| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Population Council (Z.-M.F., A.Z.W., C.-L.C.C.) and The Rockefeller University (C.-L.C.C.) New York, New York 10021
| ABSTRACT |
|---|
|
|
|---|
-subunit gene through interaction with GATA motifs in the promoter
region in MA-10, a mouse Leydig tumor cell line. In this study, we
showed that both GATA-1 and GATA-4 also transactivated the
transcription from the promoter for the 4.8-kb inhibin/activin
ß-B-subunit gene transcripts, ß-B(4.8)-subunit promoter, in two
testicular cell lines, MA-10 and MSC-1, which is a mouse Sertoli cell
line. The abilities of GATA-1 and GATA-4 interacting with GATA and/or
GATA-like sequences to transactivate the ß-B(4.8)-subunit promoter
were next examined by mutation analysis. Mutations of GATA or GATA-like
sequences caused no apparent effect or only a small decrease in the
basal transcriptional activity of this promoter. However, mutation of
the GATA motif at -65 markedly decreased 6070% of the effect of
GATA-1 on the transactivation of ß-B(4.8)-subunit promoter in both
MA-10 and MSC-1 cells. In addition, mutation of the GATA motif in MSC-1
cells also reduced 4050% of the effect of GATA-4 to transactivate
this promoter. Interestingly, mutation of GATT at -42 caused a
7090% increase in the transactivation of ß-B(4.8)-subunit promoter
by GATA-1 or GATA-4. No significant change in the promoter activity was
observed when GATT at -177 or GATC at -201 was mutated.
Electrophoretic mobility shift assay confirmed the above observations
that these GATA-binding proteins interacted with the GATA motif at -65
and GATT at -42, but not with GATC at -201 or GATT at -177. Serial
deletion from the 5'-end of the basal promoter, from -226 to -90,
markedly decreased the basal transcription, but increased the effect of
GATA-1 on transactivation of the ß-B(4.8)-subunit promoter. In
summary, our observations suggest that the two GATA-binding proteins
transactivate the ß-B(4.8)-subunit promoter in testicular cells via
complicated mechanisms. Both GATA-1 and GATA-4 factors act through the
GATA motif at -65 and GATT at -42 to positively and negatively
regulate the transcription from this promoter, respectively.
Furthermore, GATA-1 may also interact directly or indirectly with DNA
sequences at -180 to -90 to regulate the ß-B(4.8)-subunit promoter. | INTRODUCTION |
|---|
|
|
|---|
- and
ß-B-subunit genes (20, 21, 22, 23). Since GATA-1 and GATA-4 are expressed in
testicular cells of mouse and rat, including Sertoli and Leydig cells,
and Leydig tumor cell lines, such as MA-10 cells (13, 14, 15, 16, 17, 18, 24), we have
investigated the possible actions of GATA-1 and GATA-4 in controlling
the expression of inhibin and activin subunit genes in testicular
cells.
Inhibins and activins have been characterized as dimeric glycoproteins
sharing a common subunit linked by disulfide bonds. Inhibin contains an
inhibin-specific
-subunit and one of the closely related
ß-subunits, ß-A and ß-B, whereas activin is a homo- or
heterodimer of the two ß-subunits. The two ß- subunits were
shown to be members of the transforming growth factor (TGF-ß)
superfamily. The mRNAs and genes encoding inhibin and activin subunits
were isolated and characterized from many species (for reviews, see
Refs. 16, 25, 26, 27, 28). cDNAs encoding other new ß-subunits, ß-C
(29, 30, 31), ß-E (32, 33), and ß-D (34), were recently isolated. All
inhibin and activin subunit genes contain one intron within their
precursor region, except the ß-A-subunit gene, which contains two
introns (27, 35). The two species (4.8 and 3.7 kb) of the ß-B-subunit
mRNAs are derived from transcription at different initiation sites (36, 37).
The promoter regions required for maximal basal transcription of the
inhibin/activin subunit genes in testicular and ovarian cells were
determined by transient transfection studies (for reviews, see Refs. 16, 27). We have shown that the promoter required for the transcription
of rat inhibin
-subunit gene in MA-10 cells depends upon a 67-bp DNA
fragment at -163 to -96, in which two GATA motifs were identified.
Furthermore, our recent new findings revealed that the basal
transcription of
-subunit gene in MA-10 cells is up-regulated
selectively by testicular GATA-1, but not GATA-4, through interaction
with the GATA motifs in the promoter (16). The promoters required for
the expression of the 3.7-kb ß-B-subunit mRNA, referred to as
ß-B(3.7)-subunit promoter, and the 4.8-kb ß-B-subunit mRNA,
referred to as ß-B(4.8)-subunit promoter, were mapped to regions of
-139 to +60 and -409 to +67 from their corresponding transcription
initiation sites (37). The ß-B(3.7)-subunit promoter is highly GC
rich with several Spl binding sites, while the ß-B(4.8)-subunit
promoter is not GC rich but contains one Spl site and many potential
recognition sites for GATA-binding proteins, including GATA motif and
GATA-like sequences such as GATT and GATC (37). The ß-B(3.7)
promoter, which lacks GATA motifs, cannot be transactivated by either
of these GATA-binding proteins (16). In this study, we investigated the
possibility that GATA-1 and GATA-4 interact with the GATA and GATA-like
motifs identified in the ß-B(4.8)-subunit promoter to regulate its
transcription in testicular cells.
| RESULTS |
|---|
|
|
|---|
|
-subunit
promoter (16) (Fig. 2A
-subunit promoter (16), which
can be regulated only by GATA-1 and not by GATA-4 protein (Fig. 2A
|
-subunit mRNA were detected in MSC-1 cells. However,
similar to that observed in normal Sertoli cells (21), the 4.8- and
3.7-kb inhibin/activin ß-B-subunit mRNAs were found in the MSC-1 cell
line.
The expression of GATA-1 and GATA-4 genes in MSC-1 cells was examined
by Northern blot analysis and RT-PCR (Fig. 3
). As reported previously (16), both
GATA-1 and GATA-4 mRNAs were observed in 21-day-old rat testis and
MA-10 cells (Fig. 3
, A and B). In MSC-1 cells, GATA-4 mRNA could be
detected, but in a level much lower than that observed in rat testis or
MA-10 cells. The expression of GATA-1 gene in MSC-1 cells was too low
to be detected by Northern blot analysis (Fig. 3A
); however, it could
be observed by the RT-PCR method (Fig. 3C
). Using primers described
previously (16), GATA-1 mRNA was detected in 21-day-old rat testis and
in MA-10 and MSC-1 cells, although the levels in MSC-1 cells were
low.
|
Our observations in Fig. 2
suggested that overexpression of
GATA-binding proteins in MA-10 by cotransfection with GATA-1 and GATA-4
expression plasmids resulted in the transactivation of
- and
ß-B(4.8)-subunit promoter activities. Similarly, cotransfection
studies in MSC-1 cells (Fig. 4
) also
showed that overexpression of GATA-1 protein transactivated both
-
and ß-B(4.8)-subunit promoters, while GATA-4 protein up-regulated
only ß-B(4.8)- subunit gene transcription. Approximately a 9- and
4-fold increase in CAT activity by overexpression of GATA-1 and GATA-4
protein, respectively, was detected in MSC-1 cells.
|
|
|
|
|
-subunit promoter caused a marked decrease in the
basal transcription of this gene (16). Mutation of GATA sequence at
-65 of the ß-B(4.8)-subunit promoter also resulted in a reproducible
reduction of basal transcriptional activity from this promoter in both
MA-10 and MSC-1 cell lines (Figs. 7A
-
subunit promoter. Mutation of GATT sequence at -177 or -42 did
not apparently affect the basal transcriptional activity from the
ß-B(4.8)-subunit promoter in either cell line. A small (1520%)
decrease was observed in MA-10 cells when GATC at -201 was
mutated.
Effect on Transactivation by GATA-1 Factor.
The ability of GATA-1 factor interacting with GATA and/or GATA-like
motifs to transactivate the ß-B(4.8)-subunit promoter was next
examined by cotransfection of mutated CAT constructs (Fig. 6
) with a
cDNA expression plasmid encoding mouse GATA-1 (6) (Figs. 7B
and 8B
).
GATA-1 increased CAT activity 4- and 8-fold in MA-10 and MSC-1 cells,
respectively, when GATA-1 expression plasmid was cotransfected with the
unmutated ß-B(4.8)( -226/+67)CAT construct. Mutations of the GATA
motif at -65 resulted in a marked decrease (6070%) in the ability
of GATA-1 factor to transactivate the ß-B(4.8)-subunit promoter in
both testicular cell lines. Mutation of the GATT sequence at -177 or
GATC sequence at -201, however, caused no apparent effect or only a
small decrease (1015%) in the transactivation by GATA-1.
Interestingly, mutation of GATT at -42 strikingly elevated the effect
of GATA-1 factor on the transactivation of the ß-B(4.8)-subunit
promoter. An 8- to 15-fold increase in CAT activity was observed in
MA-10 and MSC-1 cells, respectively.
Effect on Transactivation by GATA-4 Factor.
Cotransfection of the normal ß-B(4.8)(-226/+67)CAT construct with
mGATA-4 expression plasmid (10) increased CAT activity 2.5- and 4-fold
in MA-10 and MSC-1 cells, respectively (Figs. 7C
and 8C
). Mutations of
GATA motif at -65 caused no apparent effect or only a small decrease
(1020%) in the transactivation of ß-B(4.8)-subunit promoter by
GATA-4 factor in MA-10 cells. However, an evident reduction (4050%)
in the transactivation by GATA-4 was detected in MSC-1 cells. These
observations suggested that in MSC-1 cells both GATA-1 and GATA-4
interact with the GATA motif at -65 to transactivate the
ß-B(4.8)-subunit promoter, while in MA-10 cells it is mainly
GATA-1.
Similar to GATA-1 factor, GATA-4 did not interact with GATT at -177 or GATC at -201 since mutation of these sequences did not influence the effect of GATA-4 on the transactivation of the ß-B(4.8)-subunit promoter. Mutation of GATT at -42 again increased the transactivation of this promoter by GATA-4, as those shown above by GATA-1.
Electrophoretic Mobility Shift Assay (EMSA) Analysis of the
Interaction of GATA-Binding Proteins with the ß-B(4.8)-Subunit
Promoter
Interaction with GATA Motif at -65.
When a radiolabeled DNA fragment prepared from the ß-B(4.8)-subunit
promoter at -77 to -53 (-77/-53) containing a GATA motif at -65
was added to the nuclear extracts of MA-10 (Fig. 9
) or MSC-1 (Fig. 10
) cells for binding analysis, at
least three major shifted bands were observed in both cell lines.
After the addition of a nonradiolabeled GATA-containing
oligonucleotide, wGATA, which was derived from mouse GATA-1 gene
promoter (3), as a competitor, the binding for one of the shifted bands
(indicated by a solid arrow) decreased in a dose-dependent
manner (Fig. 9
, lanes 25, and Fig. 10
, lanes 2 and 3). This suggested
that the endogenous GATA-binding protein(s) in MA-10 and MSC-1 cells
interacts with GATA motif in the ß-B(4.8)-subunit promoter.
|
|
The endogenous levels of GATA-1 and GATA-4 proteins in MSC-1 cells are
quite low as estimated by the weak intensity of the supershifted bands
shown in Fig. 10
and by Western blot analysis (Fig. 3E
). To compare the
bindings of GATA-1 and GATA-4 proteins to the ß-B(4.8)-subunit
promoter in two testicular cell lines, nuclear extracts were prepared
from MA-10 (Fig. 9
, lanes 912) and MSC-1 (Fig. 10
, lanes 615) cells
in which GATA-binding proteins were overexpressed by
transfection of the cells with the cDNA expression plasmids.
Nuclear extracts were prepared from MA-10 (Fig. 9
, lanes 912) and
MSC-1 (Fig. 10
, lanes 615) cells in which GATA-1 or GATA-4
protein was overexpressed by transfection of the cells with the cDNA
expression plasmid (6, 10). As shown above in Fig. 3E
by Western blot
analysis, marked increases in GATA-1 and GATA-4 proteins were observed
in transfected cells. EMSA studies in Figs. 9
and 10
showed that the
bindings of the overexpressed GATA-binding proteins to the GATA motif
at -65 of the ß-B(4.8)-subunit promoter were also evidently
increased (Fig. 9
, lane 9, and Fig. 10
, lanes 6 and 11). The bindings
were decreased by the addition of excess nonradiolabeled
GATA-containing oligonucleotide, wGATA (Fig. 9
, lane 10, and Fig. 10
, lanes 78 and 1213). In addition, the supershifted bands
resulting from formation of an immunocomplex with antibodies
against GATA-binding proteins were also markedly increased (Fig. 9
, lane 11, and Fig. 10
, lanes 9 and 14).
The dose-dependent effect of GATA-1 and GATA-4 proteins on the binding
to the GATA motif at -65 of the ß-B(4.8)-subunit promoter was
demonstrated in Fig. 11
. Nuclear
extracts were prepared from MA-10 cells that were transfected with
different amounts of GATA-1 and GATA-4 expression plasmids to
overexpress various concentrations of these two proteins. Analysis of
their bindings to the ß-B(4.8)-subunit promoter DNA revealed that a
dose-dependent increase in the binding of GATA-1 (lanes 24) and
GATA-4 (lanes 57) proteins to the GATA motif was observed.
Furthermore, as shown in Fig. 5
, cotransfection of MA-10 cells with a
combination of both GATA-1 and GATA-4 expression plasmids also resulted
in an additive increase in their bindings to the GATA motif by the two
nuclear proteins (lanes 28).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-subunit gene in
testicular cells (16). In this study, we demonstrated that another
inhibin/activin subunit gene promoter, the ß-B(4.8)-subunit promoter,
was also up-regulated by GATA-binding proteins, GATA-1 and GATA-4. Our
observations suggested that GATA-1 transactivates both
- and
ß-B(4.8)-subunit promoters through interaction with GATA motifs in
their basal promoters, -147 and -114 in
-subunit (16), and -65 in
ß-B(4.8)-subunit promoter. GATA-4 selectively up-regulates
ß-B(4.8)- subunit, but not
-subunit, gene transcription. The
effect of GATA-4 to transactivate the ß-B(4.8)-subunit promoter was
generally lower than that of GATA-1. Both GATA-binding proteins
transactivate inhibin/activin subunit gene promoters in a
dose-dependent manner (16) (Fig. 5
The transactivation of the ß-B(4.8)-subunit promoter by GATA-1 and
GATA-4 was observed in two testicular cell lines, MA-10 and MSC-1,
which were derived from different cell types, Leydig and Sertoli,
respectively. Both cell lines express genes encoding inhibin and
activin subunits (41, 42, 43) and GATA-1 and GATA-4 (16) (Fig. 3
), although
MSC-1 cells produce low levels of GATA-binding proteins and inhibin
-subunit mRNA. The endogenous levels of GATA-1 and GATA-4 mRNAs
(Fig. 3
, AC) and proteins (Fig. 3E
) were much lower in MSC-1 cells.
Thus, the greater effects of exogenous GATA-1 and GATA-4 on the
ß-B(4.8)-subunit promoter activity in MSC-1 cells (Fig. 4) as
compared with MA-10 cells (Fig. 2
) may probably be due to the lower
endogenous levels of these proteins.
The mechanism by which GATA-4 elevates the ß-B(4.8)-subunit promoter activity is less clear, based on our mutation analysis of GATA and GATA-like sequences. In MSC-1 cells, mutation of the GATA motif reduced the transactivation effect of GATA-4, suggesting that GATA-4 interacts with the GATA motif to up-regulate ß-B(4.8)-subunit promoter activity. However, a less evident effect caused by mutation of this motif was observed in MA-10 cells. GATA-4 was also shown to transactivate other testis-expressing genes through GATA motifs (17, 18, 44). In Müllerian-inhibiting substance gene, GATA-4 enhances its promoter activity through a protein-protein interaction with a nuclear receptor SF-1 (17, 44). Whether GATA-4 interacts with other nuclear factor(s) to activate ß-B(4.8)-subunit gene transcription in testicular cells is currently under investigation.
Although GATA-1 was shown to transactivate both
- and
ß-B(4.8)-subunit gene promoters through GATA motifs in testicular
cell lines, differences were observed in the mechanisms by which GATA-1
up-regulates these genes. Mutation of GATA sequences markedly
suppressed the transactivation effect of GATA-1 on both
- and
ß-B(4.8)-subunit promoter activities. Mutation of this motif also
evidently decreased the basal transcription of the
-subunit gene
(16), but only caused a small effect on the ß-B(4.8)-subunit promoter
(Figs. 7
and 8
). Furthermore, deletion analysis (Figs. 14
and 15
)
revealed that progressive removal from the 5'-end of the
ß-B(4.8)-subunit promoter DNA markedly increased the transactivation
effect of GATA-1 on this promoter, suggesting that GATA-1 may, directly
or indirectly through other protein factor(s), interact with DNA
sequences at the region of -180 to -90 to negatively regulate
ß-B(4.8)-subunit gene transcription. Since no consensus GATA or
GATA-like sequence was identified at the -180 to -90 region of the
ß-B(4.8)-subunit basal promoter, it is likely that GATA-1 interacts
with other protein factor(s) that bind to the DNA sequence in this
region to regulate ß-B(4.8)-subunit gene transcription. These
observations are quite different from those found in the
-subunit
promoter, where deletion of the region containing either the 5'- or
3'-GATA motif resulted in drastic suppression of both basal and GATA-1-
induced transcription of
-subunit gene (Z.-M. Feng and
C.-L. C. Chen, unpublished results).
One of the possible explanations for the differences found in the
transactivation of
- and ß-B(4.8)-subunit genes by GATA-1 is that
GATA-1 interacts with different protein factors to regulate these
promoters. At least three major shifted bands were observed binding to
the -77 to -53 GATA-containing region of the ß-B(4.8)-subunit
promoter in both MA-10 (Fig. 9
) and MSC-1 (Fig. 10
) cells. Nucleotide
sequence analysis revealed that putative binding sites for
transcription factors other than GATA-binding proteins, such as NF-1
and Sp1, were also identified in this region (36, 37). Whether these
factors play any role in regulating ß-B(4.8)-subunit promoter
activity is not clear at the present time. The binding sites for CREB
[cAMP response element (CRE)-binding protein] and SF-1 nuclear
factors were located within the two GATA motifs of the
-subunit
basal promoter and were involved in the cAMP-regulated transcription of
the
-subunit gene in ovarian cells (45). In addition, mutation
analysis revealed that CRE sequence is also required for the basal
transcription of
-subunit gene in granulosa cells (46). GATA-1 was
shown to interact with many protein factors including SF-1 (44),
CREB-binding protein (47), and Sp1 (48) to positively or
negatively regulate specific gene transcription. Whether GATA-1
interacts with these nuclear factors to regulate
- and
ß-B(4.8)-subunit promoter activities is currently under investigation
in our laboratory.
Members of the GATA-binding protein family were shown to recognize a consensus sequence derived from regulatory elements in erythroid cell-specific genes, (A/T)GATA(A/G). Analysis of DNA-binding specificity of each GATA-binding protein further suggested a greater flexibility of the recognition sites, i.e. the GAT consensus derivations, for these transcription factors (49, 50, 51). For instance, mGATA-1 protein binds to GATA variants, GAT(A/G/T), while GATA-2 and GATA-3 recognize the GATC site. The possibility of GATA-1 and/or GATA-4 interacting with GATA variants, or GATA-like sequences, in the ß-B(4.8)-subunit basal promoter was thus investigated. Our results indicated that, in addition to the GATA motif at -65, both GATA-1 and GATA-4 interacted with a GATA-like sequence, GATT at -42, to regulate ß-B(4.8)-subunit promoter activity. However, neither of these factors interacted with GATT at -177 or GATC at -201 in the ß-B(4.8)-subunit promoter. The ability of GATA-1 and GATA-4 to interact with GATT at -42 and not GATT at -177 demonstrated the binding specificity of these proteins to the DNA sequences flanking the GAT core motif (AGATTG at -42 and GGATTC at -177).
GATA-binding proteins exert a dual function, acting either as an
activator or as a repressor depending on the location or the structure
of the binding site, in the regulation of GATA-containing gene
promoters, such as globins and rat platelet factor (PF4) (48, 49, 52).
In rat PF4 promoter, GATA-1 binds to the GATA site at -31 and
represses its gene expression. However, GATA-binding protein and/or its
cofactor may also bind to the upstream GATA site at -134 and activate
the transcription of PF4 gene (52). The steric interference of
preinitiation complex formation by GATA-1 and GATA-2 factors was
observed at the -31 GATA site in the core promoter of rat PF4 gene
(52). Similar observations were found in ß-B(4.8)-subunit promoter
(Figs. 7
and 8
). We showed that GATA-1 and GATA-4 factors
transactivated ß-B(4.8)-subunit promoter through binding to the GATA
motif at -65, while the two factors suppressed this promoter activity
by interaction with GATT sequence at -42. Whether a similar repression
mechanism observed in the PF4 gene applies to the ß-B(4.8)-subunit
promoter is of interest to study. The possibility of the steric
interference of GATA-binding proteins on GATT at -42 in the regulation
of the ß-B(4.8)-subunit promoter is currently under investigation. In
addition, the possible physiological relevance of the suppressor
mechanism is also being examined.
The expressions of GATA-1 and GATA-4 genes were developmentally
regulated in the testis of mouse and rat (13, 14, 15, 17, 18, 24). Both
GATA-1 and GATA-4 proteins and mRNAs were present in high levels in
immature testis. Maximal expression was observed in 14- to
21-day-old testis for GATA-1 (13, 14, 15, 24) and in 1- to 7-day-old
testis for GATA-4 (17, 18, 24). Similar results were previously
observed in the testicular inhibin/activin
- and ß-B-subunit genes
(20, 21, 22, 23, 26). Both GATA-binding proteins and inhibin/activin subunit
genes are predominantly expressed in Sertoli cells and are also
expressed in Leydig cells and tumor cell lines derived from Sertoli and
Leydig cells (13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 26). Our recent findings that GATA-1
protein transactivates both inhibin/activin
- and ß-B-subunit gene
promoters in Sertoli and Leydig tumor cell lines suggest that the
developmental regulation of the expression of GATA-1 in the testis may
be one of the important factors involved in controlling the testicular
production of inhibin B. Furthermore, the new demonstration of the
selective effect of GATA-4 on the transactivation of the
ß-B(4.8)-subunit gene promoter and the observation of the maximal
expression of GATA-4 and ß-B-subunit genes in 1- to 7-day-old testis
(17, 18, 24, 26) also suggest that the age-dependent regulation of
GATA-4 expression in the testis may play a role in modulating the
production of activin protein in the testis. Further investigation to
clarify these possibilities is in progress in our laboratory.
In summary, we provide new information that two GATA-binding proteins,
GATA-1 and GATA-4, which are expressed in the testis, play important
roles in regulating the transcription of inhibin and activin subunit
genes in testicular cells via complicated mechanisms. Both GATA-1 and
GATA-4 act through the GATA motif at -65 and GATT at -42 to
up-regulate and down-regulate the promoter activity of the
ß-B(4.8)-subunit gene, respectively. GATA-1, using similar mechanisms
but with differences, transactivates both
- and ß-B(4.8)-subunit
gene promoters through interaction with GATA motif. In addition, GATA-1
may interact with DNA sequences at -180 to -90 to regulate the
ß-B(4.8)-subunit gene promoter. The mechanisms by which these
GATA-binding proteins transactivate inhibin/activin subunit gene
transcription in testicular cells are currently under investigation in
our laboratory. The observations obtained from our studies may provide
new insight into the actions of GATA-binding proteins on the production
of inhibin and activin proteins in the testis.
| MATERALS AND METHODS |
|---|
|
|
|---|
Identification of GATA-1 mRNA by RT-PCR
The RT-PCR was carried out as described (16, 37) using Titan One
Tube RT/PCR Kit (Roche Molecular Biochemicals,
Indianapolis, IN). Briefly, reverse transcription was performed using 2
µg each total RNA isolated from tissues or cultured cells, 1
µM each primer, 5 mM dithiothreitol, and 1
µl enzyme mixture containing reverse transcriptase and Taq
DNA polymerase at 52 C for 30 min. After denaturing at 94 C for 2 min,
the cDNAs were amplified 30 cycles by PCR at 94 C for 30 sec, 52 C for
30 sec, and 68 C for 90 sec in each amplification cycle. Forward primer
(CCCATGGATTTTCCTGGTC, 19-mer) from translation initiation codon and
reverse primer (TCCACAGTTCACACACTCTCTGGC, 24-mer) containing a sequence
complementary to amino acids 201209 of the zinc finger domain of
mGATA-1 gene (6) were used for the analysis of GATA-1 mRNA by RT-PCR
(16). An aliquot of the RT-PCR-generated products was subjected to
agarose gel electrophoresis followed by transfer to Nytran membrane.
GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1
cDNA probe (16). The levels of total RNA used in each sample were
further quantified by measurement of glyceraldehyde-3-phosphate
dehydrogenase (G3PDH) mRNA levels by the RT-PCR method. The primers
used for analysis of G3PDH mRNA, forward primer ACCACAGTCCATGCCATCAC,
and reverse primer TCCACCACCCTGTTGCTG, were purchased from
CLONTECH Laboratories, Inc. (Palo Alto, CA).
Preparation of Deletion Constructs
Deletion constructs were made using Erase-a-Base System
(Promega Corp., Madison, WI) as described previously (37, 53). A CAT construct containing the promoter DNA from -3,600 to +67 of
the ß-B(4.8)promoter, pßB4.8(-3600)CAT, was linearized by digestion
with KpnI and BamHI and was used to generate
deletion mutants from the 5'-end by Exonuclease III. At various time
points, aliquots of nuclease-digests were collected. After treatment
with Klenow and DNA ligase, the deletion plasmids with different
lengths of the ß-B(4.8)promoter were transformed into
Escherichia. coli. The deletions of these plasmids were
confirmed by DNA sequences analysis.
Preparation of Mutation Constructs
Mutations of GATA motif and GATA-like GATT and GATC motifs were
performed in pßB4.8(-226/+67)CAT using 1) Transform Site-Directed
Mutagenesis Kit (CLONTECH Laboratories, Inc.) or 2)
GeneEditor in vitro Site-Directed Mutagenesis System
(Promega Corp.). In 1) the selection primer, TransOligo
NdeI/NcoI, and one or two GATA-, GATC-, or
GATT-mutated primers were annealed to the denatured plasmid
pßB4.8(-226/+67)CAT. After elongation and ligation of the mutant
DNA, the plasmid DNA mixture was transformed into a strain of E.
coli, mutS, which is defective in mismatch repair. Clones with
mutated sequences were identified by digestion with NcoI and
further confirmed by sequence analysis of their mutations. In 2) the
selection oligonucleotide and the mutagenic oligonucleotide(s) were
annealed to target DNA template, pßB4.8(-226/+67)CAT, and the mutant
strand DNA was synthesized and ligated. The heteroduplex DNA was then
transformed into a repair minus E. coli strain, BMH7118
mutS, grown in selective media containing the novel GeneEditor
Antibiotics. Plasmids resistant to antibiotics were isolated and
transformed again into the final host strain, JM 109.
Procedure of DNA Transfection and CAT Assay
MA-10 cells, a clonal strain of cultured mouse Leydig tumor
cells, were provided by Dr. Mario Ascoli (University of Iowa, Iowa
City, IA) (54) and were cultured and maintained as described previously
(16, 55). The procedure for transfection of plasmid DNA into MA-10
cells was described previously (16, 37, 53). MA-10 cells were
plated at a density of 1.2 x 106
cells per 100-mm petri dish the day before transfection. The
purified plasmid DNA was introduced into cells by the calcium phosphate
precipitation method (56). Each precipitate DNA contained 16 µg of
test plasmid and 2 µg of pAct/LacZ plasmid containing actin promoter
and ß-galactosidase to monitor transfection efficiency. Five hours
after precipitate was added, the cells were shocked with 15% glycerol
for 2 min and harvested 48 h later.
MSC-1 cells, a mouse Sertoli tumor cell line provided by Dr. Michael Griswold (Washington State University, Pullman, WA) (41, 42), were plated at 0.5 x 106 cells per 60-mm dish. One day later, transfection was performed by using the liposome DC-chol:DOPE method as described by M. J. Campbell (57). Each precipitate contained 4 µg of test plasmid and 0.6 µg pAct/LacZ plasmid. In some cases, MSC-1 cells were transfected by the calcium phosphate precipitation method using the same amount of DNA as described above. The cells were harvested 48 h after transfection.
For cotransfection studies, ßB(4.8)CAT plasmids (37) containing
normal or mutated sequences at GATA, GATT, or GATC motif, and
A
BstCAT plasmid containing a rat inhibin
-subunit basal promoter
DNA from -163 to +65 bp (16, 53) were coprecipitated with cDNA
expression plasmids encoding GATA-binding proteins. The precipitates
were then transfected into MA-10 or MSC-1 cells. Expression plasmids
containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (6) and
GATA-4 (pMT2-mGATA-4) (10) were provided by Dr. Stuart Orkin (Harvard
Medical School, Boston, MA) and Dr. David Wilson (Washington
University, St. Louis, MO), respectively. Promoterless CAT construct
(A0CAT), and pXM and pMT2 expression vectors without cDNA inserts were
included as negative controls for
- or ß-CAT constructs and
mGATA-1 and mGATA-4, respectively (16).
Cell lysates were prepared by repeated freezing in a dry ice/ethanol bath and thawing at 37 C for 5 min each from the transfected MA-10 and MSC-1 cells and were used for measurements of protein concentration (58) and the activities of ß-galactosidase and CAT as described previously (16, 37, 53). Four micrograms each of cellular protein were applied for the measurement of ß-galactosidase activity (59, 60), using chlorophenol red-p-D-galactopyranoside (CPRG) as a substrate. One hundred micrograms each of the heated cellular protein were employed for the measurement of CAT activity using a diffusion method with 3H-acetyl coenzyme A (200 mCi/mmol and 0.5 mCi/ml, NEN Life Science Products, Boston, MA) (61, 62). The CAT activity was then normalized to the activity of ß-galactosidase.
Preparation of Nuclear Extracts
Nuclear extracts were prepared from MA-10 or MSC-1 cells using
the procedure described previously (63). Cell pellets were suspended in
hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM
KCl, 1.5 mM MgCl2, 0.2 mM
phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol)
at 400 µl/dish for 10 min on ice. Nuclear proteins were extracted
from the swollen cells in a buffer, 20 µl/dish, similar to the above
hypotonic buffer except that 420 mM KCI and 25% glycerol
were included. Aliquots of nuclear extracts were stored at -70 C until
use.
Western Blot Analysis
Nuclear extracts prepared from testicular cell lines were
subjected to SDS-PAGE using a 10% polyacrylamide gel. After
transferring the nuclear proteins onto Immun-Blot polyvinylidene
fluoride (PVDF) membrane (Bio-Rad Laboratories, Inc. Hercules, CA), the membrane was placed in a solution
containing 3% nonfat milk in TBS (10 mM Tris·HCl, pH
8.0, 150 mM NaCl, and 0.05% Tween-20) at 4 C overnight.
GATA-1 and GATA-4 proteins on the membrane were identified by
incubation with anti-GATA-1 and anti-GATA-4 antiserum, respectively, at
1:100 to 1:300 dilution (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) for 60 min at room temperature and then alkaline
phosphatase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:2,000 dilution for 45 min at room
temperature and were visualized using BCIP/NBI
(5-bromo-4-chloro-3-indoyl phosphate p-toluidine salt and
p-nitro blue tetrazolium chloride) (Bio-Rad Laboratories, Inc.).
EMSA
EMSA was performed as described previously (16) by incubation of
nuclear extracts (0.53 µg) prepared from MA-10 or MSC-1 cells with
radiolabeled double-stranded oligonucleotides or DNA fragments, and 1
µg of poly(dI/dC) as a nonspecific competitor. The binding reactions
were performed at room temperature for 30 min and on ice for another 30
min. Specific DNA competitors or antisera were added to the reactions
as indicated. Antiserum against mGATA-1 or mGATA-4 protein (purchased
from Santa Cruz Biotechnology, Inc.) was added before the
incubation for 30 min on ice. For competition analysis, excess of
nonradiolabeled double-stranded oligonucleotides containing GATA
motif(s) or the mutated sequences was added along with radiolabeled
oligonucleotide probes to the reaction mixtures. The binding reactions
were analyzed on 6% or 7% polyacrylamide gel as described (16, 52).
Double-stranded oligonucleotides containing GATA or GATA-like sequences
from different regions of the ß-B(4.8)-subunit promoter were
radiolabeled with [
-32P]ATP and T4
polynucleotide kinase for binding analysis. These DNA fragments
included -77 to -53 containing GATA at -65, -77/-53; -52 to -31
containing GATT at -42, -52/-31; -229 to -187 containing GATC
motif at -201, -229/-187; and -186 to -142 containing GATT at
-177, -186/-142. Nonradiolabeled oligonucleotides used for
competition analysis included a 20-mer from mGATA-1 gene, wGATA
(GTCCATCTGATAAGACTTAT)(3), DNA fragments from various regions of the
ß-B(4.8)-subunit promoter, and m(-42) containing -52 to -31
fragment with mutation of GATT motif at -42 to CTTT.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This research was supported by NICHD/NIH through cooperative agreement [U54(HD-13541)] as part of the Specialized Cooperative Centers Program in Reproduction Research, and by NIDDK/NIH DK-34449 (to C.-L.C). Z. Zhang was partially supported by a Dewitt Wallace Fellowship.
1 Current address: Research Institute of Sericulture, Chinese Academy
of Agricultural Sciences, Zhenjiang City, Jian Su, Peoples Republic
of China. ![]()
Received for publication February 8, 2000. Revision received July 24, 2000. Accepted for publication August 4, 2000.
| REFERENCES |
|---|
|
|
|---|
-subunit gene
in MA-10 Leydig tumor cells. Mol Endocrinol 12:378390
-subunit gene in
vivo and in vitro. Mol Endocrinol 3:2935
and ß-B subunits during the
cycle of the rat seminiferous epithelium. Endocrinology 124:987991
-promoter by steroidogenic
factor-1, cyclic adenosine 3',5'-monophosphate. Mol Endocrinol 14:6681
inhibin gene by cyclic adenosine
3',5'-monophosphate after transfection into rat granulosa cells. Mol
Endocrinol 5:521534
-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:3947This article has been cited by other articles:
![]() |
I. Qamar, E. Park, E.-Y. Gong, H. J. Lee, and K. Lee ARR19 (Androgen Receptor Corepressor of 19 kDa), an Antisteroidogenic Factor, Is Regulated by GATA-1 in Testicular Leydig Cells J. Biol. Chem., July 3, 2009; 284(27): 18021 - 18032. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Looyenga and G. D. Hammer Origin and Identity of Adrenocortical Tumors in Inhibin Knockout Mice: Implications for Cellular Plasticity in the Adrenal Cortex Mol. Endocrinol., November 1, 2006; 20(11): 2848 - 2863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Anttonen, H Parviainen, A Kyronlahti, M Bielinska, D B Wilson, O Ritvos, and M Heikinheimo GATA-4 is a granulosa cell factor employed in inhibin-{alpha} activation by the TGF-{beta} pathway. J. Mol. Endocrinol., June 1, 2006; 36(3): 557 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse. Vet. Pathol., February 1, 2006; 43(2): 97 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Okuma, A E O'Connor, J A Muir, P G Stanton, D M de Kretser, and M P Hedger Regulation of activin A and inhibin B secretion by inflammatory mediators in adult rat Sertoli cell cultures J. Endocrinol., October 1, 2005; 187(1): 125 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jarvis, D. J. Elliott, D. Morgan, R. Winston, and C. Readhead Molecular markers for the assessment of postnatal male germ cell development in the mouse Hum. Reprod., January 1, 2005; 20(1): 108 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology J Androl, July 1, 2004; 25(4): 441 - 452. [Full Text] [PDF] |
||||
![]() |
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein J Androl, July 1, 2004; 25(4): 479 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. LaVoie The Role of GATA in Mammalian Reproduction Experimental Biology and Medicine, December 1, 2003; 228(11): 1282 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lindeboom, N. Gillemans, A. Karis, M. Jaegle, D. Meijer, F. Grosveld, and S. Philipsen A tissue-specific knockout reveals that Gata1 is not essential for Sertoli cell function in the mouse Nucleic Acids Res., September 15, 2003; 31(18): 5405 - 5412. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ketola, J. Toppari, T. Vaskivuo, R. Herva, J. S. Tapanainen, and M. Heikinheimo Transcription Factor GATA-6, Cell Proliferation, Apoptosis, and Apoptosis-Related Proteins Bcl-2 and Bax in Human Fetal Testis J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1858 - 1865. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Cheng, C. H. Cheung, and W. M. Lee Mouse Testin: Complementary DNA Cloning, Genomic Organization, and Characterization of Its Proximal Promoter Region Biol Reprod, April 1, 2003; 68(4): 1376 - 1386. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Anttonen, I. Ketola, H. Parviainen, A.-K. Pusa, and M. Heikinheimo FOG-2 and GATA-4 Are Coexpressed in the Mouse Ovary and Can Modulate Mullerian-Inhibiting Substance Expression Biol Reprod, April 1, 2003; 68(4): 1333 - 1340. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, A. Z. Wu, Z.-M. Feng, D. Mruk, C. Y. Cheng, and C.-L. C. Chen Gonadotropins, via cAMP, Negatively Regulate GATA-1 Gene Expression in Testicular Cells Endocrinology, March 1, 2002; 143(3): 829 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells Am. J. Pathol., January 1, 2002; 160(1): 369 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Hales Editorial: Gonadal-Specific Transcription Factors--GATA (Go) 4 It! Endocrinology, March 1, 2001; 142(3): 974 - 976. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |