Molecular Endocrinology 14 (11): 1820-1835
Copyright © 2000 by The Endocrine Society
GATA-1 and GATA-4 Transactivate Inhibin/Activin ß-B-Subunit Gene Transcription in Testicular Cells
Zong-Ming Feng,
Ai Zhen Wu,
Zhifang Zhang1 and
Ching-Ling C. Chen
Population Council (Z.-M.F., A.Z.W., C.-L.C.C.) and The
Rockefeller University (C.-L.C.C.) New York, New York 10021
 |
ABSTRACT
|
|---|
We have recently demonstrated that a testicular
GATA-binding protein, GATA-1, up-regulates the transcription of inhibin
-subunit gene through interaction with GATA motifs in the promoter
region in MA-10, a mouse Leydig tumor cell line. In this study, we
showed that both GATA-1 and GATA-4 also transactivated the
transcription from the promoter for the 4.8-kb inhibin/activin
ß-B-subunit gene transcripts, ß-B(4.8)-subunit promoter, in two
testicular cell lines, MA-10 and MSC-1, which is a mouse Sertoli cell
line. The abilities of GATA-1 and GATA-4 interacting with GATA and/or
GATA-like sequences to transactivate the ß-B(4.8)-subunit promoter
were next examined by mutation analysis. Mutations of GATA or GATA-like
sequences caused no apparent effect or only a small decrease in the
basal transcriptional activity of this promoter. However, mutation of
the GATA motif at -65 markedly decreased 6070% of the effect of
GATA-1 on the transactivation of ß-B(4.8)-subunit promoter in both
MA-10 and MSC-1 cells. In addition, mutation of the GATA motif in MSC-1
cells also reduced 4050% of the effect of GATA-4 to transactivate
this promoter. Interestingly, mutation of GATT at -42 caused a
7090% increase in the transactivation of ß-B(4.8)-subunit promoter
by GATA-1 or GATA-4. No significant change in the promoter activity was
observed when GATT at -177 or GATC at -201 was mutated.
Electrophoretic mobility shift assay confirmed the above observations
that these GATA-binding proteins interacted with the GATA motif at -65
and GATT at -42, but not with GATC at -201 or GATT at -177. Serial
deletion from the 5'-end of the basal promoter, from -226 to -90,
markedly decreased the basal transcription, but increased the effect of
GATA-1 on transactivation of the ß-B(4.8)-subunit promoter. In
summary, our observations suggest that the two GATA-binding proteins
transactivate the ß-B(4.8)-subunit promoter in testicular cells via
complicated mechanisms. Both GATA-1 and GATA-4 factors act through the
GATA motif at -65 and GATT at -42 to positively and negatively
regulate the transcription from this promoter, respectively.
Furthermore, GATA-1 may also interact directly or indirectly with DNA
sequences at -180 to -90 to regulate the ß-B(4.8)-subunit promoter.
 |
INTRODUCTION
|
|---|
Members of the GATA-binding protein family recognize a consensus
sequence (T/A)GATA(A/G) and share conserved zinc fingers in their
DNA-binding domains. The expression of each GATA-binding protein is,
however, tissue specific (1, 2, 3). GATA-1 was originally considered as a
transcription factor exclusively for the globin genes and other
erythroid lineage-specific genes (4, 5, 6, 7). GATA-2, in addition to
erythroid cells, was expressed in chicken embryonic brain, liver, and
cardiac muscle (1) and human endothelial cells (8). GATA-3 was
identified in many tissues, including definitive erythrocytes, T
lymphocytes, embryonic tissues, and placenta (1, 9). GATA-4, GATA-5,
and GATA-6 factors were predominantly observed in the heart, intestine,
and gut (10, 11, 12). In gonads, GATA-1, GATA-4, and GATA-6 were identified
in the testis (10, 11, 13, 14, 15, 16, 17, 18), and GATA-4 and GATA-6 were also
detected in the ovary (10, 11, 17, 19). The mouse testicular GATA-1
mRNA was shown to be transcribed from a testis-specific promoter, which
is 8 kb upstream from that in erythroid cells. The remaining exons that
encode the GATA-1 protein are commonly used by both testis and
erythroid transcripts (13, 15, 16). The immunoreactive GATA-1 protein
detected in mouse Sertoli cells occurred in an age- and spermatogenic
cycle-specific manner (13, 14), a pattern that is similar to that
previously observed for testicular inhibin/activin
- and
ß-B-subunit genes (20, 21, 22, 23). Since GATA-1 and GATA-4 are expressed in
testicular cells of mouse and rat, including Sertoli and Leydig cells,
and Leydig tumor cell lines, such as MA-10 cells (13, 14, 15, 16, 17, 18, 24), we have
investigated the possible actions of GATA-1 and GATA-4 in controlling
the expression of inhibin and activin subunit genes in testicular
cells.
Inhibins and activins have been characterized as dimeric glycoproteins
sharing a common subunit linked by disulfide bonds. Inhibin contains an
inhibin-specific
-subunit and one of the closely related
ß-subunits, ß-A and ß-B, whereas activin is a homo- or
heterodimer of the two ß-subunits. The two ß- subunits were
shown to be members of the transforming growth factor (TGF-ß)
superfamily. The mRNAs and genes encoding inhibin and activin subunits
were isolated and characterized from many species (for reviews, see
Refs. 16, 25, 26, 27, 28). cDNAs encoding other new ß-subunits, ß-C
(29, 30, 31), ß-E (32, 33), and ß-D (34), were recently isolated. All
inhibin and activin subunit genes contain one intron within their
precursor region, except the ß-A-subunit gene, which contains two
introns (27, 35). The two species (4.8 and 3.7 kb) of the ß-B-subunit
mRNAs are derived from transcription at different initiation sites (36, 37).
The promoter regions required for maximal basal transcription of the
inhibin/activin subunit genes in testicular and ovarian cells were
determined by transient transfection studies (for reviews, see Refs. 16, 27). We have shown that the promoter required for the transcription
of rat inhibin
-subunit gene in MA-10 cells depends upon a 67-bp DNA
fragment at -163 to -96, in which two GATA motifs were identified.
Furthermore, our recent new findings revealed that the basal
transcription of
-subunit gene in MA-10 cells is up-regulated
selectively by testicular GATA-1, but not GATA-4, through interaction
with the GATA motifs in the promoter (16). The promoters required for
the expression of the 3.7-kb ß-B-subunit mRNA, referred to as
ß-B(3.7)-subunit promoter, and the 4.8-kb ß-B-subunit mRNA,
referred to as ß-B(4.8)-subunit promoter, were mapped to regions of
-139 to +60 and -409 to +67 from their corresponding transcription
initiation sites (37). The ß-B(3.7)-subunit promoter is highly GC
rich with several Spl binding sites, while the ß-B(4.8)-subunit
promoter is not GC rich but contains one Spl site and many potential
recognition sites for GATA-binding proteins, including GATA motif and
GATA-like sequences such as GATT and GATC (37). The ß-B(3.7)
promoter, which lacks GATA motifs, cannot be transactivated by either
of these GATA-binding proteins (16). In this study, we investigated the
possibility that GATA-1 and GATA-4 interact with the GATA and GATA-like
motifs identified in the ß-B(4.8)-subunit promoter to regulate its
transcription in testicular cells.
 |
RESULTS
|
|---|
Transactivation of ß-B(4.8)-Subunit Promoter by GATA-1 and GATA-4
Factors in Testicular Cells
We have previously shown that a DNA fragment at -409 to +67 from
the transcription initiation site for the 4.8-kb ß-B-subunit mRNA
exerts high transcriptional activity, as analyzed by its ability to
induce transient expression of the chloramphenicol acetyltransferase
(CAT) gene in MA-10 cells (37). Using the same approach, the basal
promoter for the 4.8-kb ß-B- subunit gene transcripts was further
analyzed. As shown in Fig. 1
, deletion
mutation from its 5'-end revealed that the -226 to +67 bp DNA fragment
reproducibly induced maximal CAT activity within the 3.6-kb 5'-flanking
DNA examined. Further deletion from -226 to -90 markedly decreased
CAT activity, suggesting that the promoter required for the production
of maximal levels of 4.8-kb ß-B-subunit gene transcripts resides
within this region. Since GATA motif at -65 and several GATA-like
sequences, such as GATT at -177 and -42 and GATC at -201, were
identified in this region, the -226/+67 promoter DNA was used for the
studies described below on the transactivation of the
ß-B(4.8)-subunit promoter by GATA-binding proteins.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 1. Identification of the Basal Promoter for the
4.8-kb ß-B-Subunit Transcripts by Deletion Analysis
Left panel shows the ß-B(4.8)CAT constructs used for
transfection into MA-10 cells that contain varied lengths of
ß-B(4.8)-subunit promoter DNA prepared by serial deletions from its
5'-end. Right panel shows the CAT activity that is
normalized to ß-galactosidase activity for transfection efficiency.
The effect of deletion on ß-B(4.8)-subunit promoter activity was
expressed as percent (mean ± SEM) relative
to the CAT activity observed with ß-B(4.8)(-226/+67)CAT (designated
as 100%), which exerts maximal CAT activity.
|
|
The ability of GATA-binding proteins to transactivate the
ß-B(4.8)-subunit promoter in MA-10 cells (Fig. 2B
) was examined by cotransfection of a
CAT construct driven by the ß-B(4.8)-subunit promoter containing a
-226 to +67 region with a cDNA expression plasmid encoding a
GATA-binding protein as described previously for studies of
-subunit
promoter (16) (Fig. 2A
). CAT activity driven by the ß-B(4.8)-subunit
promoter was increased approximately 5-fold by cotransfection with
mGATA-1 and 3-fold with mGATA-4 expression plasmid (Fig. 2B
). The
observation of the transactivation of the ß-B(4.8)-subunit promoter
by both GATA-1 and GATA-4 nuclear factors in MA-10 cells is different
from that previously reported for the
-subunit promoter (16), which
can be regulated only by GATA-1 and not by GATA-4 protein (Fig. 2A
).
Sertoli cells were shown to be the predominant site of expression of
inhibins and activins (for reviews, see Refs. 26, 27, 38, 39, 40) and
GATA-1 and GATA-4 (13, 14, 17, 18) in the testis. The possible role of
GATA-binding proteins in the regulation of inhibin and activin subunit
gene expression in Sertoli cells was thus studied in a mouse Sertoli
cell line, MSC-1, which displays features characteristic of normal
Sertoli cells and expresses inhibin and activin subunit genes (41, 42).
Low levels of
-subunit mRNA were detected in MSC-1 cells. However,
similar to that observed in normal Sertoli cells (21), the 4.8- and
3.7-kb inhibin/activin ß-B-subunit mRNAs were found in the MSC-1 cell
line.
The expression of GATA-1 and GATA-4 genes in MSC-1 cells was examined
by Northern blot analysis and RT-PCR (Fig. 3
). As reported previously (16), both
GATA-1 and GATA-4 mRNAs were observed in 21-day-old rat testis and
MA-10 cells (Fig. 3
, A and B). In MSC-1 cells, GATA-4 mRNA could be
detected, but in a level much lower than that observed in rat testis or
MA-10 cells. The expression of GATA-1 gene in MSC-1 cells was too low
to be detected by Northern blot analysis (Fig. 3A
); however, it could
be observed by the RT-PCR method (Fig. 3C
). Using primers described
previously (16), GATA-1 mRNA was detected in 21-day-old rat testis and
in MA-10 and MSC-1 cells, although the levels in MSC-1 cells were
low.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 3. Analysis of GATA-1 and GATA-4 mRNA and Protein in
Testicular Cells
GATA-1 and GATA-4 mRNA (AD) and protein (E) in MA-10 and MSC-1 cells
were analyzed. Twenty micrograms each of total RNA were subjected to
Northern blot analysis of GATA-1 (A) and GATA-4 (B) mRNA. Two
micrograms each of total RNA were employed for the analysis of GATA-1
(C) and G3PDH (D) mRNA by RT-PCR as described previously (16 ). In AD,
lanes 13 are total RNA isolated from 21-day-old rat testis, MA-10,
and MSC-1 cells, respectively. The exposure time for the autoradiogram
was 4 days in panel A, 1 day in panel B, 35 min in panel C, and 10 min
in panel D. In panel E, 15 µg each of nuclear proteins were applied
for Western blot analysis of the endogenous and overexpressed
GATA-1 (lanes 14) and GATA-4 (lanes 58) proteins. Nuclear extracts
were prepared from MA-10 (lanes 12 and 56) and MSC-1 (lanes 34
and 78) cells, which were transfected without (lanes 1, 3, 5 and 7)
or with GATA-1 (lanes 2 and 4) or GATA-4 (lanes 6 and 8) expression
plasmid.
|
|
The GATA-1 and GATA-4 proteins in MA-10 and MSC-1 cells were examined
by Western blot analysis (Fig. 3E
). Similar to those described above in
the mRNA levels, the endogenous GATA-1 and GATA-4 proteins were present
in much higher levels in MA-10 cells (Fig. 3E
, lanes 1 and 5) than in
MSC-1 cells (lanes 3 and 7), respectively. Very weak signals of GATA-1
and GATA-4 proteins were detected in MSC-1 cells. Transfection of
GATA-1 and GATA-4 cDNA expression plasmids into MA-10 and MSC-1 cells
markedly increased the production of GATA-1 (lanes 2 and 4) and GATA-4
(lanes 6 and 8) proteins in both cell lines.
Our observations in Fig. 2
suggested that overexpression of
GATA-binding proteins in MA-10 by cotransfection with GATA-1 and GATA-4
expression plasmids resulted in the transactivation of
- and
ß-B(4.8)-subunit promoter activities. Similarly, cotransfection
studies in MSC-1 cells (Fig. 4
) also
showed that overexpression of GATA-1 protein transactivated both
-
and ß-B(4.8)-subunit promoters, while GATA-4 protein up-regulated
only ß-B(4.8)- subunit gene transcription. Approximately a 9- and
4-fold increase in CAT activity by overexpression of GATA-1 and GATA-4
protein, respectively, was detected in MSC-1 cells.
The transactivation of ß-B(4.8)-subunit promoter by combination of
these two GATA-binding proteins was further examined by cotransfection
with different amounts of GATA-1 and/or GATA-4 expression plasmid into
testicular cells. As shown in Fig. 5
, both GATA-1 (lanes 2 and 5) and GATA-4 (lanes 3 and 6) transactivated
the ß-B(4.8)-subunit promoter in a dose-dependent manner in MA-10
(Fig. 5
) and MSC-1 (data not shown) cells. Moreover, cotransfection of
GATA-1 and GATA-4 expression plasmids at two different doses, 2.5 or 5
µg each, into testicular cells, elevated CAT activity driven by the
ß-B(4.8)-subunit promoter activity in an additive fashion (lanes 4
and 7).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5. Transactivation of ß-B(4.8)-Subunit Gene Promoter
by Cotransfection with Both GATA-1 and GATA-4 Expression Plasmids into
MA-10 Cells
CAT construct (16 µg) containing the ß-B(4.8)-subunit basal
promoter DNA, ßB(-226)CAT, was cotransfected with cDNA expression
plasmid encoding mGATA-1 or mGATA-4 or both into MA-10 cells. The
change in normalized CAT activity by cotransfection with mGATA-1 and/or
mGATA-4 cDNA plasmid was calculated as percent (mean ±
SEM) relative to the CAT activity in the cells with
cotransfection of pXM and/or pMT2 (designated as 100%).
|
|
Mutation Analysis of GATA and GATA-Like Motifs in the
ß-B(4.8)-Subunit Promoter
To delineate the mechanisms by which GATA-1 and GATA-4 up-regulate
the ß-B(4.8)-subunit promoter in testicular cells, the abilities of
these GATA-binding proteins interacting with GATA motif and/or
GATA-like sequences to transactivate this promoter were examined by
mutation analysis. CAT constructs containing mutations of the GATA
motif at -65 and/or GATA-like sequence, GATT at -177 and -42 and
GATC at -201, in the ß-B(4.8)-subunit promoter were prepared as
illustrated in Fig. 6
. The effects of the
mutations of GATA and GATA-like sequences on the basal transcriptional
activity and the effects of GATA-1 and GATA-4 on the transactivation of
the ß-B(4.8)-subunit promoter in MA-10 and MSC-1 cells were analyzed
as shown in Figs. 7
and 8
, respectively.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 6. CAT Constructs Containing Mutations at GATA and
GATA-Like Motifs in the ß-B(4.8)-Subunit Basal Promoter Region
Mutations of GATA motif at -65, m1(-65), and m2(-65); GATT sequence
at -177, m(-177), and at -42, m(-42); and GATC at -201, m(-201),
were prepared from ß-B(4.8)-subunit promoter containing -226 to +67
region as described in Materials and Methods. Mutations
at both GATA and GATT motifs were also made, m1(-65)m(-177). These
mutated CAT constructs were used for transactivation studies described
in Figs. 7 and 8 .
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Figure 7. The Effect of Mutations of GATA and GATA-Like
Motifs on Basal Transcription (A), Transactivation by GATA-1 (B), and
Transactivation by GATA-4 (C) of ß-B(4.8)-Subunit Promoter in MA-10
Cells
CAT constructs containing mutations at GATA, GATT, and GATC motifs as
described in Fig. 6 were cotransfected with expression plasmid without
cDNA insert (panel A), with mGATA-1 (panel B), or with mGATA-4 (panel
C) cDNA into MA-10 cells. The changes in CAT activity by mutations of
GATA and/or GATA-like motifs were expressed as percent (mean ±
SEM) relative to CAT activity obtained from cells
transfected with unmutated ß-B(4.8)(-226/+67)CAT construct and an
expression vector containing no cDNA (designated as 100%).
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 8. The Effect of Mutations of GATA and GATA-Like
Motifs on Basal Transcription (A), Transactivation by GATA-1 (B), and
Transactivation by GATA-4 (C) of the ß-B(4.8)-Subunit Promoter in the
MSC-1 Sertoli Cell Line
CAT constructs containing mutations at GATA and GATT motifs as shown in
Fig. 6 were cotransfected with expression plasmid without cDNA (panel
A), with mGATA-1 (panel B), or with mGATA-4 (panel C) cDNA into MSC-1
cells as described above. The changes in CAT activity by mutations of
GATA and/or GATA-like motifs were expressed as percent (mean ±
SEM) relative to CAT activity obtained from cells
transfected with unmutated ß-B(4.8)(-226/+67)CAT construct and an
expression vector containing no cDNA (designated as 100%).
|
|
Effect on Basal Transcription.
We have demonstrated that mutations of one or both of the two GATA
motifs in the
-subunit promoter caused a marked decrease in the
basal transcription of this gene (16). Mutation of GATA sequence at
-65 of the ß-B(4.8)-subunit promoter also resulted in a reproducible
reduction of basal transcriptional activity from this promoter in both
MA-10 and MSC-1 cell lines (Figs. 7A
and 8A
). The reduction, however,
is less evident (2030%) when compared with that observed in the
-
subunit promoter. Mutation of GATT sequence at -177 or -42 did
not apparently affect the basal transcriptional activity from the
ß-B(4.8)-subunit promoter in either cell line. A small (1520%)
decrease was observed in MA-10 cells when GATC at -201 was
mutated.
Effect on Transactivation by GATA-1 Factor.
The ability of GATA-1 factor interacting with GATA and/or GATA-like
motifs to transactivate the ß-B(4.8)-subunit promoter was next
examined by cotransfection of mutated CAT constructs (Fig. 6
) with a
cDNA expression plasmid encoding mouse GATA-1 (6) (Figs. 7B
and 8B
).
GATA-1 increased CAT activity 4- and 8-fold in MA-10 and MSC-1 cells,
respectively, when GATA-1 expression plasmid was cotransfected with the
unmutated ß-B(4.8)( -226/+67)CAT construct. Mutations of the GATA
motif at -65 resulted in a marked decrease (6070%) in the ability
of GATA-1 factor to transactivate the ß-B(4.8)-subunit promoter in
both testicular cell lines. Mutation of the GATT sequence at -177 or
GATC sequence at -201, however, caused no apparent effect or only a
small decrease (1015%) in the transactivation by GATA-1.
Interestingly, mutation of GATT at -42 strikingly elevated the effect
of GATA-1 factor on the transactivation of the ß-B(4.8)-subunit
promoter. An 8- to 15-fold increase in CAT activity was observed in
MA-10 and MSC-1 cells, respectively.
Effect on Transactivation by GATA-4 Factor.
Cotransfection of the normal ß-B(4.8)(-226/+67)CAT construct with
mGATA-4 expression plasmid (10) increased CAT activity 2.5- and 4-fold
in MA-10 and MSC-1 cells, respectively (Figs. 7C
and 8C
). Mutations of
GATA motif at -65 caused no apparent effect or only a small decrease
(1020%) in the transactivation of ß-B(4.8)-subunit promoter by
GATA-4 factor in MA-10 cells. However, an evident reduction (4050%)
in the transactivation by GATA-4 was detected in MSC-1 cells. These
observations suggested that in MSC-1 cells both GATA-1 and GATA-4
interact with the GATA motif at -65 to transactivate the
ß-B(4.8)-subunit promoter, while in MA-10 cells it is mainly
GATA-1.
Similar to GATA-1 factor, GATA-4 did not interact with GATT at -177 or
GATC at -201 since mutation of these sequences did not influence the
effect of GATA-4 on the transactivation of the ß-B(4.8)-subunit
promoter. Mutation of GATT at -42 again increased the transactivation
of this promoter by GATA-4, as those shown above by GATA-1.
Electrophoretic Mobility Shift Assay (EMSA) Analysis of the
Interaction of GATA-Binding Proteins with the ß-B(4.8)-Subunit
Promoter
Interaction with GATA Motif at -65.
When a radiolabeled DNA fragment prepared from the ß-B(4.8)-subunit
promoter at -77 to -53 (-77/-53) containing a GATA motif at -65
was added to the nuclear extracts of MA-10 (Fig. 9
) or MSC-1 (Fig. 10
) cells for binding analysis, at
least three major shifted bands were observed in both cell lines.
After the addition of a nonradiolabeled GATA-containing
oligonucleotide, wGATA, which was derived from mouse GATA-1 gene
promoter (3), as a competitor, the binding for one of the shifted bands
(indicated by a solid arrow) decreased in a dose-dependent
manner (Fig. 9
, lanes 25, and Fig. 10
, lanes 2 and 3). This suggested
that the endogenous GATA-binding protein(s) in MA-10 and MSC-1 cells
interacts with GATA motif in the ß-B(4.8)-subunit promoter.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 9. EMSA Analysis of the Interaction of GATA-Binding
Proteins with GATA Motif in ß-B(4.8)-Subunit Promoter in MA-10 Cells
Nuclear extracts (1 µg each) prepared from MA-10 cells without (lanes
18) or with transfection with mGATA-1 expression plasmid (lanes
912) were added to radiolabeled oligonucleotide -77/-53 containing
ß-B(4.8)-subunit promoter DNA from -77 to -53 with a GATA motif at
-65 for binding analysis. Different amounts (25- to 200-fold in
excess) of nonradiolabeled GATA-containing oligonucleotide, wGATA (3 ),
and antisera raised against GATA-1 and GATA-4 were used for competition
of binding. Solid arrows indicate the band containing
GATA-binding proteins, and open and hatched
arrows indicate the supershifted band by addition of GATA-1 and
GATA-4 antiserum, respectively. The exposure time for the autoradiogram
was 16 h.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
Figure 10. EMSA Analysis of the Interaction of GATA-Binding
Proteins with the GATA Motif in the ß-B(4.8)-Subunit Promoter in
MSC-1 Sertoli Tumor Cells
As described in Fig. 9 , nuclear extracts (3 µg each) were prepared
from MSC-1 cells without (lanes 15) or with transfection of a cDNA
expression plasmid encoding mGATA-1 (lanes 610) or mGATA-4 (lanes
1115) and were used to analyze the binding activity to a radiolabeled
oligonucleotide -77/-53 containing a GATA motif at -65.
Nonradiolabeled oligonucleotide wGATA (50- or 100-fold in excess) and
antisera against GATA-1 and GATA-4 were included for competition of
binding. Solid arrows indicate the band containing
GATA-binding proteins, and open and hatched
arrows indicate the supershifted bands by addition of GATA-1
and GATA-4 antiserum, respectively. The exposure time for the
autoradiogram was 36 h.
|
|
To determine which GATA-binding protein(s) is responsible for the
binding, antibodies raised against GATA-1 and GATA-4 protein were
included in EMSA analysis (Fig. 9
, lanes 68, and Fig. 10
, lanes 4 and
5). A weak further shifted band (indicated by an open arrow)
resulting from the formation of immunocomplex was observed in MA-10
cells by the addition of anti-GATA-1 antibody (Fig. 9
, lane 6). When
GATA-4 antibody was added to the MA-10 nuclear extracts (Fig. 9
, lanes
7 and 8), an intense supershifted band (indicated by a hatched
arrow) was observed, which was accompanied by a marked decrease in
the intensity of the band binding to GATA (indicated by a solid
arrow). A weak supershifted band was also detected when
anti-GATA-4 antiserum was added to the MSC-1 extracts (Fig. 10
, lanes 5
and 10). These observations suggest that both endogenous GATA-1 and
GATA-4 proteins interact with the GATA motif at -65.
The endogenous levels of GATA-1 and GATA-4 proteins in MSC-1 cells are
quite low as estimated by the weak intensity of the supershifted bands
shown in Fig. 10
and by Western blot analysis (Fig. 3E
). To compare the
bindings of GATA-1 and GATA-4 proteins to the ß-B(4.8)-subunit
promoter in two testicular cell lines, nuclear extracts were prepared
from MA-10 (Fig. 9
, lanes 912) and MSC-1 (Fig. 10
, lanes 615) cells
in which GATA-binding proteins were overexpressed by
transfection of the cells with the cDNA expression plasmids.
Nuclear extracts were prepared from MA-10 (Fig. 9
, lanes 912) and
MSC-1 (Fig. 10
, lanes 615) cells in which GATA-1 or GATA-4
protein was overexpressed by transfection of the cells with the cDNA
expression plasmid (6, 10). As shown above in Fig. 3E
by Western blot
analysis, marked increases in GATA-1 and GATA-4 proteins were observed
in transfected cells. EMSA studies in Figs. 9
and 10
showed that the
bindings of the overexpressed GATA-binding proteins to the GATA motif
at -65 of the ß-B(4.8)-subunit promoter were also evidently
increased (Fig. 9
, lane 9, and Fig. 10
, lanes 6 and 11). The bindings
were decreased by the addition of excess nonradiolabeled
GATA-containing oligonucleotide, wGATA (Fig. 9
, lane 10, and Fig. 10
, lanes 78 and 1213). In addition, the supershifted bands
resulting from formation of an immunocomplex with antibodies
against GATA-binding proteins were also markedly increased (Fig. 9
, lane 11, and Fig. 10
, lanes 9 and 14).
The dose-dependent effect of GATA-1 and GATA-4 proteins on the binding
to the GATA motif at -65 of the ß-B(4.8)-subunit promoter was
demonstrated in Fig. 11
. Nuclear
extracts were prepared from MA-10 cells that were transfected with
different amounts of GATA-1 and GATA-4 expression plasmids to
overexpress various concentrations of these two proteins. Analysis of
their bindings to the ß-B(4.8)-subunit promoter DNA revealed that a
dose-dependent increase in the binding of GATA-1 (lanes 24) and
GATA-4 (lanes 57) proteins to the GATA motif was observed.
Furthermore, as shown in Fig. 5
, cotransfection of MA-10 cells with a
combination of both GATA-1 and GATA-4 expression plasmids also resulted
in an additive increase in their bindings to the GATA motif by the two
nuclear proteins (lanes 28).

View larger version (69K):
[in this window]
[in a new window]
|
Figure 11. EMSA Analysis of the Dose-Dependent Interaction of
GATA-1 and GATA-4 Proteins with the GATA Motif in the
ß-B(4.8)-Subunit Promoter
As described in Fig. 9 , nuclear extracts (1 µg each) were prepared
from MA-10 cells that were cotransfected with different amounts of cDNA
expression plasmids encoding mGATA-1 and mGATA-4 as indicated and were
used to analyze their binding activities to a radiolabeled
oligonucleotide -77/-53 containing a GATA motif at -65.
Nonradiolabeled oligonucleotide wGATA (200-fold in excess, lane 9) and
antiserum against GATA-1 and GATA-4 proteins were included for the
competition analysis of the binding (lanes 1012). Solid
arrows indicate the band containing GATA-binding proteins, and
open and hatched arrows indicate the
supershifted bands by addition of GATA-1 and GATA-4 antiserum,
respectively. The exposure time for the autoradiogram was 36 h.
|
|
Interaction with GATT at -42.
As shown in Figs. 7
and 8
, mutation of the GATT sequence at -42
increased the effects of GATA-1 and GATA-4 on the transactivation of
the ß-B(4.8)-subunit promoter in both MA-10 and MSC-1 cells. The
interaction of GATA-binding proteins in testicular cells with a GATT
motif at -42 was next examined using radiolabeled
oligonucleotide -52/-31 for EMSA analysis (Fig. 12A
). One intense, broad-shifted band
and one minor shifted band interacting with this DNA fragment were
observed in nuclear extracts of MA-10 cells (lane 2). In MSC-1 cells,
both shifted bands were present in similar intensity (lane 8). The
addition of nonradiolabeled GATA-containing oligonucleotides, wGATA
(lanes 3 and 9) and -77/-53 (lanes 5 and 11), competed most of the
bindings in two shifted bands. Only one species of protein in the
high-shifted band did not compete binding to the GATA motif. When a
GATT-mutated oligonucleotide of -52/-31 was used for competition
analysis, the binding to the GATA motif in two shifted bands was
restored. These results suggested that GATA-binding proteins interact
with the GATT sequence at -42 in the ß-B(4.8)-subunit promoter. The
addition of antiserum against GATA-4 yielded a supershifted band (lanes
6 and 12). When antibody against GATA-1 was added (lanes 7 and 13), a
faint supershifted band was also observed after long exposure of the
autoradiogram. To further verify that GATA-1 interacts with the GATT
motif at -42, nuclear extracts obtained from MA-10 and MSC-1 cells,
which had been transfected with mGATA-1 cDNA plasmid to overexpress
GATA-1 protein, were used to repeat the EMSA analysis (Fig. 12B
).
Similar results were obtained in Fig. 12
, A and B. An intense
supershifted band was detected in the nuclear extracts containing
overexpressed GATA-1 protein (Fig. 12B
, lanes 6 and 12). Our
observations reconfirm that the testicular GATA-1 and GATA-4 interacted
with GATT sequence at -42 of the ß-B(4.8)-subunit promoter.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 12. EMSA Analysis of the Interaction of Testicular
GATA-Binding Proteins with GATT Motif at -42 of ß-B(4.8)-Subunit
Promoter
Nuclear extracts were prepared from MA-10 and MSC-1 cells without
(panel A) or with (panel B) with transfection of an expression plasmid
encoding GATA-1 and were added to a radiolabeled oligonucleotide,
-52/-31, containing GATT motif at -42 for binding analysis.
Nonradiolabeled oligonucleotides and antisera against GATA-1 or GATA-4
were included for competition analysis. No nuclear extract was added to
lane 1. Solid arrow indicates the band containing
GATA-binding proteins, and open and
hatched arrows indicate the supershifted
bands by addition of GATA-1 and GATA-4 antiserum, respectively. The
exposure time for the autoradiogram shown in Fig. 12A was 30 h,
and in Fig. 12B , 16 h for lanes 17 and 48 h for lanes
813.
|
|
Interaction with GATC at -201 and GATT at -177.
Mutation of GATC at -201 or GATT at -177 did not apparently affect
the basal transcription nor the GATA-1- or GATA-4-induced
transactivation of the ß-B(4.8)-subunit promoter activity (Figs. 7
and 8
). The possibility of GATA-1 and/or GATA-4 protein interacting
with these motifs in the promoter was also analyzed by EMSA (Fig. 13
). Oligonucleotides containing GATC
at -201, -229/-187, and GATT at -177, -186/-142, in the
ß-B(4.8)-subunit promoter were radiolabeled and used for binding
analysis. Three shifted bands were observed binding to these
oligonucleotides. However, the bindings in these bands could not be
competed by addition of the GATA-containing oligonucleotide,
wGATA, or antibody against GATA-1 or GATA-4, suggesting that testicular
GATA-binding proteins did not interact with GATC at -201 or GATT at
-177 in the ß-B(4.8)-subunit promoter.

View larger version (98K):
[in this window]
[in a new window]
|
Figure 13. EMSA Analysis of the Interaction of Testicular
GATA-Binding Proteins with GATC Motif at -201 and GATT motif at -177
of ß-B(4.8)-Subunit Promoter
Nuclear extracts prepared from MA-10 cells were added to radiolabeled
oligonucleotide -229/-187 containing GATC motif at -201 (lanes 26)
or to -186/-142 containing GATT motif at 177 (lanes 812) for
binding analysis. No nuclear extract was added to lanes 1 and 7.
Nonradiolabeled oligonucleotide wGATA (50- or 100-fold in excess) and
antisera raised against GATA-1 and GATA-4 were used for competition of
binding. The exposure time for the autoradiogram was 16 h.
|
|
Deletion Analysis of the Transactivation of ß-B(4.8)-Subunit
Promoter by GATA- Binding Proteins
We have shown that serial deletion from the 5'-end of the
ß-B(4.8)-subunit promoter at -226 to -90 markedly decreased the
basal transcriptional activity of this promoter in MA-10 cells (Fig. 1
). Similar observations were also found in MSC-1 cells, as shown in
Fig. 14A
. The effect of 5'-deletion on
the transactivation of the ß-B (4.8)-subunit promoter by GATA-1
(Figs. 14B
and 15A
) and GATA-4 (Figs. 14C
and 15B
) was next examined. In Fig. 14
, B and C, total CAT activity
in GATA-1- or GATA-4-transfected cells was compared. CAT activity in
GATA-1-transfected cells was not significantly changed by 5'-deletion
from -226 to -126. A small reduction was found at the deletion from
-126 to -90 (Fig. 14B
). CAT activity in GATA-4-transfected cells
(Fig. 14C
) was markedly reduced by 5'-deletion in a manner similar to
that observed for basal transcription (Fig. 14A
).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 14. The 5'-End Deletion Analysis of Basal
Transcription (A), Transactivation by GATA-1 (B), and Transactivation
by GATA-4 (C) of ß-B(4.8)-Subunit Promoter in MA-10 and MSC-1 Cells
Upper panel shows the CAT constructs containing varied
lengths of the ß-B(4.8)-subunit promoter prepared by serial deletion
from the 5'-end of the -226 to +67 promoter DNA. Lower
panel shows the effects of 5'-deletion on ß-B(4.8)-subunit
promoter activities in two testicular cell lines. CAT constructs were
cotransfected with expression plasmid without cDNA (A), with mGATA-1
(B), or with mGATA-4 (C) cDNA. The changes in CAT activity by deletion
mutations were expressed as percent (mean ± SEM)
relative to CAT activity obtained from cells transfected with undeleted
ß-B(4.8)( -226/+67)CAT construct and an expression vector containing
no cDNA (designated as 100%).
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Figure 15. The Effect of 5'-Deletion on the Transactivation
of the ß-B(4.8)-Subunit Promoter by GATA-Binding Proteins
The transactivation of the ß-B(4.8)-subunit promoter activity by
GATA-1 (A) and GATA-4 (B) in each deletion construct of ß-B(4.8)CAT
was calculated from Figs. 13B and 13C , respectively, and was expressed
as folds of increase in CAT activity as compared with the corresponding
untreated CAT construct.
|
|
The effects of GATA-binding proteins on the activities of the
ß-B(4.8)-subunit promoter with varied deletions of the 5'-end were
further analyzed by their folds of increase in CAT activity in each CAT
construct after transfection with GATA-1 or GATA-4 expression plasmid
(Fig. 15
). A drastic increase in the induction of ß-B(4.8)-subunit
promoter activity by GATA-1 was observed when promoter DNA was deleted
from -180 to -126 and from -126 to -90 (Fig. 15A
). In MA-10 cells,
a 30- and 70-fold increase in CAT activity by cotransfection with
GATA-1 expression plasmid was obtained in CAT constructs containing
-126/+67 and -90/+67, respectively, while a 5-fold induction was
detected in the construct containing -180/+67 or undeleted -226/+67
of the ß-B(4.8)-subunit promoter DNA. Similar results were observed
in MSC-1 cells. These observations suggested that DNA sequences at the
region of -180 to -90 may be involved in the negative regulation of
the transactivation effect of GATA-1 on this promoter. The effect of
the 5'-deletion of the ß-B(4.8)-subunit promoter DNA caused much less
influence on the effect of GATA-4 on the transactivation of
ß-B(4.8)-subunit gene transcription in both cell lines (Fig. 15B
).
 |
DISCUSSION
|
|---|
We have previously shown that GATA-1, but not GATA-4,
transactivated the promoter activity of the inhibin
-subunit gene in
testicular cells (16). In this study, we demonstrated that another
inhibin/activin subunit gene promoter, the ß-B(4.8)-subunit promoter,
was also up-regulated by GATA-binding proteins, GATA-1 and GATA-4. Our
observations suggested that GATA-1 transactivates both
- and
ß-B(4.8)-subunit promoters through interaction with GATA motifs in
their basal promoters, -147 and -114 in
-subunit (16), and -65 in
ß-B(4.8)-subunit promoter. GATA-4 selectively up-regulates
ß-B(4.8)- subunit, but not
-subunit, gene transcription. The
effect of GATA-4 to transactivate the ß-B(4.8)-subunit promoter was
generally lower than that of GATA-1. Both GATA-binding proteins
transactivate inhibin/activin subunit gene promoters in a
dose-dependent manner (16) (Fig. 5
). Furthermore, GATA-1 and GATA-4
exert an additive effect on the transactivation of ß-B(4.8)-subunit
promoter when a combination of the two nuclear proteins was
administered.
The transactivation of the ß-B(4.8)-subunit promoter by GATA-1 and
GATA-4 was observed in two testicular cell lines, MA-10 and MSC-1,
which were derived from different cell types, Leydig and Sertoli,
respectively. Both cell lines express genes encoding inhibin and
activin subunits (41, 42, 43) and GATA-1 and GATA-4 (16) (Fig. 3
), although
MSC-1 cells produce low levels of GATA-binding proteins and inhibin
-subunit mRNA. The endogenous levels of GATA-1 and GATA-4 mRNAs
(Fig. 3
, AC) and proteins (Fig. 3E
) were much lower in MSC-1 cells.
Thus, the greater effects of exogenous GATA-1 and GATA-4 on the
ß-B(4.8)-subunit promoter activity in MSC-1 cells (Fig. 4) as
compared with MA-10 cells (Fig. 2
) may probably be due to the lower
endogenous levels of these proteins.
The mechanism by which GATA-4 elevates the ß-B(4.8)-subunit promoter
activity is less clear, based on our mutation analysis of GATA and
GATA-like sequences. In MSC-1 cells, mutation of the GATA motif reduced
the transactivation effect of GATA-4, suggesting that GATA-4 interacts
with the GATA motif to up-regulate ß-B(4.8)-subunit promoter
activity. However, a less evident effect caused by mutation of this
motif was observed in MA-10 cells. GATA-4 was also shown to
transactivate other testis-expressing genes through GATA motifs (17, 18, 44). In Müllerian-inhibiting substance gene, GATA-4 enhances
its promoter activity through a protein-protein interaction with a
nuclear receptor SF-1 (17, 44). Whether GATA-4 interacts with other
nuclear factor(s) to activate ß-B(4.8)-subunit gene transcription in
testicular cells is currently under investigation.
Although GATA-1 was shown to transactivate both
- and
ß-B(4.8)-subunit gene promoters through GATA motifs in testicular
cell lines, differences were observed in the mechanisms by which GATA-1
up-regulates these genes. Mutation of GATA sequences markedly
suppressed the transactivation effect of GATA-1 on both
- and
ß-B(4.8)-subunit promoter activities. Mutation of this motif also
evidently decreased the basal transcription of the
-subunit gene
(16), but only caused a small effect on the ß-B(4.8)-subunit promoter
(Figs. 7
and 8
). Furthermore, deletion analysis (Figs. 14
and 15
)
revealed that progressive removal from the 5'-end of the
ß-B(4.8)-subunit promoter DNA markedly increased the transactivation
effect of GATA-1 on this promoter, suggesting that GATA-1 may, directly
or indirectly through other protein factor(s), interact with DNA
sequences at the region of -180 to -90 to negatively regulate
ß-B(4.8)-subunit gene transcription. Since no consensus GATA or
GATA-like sequence was identified at the -180 to -90 region of the
ß-B(4.8)-subunit basal promoter, it is likely that GATA-1 interacts
with other protein factor(s) that bind to the DNA sequence in this
region to regulate ß-B(4.8)-subunit gene transcription. These
observations are quite different from those found in the
-subunit
promoter, where deletion of the region containing either the 5'- or
3'-GATA motif resulted in drastic suppression of both basal and GATA-1-
induced transcription of
-subunit gene (Z.-M. Feng and
C.-L. C. Chen, unpublished results).
One of the possible explanations for the differences found in the
transactivation of
- and ß-B(4.8)-subunit genes by GATA-1 is that
GATA-1 interacts with different protein factors to regulate these
promoters. At least three major shifted bands were observed binding to
the -77 to -53 GATA-containing region of the ß-B(4.8)-subunit
promoter in both MA-10 (Fig. 9
) and MSC-1 (Fig. 10
) cells. Nucleotide
sequence analysis revealed that putative binding sites for
transcription factors other than GATA-binding proteins, such as NF-1
and Sp1, were also identified in this region (36, 37). Whether these
factors play any role in regulating ß-B(4.8)-subunit promoter
activity is not clear at the present time. The binding sites for CREB
[cAMP response element (CRE)-binding protein] and SF-1 nuclear
factors were located within the two GATA motifs of the
-subunit
basal promoter and were involved in the cAMP-regulated transcription of
the
-subunit gene in ovarian cells (45). In addition, mutation
analysis revealed that CRE sequence is also required for the basal
transcription of
-subunit gene in granulosa cells (46). GATA-1 was
shown to interact with many protein factors including SF-1 (44),
CREB-binding protein (47), and Sp1 (48) to positively or
negatively regulate specific gene transcription. Whether GATA-1
interacts with these nuclear factors to regulate
- and
ß-B(4.8)-subunit promoter activities is currently under investigation
in our laboratory.
Members of the GATA-binding protein family were shown to recognize a
consensus sequence derived from regulatory elements in erythroid
cell-specific genes, (A/T)GATA(A/G). Analysis of DNA-binding
specificity of each GATA-binding protein further suggested a greater
flexibility of the recognition sites, i.e. the GAT consensus
derivations, for these transcription factors (49, 50, 51). For instance,
mGATA-1 protein binds to GATA variants, GAT(A/G/T), while GATA-2 and
GATA-3 recognize the GATC site. The possibility of GATA-1 and/or GATA-4
interacting with GATA variants, or GATA-like sequences, in the
ß-B(4.8)-subunit basal promoter was thus investigated. Our results
indicated that, in addition to the GATA motif at -65, both GATA-1 and
GATA-4 interacted with a GATA-like sequence, GATT at -42, to regulate
ß-B(4.8)-subunit promoter activity. However, neither of these factors
interacted with GATT at -177 or GATC at -201 in the
ß-B(4.8)-subunit promoter. The ability of GATA-1 and GATA-4 to
interact with GATT at -42 and not GATT at -177 demonstrated the
binding specificity of these proteins to the DNA sequences flanking the
GAT core motif (AGATTG at -42 and GGATTC at
-177).
GATA-binding proteins exert a dual function, acting either as an
activator or as a repressor depending on the location or the structure
of the binding site, in the regulation of GATA-containing gene
promoters, such as globins and rat platelet factor (PF4) (48, 49, 52).
In rat PF4 promoter, GATA-1 binds to the GATA site at -31 and
represses its gene expression. However, GATA-binding protein and/or its
cofactor may also bind to the upstream GATA site at -134 and activate
the transcription of PF4 gene (52). The steric interference of
preinitiation complex formation by GATA-1 and GATA-2 factors was
observed at the -31 GATA site in the core promoter of rat PF4 gene
(52). Similar observations were found in ß-B(4.8)-subunit promoter
(Figs. 7
and 8
). We showed that GATA-1 and GATA-4 factors
transactivated ß-B(4.8)-subunit promoter through binding to the GATA
motif at -65, while the two factors suppressed this promoter activity
by interaction with GATT sequence at -42. Whether a similar repression
mechanism observed in the PF4 gene applies to the ß-B(4.8)-subunit
promoter is of interest to study. The possibility of the steric
interference of GATA-binding proteins on GATT at -42 in the regulation
of the ß-B(4.8)-subunit promoter is currently under investigation. In
addition, the possible physiological relevance of the suppressor
mechanism is also being examined.
The expressions of GATA-1 and GATA-4 genes were developmentally
regulated in the testis of mouse and rat (13, 14, 15, 17, 18, 24). Both
GATA-1 and GATA-4 proteins and mRNAs were present in high levels in
immature testis. Maximal expression was observed in 14- to
21-day-old testis for GATA-1 (13, 14, 15, 24) and in 1- to 7-day-old
testis for GATA-4 (17, 18, 24). Similar results were previously
observed in the testicular inhibin/activin
- and ß-B-subunit genes
(20, 21, 22, 23, 26). Both GATA-binding proteins and inhibin/activin subunit
genes are predominantly expressed in Sertoli cells and are also
expressed in Leydig cells and tumor cell lines derived from Sertoli and
Leydig cells (13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 26). Our recent findings that GATA-1
protein transactivates both inhibin/activin
- and ß-B-subunit gene
promoters in Sertoli and Leydig tumor cell lines suggest that the
developmental regulation of the expression of GATA-1 in the testis may
be one of the important factors involved in controlling the testicular
production of inhibin B. Furthermore, the new demonstration of the
selective effect of GATA-4 on the transactivation of the
ß-B(4.8)-subunit gene promoter and the observation of the maximal
expression of GATA-4 and ß-B-subunit genes in 1- to 7-day-old testis
(17, 18, 24, 26) also suggest that the age-dependent regulation of
GATA-4 expression in the testis may play a role in modulating the
production of activin protein in the testis. Further investigation to
clarify these possibilities is in progress in our laboratory.
In summary, we provide new information that two GATA-binding proteins,
GATA-1 and GATA-4, which are expressed in the testis, play important
roles in regulating the transcription of inhibin and activin subunit
genes in testicular cells via complicated mechanisms. Both GATA-1 and
GATA-4 act through the GATA motif at -65 and GATT at -42 to
up-regulate and down-regulate the promoter activity of the
ß-B(4.8)-subunit gene, respectively. GATA-1, using similar mechanisms
but with differences, transactivates both
- and ß-B(4.8)-subunit
gene promoters through interaction with GATA motif. In addition, GATA-1
may interact with DNA sequences at -180 to -90 to regulate the
ß-B(4.8)-subunit gene promoter. The mechanisms by which these
GATA-binding proteins transactivate inhibin/activin subunit gene
transcription in testicular cells are currently under investigation in
our laboratory. The observations obtained from our studies may provide
new insight into the actions of GATA-binding proteins on the production
of inhibin and activin proteins in the testis.
 |
MATERALS AND METHODS
|
|---|
Northern Blot Analysis
Testes were collected from 21-day-old Sprague Dawley rats
purchased from Charles River Laboratories, Inc. Breeding
Laboratories (Wilmington, MA). Total RNAs isolated from testes and
cultured MA-10 and MSC-1 cells were subjected to Northern blot
analysis. Expression plasmids containing full-length cDNAs encoding
mouse GATA-1 (pXM/GATA-1) (6) and GATA-4 (pMT2-mGATA-4) (10) were used
to prepare radioactive probes for the identification of GATA-1 and
GATA-4 mRNA on the RNA blots.
Identification of GATA-1 mRNA by RT-PCR
The RT-PCR was carried out as described (16, 37) using Titan One
Tube RT/PCR Kit (Roche Molecular Biochemicals,
Indianapolis, IN). Briefly, reverse transcription was performed using 2
µg each total RNA isolated from tissues or cultured cells, 1
µM each primer, 5 mM dithiothreitol, and 1
µl enzyme mixture containing reverse transcriptase and Taq
DNA polymerase at 52 C for 30 min. After denaturing at 94 C for 2 min,
the cDNAs were amplified 30 cycles by PCR at 94 C for 30 sec, 52 C for
30 sec, and 68 C for 90 sec in each amplification cycle. Forward primer
(CCCATGGATTTTCCTGGTC, 19-mer) from translation initiation codon and
reverse primer (TCCACAGTTCACACACTCTCTGGC, 24-mer) containing a sequence
complementary to amino acids 201209 of the zinc finger domain of
mGATA-1 gene (6) were used for the analysis of GATA-1 mRNA by RT-PCR
(16). An aliquot of the RT-PCR-generated products was subjected to
agarose gel electrophoresis followed by transfer to Nytran membrane.
GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1
cDNA probe (16). The levels of total RNA used in each sample were
further quantified by measurement of glyceraldehyde-3-phosphate
dehydrogenase (G3PDH) mRNA levels by the RT-PCR method. The primers
used for analysis of G3PDH mRNA, forward primer ACCACAGTCCATGCCATCAC,
and reverse primer TCCACCACCCTGTTGCTG, were purchased from
CLONTECH Laboratories, Inc. (Palo Alto, CA).
Preparation of Deletion Constructs
Deletion constructs were made using Erase-a-Base System
(Promega Corp., Madison, WI) as described previously (37, 53). A CAT construct containing the promoter DNA from -3,600 to +67 of
the ß-B(4.8)promoter, pßB4.8(-3600)CAT, was linearized by digestion
with KpnI and BamHI and was used to generate
deletion mutants from the 5'-end by Exonuclease III. At various time
points, aliquots of nuclease-digests were collected. After treatment
with Klenow and DNA ligase, the deletion plasmids with different
lengths of the ß-B(4.8)promoter were transformed into
Escherichia. coli. The deletions of these plasmids were
confirmed by DNA sequences analysis.
Preparation of Mutation Constructs
Mutations of GATA motif and GATA-like GATT and GATC motifs were
performed in pßB4.8(-226/+67)CAT using 1) Transform Site-Directed
Mutagenesis Kit (CLONTECH Laboratories, Inc.) or 2)
GeneEditor in vitro Site-Directed Mutagenesis System
(Promega Corp.). In 1) the selection primer, TransOligo
NdeI/NcoI, and one or two GATA-, GATC-, or
GATT-mutated primers were annealed to the denatured plasmid
pßB4.8(-226/+67)CAT. After elongation and ligation of the mutant
DNA, the plasmid DNA mixture was transformed into a strain of E.
coli, mutS, which is defective in mismatch repair. Clones with
mutated sequences were identified by digestion with NcoI and
further confirmed by sequence analysis of their mutations. In 2) the
selection oligonucleotide and the mutagenic oligonucleotide(s) were
annealed to target DNA template, pßB4.8(-226/+67)CAT, and the mutant
strand DNA was synthesized and ligated. The heteroduplex DNA was then
transformed into a repair minus E. coli strain, BMH7118
mutS, grown in selective media containing the novel GeneEditor
Antibiotics. Plasmids resistant to antibiotics were isolated and
transformed again into the final host strain, JM 109.
Procedure of DNA Transfection and CAT Assay
MA-10 cells, a clonal strain of cultured mouse Leydig tumor
cells, were provided by Dr. Mario Ascoli (University of Iowa, Iowa
City, IA) (54) and were cultured and maintained as described previously
(16, 55). The procedure for transfection of plasmid DNA into MA-10
cells was described previously (16, 37, 53). MA-10 cells were
plated at a density of 1.2 x 106
cells per 100-mm petri dish the day before transfection. The
purified plasmid DNA was introduced into cells by the calcium phosphate
precipitation method (56). Each precipitate DNA contained 16 µg of
test plasmid and 2 µg of pAct/LacZ plasmid containing actin promoter
and ß-galactosidase to monitor transfection efficiency. Five hours
after precipitate was added, the cells were shocked with 15% glycerol
for 2 min and harvested 48 h later.
MSC-1 cells, a mouse Sertoli tumor cell line provided by Dr. Michael
Griswold (Washington State University, Pullman, WA) (41, 42), were
plated at 0.5 x 106 cells per 60-mm dish.
One day later, transfection was performed by using the liposome
DC-chol:DOPE method as described by M. J. Campbell (57). Each
precipitate contained 4 µg of test plasmid and 0.6 µg pAct/LacZ
plasmid. In some cases, MSC-1 cells were transfected by the calcium
phosphate precipitation method using the same amount of DNA as
described above. The cells were harvested 48 h after
transfection.
For cotransfection studies, ßB(4.8)CAT plasmids (37) containing
normal or mutated sequences at GATA, GATT, or GATC motif, and
A
BstCAT plasmid containing a rat inhibin
-subunit basal promoter
DNA from -163 to +65 bp (16, 53) were coprecipitated with cDNA
expression plasmids encoding GATA-binding proteins. The precipitates
were then transfected into MA-10 or MSC-1 cells. Expression plasmids
containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (6) and
GATA-4 (pMT2-mGATA-4) (10) were provided by Dr. Stuart Orkin (Harvard
Medical School, Boston, MA) and Dr. David Wilson (Washington
University, St. Louis, MO), respectively. Promoterless CAT construct
(A0CAT), and pXM and pMT2 expression vectors without cDNA inserts were
included as negative controls for
- or ß-CAT constructs and
mGATA-1 and mGATA-4, respectively (16).
Cell lysates were prepared by repeated freezing in a dry ice/ethanol
bath and thawing at 37 C for 5 min each from the transfected MA-10 and
MSC-1 cells and were used for measurements of protein concentration
(58) and the activities of ß-galactosidase and CAT as described
previously (16, 37, 53). Four micrograms each of cellular protein were
applied for the measurement of ß-galactosidase activity (59, 60),
using chlorophenol
red-p-D-galactopyranoside (CPRG) as a
substrate. One hundred micrograms each of the heated cellular protein
were employed for the measurement of CAT activity using a diffusion
method with 3H-acetyl coenzyme A (200 mCi/mmol
and 0.5 mCi/ml, NEN Life Science Products, Boston, MA)
(61, 62). The CAT activity was then normalized to the activity of
ß-galactosidase.
Preparation of Nuclear Extracts
Nuclear extracts were prepared from MA-10 or MSC-1 cells using
the procedure described previously (63). Cell pellets were suspended in
hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM
KCl, 1.5 mM MgCl2, 0.2 mM
phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol)
at 400 µl/dish for 10 min on ice. Nuclear proteins were extracted
from the swollen cells in a buffer, 20 µl/dish, similar to the above
hypotonic buffer except that 420 mM KCI and 25% glycerol
were included. Aliquots of nuclear extracts were stored at -70 C until
use.
Western Blot Analysis
Nuclear extracts prepared from testicular cell lines were
subjected to SDS-PAGE using a 10% polyacrylamide gel. After
transferring the nuclear proteins onto Immun-Blot polyvinylidene
fluoride (PVDF) membrane (Bio-Rad Laboratories, Inc. Hercules, CA), the membrane was placed in a solution
containing 3% nonfat milk in TBS (10 mM Tris·HCl, pH
8.0, 150 mM NaCl, and 0.05% Tween-20) at 4 C overnight.
GATA-1 and GATA-4 proteins on the membrane were identified by
incubation with anti-GATA-1 and anti-GATA-4 antiserum, respectively, at
1:100 to 1:300 dilution (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) for 60 min at room temperature and then alkaline
phosphatase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:2,000 dilution for 45 min at room
temperature and were visualized using BCIP/NBI
(5-bromo-4-chloro-3-indoyl phosphate p-toluidine salt and
p-nitro blue tetrazolium chloride) (Bio-Rad Laboratories, Inc.).
EMSA
EMSA was performed as described previously (16) by incubation of
nuclear extracts (0.53 µg) prepared from MA-10 or MSC-1 cells with
radiolabeled double-stranded oligonucleotides or DNA fragments, and 1
µg of poly(dI/dC) as a nonspecific competitor. The binding reactions
were performed at room temperature for 30 min and on ice for another 30
min. Specific DNA competitors or antisera were added to the reactions
as indicated. Antiserum against mGATA-1 or mGATA-4 protein (purchased
from Santa Cruz Biotechnology, Inc.) was added before the
incubation for 30 min on ice. For competition analysis, excess of
nonradiolabeled double-stranded oligonucleotides containing GATA
motif(s) or the mutated sequences was added along with radiolabeled
oligonucleotide probes to the reaction mixtures. The binding reactions
were analyzed on 6% or 7% polyacrylamide gel as described (16, 52).
Double-stranded oligonucleotides containing GATA or GATA-like sequences
from different regions of the ß-B(4.8)-subunit promoter were
radiolabeled with [
-32P]ATP and T4
polynucleotide kinase for binding analysis. These DNA fragments
included -77 to -53 containing GATA at -65, -77/-53; -52 to -31
containing GATT at -42, -52/-31; -229 to -187 containing GATC
motif at -201, -229/-187; and -186 to -142 containing GATT at
-177, -186/-142. Nonradiolabeled oligonucleotides used for
competition analysis included a 20-mer from mGATA-1 gene, wGATA
(GTCCATCTGATAAGACTTAT)(3), DNA fragments from various regions of the
ß-B(4.8)-subunit promoter, and m(-42) containing -52 to -31
fragment with mutation of GATT motif at -42 to CTTT.
 |
ACKNOWLEDGMENTS
|
|---|
We wish to thank Drs. Stuart Orkin and David Wilson for
providing mGATA-1 and mGATA-4 expression plasmids, respectively, Dr.
Mario Ascoli for MA-10 cells, Dr. Michael Griswold for MSC-1 cells, and
the assistance from Tissue Culture Core of Center for Biomedical
Research, Population Council.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Ching-Ling C. Chen, Ph.D., Population Council, 1230 York Avenue, New York, New York 10021. E-mail:
chen{at}popcbr.rockefeller.edu
This research was supported by NICHD/NIH through cooperative agreement
[U54(HD-13541)] as part of the Specialized Cooperative Centers
Program in Reproduction Research, and by NIDDK/NIH DK-34449 (to
C.-L.C). Z. Zhang was partially supported by a Dewitt Wallace
Fellowship.
1 Current address: Research Institute of Sericulture, Chinese Academy
of Agricultural Sciences, Zhenjiang City, Jian Su, Peoples Republic
of China. 
Received for publication February 8, 2000.
Revision received July 24, 2000.
Accepted for publication August 4, 2000.
 |
REFERENCES
|
|---|
-
Yamamoto M, Ko LJ, Leonard MW, Beug H, Orkin SH, Engel JD 1990 Activity and tissue-specific expression of the transcription
factor NF-E1 multigene family. Genes Dev 4:16501662[Abstract/Free Full Text]
-
Orkin SH 1992 GATA-binding transcription factors in
hematopoietic cells. Blood 80:575581[Free Full Text]
-
Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and
in vivo footprinting implicate the erythroid transcription
factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919931[Abstract/Free Full Text]
-
Evans T, Reitman M, Felsenfeld G 1988 An erythroid-specific
DNA-binding factor recognizes a regulatory sequence common to all
chicken globin genes. Proc Natl Acad Sci USA 85:59765980[Abstract/Free Full Text]
-
Wall L, deBoer E, Grosveld F 1988 The human ß-globin
gene 3' enhancer contains multiple binding sites for an
erythroid-specific protein. Genes Dev 2:10891100[Abstract/Free Full Text]
-
Tsai S-F, Martin DI, Zon LI, DAndrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid
lineage through expression in mammalian cells. Nature 339:446451[CrossRef][Medline]
-
Martin DI, Orkin SH 1990 Transcriptional activation and DNA
binding by the erythroid factor GF-1/NF-El1/Eryf 1. Genes Dev 4:18861898[Abstract/Free Full Text]
-
Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning
of the GATA-binding protein that regulates endothelin-1 gene expression
in endothelial cells. J Biol Chem 266:1618816192[Abstract/Free Full Text]
-
George KM, Leonard MW, Roth ME, Lieuw KH, Kiossis D, Grosveld
F, Engel JD 1994 Embryonic expression and cloning of the murine
GATA-3 gene. Development 120:26732686[Abstract/Free Full Text]
-
Arceci RJ, King AA, Simon MC, Orkin SH, Wilson DB 1993 Mouse
GATA-4: a retinoic acid-inducible GATA-binding transcription factor
expressed in endodermally derived tissues and heart. Mol Cell Biol 13:22352246[Abstract/Free Full Text]
-
Grepin C, Dagnino L, Robitaille L, Haberstroh L, Antakly T,
Nemer M 1994 A hormone-encoding gene identifies a pathway for cardiac
but not skeletal muscle gene transcription. Mol Cell Biol 14:31153129[Abstract/Free Full Text]
-
Laverriere AC, MacNeill C, Mueller C, Poelmann RE, Burch JB,
Evans T 1994 GATA-4/5/6, a subfamily of three transcription factors
transcribed in developing heart and gut. J Biol Chem 269:2317723184[Abstract/Free Full Text]
-
Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M, Engel
JD, Yamamoto M 1993 Erythroid transcription factor GATA-1 is abundantly
transcribed in mouse testis. Nature 362:466468[CrossRef][Medline]
-
Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD,
Yamamoto M 1994 Developmental stage- and spermatogenic cycle-specific
expression of transcription factor GATA-1 in mouse Sertoli cells.
Development 120:17591766[Abstract]
-
Onodera K, Yomogida K, Suwabe N, Takahashi S, Muraosa Y,
Hayashi N, Ito E, Gu L, Ras-soulzadegan M, Engel JD, Yamamoto M 1997 Conserved structure, regulatory elements, and transcriptional
regulation from the GATA-1 gene testis promoter. J Biochem 121:251263[Abstract/Free Full Text]
-
Feng Z-M, Wu AZ, Chen C-LC 1998 Testicular GATA-1 factor
upregulates the promoter activity of rat inhibin
-subunit gene
in MA-10 Leydig tum