help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jamaluddin, M.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jamaluddin, M.
Right arrow Articles by Brasier, A. R.
Molecular Endocrinology 14 (1):99
Copyright © 2000 by The Endocrine Society

Angiotensin II Induces Nuclear Factor (NF)-{kappa}B1 Isoforms to Bind the Angiotensinogen Gene Acute-Phase Response Element: A Stimulus-Specific Pathway for NF-{kappa}B Activation

Mohammad Jamaluddin, Tao Meng, Juan Sun, Istvan Boldogh, Youqi Han and Allan R. Brasier

Department of Internal Medicine (M.J., T.M., J.S., Y.H., A.R.B.) Department of Microbiology & Immunology (I.B.) Sealy Center for Molecular Sciences (A.R.B.) University of Texas Medical Branch Galveston, Texas 77555-1060


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The vasopressor angiotensin II (AII) activates transcriptional expression of its precursor, angiotensinogen. This biological "positive feedback loop" occurs through an angiotensin receptor-coupled pathway that activates a multihormone-responsive enhancer of the angiotensinogen promoter, termed the acute-phase response element (APRE). Previously, we showed that the APRE is a cytokine [tumor necrosis factor-{alpha} (TNF{alpha})]- inducible enhancer by binding the heterodimeric nuclear factor-{kappa}B (NF-{kappa}B) complex Rel A•NF-{kappa}B1. Here, we compare the mechanism for NF-{kappa}B activation by the AII agonist, Sar1 AII, with TNF{alpha} in HepG2 hepatocytes. Although Sar1 AII and TNF{alpha} both rapidly activate APRE-driven transcription within 3 h of treatment, the pattern of inducible NF-{kappa}B binding activity in electrophoretic mobility shift assay is distinct. In contrast to the TNF{alpha} mechanism, which strongly induces Rel A•NF-{kappa}B1 binding, Sar1 AII selectively activates a heterogenous pattern of NF-{kappa}B1 binding. Using a two-step microaffinity DNA binding assay, we observe that Sar1 AII recruits 50-, 56-, and 96-kDa NF-{kappa}B1 isoforms to bind the APRE. Binding of all three NF-{kappa}B1 isoforms occurs independently of changes in their nuclear abundance or proteolysis of cytoplasmic I{kappa}B inhibitors. Phorbol ester-sensitive protein kinase C (PKC) isoforms are required because PKC down-regulation completely blocks AII-inducible transcription and inducible NF-{kappa}B1 binding. We conclude that AII stimulates the NF-{kappa}B transcription factor pathway by activating latent DNA-binding activity of NF-{kappa}B subunits through a phorbol ester-sensitive (PKC-dependent) mechanism.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In multicellular organisms, hormonal systems coordinate complex tissue responses to challenges in homeostasis through programmed responses mediated by ligand-activated receptors. After receptor activation, second messenger signals are produced that control intracellular kinase, phosphatase, and proteolytic pathways to allow the cellular components of tissues to respond coordinately to the stressing agent. A consequence of signal transduction cascade is to control the expression of genetic networks that allow for long-term changes in the function of the organism.

The intravascular renin-angiotensin system (RAS) is a cardiovascular homeostatic system that produces peptides such as the vasopressor, angiotensin II (AII), in the intravascular space (1 2 ) as a response to cardiovascular stress. In response to hypotensive stimuli, for example, the kidney secretes an aminopeptidase (renin), an enzyme that catalyzes the first (rate-limiting) cleavage of the angiotensinogen (AGT) precursor into angiotensin I. After its rapid and stoichiometric conversion to AII, AII restores cardiovascular homeostasis through its potent vasoconstrictive and salt-retaining properties, mediated through binding the type 1 AII receptor (AT1, Ref. 3 ). Recently increased attention has been paid to the concept that intravascular AII formation activates genetic changes in responsive tissues (Refs. 4 5 and reviewed in Ref. 6 ). Through AT1 binding, AII activates the expression of early response and inflammatory genes, including immediate-early transcription factors [AP-1 (7 8 )], tyrosine receptor- coupled transcription factors [STAT (9 )], and Egr-1 (10 ) in vascular smooth muscle cells and the adrenal cortex.

Activation of the intravascular RAS, in addition, initiates a biological positive feedback loop in the hepatocyte, stimulating the synthesis of its own precursor, AGT, by a mechanism involving enhanced mRNA production (4 11 12 ). Nuclear run-on assays (5 ) and promoter mapping studies (13 ) have demonstrated that AII activates AGT transcription over physiologically relevant concentrations of hormone. Previously, we reported the surprising findings that the AII-inducible cis-element mediating AGT transcription was a well characterized cytokine-inducible enhancer responsible for mediating the transcriptional induction of AGT during the acute phase response (this element is termed the acute phase response element (APRE) (Ref. 13 ; reviewed in Ref. 6 ).

Cytokines and AII stimulate transcription of AGT in a manner dependent on binding the potent NF-{kappa}B transcription factor (13 ). NF-{kappa}B is a family of homo- and heterodimeric proteins containing a homologous NH2-terminal Rel homology domain (14 ) tethered in the cytoplasm of unstimulated cells by hormone-regulated association with the I{kappa}B inhibitors. The NF-{kappa}B DNA-binding subunits are NF-{kappa}B1 p50 (50 kDa) and NF-{kappa}B2 p49, encoded by proteolytically processed precursor proteins of approximately 105 and 100 kDa, respectively (reviewed in Ref. 14 ). The transcription-activating subunits of NF-{kappa}B are Rel A and c-Rel; these bind DNA weakly. To activate, Rel A and c-Rel are targeted to some NF-{kappa}B binding sites as heterodimers with the NF-{kappa}B1- or NF-{kappa}B2 binding subunits (16 22 ). Because the transcription-activating NF-{kappa}B subunits associate with the cytoplasmic I{kappa}B inhibitors, heterodimeric Rel A and c-Rel complexes are inducible by cytoplasmic-to-nuclear translocation. For example, the potent transactivator, Rel A•NF-{kappa}B1, rapidly translocates from the cytoplasm into the nucleus after cytokine-induced I{kappa}B{alpha} proteolysis. In contrast, NF-{kappa}B1 p50 homodimers are constitutively nuclear and bind DNA avidly, yet activate transcription weakly, if at all (6 14 15 ). A number of studies, including UV cross-linking (16 ), gel mobility supershift assays with isoform-specific NF-{kappa}B antibodies (17 ), and transient overexpression assays (15 ), indicate that the Rel A•NF-{kappa}B1 p50 heterodimer is the primary cytokine-inducible NF-{kappa}B subunit binding the APRE in hepatocytes. The mode of NF-{kappa}B regulation by AII is unknown.

Here we report observations that AII-inducible gene activation occurs through an mechanism independent from that used by cytokines. High resolution gel mobility shift assays show that AII induces a pattern of NF-{kappa}B binding complexes different from that produced by TNF{alpha}. Using a specific biotinylated DNA binding/Western immunoblot assay, we demonstrate that, in contrast to TNF{alpha}, AII does not increase Rel A binding but, rather, selectively increases binding of larger 96-kDa and 56-kDa NF-{kappa}B1 isoforms. Binding of the larger NF-{kappa}B1 isoforms occurs without steady-state changes in their nuclear abundance and is independent of I{kappa}B{alpha} proteolysis. AII-induced recruitment of NF-{kappa}B1 p50, p56, and p96 kDa isoforms is dependent on activity of phorbol ester- sensitive protein kinase C (PKC) isoforms. These data indicate that AII activates NF-{kappa}B through a separate pathway than that used by cytokines and involves inducible recruitment of previously uncharacterized latent NF-{kappa}B1 binding isoforms.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Kinetics of Agonist-Inducible Transcription
In previous studies, we observed that treatment with physiological concentrations of the AII agonist (Sar1 AII, 10–100 nM) increases transcription of the native AGT promoter in an APRE-dependent manner, where site mutations of the APRE abolish AII inducibility (13 ). Sar1 AII rapidly increases APRE-driven transcription through NF-{kappa}B binding [by activating APRE WT-LUC reporter activity, but not the NF-{kappa}B binding site mutations (e.g. APRE M2 or APRE M6)] with an apparent peak at 6 h and falling thereafter (13 ). To further study the mechanism for transcriptional induction, we compared the early kinetics of APRE-driven transcription in response to maximal doses of the agonists TNF{alpha} (30 ng/ml) and Sar1 AII (100 nM from 0–6 h (Fig. 1Go). Luciferase was selected as a reporter because its rapid turnover closely monitors changes in transcription of endogenous genes, where, after gene activation, changes in luciferase activity can be measured within 2 h (18 ). In HepG2 cells transiently transfected with APRE-LUC, Sar1 AII begins to increase transcriptional activity at statistically significant levels at 1 h and plateaus at a 7.6 ± 4-fold (x ± SEM, n = 11) from 3–6 h. In contrast, although TNF{alpha} also produces a similar rapid induction, the level of activity at 6 h is significantly higher than that produced by Sar1 AII, peaking at 20 ± 5 fold (x ± SEM, n = 12, P < 0.05 compared with Sar1 AII). As additional demonstration that the Sar1 AII effect on APRE-driven transcription is mediated through the AT1 receptor, increasing concentrations of the specific (competitive) AT1 receptor antagonist, Dup 753 (19 ) were included in the transfection (Fig. 1BGo). Although only 4% inhibition was seen at 0.01 µM Dup753, 64% inhibition was seen at 0.1 µM Dup753, and 72% inhibition was seen at 1.0 µM Dup753 (10-fold excess relative to agonist), a concentration well within the IC50 of the antagonist (3 ). Together, these data indicate that Sar1 AII activates APRE-driven transcription through an AT1-dependent pathway.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Hormone-Inducible APRE WT-LUC Transcription

A, Early kinetics of hormone (TNF{alpha} and Sar1 AII) treatment by transient transfection assays. HepG2 hepatocytes were transfected with the APRE-LUC reporter gene. APRE LUC containing a trimerized AGT APRE wild type (WT) sequence upstream of the AGT TATA box is driving the expression of the firefly luciferase reporter gene (20 ). Transfectants(16 ) were stimulated from 0–6 h before simultaneous harvest at 46 h. Shown is the mean ± SEM of n =12 independent experiments (Sar1 AII) and n = 11 experiments (for TNF{alpha}). Squares, 30 ng/ml TNF{alpha}; circles, 100 nM Sar1 AII. * Indicates different from control (P < 0.05), + different between treatment group (P < 0.05, paired t test). B, Sar1 AII effect is mediated by the type 1 AT receptor. HepG2 hepatocytes were stimulated with 100 nM Sar1 AII for 6 h in the absence or presence of indicated concentrations of the specific (competitive) AT1 receptor antagonist, Dup753 (Losartan). Shown is the fold induction in the mean ± SD of representative transfection repeated in three independent experiments. Percent inhibition as a function of Dup753 competitive inhibitor concentration: for 0.01 µM Dup753, 4%; for 0.1 µM Dup753, 64%; for 1.0 µM Dup753, 72%; for 10.0 µM Dup753, 80%.

 
Agonist-Specific Differences in Inducible APRE Binding Activity
To assay changes in APRE-binding proteins in a homogeneous population of cells, transient transfectants were immunoaffinity purified by magnetic separation. In this technique, antibodies to a transfected cell surface marker not normally expressed by HepG2 cells (IL-2 receptor {alpha}-subunit) is used to positively select transient transfectants. Under these conditions, 99% of reporter gene activity is bound to the magnetic beads representing a 19- to 30-fold enrichment in specific activity (Table 1Go). We interpret these data to indicate that the bound cells are a nearly homogeneous population of transient transfectants. After this isolation, sucrose cushion-purified nuclear extracts were prepared and APRE-binding activity assayed in electrophoretic mobility shift assay (EMSA). Figure 2Go represents time course experiments of control and stimulated HepG2 cells assayed by EMSA under conditions where individual heterodimeric NF-{kappa}B complexes can be resolved. In control cells, we routinely detect two NF-{kappa}B-specific complexes, complex 2 (C2) and C4. Based on antibody supershifting experiments, we have previously reported that the complex C2 represents the Rel A•NF-{kappa}B1 heterodimer, and that the C4 complex represents NF-{kappa}B1 homodimers (17 ). In control extracts, a faint C2 pattern and a strong C4 binding pattern are seen (Fig. 2AGo, top and bottom panels, lane 1) indicating that APRE binding activity is predominately that of NF-{kappa}B1 (with lesser, but detectable, Rel A binding). Sar1AII treatment weakly increased (2- to 4-fold) the binding of the C4 complex over the 6-h time course (although C2 apparently decreased in this particular experiment, in four independent experiments, there was no consistent effect on C2 binding).


View this table:
[in this window]
[in a new window]
 
Table 1. Immunoaffinity Purification of Transient Transfectants

 


View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Sar1 AII Induces Binding Of NF-{kappa}B Homodimeric Complexes

A, Top, Time course of Sar1 AII treatment. EMSA of nuclear protein binding the APRE WT from cells stimulated for the indicated times (in hours, top) with 100 nM Sar1 AII from a homogenous transfected cell population (Materials and Methods). Shown is an autoradiogram of the bound complexes only. C2 is a Rel A•NF-{kappa}B1 heterodimer, whereas C4 is a NF-{kappa}B1 homodimer (17 ). After treatment, C4 binding increases weakly in parallel with the changes in APRE LUC reporter activity. n.s., A nonspecific DNA-binding complex. Bottom, Time course of TNF{alpha} stimulation. Autoradiogram of representative experiment. TNF{alpha} is a potent inducer of the C2 complex, followed by a nadir at 1 h [due to the NF-{kappa}B-I{kappa}B autoregulatory loop (19 24 )]. C2 then reaccumulates in the nucleus at 3 and 6 h. B, Competition analysis of AII-inducible complexes. Nuclear extracts from cells stimulated for 6 h with 100 nM Sar1 AII were used to bind to radioactive APRE WT in the absence or presence of indicated unlabeled competitor oligonucleotides (Materials and Methods) at a 10-fold molar excess. The C4 complex is competed with APRE WT and APRE BPi duplexes. N.S., Nonspecific complex.

 
The pattern of Sar1 AII-inducible binding is qualitatively different with the pattern induced by TNF{alpha} (Fig. 2AGo, bottom panel). Upon TNF{alpha} stimulation, the C2 and C4 complexes are rapidly induced at 15 and 30 min, followed by a nadir at 1 h (Fig. 2AGo, bottom panel, lanes 2–4). Induction of C2 and C4 binding is due to rapid increase in nuclear abundance of Rel A and NF-{kappa}B1, whereas the 1-h nadir in C2 binding is due to overshoot resynthesis of the I{kappa}B{alpha} inhibitor (17 ). Although the C2 binding returns at 3 and 6 h, the abundance is weaker than the 15-min time point due to partial cytoplasmic sequestration of Rel A (17 ). These data indicate that the two agonists induce qualitatively distinct NF-{kappa}B binding profiles.

To verify that the Sar1 AII-inducible C4 complex binds with NF-{kappa}B binding specificity, competition analysis was performed using previously characterized APRE site mutations (Fig. 2BGo and Materials and Methods). Inducible C4 binding is efficiently competed with 10-fold molar excess of either homologous probe (APRE WT) or BPi, a mutation that binds NF-{kappa}B but selectively disrupts C/EBP binding (20 ) and is not competed by the NF-{kappa}B-disruptive APRE M6 or M2 mutations (20 ).

Sar1 AII Induces NF-{kappa}B1 Binding Activity
These data indicated that Sar1 AII may activate a different subset of NF-{kappa}B complexes than those regulated by TNF{alpha}. Supershifting assays were next used to qualitatively compare the NF-{kappa}B subunits binding the APRE from Sar1 AII-stimulated cells. In AII-stimulated extracts, anti-NF-{kappa}B1 antibody produced a strong supershift of two separate bands. Surprisingly, weak supershifted bands were seen with the addition of Rel A and NF-{kappa}B2 antibodies in a manner that did not differ from that of control extracts (data not shown). These data indicated that AII induced primarily the binding of NF-{kappa}B1 proteins. As a direct comparison, control and Sar1 AII-treated extracts were supershifted in parallel with the addition of nuclear localization signal (NLS)-directed NF-{kappa}B1 antibody. This antibody produced a strong supershift of two NF-{kappa}B1 bands whose intensities were increased after Sar1 AII treatment (Fig. 3Go). These data indicated that Sar1 AII activates binding of NF-{kappa}B1 in a qualitatively distinct pattern from NF-{kappa}B proteins induced by TNF{alpha}. Moreover, the presence of multiple supershifted bands suggest a heterogeneous population of NF-{kappa}B1 isoforms are binding the APRE.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 3. Supershift Assay for NF-{kappa}B Isoforms in Control and Hormone-Treated Cells

A, Sar1 AII increases NF-{kappa}B1 binding activity. Supershift assay using equal amounts (15 µg) nuclear extract from control and Sar1 AII-stimulated cells in the presence of anti-NF-{kappa}B1p50 (C-19) antibody. Shown are two regions from the same autoradiographic exposure. Compared with untreated cells, Sar1 AII produced stronger supershifted complexes of NF-{kappa}B1 binding (indicated as dash and bracket). Bottom panel is a lighter exposure to indicate depletion of the AII-inducible C4 complex.

 
Microaffinity Capture of Agonist-Inducible NF-{kappa}B Subunits
To rigorously determine the composition of the NF-{kappa}B subunits regulated by hormone, we applied a technique for microaffinity capture of DNA binding proteins followed by their detection using Western blotting (18 ). This specific technique avoids inherent problems associated with epitope masking in native complexes and can detect NF-{kappa}B isoforms without the bias introduced by UV cross-linking. Using this two-step microaffinity isolation technique, we analyzed the patterns of TNF{alpha}-inducible NF-{kappa}B proteins binding to the APRE (Fig. 4AGo). Affinity-isolated APRE-binding proteins from control and TNF{alpha}-stimulated cells were probed with a panel of anti-NF-{kappa}B antibodies. Although the inducible binding protein Rel A and c-Rel are primarily cytoplasmic, in situations where the abundance of these proteins are systematically analyzed, a small fraction is nuclear [even in unstimulated cells (17 )]. We observed staining of 65-kDa Rel A, 50-kDa NF-{kappa}B1, 68-kDa c-Rel, and 50-kDa NF-{kappa}B2, indicating their presence in unstimulated HepG2 nuclear extracts (17 ). These data are consistent with the presence of Rel A-containing C2 binding in EMSA (c.f. Fig. 2AGo). However, after TNF{alpha} stimulation, a strong induction of Rel A, NF-{kappa}B1, c-Rel, and a weaker induction of NF-{kappa}B2 binding occurred on the APRE (Fig. 4AGo). We have shown that this increase is due to changes in steady state abundance of these proteins in the nuclear compartment (17 ).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Microaffinity Capture of APRE Binding Proteins after Cytokine Treatment

A, TNF{alpha}-inducible NF-{kappa}B complexes. Nuclear extracts from control (–) and TNF{alpha} (30 ng/ml, 15 min, ++)- treated cells were affinity purified by Bt-APRE-Streptavidin capture (Materials and Methods), and probed with indicated antibody in Western immunoblot. Blots from representative experiments are shown. Migration of molecular mass markers (in kilodatons) are shown at left. 65-kDa Rel A is detectable in control extracts and increases 8-fold (relative to control) after TNF{alpha} treatment. Similarly, 50 kDa NF-{kappa}B1 (15-fold), 68 kDa c-Rel (10-fold), and 50 kDa NF-{kappa}B2 (2-fold) are induced after TNF{alpha}-stimulation. A short exposure of NF-{kappa}B1 is shown to illustrate its induction after cytokine treatment. (The antibody used in this experiment is directed to amino acids 350–363 of NF-{kappa}B1; a longer exposure showing constitutive NF-{kappa}B1 binding is presented in panel B). Specific complexes are indicated by *. B, Binding specificity. Nuclear extracts from control (–) and TNF{alpha} (++)-treated cells were affinity purified by Bt-APRE-Streptavidin capture assay in the absence or presence of the indicated (nonbiotinylated) competitor DNA in the initial binding reaction. Top panel, Western blot using Rel A as the primary antibody. Bottom, NF-{kappa}B1 antibody. The antibody used is NLS-directed NF-{kappa}B1 (reactive with amino acids 350–363). The inducible NF-{kappa}B binding is competed with APRE WT, but not the NF-{kappa}B site mutation (APRE M6), indicating complexes detected by this assay bind in a sequence-specific fashion.

 
Binding specificity of the prominent Rel A and NF-{kappa}B1 p50 complexes was demonstrated by competition assay where nonbiotinylated DNA competitors were added to the initial binding reaction (Fig. 4BGo). Detection of both Rel A and NF-{kappa}B1 binding is specifically reduced with the WT oligonucleotide competitor, but not the NF-{kappa}B mutant, APRE M6, indicating that the binding of these isoforms is NF-{kappa}B-specific (c.f. Fig 2BGo and Refs. 17 20 ).

The Bt-microaffinity isolation/Western blot technique was applied to nuclear extract from the Sar1 AII-treated cells; a pattern of inducible complexes was produced that was distinct from that seen for TNF{alpha} (Fig. 5Go). No relative change in Rel A binding was observed, but inducible binding of both NF-{kappa}B2 and NF-{kappa}B1 was seen. Surprisingly, in addition to the NF-{kappa}B1 p50 subunit, several additional, larger complexes induced by Sar1 AII were specifically detected by the NF-{kappa}B1 antibody (of 56 and 96 kDa). Together, these data indicate Sar1 AII induces NF-{kappa}B1 isoform binding to the APRE (without changes in Rel A binding).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 5. Micoaffinity Capture of APRE Binding Proteins after Sar1 AII Treatment

Nuclear extracts from control (–) and Sar1 AII (100 nM, 6 h, ++)- treated cells were affinity purified by Bt-APRE-Streptavidin capture (Materials and Methods), and probed with indicated antibody in Western immunoblot. Only Rel A, NF-{kappa}B1, and NF-{kappa}B2 consistently showed signals in the Western blot and are shown. Left (top), Abundance of Rel A binding was not detectably different in control and AII-stimulated extracts. Left (bottom), 50-kDa NF-{kappa}B2 binding was weakly induced (1.8-fold relative to control). Right, NF-{kappa}B1 staining detected several species. NF-{kappa}B1 50 kDa species is induced by 2-fold. Also consistently seen were two larger isoforms at 56 and 96 kDa (latter increasing 4.8-fold, p56 could not be accurately quantitated due to its low signal in control lanes). Asterisks are specific NF-{kappa}B1 signals as they are blocked by preadsorption of the antibody and presumably are breakdown products, as their presence was inconsistently detected (c.f. Figs. 7CGo and 8Go). The antibody used in this experiment is the NLS-directed NF-{kappa}B1 (reactive with amino acids 350–363).

 
Sar1 AII Induction of NF-{kappa}B1 Binding Is Independent Of I{kappa}B Proteolysis
We next examined whether Sar1 AII induced changes in steady state I{kappa}B levels [as most NF-{kappa}B activators induce I{kappa}B proteolysis (14 )]; of the isoforms expressed in hepatocytes, I{kappa}B{alpha} is the most abundant (17 21 ). In our hands, the Western immunoblot signal for I{kappa}B{alpha} was proportional to input protein over a 4-fold concentration of cytoplasmic extract (50–200 µg; Fig. 6AGo, top panel). In nonselected HepG2 cell populations, we previously demonstrated that TNF{alpha} induces a biphasic pattern of I{kappa}B{alpha} proteolysis and resynthesis. This phenomenon is part of an NF-{kappa}B-I{kappa}B autoregulatory feedback loop that accounts for nadir in C2 binding at 1 h (Ref s. 19 and 24 and Fig. 2Go). To confirm that the immunoaffinity isolation does not produce systematic artifacts in our ability to detect changes in I{kappa}B{alpha} abundance, dynamic changes in cytoplasmic I{kappa}B{alpha} levels were measured after immunoaffinity isolation of TNF{alpha}-stimulated cells (Fig. 6AGo, bottom). In control cells, I{kappa}B{alpha} abundance is easily detected as a 37-kDa band. Within 15 min of TNF{alpha} stimulation, I{kappa}B{alpha} is rapidly proteolyzed and is undetectable. Thereafter the abundance of I{kappa}B{alpha} increases, and after 1 h stimulation, I{kappa}B{alpha} is resynthesized to 2-fold greater than control levels (17 21 ). Because the pattern of I{kappa}B{alpha} proteolysis (and resynthesis) is identical to our previous observations in populations of TNF{alpha}-stimulated HepG2 cells, the immunoaffinity isolation/Western immunoblot assay is suitable for detection of dynamic changes in I{kappa}B{alpha} abundance. This assay was then applied to cytoplasmic extracts of cells stimulated by Sar1 AII. Surprisingly, in contrast to those effects induced by TNF{alpha}, Sar1 AII treatment did not produce detectable changes in either I{kappa}B{alpha} or I{kappa} steady-state levels in the cytoplasm (Fig. 6BGo), even though the assay was done at identical time points when inducible C4 binding was observed in EMSA (c.f. Fig 2AGo). These data, repeated three times in independent experiments, indicate that Sar1 AII activates NF-{kappa}B1 binding independently of detectable changes in cytoplasmic I{kappa}B abundance.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. The AII Effect Is Independent of Changes in I{kappa}B Steady State Abundance

A, Dynamic changes in I{kappa}B{alpha} steady state levels after TNF{alpha} stimulation. Top panel, Standard curve in Western immunoblot using indicated concentrations of cytoplasmic protein. The Western blot is linear over 4-fold differences in protein concentration. Bottom panel, dynamic changes in I{kappa}B{alpha} after TNF{alpha} stimulation. Cytoplasmic extracts of TNF{alpha}-stimulated cells (30 ng/ml for the indicated times, in hours) were immunoaffinity purified and assayed for changes in I{kappa}B{alpha} abundance by Western immunoblot. I{kappa}B{alpha} is rapidly depleted from the cytoplasm at 15 min and is resynthesized to 2-fold greater than control levels [1 h, (17 )]. These kinetics are exactly those seen in nonpurified HepG2 cells (17 21 ), indicating the isolation protocol does not artifactually influence I{kappa}B recovery. B, Effect of Sar1 AII on I{kappa}B{alpha} and I{kappa}Bß steady state levels. Cytoplasmic extracts from control and Sar1 AII-stimulated cells were prepared after the same times of stimulation and analyzed for I{kappa}B{alpha} abundance by Western. No change in steady state abundance of either I{kappa}B isoform could be detected over a time course where inducible NF-{kappa}B binding was observed. This experiment was reproduced three times with qualitatively similar results.

 
Inducible NF-{kappa}B1 Binding Occurs Independently of Changes in Either NF-{kappa}B1 Processing or Nuclear Abundance
NF-{kappa}B1 processing has previously been shown to occur through the ubiquitin-proteasome pathway and is sensitive to the effect of the proteasome inhibitor, MG132 [Z-Leu-Leu-Leucinal, (22 )]. Because our data indicated Sar1 AII stimulated binding of NF-{kappa}B1 isoforms to the APRE, perhaps through a mechanism involving NF-{kappa}B1 p105 processing, we asked whether MG132 would interfere with APRE-driven transcription. Transient HepG2 transfectants were treated with nothing, Sar1-AII, or Sar1 AII + MG132 before harvest for luciferase reporter activity. We observed that pretreatment of with MG132 (25 µM, 30 min before stimulation) completely blocked inducible reporter activity (Fig. 7AGo). To investigate the mechanism for the inhibitory effect of MG132, Western immunoblots for the NF-{kappa}B subunits were performed on nuclear extracts from the homogeneous population of immunoaffinity isolated cells. First, changes in Rel A were examined. As shown in Fig. 7BGo, Sar1 AII stimulation had no effect on the constitutive abundance of nuclear Rel A. Moreover, the inhibitory effects of MG132 are not mediated through detectable changes in abundance of the 65-kDa transactivatory subunit Rel A, as its nuclear level was not influenced by MG132 treatment (Fig. 7BGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Proteasome Inhibitors Block Sar1 AII-Inducible Transcription and NF-{kappa}B1 Binding

A, Transient transfection assay. HepG2 cells were transiently transfected with APRE LUC expression plasmid (as in Fig. 1Go) and stimulated with nothing, Sar1 AII (100 nM), or Sar1 AII in the presence of the proteasome inhibitor, MG132. Six hours later, cells were harvested and assayed for luciferase and internal control alkaline phosphatase activity. Shown are the results of a representative experiment of triplicate plates, repeated six times. MG132 produced greater than 100% inhibition. B, Effect of Sar1 AII on subcellular abundance of Rel A. Western immunoblot of Rel A abundance in cytoplasmic (Cyto) and nuclear (Nuc) fractions from cells stimulated with nothing, Sar1 AII, or Sar1 AII in the presence of the proteasome inhibitor MG132 (as above). Steady state levels of Rel A are unaffected by Sar1 AII treatment in the absence or presence of MG132. C, Effect of Sar1 AII on subcellular abundance of NF-{kappa}B1 isoforms. Lefthand panel, cytoplasmic (Cyto) extract (from control cells) and nuclear extracts (Nuc) from control, Sar1 AII, or Sar1 AII + MG132-treated cells were isolated and analyzed for NF-{kappa}B1 by Western immunoblot using NF-{kappa}B1 antibody (reactive with amino acids 350–363). The cytoplasmic lane is relatively overexposed to allow optimal visualization of the lower abundance nuclear fractions and nonspecific bands are also detected. The specific cytoplasmic NF-{kappa}B1 isoforms, the p105 precursor and p50 are indicated at left. Asterisks are inconsistently detected NF-{kappa}B1 breakdown products. The nuclear 50-, 56-, and 96-kDa NF-{kappa}B1 isoforms, indicated by asterisks, do not change in abundance in the nuclear fraction. Right panel, Specificity of binding. Control nuclear extracts were analyzed by Western using preadsorbed (Pread) NF-{kappa}B1 antibody (reactive with amino acids 350–363) or COOH-terminal NF-{kappa}B1 antibody ({alpha}-p105, reactive with amino acids 471–490) and its preadsorbed control. The 96-kDa nuclear NF-{kappa}B1 isoform is recognized by both immune antisera, but not by the preadsorbed controls. D, Inducible NF-{kappa}B1 binding is blocked by proteasome inhibitor. Nuclear extracts from control (–), Sar1 AII (100 nM, 6 h, ++) or Sar1 AII + MG132-treated cells were affinity purified by Bt-APRE-Streptavidin capture (Materials and Methods), and probed with NH2-terminal NF-{kappa}B1 antibody. Sar1 AII-inducible binding of NF-{kappa}B1 p50, p56,and p96 isoforms is blocked by the proteasome inhibitor (without effects on steady-state p105 abundance).

 
We next examined the effect of Sar1 AII and MG132 on the subcellular abundance of NF-{kappa}B1 p50, p56, and p96 isoforms (Fig. 7CGo). In this experiment, control cytoplasmic extracts were coelectrophoresed with nuclear extracts from control, Sar1 AII- and Sar1 AII + MG132-treated cells. In the (overexposed) cytoplasmic lane, the p105 precursor and the 50- and 56-kDa NF-{kappa}B1 isoforms were detected, but not the 96-kDa NF-{kappa}B1 isoform (Fig. 7CGo, lane 1). In contrast, in the nuclear fraction, the p96, p56, and NF-{kappa}B1 p50 isoforms were all detected in control cells (Fig. 7CGo, lanes 2–4). Surprisingly, after Sar1 AII treatment, no measurable increase in the steady-state nuclear abundance of any of the three isoforms could be detected. In addition, the potent transcriptional inhibitor MG132 did not detectably influence the steady-state levels of any isoform. The specificity of nuclear NF-{kappa}B1 species was further examined in control experiments in Fig. 7CGo (right panels). Preadsorption with the immunizing NF-{kappa}B1 peptide blocks staining of p96, p56, and p50 NF-{kappa}B1 isoforms. Moreover, Western blots of nuclear fraction using an NF-{kappa}B p105-specific antibody stains selectively NF-{kappa}B1 p96. This NF-{kappa}B1 p96 staining is also selective because preadsorption of the p105 antibody blocks its recognition of NF-{kappa}B1 p96. Together, these data indicate that 1) NF-{kappa}B1 species do not change nuclear abundance after Sar1 AII treatment; 2) the effect of MG132 on APRE- dependent transcription occurs without measurable changes in steady state abundance of nuclear Rel A or the NF-{kappa}B1 isoforms; and 3) the abundance of NF-{kappa}B1 p96 appears to be independent of p105 processing (see Discussion).

Proteasome Activity Is Required for Inducible NF-{kappa}B1 P96 Binding
We next analyzed whether MG132 treatment influenced recruitment of NF-{kappa}B1 DNA binding as a mechanism for blocking AII-inducible transcription. Nuclear proteins from treated cells were assayed for Bt-APRE WT binding using the two-step microaffinity isolation assay. As before, Sar1 AII treatment induced NF-{kappa}B1 p50, 56, and p96 isoforms to the APRE (Fig. 7DGo, lane 1 and 2). Coincubation with MG132 selectively blocked the Sar1 AII-induced binding of NF-{kappa}B1 p50, 56, and p96 isoforms to the APRE (Fig. 7DGo, lane 3). Together these data indicate that Sar1 AII induces NF-{kappa}B1 binding on the APRE without detectable changes in their steady-state nuclear abundance through an proteasome-sensitive mechanism.

Inducible Binding of NF-{kappa}B1 Species Can Be Mediated by the Diacylglycerol (DAG) Agonist, PMA
Sar1 AII is a potent activator of DAG production, intracellular calcium concentration, and PKC activity in responsive cells (23 24 ). To investigate the potential role of DAG-sensitive PKC isoforms in inducible NF-{kappa}B1 binding, we assayed for the acute effects of the DAG agonist, phorbol 12-myristate 13-acetate (PMA) on recruitment of NF-{kappa}B1 binding. At various times after PMA exposure, APRE binding was measured by two-step microaffinity assay. PMA rapidly (and transiently) induced NF-{kappa}B1 p50 and p96 isoform binding within 30 min of treatment; however, p56 was only weakly detected (Fig. 8AGo). At later times, NF-{kappa}B1 p96 binding activity is down-regulated. These data indicate DAG is sufficient to induce rapid NF-{kappa}B1 binding.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. AII Inducible Transcription and NF-{kappa}B1 Binding Are Dependent on Phorbol Ester-Sensitive Protein Kinase C (PKC) Isoforms

A, Acute exposure to phorbol ester induces binding of the NF-{kappa}B1 p96 and p50 isoforms to the APRE. Nuclear extracts from control and 0.5 µM PMA-treated HepG2 cells for indicated times (in hours, top) were affinity purified by Bt-APRE-Streptavidin capture and probed with anti NF-{kappa}B1 antibody. Shown is Western immunoblot. PMA treatment rapidly induces the binding of NF-{kappa}B1 p96 and NF-{kappa}B1 p50 isoforms within 30 min of treatment. NF-{kappa}B1 p56 is only weakly induced. B, Hydrolysis of PKC isoforms by chronic agonist exposure. Western blot of PKC{alpha} in cytosolic extracts taken from control HepG2 cells in the absence or presence of PKC down-regulation. PKC down-regulation was accomplished by chronic exposure to phorbol ester [24 h, 1 µM PMA (21 )]. PKC{alpha} is completely hydrolyzed by this treatment. C, Effect of PKC down-regulation on Sar1 AII-inducible transcription. HepG2 cells were transiently transfected with APRE LUC (as in Fig. 1Go) and assayed for inducible transcription in control or PKC down-regulated cells. PKC down-regulation was accomplished by chronic exposure to phorbol ester [24 h, 1 µM PMA (21 )]. Shown is normalized luciferase reporter activity from a representative experiment (reproduced five times). The effect of both Sar1 AII and acute exposure to PMA is blocked by PKC down-regulation. D, Phorbol ester-sensitive PKC isoform(s) is required for Sar1 AII-inducible NF-{kappa}B1 binding. Nuclear extracts from control or Sar1 AII-treated cells (in the absence or presence of PKC down-regulation as indicated by "PMA") were affinity purified by Bt-APRE-Streptavidin capture assay. Shown is Western blot of the DNA-binding proteins probed with anti NF-{kappa}B1 antibody. The AII-mediated induction of NF-{kappa}B1 p96, p56, and p50 isoforms was drastically reduced when stimulated after PKC hydrolysis.

 
Sar1 AII Activation Pathway Requires Phorbol Ester-Sensitive PKC Isoforms: Effect of PKC Down-Regulation
To assess the role of DAG-sensitive PKC isoforms in AII stimulation, we depleted PKC isoforms by chronic agonist exposure. PMA pretreatment induces complete hydrolysis of DAG-sensitive PKC isoforms, allowing us to test APRE responsiveness in their absence. Hep G2 cells express the DAG-activated PKC isoforms PKC{alpha}, ßII , and {delta} (21 ). Accordingly, we used Western immunoblots of PKC{alpha} as a marker for whether we successfully hydrolyzed PKC. As shown in Fig. 8BGo, we observed that chronic treatment with PMA completely hydrolyzed cytoplasmic PKC{alpha}. As a control for protein loading, the lanes were stained for cytoplasmic ß-actin, where a similar band intensity was observed (Fig. 8BGo, bottom panel). The effect of Sar1 AII on APRE transcription was next investigated in PKC-down-regulated HepG2 cells. PKC{alpha} down-regulation completely abolished both Sar1 AII- and PMA-induced APRE transcription (Fig. 8CGo). Nuclear extracts from PKC down-regulated cells were then assayed for changes in APRE binding in the microaffinity isolation assay. PKC hydrolysis blocked inducible NF-{kappa}B1 p96, p56 , and p50 binding (Fig. 8DGo), indicating an absolute requirement for the DAG-sensitive PKC isoforms in Sar1 AII-induced NF-{kappa}B1 binding.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
NF-{kappa}B is a potent and highly inducible transcription factor family that functions as a signal mediator in activating inducible acute phase reactant and cytokine gene expression. Many NF-{kappa}B activators, including TNF{alpha} (19 22 ), interleukin-1 (IL-1) (21 ), and viral infections (25 ), produce cytoplasmic-to-nuclear translocation of the potent Rel A•NF-{kappa}B1 transactivator (reviewed in Ref. 14 ). In this pathway, NF-{kappa}B agonists stimulate activity of the ubiquitous I{kappa}B kinases, resulting in serine phosphorylation of the NH2-terminal regulatory domain of I{kappa}B{alpha} (26 ). Once phosphorylated, I{kappa}B{alpha} is inducibly proteolyzed (26 27 ), allowing Rel A•NF-{kappa}B1 p50 to be liberated and to translocate into the nucleus where it activates transcription through high-affinity genomic binding sites. Here, we report observations for an alternative mode of NF-{kappa}B activation induced by AT1 receptor signaling in hepatocytes, where Sar1 AII induces apparent activation of latent NF-{kappa}B1 binding isoforms to bind the angiotensinogen promoter sequence. This phenomenon occurs without requiring changes in steady-state concentrations of Rel A or NF-{kappa}B1 in the nucleus. Moreover, our results imply dependence on DAG-sensitive PKC isoforms for inducible NF-{kappa}B1 binding. These pathways are schematically diagrammed in Fig. 9Go.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 9. Model for Distinct Pathways for Inducible NF-{kappa}B Binding by Cytokines and AII

Cytokine hormones, such as TNF{alpha}, are potent activators of a proteolytic program of the I{kappa}B-inhibitory molecules responsible for cytoplasmic inactivation of transactivating heterodimer, Rel A•NF-{kappa}B1. After I{kappa}B proteolysis, Rel A•NF-{kappa}B1 translocates into the nucleus to activate transcription of target genes. By contrast, Sar1AII binds specifically to a G protein-coupled transmembrane receptor and initiates a diacyglyercol-sensitive PKC signal transduction cascade that targets distinct NF-{kappa}B1 isoforms (96, 56, and 50 kDa) and recruits these molecules into the DNA-binding complex. This recruitment is independent of changes in nuclear abundance or I{kappa}B proteolysis. The precise role of these individual NF-{kappa}B1 isoforms in promoter activation will require further experimentation.

 
Our data report , for the first time, the recruitment of previously uncharacterized large NF-{kappa}B1 isoforms as a potential mechanism for AII-inducible APRE-dependent transcription. Evidence that AII induces multiple NF-{kappa}B1 isoforms to bind the APRE come from the distinct EMSA binding pattern (Fig. 2AGo) and the unanticipated behavior of the NF-{kappa}B1 supershift in AII-stimulated extracts. Here, an NLS-directed NF-{kappa}B1 antibody produces two strong supershifted complexes that are enhanced after Sar1 AII treatment (Fig. 3Go) and are not seen in the TNF{alpha}-treated extracts; we interpret this to mean that the nature of the AII-stimulated C4 complex is qualitatively distinct from the other treatment conditions. This may be due to the presence of the larger NF-{kappa}B1 isoforms, p56 and p96, in the C4 complex. In a previous study, we demonstrated the requirement for NF-{kappa}B in AII-stimulated AGT transcription (13 ). However, definitive detection of alternative sized NF-{kappa}B1 isoforms was not possible because of the qualitative nature of EMSA. Specific detection of individual NF-{kappa}B isoforms has been made possible by the application of the Bt-streptavidin capture assay; this assay has provided new insight into the identity of AII-inducible NF-{kappa}B1 complexes. That the inducible 50-, 56-, and 96-kDa APRE-binding isoforms detected in the Bt-streptavidin capture assay represent bona fide NF-{kappa}B1 is based on the observation that their staining in Western immunoblots is selectively inhibited by preabsorption of the immune antibody, and that the p96 isoform is recognized selectively by both NH2 and COOH-directed anti-NF-{kappa}B1 antibodies (Fig. 7CGo, right panel).

Mechanisms for NF-{kappa}B1 Transactivation of Target Genes
The 50-kDa NF-{kappa}B1 isoform is an inert DNA binding subunit that activates transcription indirectly through its association with the potent Rel A transactivator (reviewed in Ref. 14 ). By contrast, Rel A is a weak DNA binding subunit that relies on NF-{kappa}B1 for stable binding to asymmetric NF-{kappa}B binding sites. Rel A activates target genes through a direct association of its COOH-terminal transactivating domain with the coactivator proteins, CREB binding protein/p300 (CBP/p300) (28 ). CBP/p300 are multifunctional proteins that contain strong histone acetyl transferase activity (implicated in chromatin remodeling during transcriptional activation) and provide additional protein-protein interactions for efficient coupling of Rel A with the preinitiation complex. Because we have observed that overexpression of NF-{kappa}B1 p50 fails to activate APRE transcription, whereas overexpression of Rel A produces strong activation, we believe that inducible NF-{kappa}B1 p50 binding alone is unlikely to induce APRE transcription after Sar1 AII stimulation (References 13 and15 and data not shown). Our data indicate inducible binding of larger NF-{kappa}B1 isoforms as a potential mechanism for promoter activation. In support of this mechanism, others have shown that p105 NF-{kappa}B1 precursor contains latent transcriptional activation domains. For example, expression of a fusion protein between the GAL4 DNA-binding domain with the COOH terminus of NF-{kappa}B1 potently activates GAL4 DNA binding sites (29 ). Importantly, this COOH-terminal region of NF-{kappa}B1, containing the ankyrin repeat domains, is recognized by the {alpha}-p105 antibody that selectively binds NF-{kappa}B1 p96 (Fig. 7CGo). For this reason, we believe it possible that the NF-{kappa}B1 p96 contains a COOH-terminal transactivation domain and could be responsible for AII-inducible APRE activation. In separate studies, others have demonstrated the presence of a widely expressed, alternatively spliced murine NF-{kappa}B1 98-kDa isoform (muNF-{kappa}B1 p98), an isoform disrupted in its ability to be retained in the cytoplasm (30 ). Expression of muNF-{kappa}B1 transactivates NF-{kappa}B-driven reporter genes. Together, these observations indicate that NF-{kappa}B1 isoforms containing the COOH terminus also contain latent transcriptional activity (and may indicate a mechanism by which NF-{kappa}B1 p96 could activate the APRE). The mechanism by which the COOH-terminal transactivation domain of NF-{kappa}B1 activates transcription has not been further investigated. These forms may also directly associate with the CBP/p300 coactivators.

Other mechanisms for Sar1 AII-inducible transcription are possible. NF-{kappa}B1 activation could include indirect recruitment of Rel A to the APRE complex; however, we think this is unlikely. Although Rel A binding the APRE can be detected, its abundance also does not change after Sar1 AII stimulation (Figs. 5Go and 7BGo) as it does after TNF{alpha} stimulation (Fig. 2Go and Ref. 17 ). We interpret these data to exclude Rel A recruitment as a primary mechanism for APRE activation. It is also important to note that previously we observed that Rel A was a target for AII activation (13 ). This observation came from transient transfection assays expressing Rel A-GAL4-fusion proteins to drive reporter genes. In this artificial paradigm, addition of Sar1 AII induced reporter gene activity a modest 2- to 4-fold. Surprisingly, the Sar1 AII effect was lost upon deletion of the Rel A N-terminal dimerization domain. The N-terminal domain is required for NF-{kappa}B1 association and is separate from the potent COOH-terminal transactivation domain. Taken together, these two studies indicate Rel A activation of target promoters is indirect, mediated by its ability to associate with transactivating forms of NF-{kappa}B1. [Others have shown that NF-{kappa}B1 p105 forms stable complexes with Rel A and c-Rel in vivo (31 ).] Other potential alternatives include Sar1-AII inducible recruitment of the Bcl-3 coactivator. Bcl-3, a protooncogene containing an ankyrin repeat domain, has been shown to synergistically activate NF-{kappa}B2 driven transcription (32 ). However, we have not been able to demonstrate the association of Bcl-3 in the APRE complex in the Bt-streptavidin assay (data not shown).

Potential Mechanisms for NF-{kappa}B1 Isoform Expression
NF-{kappa}B1 is encoded by a large precursor protein of 105 kDa that is alternatively spliced and processed into multiple isoforms. When translated as a full-length product, NF-{kappa}B1 p105 is a cytoplasmic protein that functions as an I{kappa}B-like inhibitor (31 ) by its ability to sequester NF-{kappa}B in the cytoplasm through association with its COOH-terminal ankyrin repeat domain and, indeed, inhibits its own intrinsic DNA-binding activity (33 ). Although the NF-{kappa}B1 p50 form is produced by the proteolytic processing of the NF-{kappa}B1 p105 through the ubiquitin proteasome pathway (22 ), we think it is unlikely that NF-{kappa}B1 p96 represents a p105 processing intermediate for several reasons. First, in coupled in vitro translation/proteasome processing experiments of the p105 precursor, transient formation of 96-kDa intermediates have not been observed (22 ). In addition, the steady-state abundance of NF-{kappa}B1 p96 is not influenced by the administration of the proteasome inhibitor, MG132. MG132 is known to be a potent inhibitor of NF-{kappa}B1 p105 processing (22 ). We interpret these observations to indicate that NF-{kappa}B1 p96 is not a transient processing intermediate of the p105 precursor. We, at present, do not know the mechanism of the MG132 effect, although it appears to interfere with a step upstream of inducible NF-{kappa}B1 p96 binding, perhaps through disruption of PKC-mediated intracellular signaling. Further investigation of this mechanism will be required.

The large NF-{kappa}B1 isoforms may be the consequence of alternative splicing. Although no rigorous description of alternative transcripts encoding other human NF-{kappa}B1 isoforms has been reported, in murine lymphocytes, a large transactivating form of NF-{kappa}B1, NF-{kappa}B1 p98, has been recently described (30 ). Murine NF-{kappa}B1 (muNF-{kappa}B1) p98 is generated by alternative splicing of the NF-{kappa}B1 precursor mRNA by deleting the region encoding the seventh (penultimate) carboxy-terminal ankyrin repeat (30 ). This carboxy-terminal deletion apparently disrupts the ability of muNF-{kappa}B1 p98 to be retained in the cytoplasm or mask its intrinsic DNA binding activity, and (as indicated above) is a bona fide transactivator. Whether human hepatocytes express this alternatively spliced isoform and whether it plays a significant role in inducible transcription will require further investigation.

Role of PKC in Inducible NF-{kappa}B1 Binding
PKC is a family of serine-threonine protein kinases that mediate signal transduction pathways leading to changes in gene expression, cell differentiation, and apoptotic pathways. AII (via the AT1 receptor) is known to activate multiple different intracellular protein kinase activities, including protein kinase C (21 34 ). For example, others have shown that AII activates changes in subcellular distribution of the PKC{alpha}, -{delta}, and -{epsilon} isoforms in WB hepatocytes (35 ); we have previously demonstrated that these isoforms are also expressed in HepG2 cells (21 ), and PKC is required for AII-induced c-fos expression in vascular smooth muscle cells (34 ). Our data indicate that there is an essential requirement for PKC isoforms in Sar1 AII-inducible NF-{kappa}B1 binding. The requirement for PKC is demonstrated by the direct effect of the DAG agonist, PMA, to induce NF-{kappa}B1 p96 and p50 binding (Fig. 8AGo), and the inhibitory effect of PKC down-regulation on inducible NF-{kappa}B1 binding and transcription (Fig. 8Go, C and D). We note however, that the induction pattern of NF-{kappa}B1 binding after PMA treatment is slightly different from that produced by AII. This is probably because PMA does not exactly reproduce the magnitude and kinetics for DAG production as that produced by activated AT1. PKC signaling pathways target members of the NF-{kappa}B family including I{kappa}B and its kinases (21 ) and NF-{kappa}B itself (36 ). Nuclear NF-{kappa}B, such as NF-{kappa}B1 isoforms, are known to be phosphoproteins (37 ). NF-{kappa}B phosphorylation apparently plays a regulatory role, as either phosphorylation of the Rel A•NF-{kappa}B1 p50 complex in vitro or protein kinase C-induced hyperphosphorylation of NF-{kappa}B1 p50 in vivo induces stable DNA binding (36 ). Although in our study, PKC{alpha} is used as a marker for the PMA effect (and to demonstrate that PKC is down-regulated), it will require additional investigation to determine the specific DAG-sensitive PKC isoform involved and whether NF-{kappa}B1 is a direct target of its actions. It will be interesting to disrupt the expression of individual PKC isoforms {alpha}, ßII, {delta}, or {epsilon} and determine their effect on inducible NF-{kappa}B1 binding.

Determining the mechanisms for how AII induces transcription of its precursor, AGT, contributes to our understanding of the pathophysiology of renovascular hypertension. Our data suggest this mechanism occurs through nuclear recruitment of latent (non-DNA binding) NF-{kappa}B1 isoforms after AII stimulation in hepatocytes. Further characterization of this PKC-dependent signaling pathway and the NF-{kappa}B1 isoforms involved will yield new insights into how AII influences gene expression in the renin angiotensin system.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Treatment
The human hepatoblastoma cell-line HepG2 was obtained from ATCC(Manassas, VA) and grown in DMEM (Life Technologies, Inc., Gaithersburg, MD supplemented with 10% (vol/vol) heat-inactivated FBS, 2 mM Lglutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and antibiotics (penicillin/streptomycin/fungizone) in a humidified atmosphere of 5% CO2. Recombinant human TNF{alpha} (30 ng/ml, Calbiochem, San Diego, CA), and Sar1-AII (100 nM, Sigma, St. Louis, MO) were added in culture medium and cells were incubated for the indicated time periods at 37 C. MG132 (Z-Leu-Leu-Leucinal) was obtained from Sigma and used at 25 µM (final concentration). The type 1 AT receptor antagonist, Dup753 (Losartan) was a gift of Wm. Henckler, Merck & Co., Inc. (Rahway, NJ).

Plasmids and Transient HepG2 Transfections
APRE-LUC consists of the trimerized rat AGT APRE WT sequences ligated through BamHI/BglII ends into the p59 rat AGT minimal promoter driving the expression of the firefly luciferase reporter gene (16 20 ). The AT1 receptor expression plasmid pEF-Bos (3 ), the expression vector encoding the tac subunit of the IL-2 receptor pCMV.IL2R (38 ), and the constitutively expressed alkaline phosphatase transfection efficiency control, SV2PAP (16 ), have been previously described. For transfection, plasmids were purified by ion exchange (QIAGEN, Chatsworth, CA) and sequenced to verify authenticity. For transient transfection assay, HepG2 cells were transfected using 1,2-dioleoyl-3-trimethylammonium propane (DOTAP)-DNA liposomes into triplicate 60-mm plates with 20 µg APRE-LUC, 7.5 µg pEF-Bos, and 5 µg SV2PAP. Cells were cultured an additional 40 h and stimulated for the indicated times (0–6 h) before harvest for independent assay of luciferase and alkaline phosphatase activity at 46 h (16 ). The timing of administration of hormone was such that all plates were harvested simultaneously at 46 h. Normalized luciferase was determined for each individual plate in the triplicate before calculation of the mean value for each treatment condition. Fold activation was determined by dividing the normalized luciferase activity in each treatment by the normalized value in untreated cells.

Immunoaffinity Isolation of Transfected HepG2 Cells on Magnetic Beads
To isolate a homogenous population of transiently transfected cells, HepG2 cells were transfected by electroporation (to increase the numbers of transient transfectants). Briefly, logarithmically growing cells were trypsinized, washed in Ca++/Mg++-free PBS, and resuspended at a density of 2 x 107 cells/250 µl volume in an electroporation 0.4-cm cuvette (Bio-Rad Laboratories, Inc., Hercules, CA). The following type and amount of supercoiled plasmid DNA was added to the cuvettes: 30 µg APRE-LUC, 15 µg pEF-Bos, and 5 µg CMV.IL2R. Cells were incubated on ice for 15 min and electroporated at 960 µF, 250 V. The cells were incubated on ice for an additional 15 min and plated in prewarmed growth medium for growth. Cells were cultured for an additional 40 h with daily changes of medium and stimulated for the indicated times with Sar1-AII or TNF{alpha} before harvest at 46 h after transfection.

For immunoaffinity isolation of transiently transfected cell population, minor modifications of published protocols were used (38 ). Transfected cells were washed twice with cold PBS and incubated for 30 min at 4 C with 1 µg of {alpha}CD25 monoclonal antibody (Caltag Laboratories, Inc., Burlingame, CA) in 8 ml of PBS/0.01%BSA. After this incubation, cells were washed twice with PBS, and 25 µl of a slurry of goat antimouse IgG conjugated to magnetic beads (Dynabeads M-450, DynAl, Great Neck, NY) were added to 8 ml of PBS/0.01% BSA. After an incubation for 1 h at 4 C, cells were washed, trypsinized, and captured on a magnetic stand (DynAl) in 1.7-ml centrifuge tubes. In control experiments, transfection efficiency was directly determined by fluorescence microscopy to detect expression of the IL-2 receptor. In this assay, transfected cells were directly stained with fluorescein isothiocyanate-conjugated {alpha}CD25 monoclonal antibody (Caltag Laboratories, Inc.) and scored for IL-2 receptor expression by fluorescence microscopy. Transfection efficiency was 19.3% (n = 3 of 456 individual cells counted). To determine capture efficiency of transfected cells, bound and flow-through fractions were assayed for specific activity of luciferase reporter activity and compared with the same measurements made in whole-cell lysates before affinity isolation (Table 1Go). These data indicate that specific activity of the luciferase reporter was significantly enriched in bound fraction of the magnetic affinity, yielding a nearly homogenous transfected cell population for assay.

Sucrose Density-Purified Nuclear Extracts
For the purification of nuclei, HepG2 cells were resuspended in buffer A [50 mM HEPES (pH 7.4), 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol (DTT), 0.1 µg/ml phenylmethylsulfonyl fluoride (PMSF), 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, 10 µg/ml aprotinin, and 0.5% NP-40]. After 10 min on ice, the lysates were centrifuged at 4,000 x g for 4 min at 4 C. After discarding the supernatant, the nuclear pellet is resuspended in buffer B (buffer A with 1.7 M sucrose), and centrifuged at 15,000 x g for 30 min at 4 C (17 ). The purified nuclear pellet was then incubated in buffer C [10% glycerol, 50 mM HEPES (pH 7.4), 400 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.1 µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, and 10 µg/ml aprotinin] with frequent vortexing for 30 min at 4 C. After centrifugation at 15,000 x g for 5 min at 4 C, the supernatant is saved for nuclear extract. Both cytoplasmic and nuclear extracts were normalized for protein amounts determined by Coomassie G-250 staining (Bio-Rad Laboratories, Inc.). Sucrose cushion separation results in nuclear extracts devoid of cytoplasmic contamination as measured by the absence of cytoplasmic markers, such as actin or I{kappa}B{alpha} (17 ).

EMSAs
EMSAs were performed as previously described with minor modifications (17 ). Nuclear extracts (10 µg) were incubated with 40,000 cpm of 32P- labeled APRE WT duplex oligonucleotide probe and 1 µg of poly (dA-dT) in a buffer containing 8% glycerol, 100 mM NaCl, 5 mM MgCl2, 5 mM DTT, and 0.1 µg/ml PMSF in a final volume of 20 µl, for 15 min at room temperature. The complexes were fractionated on 6% native polyacrylamide gels run in 1x TBE buffer (89 mM Tris, 89 mM boric acid, and 2.0 mM EDTA), dried, and exposed to Kodak X-AR film at -70 C. The sequences of the APRE double-stranded oligonucleotides are (mutations underlined): APRE WT: GATCCACCACAGTTGGGATTTCCCAACCTGACCA GTGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG APRE M6: GATCCACCACAGTTGTGATTTCACAACCTGACCA GTGGTGTCAACACTAAAGTGTTGGACTGGTCTAG APRE M2: GATCCACCACATGTTGGATTTCCGATACTGACCA GTGGTGTACAACCTAAAGGCTATGACTGGTCTAG APRE BPi:GATCCACCACAGTTGGGATTTCCCAACCTGACCA GTGGTGTCAACCCTAAAGGGTTGGACTGGTCTAG

Competition was performed by the addition of 100-fold molar excess nonradioactive double-stranded oligonucleotide competitor at the time of addition of radioactive probe. Antibody supershift assays were performed by adding to the binding reaction 1 µl of indicated affinity-purified polyclonal antibodies and incubating for 1 h on ice as described (17 ). For anti-NF-{kappa}B1 supershifts, rabbit anti-NLS directed NF-{kappa}B1 (reactive with amino acids 350–363), goat anti NH2-terminal NF-{kappa}B1 (reactive to amino acids 4–22), and anti COOH-terminal NF-{kappa}B1(reactive to amino acids 338–357) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Microaffinity Purification of APRE Binding Proteins
APRE binding proteins were affinity isolated using a two-step biotinylated DNA-Streptavidin capture assay (18 ). In this assay, duplex APRE WT oligonucleotides containing 5' biotin (Bt) were chemically synthesized on a flexible linker (Genosys, The Woodlands, TX). Identical amounts of nuclear protein from control and hormone-stimulated extracts were incubated with 50 pmol Bt-APRE WT DNA in the presence of 12 µg poly dA-dT (as nonspecific competitor) in 500 µl total volume binding buffer [8% (vol/vol) glycerol, 5 mM MgCl2, 1 mM DTT, 60 mM KCl, 1 mM EDTA, 12 mM HEPES, pH 7.8] at 4 C for 1 h (in practice, 0.6–1.2 mg protein was used, the exact amount varied from one experiment to another depending on number of cells captured by magnetic affinity purification). One hundred microliters of a 50% slurry of prewashed streptavidin-agarose beads were then added to the sample and incubated at 4 C for an additional 20 min with shaking. Pellets were washed twice with 500 µl binding buffer and then resuspended in 100 µl 1x SDS-PAGE buffer for analysis by Western immunoblot. For competition assays, a 10-fold molar excess of the indicated (nonbiotinylated) duplex DNA was added in the initial binding reaction (18 ).

Western Immunoblots
For immunoblot analysis, a constant amount of indicated cellular extracts (200–300 µg as indicated) was boiled in Laemmli buffer, separated on 10% SDS-PAGE, and transferred to polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA). Membranes were blocked in 8% milk and immunoblotted with the affinity-purified rabbit polyclonal antibodies for either I{kappa}B{alpha} (reactive with amino acids 297–317), Rel A (reactive with amino acids 3–19), NH2-terminal NF-{kappa}B1 (reactive with amino acids 1–19), NLS-directed NF-{kappa}B1 (reactive with amino acids 350–363), COOH-terminal NF-{kappa}B1 (reactive with amino acids 471–490), c-Rel (reactive with amino acids 152–176), NF-{kappa}B2 (reactive with amino acids 298–324), or protein kinase C{alpha} (reactive with amino acids 651–672); all antibodies were obtained from Santa Cruz Biotech (Santa Cruz, CA). Immune complexes were detected by binding donkey anti-rabbit IgG conjugated to horseradish peroxidase (Pierce Chemical Co., Rockford, IL) followed by reaction in the enhanced chemiluminescence assay (ECL, Amersham International, Arlington Heights, IL) according to the manufacturer’s recommendations.


    FOOTNOTES
 
Address requests for reprints to: Dr. Allan Brasier, Department of Internal Medicine, Sealy Center for Molecular Science, University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-1060.

This work was supported in part by National Heart, Lung, and Blood Institute Grant R01 55630–03 (to A.R.B.) and National Institutes of Environmental Health P30 ES06676 (R.S. Lloyd, University of Texas Medical Branch). A.R.B. is an Established Investigator of the American Heart Association. We thank Bruce Howard (The National Institute of Allergy and Infectious Diseases), and T. J. Murphy (Emory University, Atlanta, GA) for plasmids, and William Henckler (Merck & Co., Inc., Wilmington, DE) for Dup 753.

Received for publication May 18, 1999. Revision received September 14, 1999. Accepted for publication September 20, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Campbell DJ 1987 Circulating and tissue angiotensin systems. J Clin Invest 79:1–6
  2. Reid IA, Morris BJ, Ganong WG 1978 The renin-angiotensin system. Annu Rev Physiol 40:377–410[CrossRef][Medline]
  3. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE 1991 Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 351:233–236[CrossRef][Medline]
  4. Hilgenfeldt U, Schwind S 1993 Angiotensin II is the mediator of the increase in hepatic angiotensinogen synthesis after bilateral nephrectomy. Am J Physiol 265:E414–E418
  5. Eggena P, Zhu JH, Clegg K, Barrett JD 1993 Nuclear angiotensin receptors induce transcription of renin and angiotensinogen mRNA. Hypertension 22:496–501[Abstract/Free Full Text]
  6. Brasier AR, Li J 1996 Mechanisms for inducible control of angiotensinogen gene transcription. J Hypertens 27:465–475
  7. Naftilan AJ, Pratt RE, Dzau VJ 1989 Induction of platelet-derived growth factor A-chain and c-myc gene expressions by angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest 83:1419–1424
  8. Naftilan A, Pratt RE, Eldridge CS, Lin HL, Dzau V 1989 Angiotensin II induces c-fos expression in smooth muscle via transcriptional control. Hypertension 13:706–711[Abstract/Free Full Text]
  9. Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontaine P, Bernstein KE 1995 Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor. Nature 375:247–250[CrossRef][Medline]
  10. Neyses L, Nouskas J, Luyken J, Fronhoffs S, Oberdorf S, Pfeifer U, Williams RS, Sukhatme VP, Vetter H 1993 Induction of immediate-early genes by angiotensin II and endothelin-1 in adult rat cardiomyocytes. J Hypertens 11:927–934[CrossRef][Medline]
  11. Nakamura A, Iwao H, Fukui K, Kimura S, Tamaki T, Nakanishi S, Abe Y 1990 Regulation of liver angiotensinogen and kidney renin mRNA levels by angiotensin II. Am J Physiol 258:E1–E6
  12. Kohara K, Brosnihan KB, Ferrario CM, Milsted A 1992 Peripheral and central angiotensin II regulates expression of genes of the renin-angiotensin system. Am J Physiol 262:E651–E657
  13. Li J, Brasier AR 1996 Angiotensinogen gene activation by AII is mediated by the Rel A (NF-{kappa}B p65) transcription factor: one mechanism for the renin angiotensin system (RAS) positive feedback loop in hepatocytes. Mol Endocrinol 10:252–264[Abstract/Free Full Text]
  14. Siebenlist U, Franzoso G, Brown K 1994 Structure, regulation and function of NF-{kappa}B. Annu Rev Cell Biol 10:405–455[CrossRef]
  15. Brasier AR, Li J, Wimbish KA 1996 Tumor necrosis factor activates angiotensinogen gene expression by the Rel A transactivator. J Hypertens 27:1009–1017
  16. Ron D, Brasier AR, Wright KA, Tate JE, Habener JF 1990 An inducible 50-kilodalton NF kappa B-like protein and a constitutive protein both bind the acute-phase response element of the angiotensinogen gene. Mol Cell Biol 10:1023–1032[Abstract/Free Full Text]
  17. Han Y, Brasier AR 1997 Mechanism for biphasic Rel A:NF-{kappa}B1 nuclear translocation in tumor necrosis factor {alpha}-stimulated hepatocytes. J Biol Chem 272:9823–9830
  18. Brasier AR, Jamaluddin M, Casola A, Duan W, Shen Q, Garofalo R 1998 A promoter recruitment mechanism for TNF{alpha}-induced IL-8 transcription in type II pulmonary epithelial cells: dependence on nuclear abundance of Rel A, NF-{kappa}B1 and c-Rel transcription factors. J Biol Chem 273:3551–3561[Abstract/Free Full Text]
  19. Chiu AT, Herblin WF, McCall DE, Ardecky RJ, Carini DJ, Duncia JV, Pease LJ, Wong PC, Wexler RR, Johnson AL 1989 Identification of angiotensin II receptor subtypes. Biochem Biophys Res Commun 165: 196–203
  20. Brasier AR, Ron D, Tate JE, Habener JF 1990 A family of constitutive C/EBP-like DNA binding proteins attenuate the IL-1{alpha} induced, NF{kappa}B mediated trans- activation of the angiotensinogen gene acute-phase response element. EMBO J 9:3933–3944[Medline]
  21. Han Y, Meng T, Murray NR, Fields AP, Brasier AR 1999 IL-1 Induced NF-{kappa}B-I{kappa}B{alpha} autoregulatory feedback loop in hepatocytes: a role for PKCa in post-transcriptional regulation of I{kappa}B{alpha} resynthesis. J Biol Chem274: 939–947
  22. Palombella VJ, Rando OJ, Goldberg AL, Maniatis T 1994 The ubiquitin-proteasome pathway is required for processing the NF-{kappa}B1 precursor protein and the activation of NF-{kappa}B. Cell 78:773–785[CrossRef][Medline]
  23. Griendling KK, Rittenhouse SE, Brock TA, Ekstein LS, Gimbrone Jr MA, Alexander RW 1986 Sustained diacylglycerol formation from inositol phospholipids in angiotensin II-stimulated vascular smooth muscle cells. J Biol Chem 261:5901–5906[Abstract/Free Full Text]
  24. Gavay C, Kushner I 1999 Acute-phase proteins and other systemic responses to inflammation. N Engl J Med 340:448–454[Free Full Text]
  25. Jamaluddin M, Casola A, Garofalo RP, Han Y, Elliott T, Ogra PL, Brasier AR 1998 The major component of I{kappa}B{alpha} proteolysis occurs independently of the proteasome pathway in respiratory syncytial virus-infected pulmonary epithelial cells. J Virol 72:4849–4857[Abstract/Free Full Text]
  26. Maniatis T 1997 Catalysis by a multiprotein I{kappa}B kinase complex. Science 278:818–819[Free Full Text]
  27. Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U 1995 Control of I{kappa}B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485–1488[Abstract/Free Full Text]
  28. Perkins ND, Felzien LZ, Betts JC, Leung K, Beach DH, Nabel GJ 1997 Regulation of NF-{kappa}B by cyclin-dependent kinases associated with the p300 coactivator. Science 275:523–527[Abstract/Free Full Text]
  29. Morin PJ, Gilmore TD 1992 The C-terminus of the NF-{kappa}B precursor and an I{kappa}B isoform contain transcription activation domains. Nucleic Acids Res 20:2453–2458[Abstract/Free Full Text]
  30. Grumont RJ, Fecondo J, Gerondakis S 1994 Alternate RNA splicing of murine nfkb1 generates a nuclear isoform of the p50 precursor NF-kB1 that can function as a transactivator of NF-{kappa}B-regulated transcription. Mol Cell Biol14:8460–8470
  31. Mercurio F, DiDonato JA, Rosette C, Karin M 1993 p105 and p98 precursor proteins play an active role in NF-{kappa}B-mediated signal transduction. Genes Dev 7:705–718[Abstract/Free Full Text]
  32. Bours V, Franzoso G, Azarenko V, Park S, Kanno T, Brown K, Siebenlist U 1993 The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell 72:729–739[CrossRef][Medline]
  33. Kieran M, Blank V, Logeat F, Vandekerckhove J, Lottspeich F, Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A 1990 The DNA binding subunit of NF-kappa B is identical to factor KBF1 and homologous to the rel oncogene product. Cell 62:1007–1018[CrossRef][Medline]
  34. Taubman MB, Berk BC, Izumo S, Tsuda T, Alexander RW, Nadal Ginard B 1989 Angiotensin II induces c-fos mRNA in aortic smooth muscle. Role of Ca2+ mobilization and protein kinase C activation. J Biol Chem 264:526–530[Abstract/Free Full Text]
  35. Maloney JA, Tsygankova O, Szot A, Yang L, Li Q, Williamson JR 1998 Differential translocation of protein kinase C isozymes by phorbol esters, EGF, and ANG II in rat liver WB cells. Am J Physiol 274: C974–C982
  36. Li C-C, Dai R-M, Chen E, Longo DL 1994 Phosphorylation of NF-{kappa}B1–p50 is involved in NF-{kappa}B activation and stable DNA binding. J Biol Chem 269:30089–30092[Abstract/Free Full Text]
  37. Naumann M, Scheidereit C 1994 Activation of NF-{kappa}B in vivo is regulated by multiple phosphorylations. EMBO J 13:4597–4607[Medline]
  38. Padmanabhan R, Howard T, Gottesman M, Howard BH 1993 Magnetic affinity cell sorting to isolate transiently transfected cells, multidrug-resistant cells, somatic cell hybrids, and virally infected cells. Methods Enzymol 218:637–651[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Satou, R. A. Gonzalez-Villalobos, K. Miyata, N. Ohashi, A. Katsurada, L. G. Navar, and H. Kobori
Costimulation with angiotensin II and interleukin 6 augments angiotensinogen expression in cultured human renal proximal tubular cells
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F283 - F289.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. E. Nowak, B. Tian, M. Jamaluddin, I. Boldogh, L. A. Vergara, S. Choudhary, and A. R. Brasier
RelA Ser276 Phosphorylation Is Required for Activation of a Subset of NF-{kappa}B-Dependent Genes by Recruiting Cyclin-Dependent Kinase 9/Cyclin T1 Complexes
Mol. Cell. Biol., June 1, 2008; 28(11): 3623 - 3638.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Choudhary, M. Lu, R. Cui, and A. R. Brasier
Involvement of a Novel Rac/RhoA Guanosine Triphosphatase-Nuclear Factor-{kappa}B Inducing Kinase Signaling Pathway Mediating Angiotensin II-Induced RelA Transactivation
Mol. Endocrinol., September 1, 2007; 21(9): 2203 - 2217.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. M. McAllister-Lucas, J. Ruland, K. Siu, X. Jin, S. Gu, D. S. L. Kim, P. Kuffa, D. Kohrt, T. W. Mak, G. Nunez, et al.
CARMA3/Bcl10/MALT1-dependent NF-{kappa}B activation mediates angiotensin II-responsive inflammatory signaling in nonimmune cells
PNAS, January 2, 2007; 104(1): 139 - 144.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Cui, B. Tieu, A. Recinos, R. G. Tilton, and A. R. Brasier
RhoA Mediates Angiotensin II-Induced Phospho-Ser536 Nuclear Factor {kappa}B/RelA Subunit Exchange on the Interleukin-6 Promoter in VSMCs
Circ. Res., September 29, 2006; 99(7): 723 - 730.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. A. Arenas, S. J. Armstrong, Y. Xu, and S. T. Davidge
Tumor Necrosis Factor-{alpha} and Vascular Angiotensin II in Estrogen-Deficient Rats
Hypertension, September 1, 2006; 48(3): 497 - 503.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Hai, M.-L. Yeung, T. G. Wood, Y. Wei, S. Yamaoka, Z. Gatalica, K.-T. Jeang, and A. R. Brasier
An Alternative Splice Product of I{kappa}B Kinase (IKK{gamma}), IKK{gamma}-{Delta}, Differentially Mediates Cytokine and Human T-Cell Leukemia Virus Type 1 Tax-Induced NF-{kappa}B Activation
J. Virol., May 1, 2006; 80(9): 4227 - 4241.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Choudhary, S. Boldogh, R. Garofalo, M. Jamaluddin, and A. R. Brasier
Respiratory Syncytial Virus Influences NF-{kappa}B-Dependent Gene Expression through a Novel Pathway Involving MAP3K14/NIK Expression and Nuclear Complex Formation with NF-{kappa}B2
J. Virol., July 15, 2005; 79(14): 8948 - 8959.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Tian, D. E. Nowak, M. Jamaluddin, S. Wang, and A. R. Brasier
Identification of Direct Genomic Targets Downstream of the Nuclear Factor-{kappa}B Transcription Factor Mediating Tumor Necrosis Factor Signaling
J. Biol. Chem., April 29, 2005; 280(17): 17435 - 17448.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. R. Brasier, H. Spratt, Z. Wu, I. Boldogh, Y. Zhang, R. P. Garofalo, A. Casola, J. Pashmi, A. Haag, B. Luxon, et al.
Nuclear Heat Shock Response and Novel Nuclear Domain 10 Reorganization in Respiratory Syncytial Virus-Infected A549 Cells Identified by High-Resolution Two-Dimensional Gel Electrophoresis
J. Virol., November 1, 2004; 78(21): 11461 - 11476.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Skurk, V. van Harmelen, and H. Hauner
Angiotensin II Stimulates the Release of Interleukin-6 and Interleukin-8 From Cultured Human Adipocytes by Activation of NF-{kappa}B
Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1199 - 1203.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. A. Haeberle, A. Casola, Z. Gatalica, S. Petronella, H.-J. Dieterich, P. B. Ernst, A. R. Brasier, and R. P. Garofalo
I{kappa}B Kinase Is a Critical Regulator of Chemokine Expression and Lung Inflammation in Respiratory Syncytial Virus Infection
J. Virol., March 1, 2004; 78(5): 2232 - 2241.
[Abstract] [Full Text] [PDF]


Home page
Arch Intern MedHome page
D. S. Jacoby and D. J. Rader
Renin-Angiotensin System and Atherothrombotic Disease: From Genes to Treatment
Arch Intern Med, May 26, 2003; 163(10): 1155 - 1164.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Zhang, M. Jamaluddin, S. Wang, B. Tian, R. P. Garofalo, A. Casola, and A. R. Brasier
Ribavirin Treatment Up-Regulates Antiviral Gene Expression via the Interferon-Stimulated Response Element in Respiratory Syncytial Virus-Infected Epithelial Cells
J. Virol., May 15, 2003; 77(10): 5933 - 5947.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
B. Tian and A. R. Brasier
Identification of a Nuclear Factor Kappa B-dependent Gene Network
Recent Prog. Horm. Res., January 1, 2003; 58(1): 95 - 130.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Zhao and K. P. Karalis
Regulation of Nuclear Factor-{kappa}B by Corticotropin-Releasing Hormone in Mouse Thymocytes
Mol. Endocrinol., November 1, 2002; 16(11): 2561 - 2570.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Tian, Y. Zhang, B. A. Luxon, R. P. Garofalo, A. Casola, M. Sinha, and A. R. Brasier
Identification of NF-{kappa}B-Dependent Gene Networks in Respiratory Syncytial Virus-Infected Cells
J. Virol., June 5, 2002; 76(13): 6800 - 6814.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
O. Lorenzo, M. Ruiz-Ortega, Y. Suzuki, M. Ruperez, V. Esteban, T. Sugaya, and J. Egido
Angiotensin III Activates Nuclear Transcription Factor-{kappa}B in Cultured Mesangial Cells Mainly via AT2 Receptors: Studies with AT1 Receptor-Knockout Mice
J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1162 - 1171.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Ray, C. T. Sherman, M. Lu, and A. R. Brasier
Angiotensinogen Gene Expression Is Dependent on Signal Transducer and Activator of Transcription 3-Mediated p300/cAMP Response Element Binding Protein-Binding Protein Coactivator Recruitment and Histone Acetyltransferase Activity
Mol. Endocrinol., April 1, 2002; 16(4): 824 - 836.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Berry, R. Touyz, A. F. Dominiczak, R. C. Webb, and D. G. Johns
Angiotensin receptors: signaling, vascular pathophysiology, and interactions with ceramide
Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2337 - H2365.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. T. Sherman and A. R. Brasier
Role of Signal Transducers and Activators of Transcription 1 and -3 in Inducible Regulation of the Human Angiotensinogen Gene by Interleukin-6
Mol. Endocrinol., March 1, 2001; 15(3): 441 - 457.
[Abstract] [Full Text]


Home page
HypertensionHome page
F. C. Luft
Workshop: Mechanisms and Cardiovascular Damage in Hypertension
Hypertension, February 1, 2001; 37(2): 594 - 598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. R. Brasier, M. Lu, T. Hai, Y. Lu, and I. Boldogh
NF-kappa B-inducible BCL-3 Expression Is an Autoregulatory Loop Controlling Nuclear p50/NF-kappa B1 Residence
J. Biol. Chem., August 17, 2001; 276(34): 32080 - 32093.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jamaluddin, M.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jamaluddin, M.
Right arrow Articles by Brasier, A. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals