help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Molecular Endocrinology 14 (11): 1820-1835
Copyright © 2000 by The Endocrine Society

GATA-1 and GATA-4 Transactivate Inhibin/Activin ß-B-Subunit Gene Transcription in Testicular Cells

Zong-Ming Feng, Ai Zhen Wu, Zhifang Zhang1 and Ching-Ling C. Chen

Population Council (Z.-M.F., A.Z.W., C.-L.C.C.) and The Rockefeller University (C.-L.C.C.) New York, New York 10021


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 
We have recently demonstrated that a testicular GATA-binding protein, GATA-1, up-regulates the transcription of inhibin {alpha}-subunit gene through interaction with GATA motifs in the promoter region in MA-10, a mouse Leydig tumor cell line. In this study, we showed that both GATA-1 and GATA-4 also transactivated the transcription from the promoter for the 4.8-kb inhibin/activin ß-B-subunit gene transcripts, ß-B(4.8)-subunit promoter, in two testicular cell lines, MA-10 and MSC-1, which is a mouse Sertoli cell line. The abilities of GATA-1 and GATA-4 interacting with GATA and/or GATA-like sequences to transactivate the ß-B(4.8)-subunit promoter were next examined by mutation analysis. Mutations of GATA or GATA-like sequences caused no apparent effect or only a small decrease in the basal transcriptional activity of this promoter. However, mutation of the GATA motif at -65 markedly decreased 60–70% of the effect of GATA-1 on the transactivation of ß-B(4.8)-subunit promoter in both MA-10 and MSC-1 cells. In addition, mutation of the GATA motif in MSC-1 cells also reduced 40–50% of the effect of GATA-4 to transactivate this promoter. Interestingly, mutation of GATT at -42 caused a 70–90% increase in the transactivation of ß-B(4.8)-subunit promoter by GATA-1 or GATA-4. No significant change in the promoter activity was observed when GATT at -177 or GATC at -201 was mutated. Electrophoretic mobility shift assay confirmed the above observations that these GATA-binding proteins interacted with the GATA motif at -65 and GATT at -42, but not with GATC at -201 or GATT at -177. Serial deletion from the 5'-end of the basal promoter, from -226 to -90, markedly decreased the basal transcription, but increased the effect of GATA-1 on transactivation of the ß-B(4.8)-subunit promoter. In summary, our observations suggest that the two GATA-binding proteins transactivate the ß-B(4.8)-subunit promoter in testicular cells via complicated mechanisms. Both GATA-1 and GATA-4 factors act through the GATA motif at -65 and GATT at -42 to positively and negatively regulate the transcription from this promoter, respectively. Furthermore, GATA-1 may also interact directly or indirectly with DNA sequences at -180 to -90 to regulate the ß-B(4.8)-subunit promoter.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 
Members of the GATA-binding protein family recognize a consensus sequence (T/A)GATA(A/G) and share conserved zinc fingers in their DNA-binding domains. The expression of each GATA-binding protein is, however, tissue specific (1, 2, 3). GATA-1 was originally considered as a transcription factor exclusively for the globin genes and other erythroid lineage-specific genes (4, 5, 6, 7). GATA-2, in addition to erythroid cells, was expressed in chicken embryonic brain, liver, and cardiac muscle (1) and human endothelial cells (8). GATA-3 was identified in many tissues, including definitive erythrocytes, T lymphocytes, embryonic tissues, and placenta (1, 9). GATA-4, GATA-5, and GATA-6 factors were predominantly observed in the heart, intestine, and gut (10, 11, 12). In gonads, GATA-1, GATA-4, and GATA-6 were identified in the testis (10, 11, 13, 14, 15, 16, 17, 18), and GATA-4 and GATA-6 were also detected in the ovary (10, 11, 17, 19). The mouse testicular GATA-1 mRNA was shown to be transcribed from a testis-specific promoter, which is 8 kb upstream from that in erythroid cells. The remaining exons that encode the GATA-1 protein are commonly used by both testis and erythroid transcripts (13, 15, 16). The immunoreactive GATA-1 protein detected in mouse Sertoli cells occurred in an age- and spermatogenic cycle-specific manner (13, 14), a pattern that is similar to that previously observed for testicular inhibin/activin {alpha}- and ß-B-subunit genes (20, 21, 22, 23). Since GATA-1 and GATA-4 are expressed in testicular cells of mouse and rat, including Sertoli and Leydig cells, and Leydig tumor cell lines, such as MA-10 cells (13, 14, 15, 16, 17, 18, 24), we have investigated the possible actions of GATA-1 and GATA-4 in controlling the expression of inhibin and activin subunit genes in testicular cells.

Inhibins and activins have been characterized as dimeric glycoproteins sharing a common subunit linked by disulfide bonds. Inhibin contains an inhibin-specific {alpha}-subunit and one of the closely related ß-subunits, ß-A and ß-B, whereas activin is a homo- or heterodimer of the two ß-subunits. The two ß- subunits were shown to be members of the transforming growth factor (TGF-ß) superfamily. The mRNAs and genes encoding inhibin and activin subunits were isolated and characterized from many species (for reviews, see Refs. 16, 25, 26, 27, 28). cDNAs encoding other new ß-subunits, ß-C (29, 30, 31), ß-E (32, 33), and ß-D (34), were recently isolated. All inhibin and activin subunit genes contain one intron within their precursor region, except the ß-A-subunit gene, which contains two introns (27, 35). The two species (4.8 and 3.7 kb) of the ß-B-subunit mRNAs are derived from transcription at different initiation sites (36, 37).

The promoter regions required for maximal basal transcription of the inhibin/activin subunit genes in testicular and ovarian cells were determined by transient transfection studies (for reviews, see Refs. 16, 27). We have shown that the promoter required for the transcription of rat inhibin {alpha}-subunit gene in MA-10 cells depends upon a 67-bp DNA fragment at -163 to -96, in which two GATA motifs were identified. Furthermore, our recent new findings revealed that the basal transcription of {alpha}-subunit gene in MA-10 cells is up-regulated selectively by testicular GATA-1, but not GATA-4, through interaction with the GATA motifs in the promoter (16). The promoters required for the expression of the 3.7-kb ß-B-subunit mRNA, referred to as ß-B(3.7)-subunit promoter, and the 4.8-kb ß-B-subunit mRNA, referred to as ß-B(4.8)-subunit promoter, were mapped to regions of -139 to +60 and -409 to +67 from their corresponding transcription initiation sites (37). The ß-B(3.7)-subunit promoter is highly GC rich with several Spl binding sites, while the ß-B(4.8)-subunit promoter is not GC rich but contains one Spl site and many potential recognition sites for GATA-binding proteins, including GATA motif and GATA-like sequences such as GATT and GATC (37). The ß-B(3.7) promoter, which lacks GATA motifs, cannot be transactivated by either of these GATA-binding proteins (16). In this study, we investigated the possibility that GATA-1 and GATA-4 interact with the GATA and GATA-like motifs identified in the ß-B(4.8)-subunit promoter to regulate its transcription in testicular cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 
Transactivation of ß-B(4.8)-Subunit Promoter by GATA-1 and GATA-4 Factors in Testicular Cells
We have previously shown that a DNA fragment at -409 to +67 from the transcription initiation site for the 4.8-kb ß-B-subunit mRNA exerts high transcriptional activity, as analyzed by its ability to induce transient expression of the chloramphenicol acetyltransferase (CAT) gene in MA-10 cells (37). Using the same approach, the basal promoter for the 4.8-kb ß-B- subunit gene transcripts was further analyzed. As shown in Fig. 1Go, deletion mutation from its 5'-end revealed that the -226 to +67 bp DNA fragment reproducibly induced maximal CAT activity within the 3.6-kb 5'-flanking DNA examined. Further deletion from -226 to -90 markedly decreased CAT activity, suggesting that the promoter required for the production of maximal levels of 4.8-kb ß-B-subunit gene transcripts resides within this region. Since GATA motif at -65 and several GATA-like sequences, such as GATT at -177 and -42 and GATC at -201, were identified in this region, the -226/+67 promoter DNA was used for the studies described below on the transactivation of the ß-B(4.8)-subunit promoter by GATA-binding proteins.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Identification of the Basal Promoter for the 4.8-kb ß-B-Subunit Transcripts by Deletion Analysis

Left panel shows the ß-B(4.8)CAT constructs used for transfection into MA-10 cells that contain varied lengths of ß-B(4.8)-subunit promoter DNA prepared by serial deletions from its 5'-end. Right panel shows the CAT activity that is normalized to ß-galactosidase activity for transfection efficiency. The effect of deletion on ß-B(4.8)-subunit promoter activity was expressed as percent (mean ± SEM) relative to the CAT activity observed with ß-B(4.8)(-226/+67)CAT (designated as 100%), which exerts maximal CAT activity.

 
The ability of GATA-binding proteins to transactivate the ß-B(4.8)-subunit promoter in MA-10 cells (Fig. 2BGo) was examined by cotransfection of a CAT construct driven by the ß-B(4.8)-subunit promoter containing a -226 to +67 region with a cDNA expression plasmid encoding a GATA-binding protein as described previously for studies of {alpha}-subunit promoter (16) (Fig. 2AGo). CAT activity driven by the ß-B(4.8)-subunit promoter was increased approximately 5-fold by cotransfection with mGATA-1 and 3-fold with mGATA-4 expression plasmid (Fig. 2BGo). The observation of the transactivation of the ß-B(4.8)-subunit promoter by both GATA-1 and GATA-4 nuclear factors in MA-10 cells is different from that previously reported for the {alpha}-subunit promoter (16), which can be regulated only by GATA-1 and not by GATA-4 protein (Fig. 2AGo).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Transactivation of ß-B(4.8)- and {alpha}-Subunit Gene Promoter by GATA-1 and GATA-4 in MA-10 Cells

CAT constructs (16 µg each in 100-mm dish) containing {alpha}-subunit basal promoter at -163 to +65 region, A{alpha}BstCAT (16 ) (panel A), and ß-B(4.8)-subunit basal promoter DNA at -226 to +67 bp, ß B(-226)CAT (panel B), as described in Fig. 1Go were cotransfected with 5 µg each of cDNA expression plasmid encoding GATA-1 or GATA-4 into MA-10 cells. The change in normalized CAT activity by cotransfection with GATA-binding protein cDNA was expressed as percent (mean ± SEM) relative to the CAT activity in the cells cotransfected with an expression vector without cDNA insert, pXM, or pMT2 (designated as 100%).

 
Sertoli cells were shown to be the predominant site of expression of inhibins and activins (for reviews, see Refs. 26, 27, 38, 39, 40) and GATA-1 and GATA-4 (13, 14, 17, 18) in the testis. The possible role of GATA-binding proteins in the regulation of inhibin and activin subunit gene expression in Sertoli cells was thus studied in a mouse Sertoli cell line, MSC-1, which displays features characteristic of normal Sertoli cells and expresses inhibin and activin subunit genes (41, 42). Low levels of {alpha}-subunit mRNA were detected in MSC-1 cells. However, similar to that observed in normal Sertoli cells (21), the 4.8- and 3.7-kb inhibin/activin ß-B-subunit mRNAs were found in the MSC-1 cell line.

The expression of GATA-1 and GATA-4 genes in MSC-1 cells was examined by Northern blot analysis and RT-PCR (Fig. 3Go). As reported previously (16), both GATA-1 and GATA-4 mRNAs were observed in 21-day-old rat testis and MA-10 cells (Fig. 3Go, A and B). In MSC-1 cells, GATA-4 mRNA could be detected, but in a level much lower than that observed in rat testis or MA-10 cells. The expression of GATA-1 gene in MSC-1 cells was too low to be detected by Northern blot analysis (Fig. 3AGo); however, it could be observed by the RT-PCR method (Fig. 3CGo). Using primers described previously (16), GATA-1 mRNA was detected in 21-day-old rat testis and in MA-10 and MSC-1 cells, although the levels in MSC-1 cells were low.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3. Analysis of GATA-1 and GATA-4 mRNA and Protein in Testicular Cells

GATA-1 and GATA-4 mRNA (A–D) and protein (E) in MA-10 and MSC-1 cells were analyzed. Twenty micrograms each of total RNA were subjected to Northern blot analysis of GATA-1 (A) and GATA-4 (B) mRNA. Two micrograms each of total RNA were employed for the analysis of GATA-1 (C) and G3PDH (D) mRNA by RT-PCR as described previously (16 ). In A–D, lanes 1–3 are total RNA isolated from 21-day-old rat testis, MA-10, and MSC-1 cells, respectively. The exposure time for the autoradiogram was 4 days in panel A, 1 day in panel B, 35 min in panel C, and 10 min in panel D. In panel E, 15 µg each of nuclear proteins were applied for Western blot analysis of the endogenous and overexpressed GATA-1 (lanes 1–4) and GATA-4 (lanes 5–8) proteins. Nuclear extracts were prepared from MA-10 (lanes 1–2 and 5–6) and MSC-1 (lanes 3–4 and 7–8) cells, which were transfected without (lanes 1, 3, 5 and 7) or with GATA-1 (lanes 2 and 4) or GATA-4 (lanes 6 and 8) expression plasmid.

 
The GATA-1 and GATA-4 proteins in MA-10 and MSC-1 cells were examined by Western blot analysis (Fig. 3EGo). Similar to those described above in the mRNA levels, the endogenous GATA-1 and GATA-4 proteins were present in much higher levels in MA-10 cells (Fig. 3EGo, lanes 1 and 5) than in MSC-1 cells (lanes 3 and 7), respectively. Very weak signals of GATA-1 and GATA-4 proteins were detected in MSC-1 cells. Transfection of GATA-1 and GATA-4 cDNA expression plasmids into MA-10 and MSC-1 cells markedly increased the production of GATA-1 (lanes 2 and 4) and GATA-4 (lanes 6 and 8) proteins in both cell lines.

Our observations in Fig. 2Go suggested that overexpression of GATA-binding proteins in MA-10 by cotransfection with GATA-1 and GATA-4 expression plasmids resulted in the transactivation of {alpha}- and ß-B(4.8)-subunit promoter activities. Similarly, cotransfection studies in MSC-1 cells (Fig. 4Go) also showed that overexpression of GATA-1 protein transactivated both {alpha}- and ß-B(4.8)-subunit promoters, while GATA-4 protein up-regulated only ß-B(4.8)- subunit gene transcription. Approximately a 9- and 4-fold increase in CAT activity by overexpression of GATA-1 and GATA-4 protein, respectively, was detected in MSC-1 cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Transactivation of {alpha}- and ß-B(4.8)-Subunit Gene Promoter by GATA-1 and GATA-4 in MSC-1 Cells

CAT constructs, 16 µg each, containing {alpha}-subunit basal promoter, A{alpha}BstCAT (16 ) (panel A), and ß-B(4.8)-subunit basal promoter DNA, ßB(-226)CAT (panel B), were cotransfected with 5 µg each of cDNA expression plasmid encoding mGATA-1 or mGATA-4 into MSC-1 cells as described in Fig. 2Go. The change in normalized CAT activity by cotransfection with mGATA-1 or mGATA-4 cDNA was expressed as percent (mean ± SEM) relative to the CAT activity in the cells with cotransfection of pXM or pMT2 (designated as 100%).

 
The transactivation of ß-B(4.8)-subunit promoter by combination of these two GATA-binding proteins was further examined by cotransfection with different amounts of GATA-1 and/or GATA-4 expression plasmid into testicular cells. As shown in Fig. 5Go, both GATA-1 (lanes 2 and 5) and GATA-4 (lanes 3 and 6) transactivated the ß-B(4.8)-subunit promoter in a dose-dependent manner in MA-10 (Fig. 5Go) and MSC-1 (data not shown) cells. Moreover, cotransfection of GATA-1 and GATA-4 expression plasmids at two different doses, 2.5 or 5 µg each, into testicular cells, elevated CAT activity driven by the ß-B(4.8)-subunit promoter activity in an additive fashion (lanes 4 and 7).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Transactivation of ß-B(4.8)-Subunit Gene Promoter by Cotransfection with Both GATA-1 and GATA-4 Expression Plasmids into MA-10 Cells

CAT construct (16 µg) containing the ß-B(4.8)-subunit basal promoter DNA, ßB(-226)CAT, was cotransfected with cDNA expression plasmid encoding mGATA-1 or mGATA-4 or both into MA-10 cells. The change in normalized CAT activity by cotransfection with mGATA-1 and/or mGATA-4 cDNA plasmid was calculated as percent (mean ± SEM) relative to the CAT activity in the cells with cotransfection of pXM and/or pMT2 (designated as 100%).

 
Mutation Analysis of GATA and GATA-Like Motifs in the ß-B(4.8)-Subunit Promoter
To delineate the mechanisms by which GATA-1 and GATA-4 up-regulate the ß-B(4.8)-subunit promoter in testicular cells, the abilities of these GATA-binding proteins interacting with GATA motif and/or GATA-like sequences to transactivate this promoter were examined by mutation analysis. CAT constructs containing mutations of the GATA motif at -65 and/or GATA-like sequence, GATT at -177 and -42 and GATC at -201, in the ß-B(4.8)-subunit promoter were prepared as illustrated in Fig. 6Go. The effects of the mutations of GATA and GATA-like sequences on the basal transcriptional activity and the effects of GATA-1 and GATA-4 on the transactivation of the ß-B(4.8)-subunit promoter in MA-10 and MSC-1 cells were analyzed as shown in Figs. 7Go and 8Go, respectively.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. CAT Constructs Containing Mutations at GATA and GATA-Like Motifs in the ß-B(4.8)-Subunit Basal Promoter Region

Mutations of GATA motif at -65, m1(-65), and m2(-65); GATT sequence at -177, m(-177), and at -42, m(-42); and GATC at -201, m(-201), were prepared from ß-B(4.8)-subunit promoter containing -226 to +67 region as described in Materials and Methods. Mutations at both GATA and GATT motifs were also made, m1(-65)m(-177). These mutated CAT constructs were used for transactivation studies described in Figs. 7Go and 8Go.

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 7. The Effect of Mutations of GATA and GATA-Like Motifs on Basal Transcription (A), Transactivation by GATA-1 (B), and Transactivation by GATA-4 (C) of ß-B(4.8)-Subunit Promoter in MA-10 Cells

CAT constructs containing mutations at GATA, GATT, and GATC motifs as described in Fig. 6Go were cotransfected with expression plasmid without cDNA insert (panel A), with mGATA-1 (panel B), or with mGATA-4 (panel C) cDNA into MA-10 cells. The changes in CAT activity by mutations of GATA and/or GATA-like motifs were expressed as percent (mean ± SEM) relative to CAT activity obtained from cells transfected with unmutated ß-B(4.8)(-226/+67)CAT construct and an expression vector containing no cDNA (designated as 100%).

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 8. The Effect of Mutations of GATA and GATA-Like Motifs on Basal Transcription (A), Transactivation by GATA-1 (B), and Transactivation by GATA-4 (C) of the ß-B(4.8)-Subunit Promoter in the MSC-1 Sertoli Cell Line

CAT constructs containing mutations at GATA and GATT motifs as shown in Fig. 6Go were cotransfected with expression plasmid without cDNA (panel A), with mGATA-1 (panel B), or with mGATA-4 (panel C) cDNA into MSC-1 cells as described above. The changes in CAT activity by mutations of GATA and/or GATA-like motifs were expressed as percent (mean ± SEM) relative to CAT activity obtained from cells transfected with unmutated ß-B(4.8)(-226/+67)CAT construct and an expression vector containing no cDNA (designated as 100%).

 
Effect on Basal Transcription.
We have demonstrated that mutations of one or both of the two GATA motifs in the {alpha}-subunit promoter caused a marked decrease in the basal transcription of this gene (16). Mutation of GATA sequence at -65 of the ß-B(4.8)-subunit promoter also resulted in a reproducible reduction of basal transcriptional activity from this promoter in both MA-10 and MSC-1 cell lines (Figs. 7AGo and 8AGo). The reduction, however, is less evident (20–30%) when compared with that observed in the {alpha}- subunit promoter. Mutation of GATT sequence at -177 or -42 did not apparently affect the basal transcriptional activity from the ß-B(4.8)-subunit promoter in either cell line. A small (15–20%) decrease was observed in MA-10 cells when GATC at -201 was mutated.

Effect on Transactivation by GATA-1 Factor.
The ability of GATA-1 factor interacting with GATA and/or GATA-like motifs to transactivate the ß-B(4.8)-subunit promoter was next examined by cotransfection of mutated CAT constructs (Fig. 6Go) with a cDNA expression plasmid encoding mouse GATA-1 (6) (Figs. 7BGo and 8BGo). GATA-1 increased CAT activity 4- and 8-fold in MA-10 and MSC-1 cells, respectively, when GATA-1 expression plasmid was cotransfected with the unmutated ß-B(4.8)( -226/+67)CAT construct. Mutations of the GATA motif at -65 resulted in a marked decrease (60–70%) in the ability of GATA-1 factor to transactivate the ß-B(4.8)-subunit promoter in both testicular cell lines. Mutation of the GATT sequence at -177 or GATC sequence at -201, however, caused no apparent effect or only a small decrease (10–15%) in the transactivation by GATA-1. Interestingly, mutation of GATT at -42 strikingly elevated the effect of GATA-1 factor on the transactivation of the ß-B(4.8)-subunit promoter. An 8- to 15-fold increase in CAT activity was observed in MA-10 and MSC-1 cells, respectively.

Effect on Transactivation by GATA-4 Factor.
Cotransfection of the normal ß-B(4.8)(-226/+67)CAT construct with mGATA-4 expression plasmid (10) increased CAT activity 2.5- and 4-fold in MA-10 and MSC-1 cells, respectively (Figs. 7CGo and 8CGo). Mutations of GATA motif at -65 caused no apparent effect or only a small decrease (10–20%) in the transactivation of ß-B(4.8)-subunit promoter by GATA-4 factor in MA-10 cells. However, an evident reduction (40–50%) in the transactivation by GATA-4 was detected in MSC-1 cells. These observations suggested that in MSC-1 cells both GATA-1 and GATA-4 interact with the GATA motif at -65 to transactivate the ß-B(4.8)-subunit promoter, while in MA-10 cells it is mainly GATA-1.

Similar to GATA-1 factor, GATA-4 did not interact with GATT at -177 or GATC at -201 since mutation of these sequences did not influence the effect of GATA-4 on the transactivation of the ß-B(4.8)-subunit promoter. Mutation of GATT at -42 again increased the transactivation of this promoter by GATA-4, as those shown above by GATA-1.

Electrophoretic Mobility Shift Assay (EMSA) Analysis of the Interaction of GATA-Binding Proteins with the ß-B(4.8)-Subunit Promoter
Interaction with GATA Motif at -65.
When a radiolabeled DNA fragment prepared from the ß-B(4.8)-subunit promoter at -77 to -53 (-77/-53) containing a GATA motif at -65 was added to the nuclear extracts of MA-10 (Fig. 9Go) or MSC-1 (Fig. 10Go) cells for binding analysis, at least three major shifted bands were observed in both cell lines. After the addition of a nonradiolabeled GATA-containing oligonucleotide, wGATA, which was derived from mouse GATA-1 gene promoter (3), as a competitor, the binding for one of the shifted bands (indicated by a solid arrow) decreased in a dose-dependent manner (Fig. 9Go, lanes 2–5, and Fig. 10Go, lanes 2 and 3). This suggested that the endogenous GATA-binding protein(s) in MA-10 and MSC-1 cells interacts with GATA motif in the ß-B(4.8)-subunit promoter.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 9. EMSA Analysis of the Interaction of GATA-Binding Proteins with GATA Motif in ß-B(4.8)-Subunit Promoter in MA-10 Cells

Nuclear extracts (1 µg each) prepared from MA-10 cells without (lanes 1–8) or with transfection with mGATA-1 expression plasmid (lanes 9–12) were added to radiolabeled oligonucleotide -77/-53 containing ß-B(4.8)-subunit promoter DNA from -77 to -53 with a GATA motif at -65 for binding analysis. Different amounts (25- to 200-fold in excess) of nonradiolabeled GATA-containing oligonucleotide, wGATA (3 ), and antisera raised against GATA-1 and GATA-4 were used for competition of binding. Solid arrows indicate the band containing GATA-binding proteins, and open and hatched arrows indicate the supershifted band by addition of GATA-1 and GATA-4 antiserum, respectively. The exposure time for the autoradiogram was 16 h.

 


View larger version (87K):
[in this window]
[in a new window]
 
Figure 10. EMSA Analysis of the Interaction of GATA-Binding Proteins with the GATA Motif in the ß-B(4.8)-Subunit Promoter in MSC-1 Sertoli Tumor Cells

As described in Fig. 9Go, nuclear extracts (3 µg each) were prepared from MSC-1 cells without (lanes 1–5) or with transfection of a cDNA expression plasmid encoding mGATA-1 (lanes 6–10) or mGATA-4 (lanes 11–15) and were used to analyze the binding activity to a radiolabeled oligonucleotide -77/-53 containing a GATA motif at -65. Nonradiolabeled oligonucleotide wGATA (50- or 100-fold in excess) and antisera against GATA-1 and GATA-4 were included for competition of binding. Solid arrows indicate the band containing GATA-binding proteins, and open and hatched arrows indicate the supershifted bands by addition of GATA-1 and GATA-4 antiserum, respectively. The exposure time for the autoradiogram was 36 h.

 
To determine which GATA-binding protein(s) is responsible for the binding, antibodies raised against GATA-1 and GATA-4 protein were included in EMSA analysis (Fig. 9Go, lanes 6–8, and Fig. 10Go, lanes 4 and 5). A weak further shifted band (indicated by an open arrow) resulting from the formation of immunocomplex was observed in MA-10 cells by the addition of anti-GATA-1 antibody (Fig. 9Go, lane 6). When GATA-4 antibody was added to the MA-10 nuclear extracts (Fig. 9Go, lanes 7 and 8), an intense supershifted band (indicated by a hatched arrow) was observed, which was accompanied by a marked decrease in the intensity of the band binding to GATA (indicated by a solid arrow). A weak supershifted band was also detected when anti-GATA-4 antiserum was added to the MSC-1 extracts (Fig. 10Go, lanes 5 and 10). These observations suggest that both endogenous GATA-1 and GATA-4 proteins interact with the GATA motif at -65.

The endogenous levels of GATA-1 and GATA-4 proteins in MSC-1 cells are quite low as estimated by the weak intensity of the supershifted bands shown in Fig. 10Go and by Western blot analysis (Fig. 3EGo). To compare the bindings of GATA-1 and GATA-4 proteins to the ß-B(4.8)-subunit promoter in two testicular cell lines, nuclear extracts were prepared from MA-10 (Fig. 9Go, lanes 9–12) and MSC-1 (Fig. 10Go, lanes 6–15) cells in which GATA-binding proteins were overexpressed by transfection of the cells with the cDNA expression plasmids. Nuclear extracts were prepared from MA-10 (Fig. 9Go, lanes 9–12) and MSC-1 (Fig. 10Go, lanes 6–15) cells in which GATA-1 or GATA-4 protein was overexpressed by transfection of the cells with the cDNA expression plasmid (6, 10). As shown above in Fig. 3EGo by Western blot analysis, marked increases in GATA-1 and GATA-4 proteins were observed in transfected cells. EMSA studies in Figs. 9Go and 10Go showed that the bindings of the overexpressed GATA-binding proteins to the GATA motif at -65 of the ß-B(4.8)-subunit promoter were also evidently increased (Fig. 9Go, lane 9, and Fig. 10Go, lanes 6 and 11). The bindings were decreased by the addition of excess nonradiolabeled GATA-containing oligonucleotide, wGATA (Fig. 9Go, lane 10, and Fig. 10Go, lanes 7–8 and 12–13). In addition, the supershifted bands resulting from formation of an immunocomplex with antibodies against GATA-binding proteins were also markedly increased (Fig. 9Go, lane 11, and Fig. 10Go, lanes 9 and 14).

The dose-dependent effect of GATA-1 and GATA-4 proteins on the binding to the GATA motif at -65 of the ß-B(4.8)-subunit promoter was demonstrated in Fig. 11Go. Nuclear extracts were prepared from MA-10 cells that were transfected with different amounts of GATA-1 and GATA-4 expression plasmids to overexpress various concentrations of these two proteins. Analysis of their bindings to the ß-B(4.8)-subunit promoter DNA revealed that a dose-dependent increase in the binding of GATA-1 (lanes 2–4) and GATA-4 (lanes 5–7) proteins to the GATA motif was observed. Furthermore, as shown in Fig. 5Go, cotransfection of MA-10 cells with a combination of both GATA-1 and GATA-4 expression plasmids also resulted in an additive increase in their bindings to the GATA motif by the two nuclear proteins (lanes 2–8).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 11. EMSA Analysis of the Dose-Dependent Interaction of GATA-1 and GATA-4 Proteins with the GATA Motif in the ß-B(4.8)-Subunit Promoter

As described in Fig. 9Go, nuclear extracts (1 µg each) were prepared from MA-10 cells that were cotransfected with different amounts of cDNA expression plasmids encoding mGATA-1 and mGATA-4 as indicated and were used to analyze their binding activities to a radiolabeled oligonucleotide -77/-53 containing a GATA motif at -65. Nonradiolabeled oligonucleotide wGATA (200-fold in excess, lane 9) and antiserum against GATA-1 and GATA-4 proteins were included for the competition analysis of the binding (lanes 10–12). Solid arrows indicate the band containing GATA-binding proteins, and open and hatched arrows indicate the supershifted bands by addition of GATA-1 and GATA-4 antiserum, respectively. The exposure time for the autoradiogram was 36 h.

 
Interaction with GATT at -42.
As shown in Figs. 7Go and 8Go, mutation of the GATT sequence at -42 increased the effects of GATA-1 and GATA-4 on the transactivation of the ß-B(4.8)-subunit promoter in both MA-10 and MSC-1 cells. The interaction of GATA-binding proteins in testicular cells with a GATT motif at -42 was next examined using radiolabeled oligonucleotide -52/-31 for EMSA analysis (Fig. 12AGo). One intense, broad-shifted band and one minor shifted band interacting with this DNA fragment were observed in nuclear extracts of MA-10 cells (lane 2). In MSC-1 cells, both shifted bands were present in similar intensity (lane 8). The addition of nonradiolabeled GATA-containing oligonucleotides, wGATA (lanes 3 and 9) and -77/-53 (lanes 5 and 11), competed most of the bindings in two shifted bands. Only one species of protein in the high-shifted band did not compete binding to the GATA motif. When a GATT-mutated oligonucleotide of -52/-31 was used for competition analysis, the binding to the GATA motif in two shifted bands was restored. These results suggested that GATA-binding proteins interact with the GATT sequence at -42 in the ß-B(4.8)-subunit promoter. The addition of antiserum against GATA-4 yielded a supershifted band (lanes 6 and 12). When antibody against GATA-1 was added (lanes 7 and 13), a faint supershifted band was also observed after long exposure of the autoradiogram. To further verify that GATA-1 interacts with the GATT motif at -42, nuclear extracts obtained from MA-10 and MSC-1 cells, which had been transfected with mGATA-1 cDNA plasmid to overexpress GATA-1 protein, were used to repeat the EMSA analysis (Fig. 12BGo). Similar results were obtained in Fig. 12Go, A and B. An intense supershifted band was detected in the nuclear extracts containing overexpressed GATA-1 protein (Fig. 12BGo, lanes 6 and 12). Our observations reconfirm that the testicular GATA-1 and GATA-4 interacted with GATT sequence at -42 of the ß-B(4.8)-subunit promoter.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 12. EMSA Analysis of the Interaction of Testicular GATA-Binding Proteins with GATT Motif at -42 of ß-B(4.8)-Subunit Promoter

Nuclear extracts were prepared from MA-10 and MSC-1 cells without (panel A) or with (panel B) with transfection of an expression plasmid encoding GATA-1 and were added to a radiolabeled oligonucleotide, -52/-31, containing GATT motif at -42 for binding analysis. Nonradiolabeled oligonucleotides and antisera against GATA-1 or GATA-4 were included for competition analysis. No nuclear extract was added to lane 1. Solid arrow indicates the band containing GATA-binding proteins, and open and hatched arrows indicate the supershifted bands by addition of GATA-1 and GATA-4 antiserum, respectively. The exposure time for the autoradiogram shown in Fig. 12AGo was 30 h, and in Fig. 12BGo, 16 h for lanes 1–7 and 48 h for lanes 8–13.

 
Interaction with GATC at -201 and GATT at -177.
Mutation of GATC at -201 or GATT at -177 did not apparently affect the basal transcription nor the GATA-1- or GATA-4-induced transactivation of the ß-B(4.8)-subunit promoter activity (Figs. 7Go and 8Go). The possibility of GATA-1 and/or GATA-4 protein interacting with these motifs in the promoter was also analyzed by EMSA (Fig. 13Go). Oligonucleotides containing GATC at -201, -229/-187, and GATT at -177, -186/-142, in the ß-B(4.8)-subunit promoter were radiolabeled and used for binding analysis. Three shifted bands were observed binding to these oligonucleotides. However, the bindings in these bands could not be competed by addition of the GATA-containing oligonucleotide, wGATA, or antibody against GATA-1 or GATA-4, suggesting that testicular GATA-binding proteins did not interact with GATC at -201 or GATT at -177 in the ß-B(4.8)-subunit promoter.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 13. EMSA Analysis of the Interaction of Testicular GATA-Binding Proteins with GATC Motif at -201 and GATT motif at -177 of ß-B(4.8)-Subunit Promoter

Nuclear extracts prepared from MA-10 cells were added to radiolabeled oligonucleotide -229/-187 containing GATC motif at -201 (lanes 2–6) or to -186/-142 containing GATT motif at 177 (lanes 8–12) for binding analysis. No nuclear extract was added to lanes 1 and 7. Nonradiolabeled oligonucleotide wGATA (50- or 100-fold in excess) and antisera raised against GATA-1 and GATA-4 were used for competition of binding. The exposure time for the autoradiogram was 16 h.

 
Deletion Analysis of the Transactivation of ß-B(4.8)-Subunit Promoter by GATA- Binding Proteins
We have shown that serial deletion from the 5'-end of the ß-B(4.8)-subunit promoter at -226 to -90 markedly decreased the basal transcriptional activity of this promoter in MA-10 cells (Fig. 1Go). Similar observations were also found in MSC-1 cells, as shown in Fig. 14AGo. The effect of 5'-deletion on the transactivation of the ß-B (4.8)-subunit promoter by GATA-1 (Figs. 14BGo and 15AGo) and GATA-4 (Figs. 14CGo and 15BGo) was next examined. In Fig. 14Go, B and C, total CAT activity in GATA-1- or GATA-4-transfected cells was compared. CAT activity in GATA-1-transfected cells was not significantly changed by 5'-deletion from -226 to -126. A small reduction was found at the deletion from -126 to -90 (Fig. 14BGo). CAT activity in GATA-4-transfected cells (Fig. 14CGo) was markedly reduced by 5'-deletion in a manner similar to that observed for basal transcription (Fig. 14AGo).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 14. The 5'-End Deletion Analysis of Basal Transcription (A), Transactivation by GATA-1 (B), and Transactivation by GATA-4 (C) of ß-B(4.8)-Subunit Promoter in MA-10 and MSC-1 Cells

Upper panel shows the CAT constructs containing varied lengths of the ß-B(4.8)-subunit promoter prepared by serial deletion from the 5'-end of the -226 to +67 promoter DNA. Lower panel shows the effects of 5'-deletion on ß-B(4.8)-subunit promoter activities in two testicular cell lines. CAT constructs were cotransfected with expression plasmid without cDNA (A), with mGATA-1 (B), or with mGATA-4 (C) cDNA. The changes in CAT activity by deletion mutations were expressed as percent (mean ± SEM) relative to CAT activity obtained from cells transfected with undeleted ß-B(4.8)( -226/+67)CAT construct and an expression vector containing no cDNA (designated as 100%).

 


View larger version (29K):
[in this window]
[in a new window]
 
Figure 15. The Effect of 5'-Deletion on the Transactivation of the ß-B(4.8)-Subunit Promoter by GATA-Binding Proteins

The transactivation of the ß-B(4.8)-subunit promoter activity by GATA-1 (A) and GATA-4 (B) in each deletion construct of ß-B(4.8)CAT was calculated from Figs. 13BGo and 13CGo, respectively, and was expressed as folds of increase in CAT activity as compared with the corresponding untreated CAT construct.

 
The effects of GATA-binding proteins on the activities of the ß-B(4.8)-subunit promoter with varied deletions of the 5'-end were further analyzed by their folds of increase in CAT activity in each CAT construct after transfection with GATA-1 or GATA-4 expression plasmid (Fig. 15Go). A drastic increase in the induction of ß-B(4.8)-subunit promoter activity by GATA-1 was observed when promoter DNA was deleted from -180 to -126 and from -126 to -90 (Fig. 15AGo). In MA-10 cells, a 30- and 70-fold increase in CAT activity by cotransfection with GATA-1 expression plasmid was obtained in CAT constructs containing -126/+67 and -90/+67, respectively, while a 5-fold induction was detected in the construct containing -180/+67 or undeleted -226/+67 of the ß-B(4.8)-subunit promoter DNA. Similar results were observed in MSC-1 cells. These observations suggested that DNA sequences at the region of -180 to -90 may be involved in the negative regulation of the transactivation effect of GATA-1 on this promoter. The effect of the 5'-deletion of the ß-B(4.8)-subunit promoter DNA caused much less influence on the effect of GATA-4 on the transactivation of ß-B(4.8)-subunit gene transcription in both cell lines (Fig. 15BGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 
We have previously shown that GATA-1, but not GATA-4, transactivated the promoter activity of the inhibin {alpha}-subunit gene in testicular cells (16). In this study, we demonstrated that another inhibin/activin subunit gene promoter, the ß-B(4.8)-subunit promoter, was also up-regulated by GATA-binding proteins, GATA-1 and GATA-4. Our observations suggested that GATA-1 transactivates both {alpha}- and ß-B(4.8)-subunit promoters through interaction with GATA motifs in their basal promoters, -147 and -114 in {alpha}-subunit (16), and -65 in ß-B(4.8)-subunit promoter. GATA-4 selectively up-regulates ß-B(4.8)- subunit, but not {alpha}-subunit, gene transcription. The effect of GATA-4 to transactivate the ß-B(4.8)-subunit promoter was generally lower than that of GATA-1. Both GATA-binding proteins transactivate inhibin/activin subunit gene promoters in a dose-dependent manner (16) (Fig. 5Go). Furthermore, GATA-1 and GATA-4 exert an additive effect on the transactivation of ß-B(4.8)-subunit promoter when a combination of the two nuclear proteins was administered.

The transactivation of the ß-B(4.8)-subunit promoter by GATA-1 and GATA-4 was observed in two testicular cell lines, MA-10 and MSC-1, which were derived from different cell types, Leydig and Sertoli, respectively. Both cell lines express genes encoding inhibin and activin subunits (41, 42, 43) and GATA-1 and GATA-4 (16) (Fig. 3Go), although MSC-1 cells produce low levels of GATA-binding proteins and inhibin {alpha}-subunit mRNA. The endogenous levels of GATA-1 and GATA-4 mRNAs (Fig. 3Go, A–C) and proteins (Fig. 3EGo) were much lower in MSC-1 cells. Thus, the greater effects of exogenous GATA-1 and GATA-4 on the ß-B(4.8)-subunit promoter activity in MSC-1 cells (Fig. 4) as compared with MA-10 cells (Fig. 2Go) may probably be due to the lower endogenous levels of these proteins.

The mechanism by which GATA-4 elevates the ß-B(4.8)-subunit promoter activity is less clear, based on our mutation analysis of GATA and GATA-like sequences. In MSC-1 cells, mutation of the GATA motif reduced the transactivation effect of GATA-4, suggesting that GATA-4 interacts with the GATA motif to up-regulate ß-B(4.8)-subunit promoter activity. However, a less evident effect caused by mutation of this motif was observed in MA-10 cells. GATA-4 was also shown to transactivate other testis-expressing genes through GATA motifs (17, 18, 44). In Müllerian-inhibiting substance gene, GATA-4 enhances its promoter activity through a protein-protein interaction with a nuclear receptor SF-1 (17, 44). Whether GATA-4 interacts with other nuclear factor(s) to activate ß-B(4.8)-subunit gene transcription in testicular cells is currently under investigation.

Although GATA-1 was shown to transactivate both {alpha}- and ß-B(4.8)-subunit gene promoters through GATA motifs in testicular cell lines, differences were observed in the mechanisms by which GATA-1 up-regulates these genes. Mutation of GATA sequences markedly suppressed the transactivation effect of GATA-1 on both {alpha}- and ß-B(4.8)-subunit promoter activities. Mutation of this motif also evidently decreased the basal transcription of the {alpha}-subunit gene (16), but only caused a small effect on the ß-B(4.8)-subunit promoter (Figs. 7Go and 8Go). Furthermore, deletion analysis (Figs. 14Go and 15Go) revealed that progressive removal from the 5'-end of the ß-B(4.8)-subunit promoter DNA markedly increased the transactivation effect of GATA-1 on this promoter, suggesting that GATA-1 may, directly or indirectly through other protein factor(s), interact with DNA sequences at the region of -180 to -90 to negatively regulate ß-B(4.8)-subunit gene transcription. Since no consensus GATA or GATA-like sequence was identified at the -180 to -90 region of the ß-B(4.8)-subunit basal promoter, it is likely that GATA-1 interacts with other protein factor(s) that bind to the DNA sequence in this region to regulate ß-B(4.8)-subunit gene transcription. These observations are quite different from those found in the {alpha}-subunit promoter, where deletion of the region containing either the 5'- or 3'-GATA motif resulted in drastic suppression of both basal and GATA-1- induced transcription of {alpha}-subunit gene (Z.-M. Feng and C.-L. C. Chen, unpublished results).

One of the possible explanations for the differences found in the transactivation of {alpha}- and ß-B(4.8)-subunit genes by GATA-1 is that GATA-1 interacts with different protein factors to regulate these promoters. At least three major shifted bands were observed binding to the -77 to -53 GATA-containing region of the ß-B(4.8)-subunit promoter in both MA-10 (Fig. 9Go) and MSC-1 (Fig. 10Go) cells. Nucleotide sequence analysis revealed that putative binding sites for transcription factors other than GATA-binding proteins, such as NF-1 and Sp1, were also identified in this region (36, 37). Whether these factors play any role in regulating ß-B(4.8)-subunit promoter activity is not clear at the present time. The binding sites for CREB [cAMP response element (CRE)-binding protein] and SF-1 nuclear factors were located within the two GATA motifs of the {alpha}-subunit basal promoter and were involved in the cAMP-regulated transcription of the {alpha}-subunit gene in ovarian cells (45). In addition, mutation analysis revealed that CRE sequence is also required for the basal transcription of {alpha}-subunit gene in granulosa cells (46). GATA-1 was shown to interact with many protein factors including SF-1 (44), CREB-binding protein (47), and Sp1 (48) to positively or negatively regulate specific gene transcription. Whether GATA-1 interacts with these nuclear factors to regulate {alpha}- and ß-B(4.8)-subunit promoter activities is currently under investigation in our laboratory.

Members of the GATA-binding protein family were shown to recognize a consensus sequence derived from regulatory elements in erythroid cell-specific genes, (A/T)GATA(A/G). Analysis of DNA-binding specificity of each GATA-binding protein further suggested a greater flexibility of the recognition sites, i.e. the GAT consensus derivations, for these transcription factors (49, 50, 51). For instance, mGATA-1 protein binds to GATA variants, GAT(A/G/T), while GATA-2 and GATA-3 recognize the GATC site. The possibility of GATA-1 and/or GATA-4 interacting with GATA variants, or GATA-like sequences, in the ß-B(4.8)-subunit basal promoter was thus investigated. Our results indicated that, in addition to the GATA motif at -65, both GATA-1 and GATA-4 interacted with a GATA-like sequence, GATT at -42, to regulate ß-B(4.8)-subunit promoter activity. However, neither of these factors interacted with GATT at -177 or GATC at -201 in the ß-B(4.8)-subunit promoter. The ability of GATA-1 and GATA-4 to interact with GATT at -42 and not GATT at -177 demonstrated the binding specificity of these proteins to the DNA sequences flanking the GAT core motif (AGATTG at -42 and GGATTC at -177).

GATA-binding proteins exert a dual function, acting either as an activator or as a repressor depending on the location or the structure of the binding site, in the regulation of GATA-containing gene promoters, such as globins and rat platelet factor (PF4) (48, 49, 52). In rat PF4 promoter, GATA-1 binds to the GATA site at -31 and represses its gene expression. However, GATA-binding protein and/or its cofactor may also bind to the upstream GATA site at -134 and activate the transcription of PF4 gene (52). The steric interference of preinitiation complex formation by GATA-1 and GATA-2 factors was observed at the -31 GATA site in the core promoter of rat PF4 gene (52). Similar observations were found in ß-B(4.8)-subunit promoter (Figs. 7Go and 8Go). We showed that GATA-1 and GATA-4 factors transactivated ß-B(4.8)-subunit promoter through binding to the GATA motif at -65, while the two factors suppressed this promoter activity by interaction with GATT sequence at -42. Whether a similar repression mechanism observed in the PF4 gene applies to the ß-B(4.8)-subunit promoter is of interest to study. The possibility of the steric interference of GATA-binding proteins on GATT at -42 in the regulation of the ß-B(4.8)-subunit promoter is currently under investigation. In addition, the possible physiological relevance of the suppressor mechanism is also being examined.

The expressions of GATA-1 and GATA-4 genes were developmentally regulated in the testis of mouse and rat (13, 14, 15, 17, 18, 24). Both GATA-1 and GATA-4 proteins and mRNAs were present in high levels in immature testis. Maximal expression was observed in 14- to 21-day-old testis for GATA-1 (13, 14, 15, 24) and in 1- to 7-day-old testis for GATA-4 (17, 18, 24). Similar results were previously observed in the testicular inhibin/activin {alpha}- and ß-B-subunit genes (20, 21, 22, 23, 26). Both GATA-binding proteins and inhibin/activin subunit genes are predominantly expressed in Sertoli cells and are also expressed in Leydig cells and tumor cell lines derived from Sertoli and Leydig cells (13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 26). Our recent findings that GATA-1 protein transactivates both inhibin/activin {alpha}- and ß-B-subunit gene promoters in Sertoli and Leydig tumor cell lines suggest that the developmental regulation of the expression of GATA-1 in the testis may be one of the important factors involved in controlling the testicular production of inhibin B. Furthermore, the new demonstration of the selective effect of GATA-4 on the transactivation of the ß-B(4.8)-subunit gene promoter and the observation of the maximal expression of GATA-4 and ß-B-subunit genes in 1- to 7-day-old testis (17, 18, 24, 26) also suggest that the age-dependent regulation of GATA-4 expression in the testis may play a role in modulating the production of activin protein in the testis. Further investigation to clarify these possibilities is in progress in our laboratory.

In summary, we provide new information that two GATA-binding proteins, GATA-1 and GATA-4, which are expressed in the testis, play important roles in regulating the transcription of inhibin and activin subunit genes in testicular cells via complicated mechanisms. Both GATA-1 and GATA-4 act through the GATA motif at -65 and GATT at -42 to up-regulate and down-regulate the promoter activity of the ß-B(4.8)-subunit gene, respectively. GATA-1, using similar mechanisms but with differences, transactivates both {alpha}- and ß-B(4.8)-subunit gene promoters through interaction with GATA motif. In addition, GATA-1 may interact with DNA sequences at -180 to -90 to regulate the ß-B(4.8)-subunit gene promoter. The mechanisms by which these GATA-binding proteins transactivate inhibin/activin subunit gene transcription in testicular cells are currently under investigation in our laboratory. The observations obtained from our studies may provide new insight into the actions of GATA-binding proteins on the production of inhibin and activin proteins in the testis.


    MATERALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 
Northern Blot Analysis
Testes were collected from 21-day-old Sprague Dawley rats purchased from Charles River Laboratories, Inc. Breeding Laboratories (Wilmington, MA). Total RNAs isolated from testes and cultured MA-10 and MSC-1 cells were subjected to Northern blot analysis. Expression plasmids containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (6) and GATA-4 (pMT2-mGATA-4) (10) were used to prepare radioactive probes for the identification of GATA-1 and GATA-4 mRNA on the RNA blots.

Identification of GATA-1 mRNA by RT-PCR
The RT-PCR was carried out as described (16, 37) using Titan One Tube RT/PCR Kit (Roche Molecular Biochemicals, Indianapolis, IN). Briefly, reverse transcription was performed using 2 µg each total RNA isolated from tissues or cultured cells, 1 µM each primer, 5 mM dithiothreitol, and 1 µl enzyme mixture containing reverse transcriptase and Taq DNA polymerase at 52 C for 30 min. After denaturing at 94 C for 2 min, the cDNAs were amplified 30 cycles by PCR at 94 C for 30 sec, 52 C for 30 sec, and 68 C for 90 sec in each amplification cycle. Forward primer (CCCATGGATTTTCCTGGTC, 19-mer) from translation initiation codon and reverse primer (TCCACAGTTCACACACTCTCTGGC, 24-mer) containing a sequence complementary to amino acids 201–209 of the zinc finger domain of mGATA-1 gene (6) were used for the analysis of GATA-1 mRNA by RT-PCR (16). An aliquot of the RT-PCR-generated products was subjected to agarose gel electrophoresis followed by transfer to Nytran membrane. GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1 cDNA probe (16). The levels of total RNA used in each sample were further quantified by measurement of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA levels by the RT-PCR method. The primers used for analysis of G3PDH mRNA, forward primer ACCACAGTCCATGCCATCAC, and reverse primer TCCACCACCCTGTTGCTG, were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA).

Preparation of Deletion Constructs
Deletion constructs were made using Erase-a-Base System (Promega Corp., Madison, WI) as described previously (37, 53). A CAT construct containing the promoter DNA from -3,600 to +67 of the ß-B(4.8)promoter, pßB4.8(-3600)CAT, was linearized by digestion with KpnI and BamHI and was used to generate deletion mutants from the 5'-end by Exonuclease III. At various time points, aliquots of nuclease-digests were collected. After treatment with Klenow and DNA ligase, the deletion plasmids with different lengths of the ß-B(4.8)promoter were transformed into Escherichia. coli. The deletions of these plasmids were confirmed by DNA sequences analysis.

Preparation of Mutation Constructs
Mutations of GATA motif and GATA-like GATT and GATC motifs were performed in pßB4.8(-226/+67)CAT using 1) Transform Site-Directed Mutagenesis Kit (CLONTECH Laboratories, Inc.) or 2) GeneEditor in vitro Site-Directed Mutagenesis System (Promega Corp.). In 1) the selection primer, TransOligo NdeI/NcoI, and one or two GATA-, GATC-, or GATT-mutated primers were annealed to the denatured plasmid pßB4.8(-226/+67)CAT. After elongation and ligation of the mutant DNA, the plasmid DNA mixture was transformed into a strain of E. coli, mutS, which is defective in mismatch repair. Clones with mutated sequences were identified by digestion with NcoI and further confirmed by sequence analysis of their mutations. In 2) the selection oligonucleotide and the mutagenic oligonucleotide(s) were annealed to target DNA template, pßB4.8(-226/+67)CAT, and the mutant strand DNA was synthesized and ligated. The heteroduplex DNA was then transformed into a repair minus E. coli strain, BMH71–18 mutS, grown in selective media containing the novel GeneEditor Antibiotics. Plasmids resistant to antibiotics were isolated and transformed again into the final host strain, JM 109.

Procedure of DNA Transfection and CAT Assay
MA-10 cells, a clonal strain of cultured mouse Leydig tumor cells, were provided by Dr. Mario Ascoli (University of Iowa, Iowa City, IA) (54) and were cultured and maintained as described previously (16, 55). The procedure for transfection of plasmid DNA into MA-10 cells was described previously (16, 37, 53). MA-10 cells were plated at a density of 1.2 x 106 cells per 100-mm petri dish the day before transfection. The purified plasmid DNA was introduced into cells by the calcium phosphate precipitation method (56). Each precipitate DNA contained 16 µg of test plasmid and 2 µg of pAct/LacZ plasmid containing actin promoter and ß-galactosidase to monitor transfection efficiency. Five hours after precipitate was added, the cells were shocked with 15% glycerol for 2 min and harvested 48 h later.

MSC-1 cells, a mouse Sertoli tumor cell line provided by Dr. Michael Griswold (Washington State University, Pullman, WA) (41, 42), were plated at 0.5 x 106 cells per 60-mm dish. One day later, transfection was performed by using the liposome DC-chol:DOPE method as described by M. J. Campbell (57). Each precipitate contained 4 µg of test plasmid and 0.6 µg pAct/LacZ plasmid. In some cases, MSC-1 cells were transfected by the calcium phosphate precipitation method using the same amount of DNA as described above. The cells were harvested 48 h after transfection.

For cotransfection studies, ßB(4.8)CAT plasmids (37) containing normal or mutated sequences at GATA, GATT, or GATC motif, and A{alpha}BstCAT plasmid containing a rat inhibin {alpha}-subunit basal promoter DNA from -163 to +65 bp (16, 53) were coprecipitated with cDNA expression plasmids encoding GATA-binding proteins. The precipitates were then transfected into MA-10 or MSC-1 cells. Expression plasmids containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (6) and GATA-4 (pMT2-mGATA-4) (10) were provided by Dr. Stuart Orkin (Harvard Medical School, Boston, MA) and Dr. David Wilson (Washington University, St. Louis, MO), respectively. Promoterless CAT construct (A0CAT), and pXM and pMT2 expression vectors without cDNA inserts were included as negative controls for {alpha}- or ß-CAT constructs and mGATA-1 and mGATA-4, respectively (16).

Cell lysates were prepared by repeated freezing in a dry ice/ethanol bath and thawing at 37 C for 5 min each from the transfected MA-10 and MSC-1 cells and were used for measurements of protein concentration (58) and the activities of ß-galactosidase and CAT as described previously (16, 37, 53). Four micrograms each of cellular protein were applied for the measurement of ß-galactosidase activity (59, 60), using chlorophenol red-p-D-galactopyranoside (CPRG) as a substrate. One hundred micrograms each of the heated cellular protein were employed for the measurement of CAT activity using a diffusion method with 3H-acetyl coenzyme A (200 mCi/mmol and 0.5 mCi/ml, NEN Life Science Products, Boston, MA) (61, 62). The CAT activity was then normalized to the activity of ß-galactosidase.

Preparation of Nuclear Extracts
Nuclear extracts were prepared from MA-10 or MSC-1 cells using the procedure described previously (63). Cell pellets were suspended in hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.2 mM phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol) at 400 µl/dish for 10 min on ice. Nuclear proteins were extracted from the swollen cells in a buffer, 20 µl/dish, similar to the above hypotonic buffer except that 420 mM KCI and 25% glycerol were included. Aliquots of nuclear extracts were stored at -70 C until use.

Western Blot Analysis
Nuclear extracts prepared from testicular cell lines were subjected to SDS-PAGE using a 10% polyacrylamide gel. After transferring the nuclear proteins onto Immun-Blot polyvinylidene fluoride (PVDF) membrane (Bio-Rad Laboratories, Inc. Hercules, CA), the membrane was placed in a solution containing 3% nonfat milk in TBS (10 mM Tris·HCl, pH 8.0, 150 mM NaCl, and 0.05% Tween-20) at 4 C overnight. GATA-1 and GATA-4 proteins on the membrane were identified by incubation with anti-GATA-1 and anti-GATA-4 antiserum, respectively, at 1:100 to 1:300 dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 60 min at room temperature and then alkaline phosphatase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:2,000 dilution for 45 min at room temperature and were visualized using BCIP/NBI (5-bromo-4-chloro-3-indoyl phosphate p-toluidine salt and p-nitro blue tetrazolium chloride) (Bio-Rad Laboratories, Inc.).

EMSA
EMSA was performed as described previously (16) by incubation of nuclear extracts (0.5–3 µg) prepared from MA-10 or MSC-1 cells with radiolabeled double-stranded oligonucleotides or DNA fragments, and 1 µg of poly(dI/dC) as a nonspecific competitor. The binding reactions were performed at room temperature for 30 min and on ice for another 30 min. Specific DNA competitors or antisera were added to the reactions as indicated. Antiserum against mGATA-1 or mGATA-4 protein (purchased from Santa Cruz Biotechnology, Inc.) was added before the incubation for 30 min on ice. For competition analysis, excess of nonradiolabeled double-stranded oligonucleotides containing GATA motif(s) or the mutated sequences was added along with radiolabeled oligonucleotide probes to the reaction mixtures. The binding reactions were analyzed on 6% or 7% polyacrylamide gel as described (16, 52).

Double-stranded oligonucleotides containing GATA or GATA-like sequences from different regions of the ß-B(4.8)-subunit promoter were radiolabeled with [{gamma}-32P]ATP and T4 polynucleotide kinase for binding analysis. These DNA fragments included -77 to -53 containing GATA at -65, -77/-53; -52 to -31 containing GATT at -42, -52/-31; -229 to -187 containing GATC motif at -201, -229/-187; and -186 to -142 containing GATT at -177, -186/-142. Nonradiolabeled oligonucleotides used for competition analysis included a 20-mer from mGATA-1 gene, wGATA (GTCCATCTGATAAGACTTAT)(3), DNA fragments from various regions of the ß-B(4.8)-subunit promoter, and m(-42) containing -52 to -31 fragment with mutation of GATT motif at -42 to CTTT.


    ACKNOWLEDGMENTS
 
We wish to thank Drs. Stuart Orkin and David Wilson for providing mGATA-1 and mGATA-4 expression plasmids, respectively, Dr. Mario Ascoli for MA-10 cells, Dr. Michael Griswold for MSC-1 cells, and the assistance from Tissue Culture Core of Center for Biomedical Research, Population Council.


    FOOTNOTES
 
Address requests for reprints to: Ching-Ling C. Chen, Ph.D., Population Council, 1230 York Avenue, New York, New York 10021. E-mail: chen{at}popcbr.rockefeller.edu

This research was supported by NICHD/NIH through cooperative agreement [U54(HD-13541)] as part of the Specialized Cooperative Centers Program in Reproduction Research, and by NIDDK/NIH DK-34449 (to C.-L.C). Z. Zhang was partially supported by a Dewitt Wallace Fellowship.

1 Current address: Research Institute of Sericulture, Chinese Academy of Agricultural Sciences, Zhenjiang City, Jian Su, People’s Republic of China. Back

Received for publication February 8, 2000. Revision received July 24, 2000. Accepted for publication August 4, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERALS AND METHODS
 REFERENCES
 

  1. Yamamoto M, Ko LJ, Leonard MW, Beug H, Orkin SH, Engel JD 1990 Activity and tissue-specific expression of the transcription factor NF-E1 multigene family. Genes Dev 4:1650–1662[Abstract/Free Full Text]
  2. Orkin SH 1992 GATA-binding transcription factors in hematopoietic cells. Blood 80:575–581[Free Full Text]
  3. Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919–931[Abstract/Free Full Text]
  4. Evans T, Reitman M, Felsenfeld G 1988 An erythroid-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes. Proc Natl Acad Sci USA 85:5976–5980[Abstract/Free Full Text]
  5. Wall L, deBoer E, Grosveld F 1988 The human ß-globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev 2:1089–1100[Abstract/Free Full Text]
  6. Tsai S-F, Martin DI, Zon LI, D’Andrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446–451[CrossRef][Medline]
  7. Martin DI, Orkin SH 1990 Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-El1/Eryf 1. Genes Dev 4:1886–1898[Abstract/Free Full Text]
  8. Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells. J Biol Chem 266:16188–16192[Abstract/Free Full Text]
  9. George KM, Leonard MW, Roth ME, Lieuw KH, Kiossis D, Grosveld F, Engel JD 1994 Embryonic expression and cloning of the murine GATA-3 gene. Development 120:2673–2686[Abstract/Free Full Text]
  10. Arceci RJ, King AA, Simon MC, Orkin SH, Wilson DB 1993 Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13:2235–2246[Abstract/Free Full Text]
  11. Grepin C, Dagnino L, Robitaille L, Haberstroh L, Antakly T, Nemer M 1994 A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol Cell Biol 14:3115–3129[Abstract/Free Full Text]
  12. Laverriere AC, MacNeill C, Mueller C, Poelmann RE, Burch JB, Evans T 1994 GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem 269:23177–23184[Abstract/Free Full Text]
  13. Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M, Engel JD, Yamamoto M 1993 Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362:466–468[CrossRef][Medline]
  14. Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD, Yamamoto M 1994 Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse Sertoli cells. Development 120:1759–1766[Abstract]
  15. Onodera K, Yomogida K, Suwabe N, Takahashi S, Muraosa Y, Hayashi N, Ito E, Gu L, Ras-soulzadegan M, Engel JD, Yamamoto M 1997 Conserved structure, regulatory elements, and transcriptional regulation from the GATA-1 gene testis promoter. J Biochem 121:251–263[Abstract/Free Full Text]
  16. Feng Z-M, Wu AZ, Chen C-LC 1998 Testicular GATA-1 factor upregulates the promoter activity of rat inhibin {alpha}-subunit gene in MA-10 Leydig tumor cells. Mol Endocrinol 12:378–390[Abstract/Free Full Text]
  17. Viger RS, Mertineit C, Trasler JM, Nemer M 1998 Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Müllerian inhibiting substance promoter. Development 125:2665–2675[Abstract]
  18. Ketola I, Rahman N, Toppari J, Bielinska M, Porter-Tinge SB, Tapanainen JS, Huhtaniemi IT, Wilson DB, Heikinheimo M 1999 Expression and regulation of transcription factors GATA-4 and GATA-6 in developing mouse testis. Endocrinology 140:1470–1480[Abstract/Free Full Text]
  19. Heikinheimo M, Ermolaeva M, Bielinska M, Rahman NA, Narita N, Huhtaniemi IT, Tapanainen JS, Wilson DB 1997 Expression and hormonal regulation of transcription factors GATA-4 and GATA-6 in the mouse ovary. Endocrinology 138:3505–3514[Abstract/Free Full Text]
  20. Keinan D, Madigan MB, Bardin CW, Chen C-LC 1989 Expression and regulation of testicular inhibin {alpha}-subunit gene in vivo and in vitro. Mol Endocrinol 3:29–35[Abstract/Free Full Text]
  21. Feng ZM, Bardin CW, Chen C-LC 1989 Characterization and regulation of testicular inhibin ß-subunit messenger RNA. Mol Endocrinol 3:939–948[Abstract/Free Full Text]
  22. Bhasin S, Krummen LA, Swerdloff RS, Morelos BS, Kim WH, DiZerega GS, Ling N, Esch F, Shimasaki S, Toppari J 1989 Stage dependent expression of inhibin {alpha} and ß-B subunits during the cycle of the rat seminiferous epithelium. Endocrinology 124:987–991[Abstract/Free Full Text]
  23. Kaipia A, Penttila T-L, Shimasaki S, Ling N, Parvinen M, Toppari J 1992 Expression of inhibin ßA and ßB, follistatin and activin-A receptor mRNAs in the rat seminiferous epithelium. Endocrinology 131:2703–2710[Abstract/Free Full Text]
  24. Chen C-LC, Feng Z-M, Chung K, Boitani C, Bardin CW, GATA- 1, GATA-4 genes are co-expressed in the Sertoli cells, Leydig tumor cell lines of the testis. Program of the 78th Annual Meeting of The Endocrine Society, San Francisco, 1996, P2–564 (Abstract)
  25. Vale W, Rivier C, Hsueh A, Campen C, Meunier H, Bicsak T, Vaughan J, Corrigan A, Bardin W, Sawchenko P, Petraglia F, Yu J, Plotsky P, Spiess J, Rivier J 1988 Chemical and biological characterization of the inhibin family of protein hormones. Recent Prog Horm Res 44:1–34
  26. Chen C-LC, Feng Z-M, Morris PL, Bardin CW 1992 Controls for inhibin subunit genes and their consequences in the testis. In: Spera G, Fabbrini L, Gnessi L, Bardin CW (eds) Molecular and Cellular Biology of Reproduction. Serono Symposia. Raven Press, New York, vol 90:97–108
  27. Mayo KE 1994 Inhibin and activin. Molecular aspects of regulation and function. Trends Endocrinol Metab 5:407–415[CrossRef][Medline]
  28. Matzuk MM, Shou W, Coerver KA, Lau AL, Behringer RR, Finegold MJ 1996 Transgenic models to study the roles of inhibins and activins in reproduction, oncogenesis, and development. Recent Prog Horm Res 51:123–157
  29. Hötten G, Neidhardt H, Schneider C, Pohl J 1995 Cloning of a new member of the TGF-ß family: a putative new activin ßc chain. Biochem Biophys Res Commun 206:608–613[CrossRef][Medline]
  30. Lau AL, Nishimori K, Matzuk MM 1996 Structural analysis of the mouse activin ßC gene. Biochim Biophys Acta 1307:145–148[Medline]
  31. Schmitt J, Hotten G, Jenkins NA, Gilbert DJ, Copeland NG, Pohl J, Schrewe H 1996 Structure, chromosomal localization, and expression analysis of the mouse inhibin/activin ßC (Inhbc) gene. Genomics 32:358–366[CrossRef][Medline]
  32. Fang J, Yin W, Smiley E, Wang SQ, Bonadio J 1996 Molecular cloning of the mouse activin ßE-subunit gene. Biochem Biophys Res Commun 228:669–674[CrossRef][Medline]
  33. Fang J, Wang S-Q, Smiley E, Bonadio J 1997 Genes coding for mouse activin ßC and ßE are closely linked and exhibit a liver-specific expression pattern in adult tissues. Biochem Biophys Res Commun 231:655–661[CrossRef][Medline]
  34. Oda S, Nishimatsu S-I, Murakami K, Ueno N 1995 Molecular cloning and functional analysis of a new activin ß subunit: a dorsal mesoderm-inducing activity in Xenopus. Biochem Biophys Res Commun 210:581–588[CrossRef][Medline]
  35. Tanimoto K, Yoshida E, Mita S, Nibu Y, Murakami K, Fukamizu A 1996 Human activin ßA gene. Identification of novel 5' exon, functional promoter, and enhancers. J Biol Chem 271:32760–32769[Abstract/Free Full Text]
  36. Dykema JC, Mayo KE 1994 Two messenger ribonucleic acids encoding the common ßB-chain of inhibin and activin have distinct 5'-initiation sites and are differentially regulated in rat granulosa cells. Endocrinology 135:702–711[Abstract]
  37. Feng Z-M, Wu AZ, Chen C-LC 1995 Characterization and regulation of two testicular inhibin/activin ß-B-subunit messenger ribonucleic acids which are transcribed from alternate initiation sites. Endocrinology 136:947–955[Abstract]
  38. Shaha S, Morris PL, Chen C-LC, Vale W, Bardin CW 1989 Immunostainable inhibin subunits are in multiple types of testicular cells. Endocrinology 125:1941–1950[Abstract/Free Full Text]
  39. Roberts V, Meunier H, Sawchenko PE, Vale W 1989 Differential production and regulation of inhibin subunits in rat testicular cell types. Endocrinology 125:2350–2359[Abstract/Free Full Text]
  40. Chen C-LC 1993 Editorial: Inhibin and activin as paracrine/autocrine factors. Endocrinology 132:4–5[Free Full Text]
  41. Peschon JJ, Behringer RR, Cate RL, Harwood KA, Idzerda RL, Brinster RL Palmiter RD 1992 Directed expression of an oncogene to Sertoli cells in transgenic mice using Müllerian inhibiting substance regulatory sequences. Mol Endocrinol 6:1403–1411[Abstract/Free Full Text]
  42. McGuinness MP, Linder CC, Morales CR, Heckert LI, Pikus J, Griswold MD 1994 Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 51:116–124[Abstract]
  43. Chen C-LC, Pignataro OP, Feng Z-M 1993 Inhibin/activin subunits and activin receptor are co-expressed in Leydig tumor cells. Mol Cell Endocrinol 83:105–115
  44. Tremblay JJ, Viger RS 1999 Transcription factor GATA-4 enhances Müllerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13:1388–1401[Abstract/Free Full Text]
  45. Ito M, Park Y, Weck J, Mayo KE, Jameson JL 2000 Synergistic activation of the inhibin {alpha}-promoter by steroidogenic factor-1, cyclic adenosine 3',5'-monophosphate. Mol Endocrinol 14:66–81[Abstract/Free Full Text]
  46. Pei L, Dodson R, Schoderbek WE, Maurer RA, Mayo K-E 1991 Regulation of the {alpha} inhibin gene by cyclic adenosine 3',5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 5:521–534[Abstract/Free Full Text]
  47. Blobel GA, Nakajima T, Eckner R, Montminy M, Orkin SH 1998 CREB-binding protein cooperates with transcription factor GATA-1 and its required for erythroid differentiation. Proc Natl Acad Sci 95:2061–2066[Abstract/Free Full Text]
  48. Fischer K-D, Haese A, Nowock J 1993 Cooperation of GATA-1 and Sp1 can result in synergistic transcriptional activation or interference. J Biol Chem 268:23915–23923[Abstract/Free Full Text]
  49. Whyatt DJ, deBoer E, Grosveld F 1993 The two zinc finger-like domains of GATA-1 have different DNA binding specificities. EMBO J 12:4993–5005[Medline]
  50. Merika M, Orkin SH 1993 DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 13:3999–4010[Abstract/Free Full Text]
  51. Ko LJ, Engel JD 1993 DNA-binding specificities of the GATA transcription factor family. Mol Cell Biol 13:4011–4022[Abstract/Free Full Text]
  52. Aird WC, Parvin JD, Sharp PA, Rosenberg RD 1994 The interaction of GATA-binding proteins and basal transcription factors with GATA box-containing core promoters. J Biol Chem 269:883–889[Abstract/Free Full Text]
  53. Feng Z-M, Chen C-LC 1994 Negative control of rat inhibin {alpha}-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:39–47[Abstract/Free Full Text]
  54. Ascoli M 1981 Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108:88–95[Abstract/Free Full Text]
  55. Pignataro OP, Feng Z-M, Chen CL-C 1992 Cyclic AMP negatively regulates clusterin gene expression in Leydig tumor cell lines. Endocrinology 130:2745–2750[Abstract/Free Full Text]
  56. Gorman C, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenical acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051[Abstract/Free Full Text]
  57. Campbell MJ 1995 Lipofection reagents prepared by a simple ethanol injection technique. Biotechniques 18:1027–1032[Medline]
  58. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  59. Herbomel P, Bourachot B, Yaniv M 1984 Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39:653–662[CrossRef][Medline]
  60. Hollon T, Yoshimura FK 1989 Variation in enzymatic transient gene expression assays. Anal Biochem 182:411–418[CrossRef][Medline]
  61. Neumann JR, Morency CA, Russian KO 1987 A novel rapid assay for chloramphenicol acetyl-transferase gene expression. Biotechniques 5:444–447
  62. Seed B, Sheen J-Y 1988 A simple phase-extraction assay for chloramphenicol acetyltransferase activity. Gene 67:271–277[CrossRef][Medline]
  63. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2494



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
I. Qamar, E. Park, E.-Y. Gong, H. J. Lee, and K. Lee
ARR19 (Androgen Receptor Corepressor of 19 kDa), an Antisteroidogenic Factor, Is Regulated by GATA-1 in Testicular Leydig Cells
J. Biol. Chem., July 3, 2009; 284(27): 18021 - 18032.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. D. Looyenga and G. D. Hammer
Origin and Identity of Adrenocortical Tumors in Inhibin Knockout Mice: Implications for Cellular Plasticity in the Adrenal Cortex
Mol. Endocrinol., November 1, 2006; 20(11): 2848 - 2863.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M Anttonen, H Parviainen, A Kyronlahti, M Bielinska, D B Wilson, O Ritvos, and M Heikinheimo
GATA-4 is a granulosa cell factor employed in inhibin-{alpha} activation by the TGF-{beta} pathway.
J. Mol. Endocrinol., June 1, 2006; 36(3): 557 - 568.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
M. Bielinska, S. Kiiveri, H. Parviainen, S. Mannisto, M. Heikinheimo, and D. B. Wilson
Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse.
Vet. Pathol., February 1, 2006; 43(2): 97 - 117.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
Y Okuma, A E O'Connor, J A Muir, P G Stanton, D M de Kretser, and M P Hedger
Regulation of activin A and inhibin B secretion by inflammatory mediators in adult rat Sertoli cell cultures
J. Endocrinol., October 1, 2005; 187(1): 125 - 134.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Jarvis, D. J. Elliott, D. Morgan, R. Winston, and C. Readhead
Molecular markers for the assessment of postnatal male germ cell development in the mouse
Hum. Reprod., January 1, 2005; 20(1): 108 - 116.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay
The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology
J Androl, July 1, 2004; 25(4): 441 - 452.
[Full Text] [PDF]


Home page
J AndrolHome page
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen
Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein
J Androl, July 1, 2004; 25(4): 479 - 493.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
H. A. LaVoie
The Role of GATA in Mammalian Reproduction
Experimental Biology and Medicine, December 1, 2003; 228(11): 1282 - 1290.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
F. Lindeboom, N. Gillemans, A. Karis, M. Jaegle, D. Meijer, F. Grosveld, and S. Philipsen
A tissue-specific knockout reveals that Gata1 is not essential for Sertoli cell function in the mouse
Nucleic Acids Res., September 15, 2003; 31(18): 5405 - 5412.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Ketola, J. Toppari, T. Vaskivuo, R. Herva, J. S. Tapanainen, and M. Heikinheimo
Transcription Factor GATA-6, Cell Proliferation, Apoptosis, and Apoptosis-Related Proteins Bcl-2 and Bax in Human Fetal Testis
J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1858 - 1865.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. K. Cheng, C. H. Cheung, and W. M. Lee
Mouse Testin: Complementary DNA Cloning, Genomic Organization, and Characterization of Its Proximal Promoter Region
Biol Reprod, April 1, 2003; 68(4): 1376 - 1386.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Anttonen, I. Ketola, H. Parviainen, A.-K. Pusa, and M. Heikinheimo
FOG-2 and GATA-4 Are Coexpressed in the Mouse Ovary and Can Modulate Mullerian-Inhibiting Substance Expression
Biol Reprod, April 1, 2003; 68(4): 1333 - 1340.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Zhang, A. Z. Wu, Z.-M. Feng, D. Mruk, C. Y. Cheng, and C.-L. C. Chen
Gonadotropins, via cAMP, Negatively Regulate GATA-1 Gene Expression in Testicular Cells
Endocrinology, March 1, 2002; 143(3): 829 - 836.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden
An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells
Am. J. Pathol., January 1, 2002; 160(1): 369 - 380.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. B. Hales
Editorial: Gonadal-Specific Transcription Factors--GATA (Go) 4 It!
Endocrinology, March 1, 2001; 142(3): 974 - 976.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals