechanism for APRE activation. It is also important to note
that previously we observed that Rel A was a target for AII activation
(13 ). This observation came from transient transfection assays
expressing Rel A-GAL4-fusion proteins to drive reporter genes. In this
artificial paradigm, addition of Sar1 AII induced
reporter gene activity a modest 2- to 4-fold. Surprisingly, the
Sar1 AII effect was lost upon deletion of the Rel
A N-terminal dimerization domain. The N-terminal domain is required for
NF-B1 association and is separate from the potent COOH-terminal
transactivation domain. Taken together, these two studies indicate Rel
A activation of target promoters is indirect, mediated by its ability
to associate with transactivating forms of NF-B1. [Others have
shown that NF-B1 p105 forms stable complexes with Rel A and c-Rel
in vivo (31 ).] Other potential alternatives include
Sar1-AII inducible recruitment of the Bcl-3
coactivator. Bcl-3, a protooncogene containing an ankyrin repeat
domain, has been shown to synergistically activate NF-B2 driven
transcription (32 ). However, we have not been able to demonstrate the
association of Bcl-3 in the APRE complex in the Bt-streptavidin assay
(data not shown).
Potential Mechanisms for NF-B1 Isoform Expression
NF-B1 is encoded by a large precursor protein of 105 kDa that
is alternatively spliced and processed into multiple isoforms. When
translated as a full-length product, NF-B1 p105 is a cytoplasmic
protein that functions as an IB-like inhibitor (31 ) by its ability
to sequester NF-B in the cytoplasm through association with its
COOH-terminal ankyrin repeat domain and, indeed, inhibits its own
intrinsic DNA-binding activity (33 ). Although the NF-B1 p50 form is
produced by the proteolytic processing of the NF-B1 p105 through the
ubiquitin proteasome pathway (22 ), we think it is unlikely that
NF-B1 p96 represents a p105 processing intermediate for several
reasons. First, in coupled in vitro translation/proteasome
processing experiments of the p105 precursor, transient formation of
96-kDa intermediates have not been observed (22 ). In addition, the
steady-state abundance of NF-B1 p96 is not influenced by the
administration of the proteasome inhibitor, MG132. MG132 is known to be
a potent inhibitor of NF-B1 p105 processing (22 ). We interpret these
observations to indicate that NF-B1 p96 is not a transient
processing intermediate of the p105 precursor. We, at present, do not
know the mechanism of the MG132 effect, although it appears to
interfere with a step upstream of inducible NF-B1 p96 binding,
perhaps through disruption of PKC-mediated intracellular signaling.
Further investigation of this mechanism will be required.
The large NF-B1 isoforms may be the consequence of alternative
splicing. Although no rigorous description of alternative transcripts
encoding other human NF-B1 isoforms has been reported, in murine
lymphocytes, a large transactivating form of NF-B1, NF-B1 p98,
has been recently described (30 ). Murine NF-B1 (muNF-B1) p98 is
generated by alternative splicing of the NF-B1 precursor mRNA by
deleting the region encoding the seventh (penultimate) carboxy-terminal
ankyrin repeat (30 ). This carboxy-terminal deletion apparently disrupts
the ability of muNF-B1 p98 to be retained in the cytoplasm or mask
its intrinsic DNA binding activity, and (as indicated above) is a
bona fide transactivator. Whether human hepatocytes express
this alternatively spliced isoform and whether it plays a significant
role in inducible transcription will require further investigation.
Role of PKC in Inducible NF-B1 Binding
PKC is a family of serine-threonine protein kinases that mediate
signal transduction pathways leading to changes in gene expression,
cell differentiation, and apoptotic pathways. AII (via the
AT1 receptor) is known to activate multiple
different intracellular protein kinase activities, including protein
kinase C (21 34 ). For example, others have shown that AII activates
changes in subcellular distribution of the PKC, -, and -
isoforms in WB hepatocytes (35 ); we have previously demonstrated that
these isoforms are also expressed in HepG2 cells (21 ), and PKC is
required for AII-induced c-fos expression in vascular
smooth muscle cells (34 ). Our data indicate that there is an essential
requirement for PKC isoforms in Sar1
AII-inducible NF-B1 binding. The requirement for PKC is demonstrated
by the direct effect of the DAG agonist, PMA, to induce NF-B1 p96
and p50 binding (Fig. 8A), and the inhibitory effect of PKC
down-regulation on inducible NF-B1 binding and transcription (Fig. 8, C and D). We note however, that the induction pattern of NF-B1
binding after PMA treatment is slightly different from that produced by
AII. This is probably because PMA does not exactly reproduce the
magnitude and kinetics for DAG production as that produced by activated
AT1. PKC signaling pathways target members of the
NF-B family including IB and its kinases (21 ) and NF-B itself
(36 ). Nuclear NF-B, such as NF-B1 isoforms, are known to be
phosphoproteins (37 ). NF-B phosphorylation apparently plays a
regulatory role, as either phosphorylation of the Rel A•NF-B1 p50
complex in vitro or protein kinase C-induced
hyperphosphorylation of NF-B1 p50 in vivo induces stable
DNA binding (36 ). Although in our study, PKC is used as a marker for
the PMA effect (and to demonstrate that PKC is down-regulated), it will
require additional investigation to determine the specific
DAG-sensitive PKC isoform involved and whether NF-B1 is a direct
target of its actions. It will be interesting to disrupt the expression
of individual PKC isoforms , ßII, , or and determine their
effect on inducible NF-B1 binding.
Determining the mechanisms for how AII induces transcription of its
precursor, AGT, contributes to our understanding of the pathophysiology
of renovascular hypertension. Our data suggest this mechanism occurs
through nuclear recruitment of latent (non-DNA binding) NF-B1
isoforms after AII stimulation in hepatocytes. Further characterization
of this PKC-dependent signaling pathway and the NF-B1 isoforms
involved will yield new insights into how AII influences gene
expression in the renin angiotensin system.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(30 ng/ml,
Calbiochem, San Diego, CA), and
Sar1-AII (100 nM, Sigma,
St. Louis, MO) were added in culture medium and cells were incubated
for the indicated time periods at 37 C. MG132 (Z-Leu-Leu-Leucinal) was
obtained from Sigma and used at 25 µM (final
concentration). The type 1 AT receptor antagonist, Dup753 (Losartan)
was a gift of Wm. Henckler, Merck & Co., Inc. (Rahway,
NJ).
Plasmids and Transient HepG2 Transfections
APRE-LUC consists of the trimerized rat AGT APRE WT sequences
ligated through BamHI/BglII ends into the p59 rat
AGT minimal promoter driving the expression of the firefly luciferase
reporter gene (16 20 ). The AT1 receptor
expression plasmid pEF-Bos (3 ), the expression vector encoding the tac
subunit of the IL-2 receptor pCMV.IL2R (38 ), and the constitutively
expressed alkaline phosphatase transfection efficiency control,
SV2PAP (16 ), have been previously described. For
transfection, plasmids were purified by ion exchange
(QIAGEN, Chatsworth, CA) and sequenced to verify
authenticity. For transient transfection assay, HepG2 cells were
transfected using 1,2-dioleoyl-3-trimethylammonium propane
(DOTAP)-DNA liposomes into triplicate 60-mm plates with 20 µg
APRE-LUC, 7.5 µg pEF-Bos, and 5 µg SV2PAP.
Cells were cultured an additional 40 h and stimulated for the
indicated times (0–6 h) before harvest for independent assay of
luciferase and alkaline phosphatase activity at 46 h (16 ). The
timing of administration of hormone was such that all plates were
harvested simultaneously at 46 h. Normalized luciferase was
determined for each individual plate in the triplicate before
calculation of the mean value for each treatment condition. Fold
activation was determined by dividing the normalized luciferase
activity in each treatment by the normalized value in untreated
cells.
Immunoaffinity Isolation of Transfected HepG2 Cells on Magnetic
Beads
To isolate a homogenous population of transiently transfected
cells, HepG2 cells were transfected by electroporation (to increase the
numbers of transient transfectants). Briefly, logarithmically growing
cells were trypsinized, washed in Ca++/Mg++-free PBS, and resuspended
at a density of 2 x 107 cells/250 µl
volume in an electroporation 0.4-cm cuvette (Bio-Rad Laboratories, Inc., Hercules, CA). The following type and
amount of supercoiled plasmid DNA was added to the cuvettes: 30 µg
APRE-LUC, 15 µg pEF-Bos, and 5 µg CMV.IL2R. Cells were incubated on
ice for 15 min and electroporated at 960 µF, 250 V. The cells were
incubated on ice for an additional 15 min and plated in prewarmed
growth medium for growth. Cells were cultured for an additional 40
h with daily changes of medium and stimulated for the indicated times
with Sar1-AII or TNF before harvest at 46
h after transfection.
For immunoaffinity isolation of transiently transfected cell
population, minor modifications of published protocols were used (38 ).
Transfected cells were washed twice with cold PBS and incubated for 30
min at 4 C with 1 µg of CD25 monoclonal antibody (Caltag Laboratories, Inc., Burlingame, CA) in 8 ml of PBS/0.01%BSA.
After this incubation, cells were washed twice with PBS, and 25 µl of
a slurry of goat antimouse IgG conjugated to magnetic beads (Dynabeads
M-450, DynAl, Great Neck, NY) were added to 8 ml of
PBS/0.01% BSA. After an incubation for 1 h at 4 C, cells were
washed, trypsinized, and captured on a magnetic stand (DynAl) in 1.7-ml
centrifuge tubes. In control experiments, transfection
efficiency was directly determined by fluorescence microscopy to detect
expression of the IL-2 receptor. In this assay, transfected cells were
directly stained with fluorescein isothiocyanate-conjugated
CD25 monoclonal antibody (Caltag Laboratories, Inc.)
and scored for IL-2 receptor expression by fluorescence microscopy.
Transfection efficiency was 19.3% (n = 3 of 456 individual cells
counted). To determine capture efficiency of transfected cells, bound
and flow-through fractions were assayed for specific activity of
luciferase reporter activity and compared with the same measurements
made in whole-cell lysates before affinity isolation (Table 1). These
data indicate that specific activity of the luciferase reporter was
significantly enriched in bound fraction of the magnetic affinity,
yielding a nearly homogenous transfected cell population for assay.
Sucrose Density-Purified Nuclear Extracts
For the purification of nuclei, HepG2 cells were resuspended in
buffer A [50 mM HEPES (pH 7.4), 10 mM KCl, 1
mM EDTA, 1 mM EGTA, 1 mM
dithiothreitol (DTT), 0.1 µg/ml phenylmethylsulfonyl fluoride (PMSF),
1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin
inhibitor, 10 µg/ml aprotinin, and 0.5% NP-40]. After 10 min on
ice, the lysates were centrifuged at 4,000 x g for 4
min at 4 C. After discarding the supernatant, the nuclear pellet is
resuspended in buffer B (buffer A with 1.7 M
sucrose), and centrifuged at 15,000 x g for 30 min at
4 C (17 ). The purified nuclear pellet was then incubated in buffer C
[10% glycerol, 50 mM HEPES (pH 7.4), 400
mM KCl, 1 mM EDTA, 1
mM EGTA, 1 mM DTT, 0.1
µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml
soybean trypsin inhibitor, and 10 µg/ml aprotinin] with frequent
vortexing for 30 min at 4 C. After centrifugation at 15,000 x
g for 5 min at 4 C, the supernatant is saved for nuclear
extract. Both cytoplasmic and nuclear extracts were normalized for
protein amounts determined by Coomassie G-250 staining (Bio-Rad Laboratories, Inc.). Sucrose cushion separation results in
nuclear extracts devoid of cytoplasmic contamination as measured by the
absence of cytoplasmic markers, such as actin or IB (17 ).
EMSAs
EMSAs were performed as previously described with minor
modifications (17 ). Nuclear extracts (10 µg) were incubated with
40,000 cpm of 32P- labeled APRE WT duplex
oligonucleotide probe and 1 µg of poly (dA-dT) in a buffer containing
8% glycerol, 100 mM NaCl, 5 mM
MgCl2, 5 mM DTT, and 0.1 µg/ml PMSF
in a final volume of 20 µl, for 15 min at room temperature. The
complexes were fractionated on 6% native polyacrylamide gels run in
1x TBE buffer (89 mM Tris, 89 mM boric acid,
and 2.0 mM EDTA), dried, and exposed to Kodak
X-AR film at -70 C. The sequences of the APRE double-stranded
oligonucleotides are (mutations underlined):
APRE WT: GATCCACCACAGTTGGGATTTCCCAACCTGACCA GTGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG
APRE M6: GATCCACCACAGTTGTGATTTCACAACCTGACCA
GTGGTGTCAACACTAAAGTGTTGGACTGGTCTAG
APRE M2: GATCCACCACATGTTGGATTTCCGATACTGACCA GTGGTGTACAACCTAAAGGCTATGACTGGTCTAG
APRE
BPi:GATCCACCACAGTTGGGATTTCCCAACCTGACCA GTGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG
Competition was performed by the addition of 100-fold molar
excess nonradioactive double-stranded oligonucleotide competitor at the
time of addition of radioactive probe. Antibody supershift assays were
performed by adding to the binding reaction 1 µl of indicated
affinity-purified polyclonal antibodies and incubating for 1 h on
ice as described (17 ). For anti-NF-B1 supershifts, rabbit anti-NLS
directed NF-B1 (reactive with amino acids 350–363), goat anti
NH2-terminal NF-B1 (reactive to amino acids
4–22), and anti COOH-terminal NF-B1(reactive to amino acids
338–357) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Microaffinity Purification of APRE Binding Proteins
APRE binding proteins were affinity isolated using a two-step
biotinylated DNA-Streptavidin capture assay (18 ). In this assay, duplex
APRE WT oligonucleotides containing 5' biotin (Bt) were
chemically synthesized on a flexible linker (Genosys, The Woodlands,
TX). Identical amounts of nuclear protein from control and
hormone-stimulated extracts were incubated with 50 pmol Bt-APRE WT DNA
in the presence of 12 µg poly dA-dT (as nonspecific competitor) in
500 µl total volume binding buffer [8% (vol/vol) glycerol, 5
mM MgCl2, 1 mM DTT, 60
mM KCl, 1 mM EDTA, 12 mM HEPES, pH
7.8] at 4 C for 1 h (in practice, 0.6–1.2 mg protein was used,
the exact amount varied from one experiment to another depending on
number of cells captured by magnetic affinity purification). One
hundred microliters of a 50% slurry of prewashed streptavidin-agarose
beads were then added to the sample and incubated at 4 C for an
additional 20 min with shaking. Pellets were washed twice with 500 µl
binding buffer and then resuspended in 100 µl 1x SDS-PAGE buffer for
analysis by Western immunoblot. For competition assays, a 10-fold molar
excess of the indicated (nonbiotinylated) duplex DNA was added in the
initial binding reaction (18 ).
Western Immunoblots
For immunoblot analysis, a constant amount of indicated cellular
extracts (200–300 µg as indicated) was boiled in Laemmli buffer,
separated on 10% SDS-PAGE, and transferred to polyvinylidene
difluoride membranes (Millipore Corp., Bedford, MA).
Membranes were blocked in 8% milk and immunoblotted with the
affinity-purified rabbit polyclonal antibodies for either IB
(reactive with amino acids 297–317), Rel A (reactive with amino acids
3–19), NH2-terminal NF-B1 (reactive with
amino acids 1–19), NLS-directed NF-B1 (reactive with amino acids
350–363), COOH-terminal NF-B1 (reactive with amino acids 471–490),
c-Rel (reactive with amino acids 152–176), NF-B2 (reactive with
amino acids 298–324), or protein kinase C (reactive with amino
acids 651–672); all antibodies were obtained from Santa Cruz Biotech
(Santa Cruz, CA). Immune complexes were detected by binding donkey
anti-rabbit IgG conjugated to horseradish peroxidase (Pierce Chemical Co., Rockford, IL) followed by reaction in the enhanced
chemiluminescence assay (ECL, Amersham International,
Arlington Heights, IL) according to the manufacturer’s
recommendations.
|
FOOTNOTES |
|---|
This work was supported in part by National Heart, Lung, and Blood Institute Grant R01 55630–03 (to A.R.B.) and National Institutes of Environmental Health P30 ES06676 (R.S. Lloyd, University of Texas Medical Branch). A.R.B. is an Established Investigator of the American Heart Association. We thank Bruce Howard (The National Institute of Allergy and Infectious Diseases), and T. J. Murphy (Emory University, Atlanta, GA) for plasmids, and William Henckler (Merck & Co., Inc., Wilmington, DE) for Dup 753.
Received for publication May 18, 1999. Revision received September 14, 1999. Accepted for publication September 20, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B p65) transcription factor: one
mechanism for the renin angiotensin system (RAS) positive feedback loop
in hepatocytes. Mol Endocrinol 10:252–264B. Annu Rev Cell Biol 10:405–455[CrossRef]
B1 nuclear translocation in tumor necrosis factor
-stimulated hepatocytes. J Biol Chem 272:9823–9830
-induced IL-8
transcription in type II pulmonary epithelial cells: dependence on
nuclear abundance of Rel A, NF-B1 and c-Rel transcription factors.
J Biol Chem 273:3551–3561
induced, NFB mediated trans- activation of the angiotensinogen gene
acute-phase response element. EMBO J 9:3933–3944[Medline]
B-IB autoregulatory feedback loop in
hepatocytes: a role for PKCa in post-transcriptional regulation of
IB resynthesis. J Biol Chem274: 939–947
B1 precursor protein and the activation of NF-B. Cell 78:773–785[CrossRef][Medline]
B proteolysis
occurs independently of the proteasome pathway in respiratory syncytial
virus-infected pulmonary epithelial cells. J Virol 72:4849–4857B kinase
complex. Science 278:818–819B-alpha proteolysis by site-specific,
signal-induced phosphorylation. Science 267:1485–1488B by cyclin-dependent kinases associated
with the p300 coactivator. Science 275:523–527B
precursor and an IB isoform contain transcription activation
domains. Nucleic Acids Res 20:2453–2458B-regulated transcription. Mol Cell Biol14:8460–8470
B-mediated signal
transduction. Genes Dev 7:705–718B1–p50 is involved in NF-B activation and stable DNA
binding. J Biol Chem 269:30089–30092B
in vivo is regulated by multiple phosphorylations. EMBO J 13:4597–4607[Medline]
This article has been cited by other articles:
 |
|
 |
|
  R. Satou, R. A. Gonzalez-Villalobos, K. Miyata, N. Ohashi, A. Katsurada, L. G. Navar, and H. Kobori Costimulation with angiotensin II and interleukin 6 augments angiotensinogen expression in cultured human renal proximal tubular cells Am J Physiol Renal Physiol, July 1, 2008; 295(1): F283 - F289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Nowak, B. Tian, M. Jamaluddin, I. Boldogh, L. A. Vergara, S. Choudhary, and A. R. Brasier RelA Ser276 Phosphorylation Is Required for Activation of a Subset of NF-{kappa}B-Dependent Genes by Recruiting Cyclin-Dependent Kinase 9/Cyclin T1 Complexes Mol. Cell. Biol., June 1, 2008; 28(11): 3623 - 3638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Choudhary, M. Lu, R. Cui, and A. R. Brasier Involvement of a Novel Rac/RhoA Guanosine Triphosphatase-Nuclear Factor-{kappa}B Inducing Kinase Signaling Pathway Mediating Angiotensin II-Induced RelA Transactivation Mol. Endocrinol., September 1, 2007; 21(9): 2203 - 2217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. McAllister-Lucas, J. Ruland, K. Siu, X. Jin, S. Gu, D. S. L. Kim, P. Kuffa, D. Kohrt, T. W. Mak, G. Nunez, et al. CARMA3/Bcl10/MALT1-dependent NF-{kappa}B activation mediates angiotensin II-responsive inflammatory signaling in nonimmune cells PNAS, January 2, 2007; 104(1): 139 - 144. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Cui, B. Tieu, A. Recinos, R. G. Tilton, and A. R. Brasier RhoA Mediates Angiotensin II-Induced Phospho-Ser536 Nuclear Factor {kappa}B/RelA Subunit Exchange on the Interleukin-6 Promoter in VSMCs Circ. Res., September 29, 2006; 99(7): 723 - 730. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Arenas, S. J. Armstrong, Y. Xu, and S. T. Davidge Tumor Necrosis Factor-{alpha} and Vascular Angiotensin II in Estrogen-Deficient Rats Hypertension, September 1, 2006; 48(3): 497 - 503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Hai, M.-L. Yeung, T. G. Wood, Y. Wei, S. Yamaoka, Z. Gatalica, K.-T. Jeang, and A. R. Brasier An Alternative Splice Product of I{kappa}B Kinase (IKK{gamma}), IKK{gamma}-{Delta}, Differentially Mediates Cytokine and Human T-Cell Leukemia Virus Type 1 Tax-Induced NF-{kappa}B Activation J. Virol., May 1, 2006; 80(9): 4227 - 4241. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Choudhary, S. Boldogh, R. Garofalo, M. Jamaluddin, and A. R. Brasier Respiratory Syncytial Virus Influences NF-{kappa}B-Dependent Gene Expression through a Novel Pathway Involving MAP3K14/NIK Expression and Nuclear Complex Formation with NF-{kappa}B2 J. Virol., July 15, 2005; 79(14): 8948 - 8959. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling J. Biol. Chem., April 29, 2005; 280(17): 17435 - 17448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Brasier, H. Spratt, Z. Wu, I. Boldogh, Y. Zhang, R. P. Garofalo, A. Casola, J. Pashmi, A. Haag, B. Luxon, et al. Nuclear Heat Shock Response and Novel Nuclear Domain 10 Reorganization in Respiratory Syncytial Virus-Infected A549 Cells Identified by High-Resolution Two-Dimensional Gel Electrophoresis J. Virol., November 1, 2004; 78(21): 11461 - 11476. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Skurk, V. van Harmelen, and H. Hauner Angiotensin II Stimulates the Release of Interleukin-6 and Interleukin-8 From Cultured Human Adipocytes by Activation of NF-{kappa}B Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1199 - 1203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. Haeberle, A. Casola, Z. Gatalica, S. Petronella, H.-J. Dieterich, P. B. Ernst, A. R. Brasier, and R. P. Garofalo I{kappa}B Kinase Is a Critical Regulator of Chemokine Expression and Lung Inflammation in Respiratory Syncytial Virus Infection J. Virol., March 1, 2004; 78(5): 2232 - 2241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Jacoby and D. J. Rader Renin-Angiotensin System and Atherothrombotic Disease: From Genes to Treatment Arch Intern Med, May 26, 2003; 163(10): 1155 - 1164. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang, M. Jamaluddin, S. Wang, B. Tian, R. P. Garofalo, A. Casola, and A. R. Brasier Ribavirin Treatment Up-Regulates Antiviral Gene Expression via the Interferon-Stimulated Response Element in Respiratory Syncytial Virus-Infected Epithelial Cells J. Virol., May 15, 2003; 77(10): 5933 - 5947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Tian and A. R. Brasier Identification of a Nuclear Factor Kappa B-dependent Gene Network Recent Prog. Horm. Res., January 1, 2003; 58(1): 95 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhao and K. P. Karalis Regulation of Nuclear Factor-{kappa}B by Corticotropin-Releasing Hormone in Mouse Thymocytes Mol. Endocrinol., November 1, 2002; 16(11): 2561 - 2570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Tian, Y. Zhang, B. A. Luxon, R. P. Garofalo, A. Casola, M. Sinha, and A. R. Brasier Identification of NF-{kappa}B-Dependent Gene Networks in Respiratory Syncytial Virus-Infected Cells J. Virol., June 5, 2002; 76(13): 6800 - 6814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Lorenzo, M. Ruiz-Ortega, Y. Suzuki, M. Ruperez, V. Esteban, T. Sugaya, and J. Egido Angiotensin III Activates Nuclear Transcription Factor-{kappa}B in Cultured Mesangial Cells Mainly via AT2 Receptors: Studies with AT1 Receptor-Knockout Mice J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1162 - 1171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ray, C. T. Sherman, M. Lu, and A. R. Brasier Angiotensinogen Gene Expression Is Dependent on Signal Transducer and Activator of Transcription 3-Mediated p300/cAMP Response Element Binding Protein-Binding Protein Coactivator Recruitment and Histone Acetyltransferase Activity Mol. Endocrinol., April 1, 2002; 16(4): 824 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Berry, R. Touyz, A. F. Dominiczak, R. C. Webb, and D. G. Johns Angiotensin receptors: signaling, vascular pathophysiology, and interactions with ceramide Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2337 - H2365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Sherman and A. R. Brasier Role of Signal Transducers and Activators of Transcription 1 and -3 in Inducible Regulation of the Human Angiotensinogen Gene by Interleukin-6 Mol. Endocrinol., March 1, 2001; 15(3): 441 - 457. [Abstract] [Full Text]
|
|
|
|
|
|
F. C. Luft Workshop: Mechanisms and Cardiovascular Damage in Hypertension Hypertension, February 1, 2001; 37(2): 594 - 598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Brasier, M. Lu, T. Hai, Y. Lu, and I. Boldogh NF-kappa B-inducible BCL-3 Expression Is an Autoregulatory Loop Controlling Nuclear p50/NF-kappa B1 Residence J. Biol. Chem., August 17, 2001; 276(34): 32080 - 32093. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
