help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heckert, L. L.
Right arrow Articles by Chen, J. k.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heckert, L. L.
Right arrow Articles by Chen, J. k.
Molecular Endocrinology 14 (11): 1836-1848
Copyright © 2000 by The Endocrine Society

The USF Proteins Regulate Transcription of the Follicle-Stimulating Hormone Receptor but Are Insufficient for Cell- Specific Expression

Leslie L. Heckert, Michele Sawadogo, Melissa A. F. Daggett and Jiang kai Chen

Department of Molecular and Integrative Physiology (L.L.H., M.A.F.D., J.k.C.) The University of Kansas Medical Center Kansas City, Kansas 66160
The Department of Molecular Genetics (M.S.) The University of Texas M.D. Anderson Cancer Center Houston, Texas 77030


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of the FSH receptor (FSHR) is limited to granulosa cells of the ovary and Sertoli cells of the testis. Previous studies showed that an E box in the proximal promoter of the FSHR gene is required for transcription and that the predominant E box binding proteins are the ubiquitous transcription factors, upstream stimulatory factor 1 (USF1) and USF2. Through cotransfection analysis, we have shown that both wild-type and dominant negative forms of the USF proteins regulate the rat FSHR promoter and that transcriptional activation of FSHR required several domains within the amino-terminal portion of the USF proteins. Analysis of the FSHR promoter region using in vivo genomic footprinting indicated that the E box is occupied by proteins in Sertoli cells but not in cells that fail to express the receptor, despite the presence of the USF proteins. To help delineate the regions of the rat FSHR gene required for correct spatial and temporal expression, transgenic mice harboring two constructs containing variable amounts of 5'-flanking sequence (5,000 bp and 100 bp) were generated. Examination of 16 different transgenic lines revealed varied transgene expression profiles with multiple lines having different amounts of ectopic expression and two lines failing to express the transgene. In addition, little or no expression was observed in Sertoli cells. These studies indicate that additional regulatory sequences outside the region from -5,000 to +123 bp are needed for proper expression in Sertoli cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the testis, germ cell development occurs within a highly specialized compartment called the seminiferous epithelium. Within this structure, Sertoli cells form the major somatic component and function to provide an environment that protects and nurtures the germ cells, assisting their development into viable sperm (1, 2, 3, 4). Sertoli cells also play a central role in testicular development, where under the direction of Sry, the sex-determining gene on the Y chromosome, they are the first somatic cell to differentiate in the embryonic gonad and are thought to orchestrate subsequent events in testis formation and sex determination (5, 6, 7, 8, 9). Sertoli cells provide many functions that are essential to testis activity and fertility; most notable are the formation of a support system to house the developing germ cells, endocytosis of eliminated waste products from developing sperm, formation of the blood-testis barrier, assistance in spermiation, delivery of nutrients to germinal cells, and secretion of proteins, ions, and other substances proposed to be important for germ cell development and viability (1, 3).

Sertoli cells are regulated by a variety of signaling molecules that assist their differentiation and development. One of these, the pituitary hormone FSH, is an integral component of the regulatory network that forms the hypothalamic-pituitary-gonadal axis. This hormone provides important stimulus to Sertoli cells that induces proliferation, final maturation events, and synthesis of specific protein products (10, 11, 12). FSH recognizes and binds a cell surface receptor (FSHR) that serves as the communicative link between the pituitary FSH signal and gonadal response (11, 13, 14). The expression of this receptor is remarkably cell specific: it is located exclusively on Sertoli cells of the testis and granulosa cells of the ovary (11, 13, 15, 16). Because of its cell-specific properties and its role in FSH signaling, determining the mechanisms that regulate FSHR gene expression will provide important insight into the regulation of FSH response and mechanisms that govern cell-specific expression in granulosa and Sertoli cells.

Studies with transgenic mice and transient transfection have been used to examine the transcriptional mechanisms that regulate FSHR (17, 18, 19, 20). Experiments using transgenic mice revealed that 5,000 bp of 5'-flanking sequence could direct expression of a reporter gene to the gonads, implicating this region in the cell-specific expression of FSHR (18). Moreover, transient transfection analysis of deletion and block replacement mutants indicated that, within this 5,000-bp gene fragment, a single E box element, located approximately 30 bp upstream of the transcriptional start site, is the major control site for FSHR transcription (17, 18, 19). Together, these studies suggest that a promoter region that includes the E box would be sufficient for cell-specific expression and that this element is an important contributor to this process. However, identification of the upstream stimulatory factor (USF) proteins, USF1 and USF2, as the major Sertoli cell E box-binding complex obscured this interpretation, as these proteins are ubiquitous and therefore insufficient, by themselves, to direct cell-specific expression (17, 19). Thus, if the E box and the USF proteins are involved, other mechanisms, such as cell-specific modifications or the use of specific coactivators, need to be invoked. Alternatively, proteins other than USF1 or USF2, not observed in the binding assays, may interact with this element and help direct cell-specific expression. To address these possible mechanisms, more direct evidence for USF regulation of FSHR is needed as well as a better-defined region that directs cell-specific expression. Through cotransfection analysis of wild-type and mutant USF proteins, we provide data that showed USF1 and USF2 activated FSHR transcription and that this activation required several domains within the amino-terminal portion of the proteins. In addition, we show that occupancy of the E box in vivo was cell specific, but likely requires assistance of sequences outside of -5,000/+123 bp of the FSHR gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
USF1 and USF2 Regulate FSHR Transcription through the E Box
USF1 and USF2 are members of the basic helix-loop-helix (bHLH)-ZIP family of transcription factors and bind DNA as a dimer, where they are known to form both homodimers and heterodimers between themselves (21, 22, 23). Binding and transfection studies have implicated these proteins in the regulation of FSHR transcription (17, 19). To derive more direct evidence for a role of the USF proteins in the regulation of FSHR, we examined the ability of both wild-type and mutant USF proteins to regulate FSHR promoter function. The rat FSHR promoter (-220/+123) driving expression of a luciferase reporter gene was cotransfected into the mouse Sertoli cell line, MSC-1, with vectors that express either wild-type or mutant USF proteins. The mutant USF proteins, U1{Delta}N and U2{Delta}N, efficiently bind DNA but are unable to transactivate due to the absence of the amino-terminal transactivation domains (24, 25). Cotransfection with increasing amounts of vectors expressing the wild-type USF proteins showed little impact on FSHR promoter activity (USF1 and USF2, Fig. 1AGo). However, cotransfection with increasing amounts of vector DNA expressing the amino-terminal transactivation mutant proteins (U1{Delta}N or U2{Delta}N) resulted in a dramatic reduction in FSHR promoter activity (Fig. 1BGo). The effects of the {Delta}N mutants were promoter specific and E box dependent, as luciferase production directed by either the SV40 promoter (in pGL3-Control) or a mutant FSHR promoter lacking the E box (FSHR{Delta}Ebox) was insensitive to cotransfection with the {Delta}N mutants (Fig. 1CGo). In addition, no specific effects of the USF mutants were observed on either the thymidine kinase or Rous sarcoma virus promoters (data not shown). The results therefore indicate that the USF {Delta}N mutants regulate the FSHR promoter in a manner that is promoter specific and dependent on the E box.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Amino-Terminal Domain Mutants of USF1 and USF2 Inhibit FSHR Promoter Activity

The rat FSHR promoter FSHR(-220/+123)Luc (1 µg) was transiently transfected into MSC-1 cells together with 50 ng pRL-TK (a control for transfection efficiency) and a total of 500 ng expression vector (empty vector pSG5 plus USF expressing vector). The promoter was transfected with either increasing amounts of expression vector for wild-type USF1 or USF2 (A) or the amino terminal domain mutants U1{Delta}N or U2{Delta}N (B). In panel C, 1 µg of either FSHR(-220/+123)Luc, pGL3-Control (SV40 promoter and enhancer), or the FSHR promoter with a mutant E box, FSHR(-220/+123){Delta}Ebox, was transiently transfected into MSC-1 cells with 500 ng of either empty expression vector (pSG5), U1{Delta}N, or U2{Delta}N. The relative activity represents the firefly/Renilla luciferase activities of each transfected sample normalized to the firefly/Renilla luciferase activity of the promoter transfected with empty vector alone. Error bars represent the SEM. The mutation through the E box in FSHR(-220/+123){Delta}Ebox, is given in Fig. 2AGo (µ9.2).

 
Although little effect of the wild-type USF proteins was observed, the impact of the {Delta}N mutants suggested that USF regulates FSHR expression and that the results observed with the wild-type proteins were due to high levels of endogenous USF proteins. The inability of the wild-type USF proteins to regulate FSHR promoter activity did not appear to be due to the level of protein expressed from the vectors, as both USF1 and USF2 expression was comparable to expression of the mutant proteins as observed by Western blot analysis (Fig. 3BGo). However, if the E box in the transfected promoter was already saturated with USF due to high levels of endogenous proteins, the ability to influence promoter activity would be compromised. To address this possibility, we used two different FSHR promoter mutants that contained subtle changes in the E box sequence (µ9.3 and µ9.6, Fig. 2AGo). As demonstrated by their diminished ability to compete for the USF proteins in an electrophoretic mobility shift assay (EMSA), these mutant E boxes bind the USF proteins with lower affinity than the wild-type sequence (Fig. 2AGo). In addition, basal activity of the mutant promoters was significantly less than the wild-type (Fig. 2BGo and Ref. 17), revealing that the mutant promoters are not saturated with regulatory proteins when transfected into MSC-1 cells. When these mutant constructs were cotransfected with expression vectors for either USF1 or USF2, promoter activity increased 2 to 3 times as compared with empty vector alone (Fig. 2BGo). In contrast, a mutant promoter with the entire E box mutated (µ9.2) was only modestly influenced by cotransfection with vectors expressing the wild-type USF proteins (Fig. 2BGo). Thus, under conditions where the E box has a lower affinity for the USF proteins and the element is not saturated with endogenous USF, USF1 and USF2 activated FSHR promoter activity. The results in Fig. 1Go further indicated that this transcriptional activation requires a domain or domains within the amino-terminal portion of these proteins.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Multiple Domains in the Amino-Terminal Regions of USF1 and USF2 Are Implicated in Transactivation of FSHR

A, Transient transfection analysis of wild-type and mutant USF proteins. One microgram of FSHR(-220/+123)Luc was transiently transfected into MSC-1 cells together with 50 ng pRL-TK and either 500 ng of empty expression vector (pSG5) or expression vectors for wild-type or various mutant USF1 or USF2 proteins. The relative activity represents the firefly/Renilla luciferase activities of each transfected sample normalized to the firefly/Renilla luciferase activities of the promoter transfected with empty vector alone. Error bars represent the SEM. A schematic diagram of the various domains and exons that make up the USF proteins is shown at the top. B, Western blot analysis of USF expressed from various expression vectors. Each expression vector was transiently transfected into MSC-1 cells and examined for protein expression by Western blot analysis as described in Materials and Methods. Lanes are: 1) pSG5, 2) USF2, 3) U2{Delta}6–40, 4) U2{Delta}7–123, 5) U2{Delta}7–148, 6) U2{Delta}7–157, 7) U2{Delta}7–186, 8) U2{Delta}1–199, 9) U2{Delta}N, 10) U2{Delta}USR, 11) U2{Delta}E4, 12) U2{Delta}E5, 13) pSG5, 14) USF1, 15) U1{Delta}1–130, 16) U1{Delta}N, 17) pSG5.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Overexpression of USF1 and USF2 Activates FSHR Promoters Having E box Sequences with Lower Binding Affinity for the USF Proteins

A, EMSA assay of the FSHR E box. A radiolabeled probe corresponding to the FSHR E box (5'-TCTTGGTGGGTCACGTGACTTTGCCCGT-3') was used in an EMSA with nuclear extracts from primary rat Sertoli cells. Twenty-five femtomoles of radiolabeled probe were incubated with nuclear extract and resolved on a 4% polyacrylamide gel, as described in Materials and Methods. Competitor DNAs were added to the reactions at a concentration equal to 15-fold that of the probe. Arrows indicate the USF proteins as previously described. Sequences of each competitor are given below the EMSA. B, Transient transfection analysis of various mutant E box promoters. One microgram of either FSHR(-220/+123)Luc (wild-type), FSHR(-220/+123)µ9.3, FSHR(-220/+123)µ9.6, or FSHR(-220/+123)µ9.2 was transfected into MSC-1 cells together with 50 ng pRL-TK and 500 ng of either empty expression vector (pSG) or expression vectors for wild-type USF1 or USF2 (U1 and U2, respectively). The relative activity represents the firefly/Renilla luciferase activities of each transfected sample normalized to the firefly/Renilla luciferase activities of the wild type promoter transfected with empty vector alone. Error bars represent the SEM.

 
USF Transactivation of the FSHR Gene Involves Multiple Amino-Terminal Domains in the Proteins
Recently, domains important to transcriptional activity of the USF proteins have been localized to their amino-terminal regions (24, 25, 26). We used a cotransfection paradigm to delineate domains within the amino termini of USF1 and USF2 that are important for FSHR transcription. A variety of expression vectors containing cDNAs for various mutant USF proteins were examined for their ability to influence FSHR transcription. Each of the proteins examined had a functional DNA-binding domain consisting of a basic region (BR) and helix-loop-helix-leucine zipper region (HLH-LZ) and has been shown to bind to DNA and translocate into the nucleus (25). Since the E box is already saturated with endogenous USF, mutant USF proteins that lack important transactivation domains should inhibit promoter activity by displacing the active proteins at the E box. Comparison of the promoter effects elicited by mutant and wild-type USF proteins revealed several transactivation domains important for regulation of FSHR transcription (Fig. 3AGo). The wild-type USF did not inhibit promoter activity, indicating that inhibition is not due to the sequestration of important factors away from the promoter. Deletion of amino acids 6–40 of USF2 (U2{Delta}6–40) reduced promoter activity 30–40%, revealing a transactivation domain within this region of the protein (Fig. 3AGo). Removal of an additional 83 amino acids that encompasses most of exon 4 (U2{Delta}7–123) had no further influence on promoter activity. Deletion of exon 4 alone also had little impact on promoter function (Fig. 3AGo, U2{Delta}E4), while progressively larger deletions through exon 5 (constructs U2{Delta}7–148 through U2{Delta}1–199) resulted in sequentially greater impact on promoter activity. This suggested that multiple regions within exon 5 act to support transcriptional activity of USF2. Removal of the USF-specific region (USR) domain, a region of high sequence conservation among USF proteins, further decreased promoter activity. However, removal of either exon 5 or the USR alone (U2{Delta}E5 and U2{Delta}USR) failed to inhibit promoter function, indicating that redundant transactivation domains act within the amino terminus of USF2. Western blot analysis of cells transfected with each of the mutants showed that the observed results were not due to differences in expressed protein (Fig. 3BGo).

An important transactivation domain within the first 130 amino acids of USF1 was also identified (Fig. 3AGo, U1{Delta}1–130), and further deletion through the USR resulted in a modest reduction in FSHR promoter activity. Thus, for both USF1 and USF2, multiple domains appear to contribute to transactivation of the FSHR gene and, at least for USF2, there is redundancy in the ability of some of these (exon 5 and USR) to transactivate the promoter.

The E Box of the Endogenous FSHR Gene Is Occupied in Expressing Cells and Vacant in Nonexpressing Cells
The central role of the E box in FSHR promoter function, as assessed by transient transfection, prompted examination of this site on the endogenous FSHR gene using in vivo genomic footprinting. Primary cultures of rat Sertoli cells and a rat choriocarcinoma cell line, RCHO, that does not express FSHR were treated in vivo with dimethyl sulfate (DMS), genomic DNA was isolated, and the methylation pattern of guanines (and to a lesser extent adenines) was determined after piperidine cleavage and ligation-mediated PCR. Genomic footprints generated from the gene in vivo were compared with footprints generated from DNA of the same source isolated before treatment with DMS (in vitro footprint). Comparison of the in vivo and in vitro footprints revealed that guanines within the FSHR E box (marked by arrows in Fig. 4Go, A and B) were protected from methylation in cultured Sertoli cells treated with DMS in vivo (T lanes, Fig. 4AGo) when compared with naked DNA treated with DMS in vitro (N lanes, Fig. 4AGo). Densitometric analysis revealed that, in Sertoli cells, the intensity of the E box bands was 65% lower in the in vivo DMS-treated DNA compared with naked DNA treated with DMS. In contrast, the intensity of the E box bands in the RCHO cells was slightly higher (127%) with in vivo DMS treatment than with in vitro treatment, indicating that the E box is not protected from methylation in RCHO cells (Fig. 4AGo). These studies indicate that the E box within the endogenous FSHR gene is occupied by regulatory proteins in FSHR-expressing cells (Sertoli) but not in cells that fail to express the receptor (RCHO). The inability to detect a footprint over the E box in RCHO cells was not due to the lack of USF proteins, as EMSA and antibody supershifts revealed the presence of these proteins in this cell line (Fig. 4CGo).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. The E Box in the FSHR Promoter Is Protected from Methylation in Sertoli Cells but Not in RCHO Cells

A, In vivo genomic footprint analysis of the FSHR promoter. DNA from rat Sertoli or RCHO cells treated with DMS either in vitro (N) or in vivo (T) was examined by ligation-mediated PCR using primers specific to the promoter region of the rat FSHR gene. An arrow indicates the position of the E box. B, Sequence of the rat FSHR promoter in the region of the footprint. The E box is shaded, and the protected guanines are indicated with arrows. C, EMSA of the FSHR E box with nuclear extracts from RCHO cells. EMSA was done as described in the legend of Fig. 2Go. Where indicated, competitors were added at a concentration equal to 100-fold that of the probe or antibodies against the bHLH proteins USF1 and USF2 were added.

 
Sequences outside of -5,000 to +123 bp of the Rat FSHR Gene Are Required for Expression in Sertoli Cells
The expression of FSHR shows exquisite specificity, being found only in granulosa cells of the ovary and Sertoli cells of the testis (11, 13, 15, 16). To help determine whether the E box is sufficient to direct cell-specific expression of the FSHR gene, two reporter vectors containing different amounts of FSHR 5'-flanking sequence were used to generate transgenic mice. Both 5,000 bp and 100 bp of rat FSHR 5'-flanking sequence were placed upstream of the Cre recombinase gene fused to a portion of the bovine GH (bGH) gene (Fig. 5AGo; -5,000/+123Cre, -100/+123Cre). Sixteen different lines of animals were obtained (eight lines from each construct), and the F1 progeny were examined for Cre recombinase expression by RT-PCR analysis of RNA isolated from 10 different adult tissues using primers that span intron D of the bGH gene (Cre6 and PolyA5; Fig. 5AGo). Expression of Cre mRNA was determined by the presence of a 334-bp amplified product as compared with a 609-bp product derived from genomic DNA, as shown for animal 527, a progeny of founder animal 254 (Fig. 5BGo).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. Expression of FSHR-Cre Recombinase in Transgenic Mice

A, Schematic diagram of the FSHR transgene. Either 5,000 bp or 100 bp of FSHR 5'-flanking sequence (FSHR Promoter) was used to direct expression of a gene encoding Cre recombinase fused to a portion of the bGH gene that includes part of exon 4, intron D, and part of exon 5. The approximate binding sites for the oligodeoxynucleotides used to examine expression of the transgene (Cre6 and PolyA5) are shown. B, Examination of Cre recombinase expression in transgenic mice. RT-PCR was used to examine Cre recombinase expression in various tissues from transgenic mouse no. 527 as described in Materials and Methods. Reactions for cDNA synthesis were done either in the presence (+) or absence (-) of added reverse transcriptase. Tissues examined were testis (T), heart (H), liver (L), lung (Ln), kidney (K), spleen (Sp), stomach (St), brain (B), bladder (Bl), and eyes (E). Controls that contain no DNA (Neg.), plasmid containing the transgene (Pos.), or cDNA from a positive expressing animal are also shown. An arrow indicates the correctly processed Cre transgene product of 334 bp. M refers to DNA markers.

 
Table 1Go gives the results obtained from animals that harbor the -5,000/+123Cre transgene. The results show that each transgenic animal expressed Cre recombinase in the testis as well as the brain (expression is indicated as +). While expression was restricted to these two tissues in most of the animals, various levels of ectopic expression were observed in some lines, most notably lines 240 and 207. Table 2Go gives the results obtained from animals containing the -100/+123Cre transgene. In two lines, 252 and 303, no transgene expression was observed. However, three lines, 254, 289, and 296, expressed Cre only in the testis, while the remaining three lines showed various levels of ectopic expression. In female mice, transgene expression was observed in the ovary of each FSHR(-5,000)Cre transgenic line examined, except for line 232, while only lines 256, 323, and 347 of the FSHR(-100)Cre animals exhibited ovarian transgene expression (Tables 1Go and 2Go). Thus, despite the rather high level of ectopic expression, especially with the -5,000-bp construct, the results with lines 254, 289, and 296 suggested that sequences within the first 100 bp of the promoter are sufficient for testis-specific expression but lacked information necessary for ovary-specific expression.


View this table:
[in this window]
[in a new window]
 
Table 1. Expression of FSHR(-5,000)Cre

 

View this table:
[in this window]
[in a new window]
 
Table 2. Expression of FSHR(-100)Cre

 
To help evaluate which cells in the testis expressed Cre recombinase, we examined testis expression in different aged animals. Both 10- and 30-day-old animals were selected, as significantly different populations of germ cells are present at these two ages. At the earlier age, only spermatogonia are present, while at the later age, germ cells have begun to proliferate and differentiate, greatly expanding the population of these cells in the testis. Expression of the FSHR gene in Sertoli cells is maintained throughout postnatal development into adulthood (11), and therefore, if the transgene is properly expressed in Sertoli cells it should be present at both 10 and 30 days of age. In contrast, expression only in the older animals would favor germ cells as the site of expression, since this population of cells is greatly increased by this age. As indicated in Tables 1Go and 2Go, all animals examined expressed Cre recombinase in the testis at 30 days of age. However, with the exception of animal 347, none of the animals examined expressed Cre recombinase in the testis at 10 days of age, while FSHR expression was observed in the testis of all animals (data not shown).

The different temporal expression patterns of FSHR and Cre strongly suggested that Cre expression in the testis was within the germ cell population rather than in Sertoli cells. To test this possibility, Cre recombinase expression was examined in Sertoli cells and germ cells isolated from the testis of lines 254 and 347. After 35 rounds of amplification in a RT-PCR reaction, a very modest signal for expressed Cre recombinase was observed when Sertoli cell RNA from line 347 was used as template. However, a robust signal was detected when germ cell RNA from the same animal was used as template (Fig. 6Go, SC and GC lanes, respectively). This difference was not attributed to variation in the cDNA synthesis as no obvious difference was observed for amplification of the control mRNA L7 (Fig. 6Go, bottom). No amplified product for Cre recombinase mRNA was observed in cell preparations from negative littermates (Fig. 6Go, Neg SC and GC samples). Similar results were obtained for transgenic line 254 (Table 2Go). Since germ cells, in small amounts, often contaminate Sertoli cell preparation, the weak Cre signal is Sertoli cells most likely represents a germ cell contribution to this RNA pool. Thus, the high degree of ectopic Cre expression and temporal misregulation in the testis indicate that the region from -5,000 to +123 bp of the rat FSHR gene was insufficient to properly restrict or direct expression to Sertoli cells.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 6. Expression of FSHR(-100)Cre in Sertoli Cells and Germ Cells

Sertoli cells and germ cells were isolated from testes of male transgenic animals from line 347. RT-PCR was used to examine Cre recombinase expression in Sertoli cells (SC) and germ cells (GC) isolated from male transgenic mice (347) and negative littermates (Neg). Reactions for cDNA synthesis were done either in the presence (+) or absence (-) of reverse transcriptase, and each reaction was examined for the presence of L7 (ribosomal protein) cDNA to confirm cDNA synthesis (bottom). Other samples include H2O (negative control) and intact testis (T) from animal 347 (positive control). Arrows indicate amplified product from correctly processed Cre transgene (334 bp, top) and amplified product for L7 (bottom). M refers to DNA markers.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Characterization of the transcriptional mechanisms regulating FSHR expression has, to date, been limited to the proximal promoter region and 5'-flanking sequences extending to -5,000 bp (18, 19, 20, 27, 28). Previous studies using transient transfection analysis have shown that all detectable regulatory sequences reside in the first 100 bp of this genomic segment and that, within this region, the E box plays a significant regulatory role (17, 19). In addition, in vitro binding assays suggest that the USF proteins regulate FSHR transcription through the E box (17, 19). To further elucidate mechanisms important to FSHR transcription, we have examined the ability of the USF proteins to modulate FSHR promoter function and the contribution of the E box to in vivo regulation of the gene.

Studies reported herein have yielded several important findings regarding the mechanisms governing FSHR expression. Through cotransfection analysis, we have shown that both USF1 and USF2 activate FSHR transcription. Although the wild-type proteins failed to significantly activate the FSHR promoter over the level due to endogenous transcription factors, the effect of mutant USF proteins strongly supported the conclusion that USF is involved in FSHR transcriptional regulation. Mutants lacking the amino- terminal transactivation domain ({Delta}N mutants) greatly inhibited FSHR promoter function, and this inhibition was promoter specific and required the E box (Fig. 1Go), demonstrating that USF binds specifically to the FSHR promoter in vivo. The inhibitory activity of the {Delta}N mutants was attributed to a competition between the mutants and endogenous USF proteins for binding to the E box. Thus, if proteins other than USF were responsible for activation through the E box, cotransfection of the wild-type USF proteins should have inhibited as well. This conclusion is further supported by the observation that cotransfection with expression vectors for wild-type c-Myc, another bHLH-Zip protein that shares the same binding site requirements as USF, inhibited FSHR promoter activity (data not shown). In addition, more direct evidence for USF activation of the FSHR promoter was provided by our finding that cotransfected USF1 and USF2 increased transcription from promoters containing E box sequences having lower affinities for the USF proteins. This also suggested that the inability of wild-type USF to regulate the wild-type promoter was due to saturation of the E box with endogenous USF proteins.

The transactivation domains of these important regulatory proteins were mapped using a variety of USF1 and USF2 mutants. By evaluating the ability of the mutants to inhibit promoter activity, three main transactivation domains of USF2 and two for USF1 were identified. For USF1, the first 130 amino acids appeared to be most critical for transactivation, while modest affects were observed with a sequential deletion through exon 5 and the USR. Similar to our findings, Roy et al. (24) showed that deletion of the first 130 amino acids significantly diminished transactivation by USF1, while further deletion through the USR had little effect. Luo and Sawadogo (25) also identified the amino-terminal portion of USF1 as critical for transactivation, but their data support a more prominent role for the USR. This difference may reflect the use of distinct promoters, which has been shown to influence the mechanism of USF transactivation (24, 25).

Activation of the FSHR promoter by USF2 required domains within the first 40 amino acids of the protein, within the region encoded by exon 5, and within the USR. However, both the exon 5 region and the USR appeared redundant with other sequences in the amino-terminal domain, as deletion of either one alone did not alter FSHR promoter function. Although previous studies also identified exon 5 and the USR as containing important transcriptional activation domains, several notable differences are apparent when comparing these earlier results with those observed on the FSHR promoter (25). Thus, in contrast with our results, two additional studies failed to reveal a significant role for the first 40 amino acids of USF2 in transactivation (25, 26). Interestingly, studies with USF1 identified this domain as important but found that its activity depended on the context of the promoter examined (24). Furthermore, Luo and Sawadogo found that deletion of the USR alone abolished transcriptional activation by USF2, while in our studies, function of the USR was only revealed when other amino-terminal sequences were absent (25).

Our studies also examined a USF2 construct (U2{Delta}E4) that represents a natural splice variant that is expressed at various levels relative to the wild-type protein in different cell types (29, 30). Although no transcriptional effect was observed with this mutant on either the FSHR or the adenovirus major late promoter, studies on the major histocompatibility complex (MHC) class I gene clearly identify exon 4 as encoding a critical activation domain (26). Thus, comparison of our studies with others already published on USF transactivation domains show an emergence of data implicating differences in the functional activity of these proteins. For the FSHR promoter in MSC-1 cells, the USF proteins appear to function somewhat differently than what has been reported for the activation of either the adenovirus major late or MHC promoters. Interestingly, earlier studies have shown that the transactivation properties of the USF proteins are both cell type and promoter context dependent, suggesting that these contribute to the differences observed (24, 25, 31, 32). Currently, information on the domains of USF proteins is limited, and a more thorough comparison on mechanisms of USF transactivation awaits additional studies that employ a variety of cell types and promoters.

The promoter region of the FSHR gene was examined in Sertoli cells using in vivo genomic footprinting. Like in vitro footprinting, this approach predicts that protected regions represent sites of protein/DNA interaction and are important sites of transcriptional regulation. Importantly, though, in vivo footprinting has the added advantage of examining interactions within living cells where the chromatin conformation and concentrations of regulatory proteins have not been altered. The signal obtained from the footprinted region depends on the endogenous occupancy level of the site as well as the number of expressing cells in the preparation. Analysis of the FSHR promoter region showed that the signal associated with the two guanines within the E box was significantly lower in DNA treated in vivo with DMS compared with DNA treated in vitro. Moreover, in RCHO cells, no apparent difference was observed between in vivo and in vitro footprints with respect to the extent of methylation of this site. Examination of other nonexpressing cell lines rendered the same results as the RCHO cells (data not shown). Thus, despite the presence of the USF proteins in these nonexpressing cells, they do not bind to the E box of the endogenous FSHR gene.

To delineate the region of the FSHR gene needed for cell-specific expression, we generated transgenic mice harboring two constructs containing variable amounts of 5'-flanking sequence (5,000 bp and 100 bp). Eight different lines of animals carrying the 5,000-bp promoter were examined, but none showed selective expression in testis or the correct temporal profile for the FSHR gene. These results suggested that sites outside this region are needed to appropriately restrict expression of FSHR to the gonads and to activate the gene at the appropriate time during development. Surprisingly, upon first observation, a smaller region (-100) of gene appeared to better restrict transgene expression, as three lines showed expression only in the testis. However, in these same three lines, no transgene expression was observed in the ovary, and closer inspection of the males revealed that testis expression was due to inappropriate expression in the germ cells.

In apparent contrast to our findings, previous studies had shown that 5,000 bp of the rat FSHR promoter could direct expression of a reporter gene (ß-galactosidase) to the gonads in transgenic mice (18). However, these earlier studies did not determine the cell types that expressed ß-galactosidase in testis or ovary (histochemical and immunohistochemical analysis for ß-galactosidase was inconclusive) suggesting that, like our findings, expression in the germ cells may have contributed to the majority of the signal in the gonads. In addition, the fewer number of transgenic lines (2 vs. 16) and tissues examined (6 vs. 11) and variation in the assay sensitivity (Northern blot analysis vs. RT-PCR) may likely have contributed to differences in the amount of ectopic expression observed in the two studies. Thus, although these earlier studies implicated the region from -5,000/+69 in cell-specific expression, the studies presented here suggest that earlier conclusions may be incorrect and that sequences outside this region are needed for cell- specific expression. Nonetheless, it is important to note that differences in the transgenic constructs (-5,000/+69 vs. -5,000/+123 of promoter and different reporters) may also have contributed to the differences in expression profiles.

Both FSHR and LH receptor (LHR) are members of the glycoprotein hormone receptor subfamily within the superfamily of G protein-coupled receptors (33, 34). Comparison of the gene structures for these proteins suggested that they evolved from a common ancestral gene and revealed that the promoters of each are TATA-less (28, 35, 36). LHR, like FSHR, is expressed predominantly in cells of the ovary and testis, where it is found in testicular Leydig cells and ovarian theca and granulosa cells (13). Interestingly, recent studies with transgenic mice carrying 2 kb of the murine LHR promoter revealed some remarkable similarities with our FSHR transgenic studies (37). Thus, similar to the FSHR transgenes, three of five LHR transgenic lines exhibited expression within the testis but failed to express in the ovary, while all lines showed ectopic expression in the brain. Also of notable similarity were the observations that testis expression of the LHR transgene was not seen in earlier stages of postnatal development (before 5 weeks) and that it later appeared in the germ cell population (elongating spermatids and spermatogonia). However, in contrast to our studies, the investigators did observe transgene expression within the appropriate cells (Leydig cells) of the testis, indicating that the LHR promoter could recapitulate some of the regulatory features of the endogenous gene. Thus, while both the LHR and FSHR promoters failed to properly restrict expression of the transgenes, only the LHR promoter was able to direct expression to one of the correct gonadal cells (Leydig).

The studies in transgenic mice revealed several important findings. First, the extensive amount of ectopic expression (predominantly brain and germ cell) as well as two silent transgenes (nos. 252 and 303) indicated that the FSHR transgenes were strongly influenced by adjacent DNA sequences at the position of transgene integration. In addition, since little or no Sertoli cell expression was detected, the elements needed to confer and/or enhance cell-specific expression were absent from the transgene construct. Thus, additional regulatory sequences are needed to overcome chromatin influences at the site of integration and to enhance transcription in Sertoli cells. The transgenic mouse studies, together with the cotransfection and in vivo genomic footprinting data, suggest a mechanism whereby sequences outside the region from -5,000 to +123 alter the transcriptional capabilities of the FSHR gene and permit or assist the occupancy of the E box by the USF proteins (Fig. 7Go). Thus, in FSHR-expressing cells, proteins bound to distal regions of the gene will likely be required for transactivation, while in nonexpressing cells these proteins are either absent or nonfunctional on the FSHR gene. The mechanisms involved in these transcriptional changes remain to be determined, but may involve alterations in chromatin structure that permit the USF proteins to bind the E box. Alternatively, proteins bound to distal regulatory elements may directly interact with the USF proteins and assist their interactions with the E box in the proximal promoter. Identification of these regulatory sequences and their binding proteins will be critical to our understanding of the mechanisms regulating FSHR.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Cell-Specific Expression of FSHR Requires Sequences Outside of -5,000/+123

In FSHR-expressing cells (top), important regulatory elements (distal elements) that reside outside of the region from -5,000 to +123 bp are bound by proteins that alter the transcriptional capabilities of the FSHR gene and permit access of the USF proteins to the E box in the proximal promoter region. In nonexpressing cells (bottom), proteins that bind these distal elements are absent, the USF proteins are unable to interact with the E box, and the gene is inactive.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA Constructs
All rat FSHR promoter/luciferase constructs are described elsewhere (17). USF expression vectors are described elsewhere (25). Two Cre recombinase transgenes were constructed using different portions of the rat FSHR gene. BSK-Cre-PolyA was generated by subcloning an 1,100-bp fragment containing the Cre recombinase gene with a nuclear localization signal (pBS317, a kind gift from Brian Sauer) 5' to the PstI/EcoRI fragment of the bGH gene containing part of exon 4, intron D, and exon 5 (polyadenylation site) into pBluescript SK- (Stratagene, La Jolla, CA). The FSHR -5,000-bp and -100-bp promoters were isolated by digestion with SstI/XbaI of either FSHR(-5,000/+123)Luc or FSHR(-100)Luc (described in Ref. 17) and cloned into the XbaI/SstI sites of pBSK-Cre-PolyA 5' to Cre recombinase/bGH sequences generating FSHR(-5,000)Cre and FSHR(-100)Cre, respectively. Plasmid DNAs were prepared from overnight bacterial cultures using DNA plasmid columns according to the supplier’s protocol (QIAGEN, Chatsworth, CA).

Transgenic Mouse Production
The 7,333- and 2,433-bp inserts of FSHR(-5,000)Cre and FSHR(-100)Cre were excised from plasmid sequence by digestion with SstI and XhoI and resolved by agarose gel electrophoresis, and the fragments were isolated using Prep-A-Gene matrix according to the manufacturers instructions (Bio-Rad Laboratories, Inc. Hercules, CA). DNA was eluted in 10 mM Tris, pH 7.5, 0.25 mM EDTA. Transgenic founders were produced by pronuclear injection into B6/SJL F1 zygotes performed by the Center for Reproductive Sciences transgenic core at the University of Kansas Medical Center. The Cre founders were back-crossed into a CD1 background for production of transgenic offspring. All animal studies were conducted in accordance with the principles and procedures outlined in "Guideline for Care and Use of Experimental Animals."

Genotyping of Transgenic Mice
The genotypes of all offspring were analyzed by PCR of mouse tail DNAs. Mouse tail cuts (~3 mm) were incubated in 20 µl lysis buffer (50 mM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM EDTA, 1% SDS) with 40 µg proteinase-K at 55 C for 30–40 min. The mixture was briefly vortexed after 15 min. After incubation, 178 µl of distilled water were added, and the mixture was heated in a boiling water bath for 5 min. The sample was cooled to room temperature, and 1.5 µl of the tail lysate were amplified by PCR (28 cycles for 40 sec at 94 C; 40 sec at 56 C; and 40 sec at 72 C) using Cre-specific primers Cre1 5'-CTGGTCGAAATCAGTGCGTTC-3' and Cre2 5'-TTACCGGTCGATGCAACGAGT-3'. Positive animals were identified by the presence of a 393-bp amplified product as observed by agarose gel electrophoresis.

Analysis of Transgene Expression
F1 transgenic mice positive for either FSHR(-5,000)Cre or FSHR(-100)Cre transgenes were killed and total RNA was isolated from various tissues using TRIZOL reagent according to manufacturer’s procedures (Life Technologies, Inc., Gaithersburg, MD). Tissue-specific expression of the transgenes was evaluated using RT-PCR. Complementary DNA was generated using Superscript reverse transcriptase (Life Technologies, Inc.), 2 µg total RNA, and 0.25 µg oligo-dT. Complementary DNA synthesis was performed in both the presence and absence of reverse transcriptase. The cDNA was used as a template in a PCR with intron-spanning primers specific for the Cre recombinase and exon 5 of the bGH gene (upstream primer: Cre6, 5'-CTGGATAGTGAAACAG-GG-3'; and downstream primer: polyA5, 5'-GTACGTCTC-CGT-CTTAT-3'). This primer set was used to distinguish between genomic DNA (a contaminant in the RNA preparation) and the expressed transgene. In addition, each cDNA was examined for the presence of the ribosomal protein L7 to confirm cDNA synthesis (upstream primer: L7.1, 5'-GGAAAG-GCAAGGAGGAAGCA-3'; downstream primer: L7.2, TCCTCCATGCAGATGATGC). Amplified products were examined by agarose gel electrophoresis in which amplification of unprocessed transgene from genomic DNA resulted in the presence of a 609-bp DNA fragment, while cDNA generated from processed mRNA resulted in the amplification of a 334-bp fragment. In studies examining Cre recombinase expression in mouse Sertoli cells and germ cells, samples were also examined for the expression of FSHR using mouse-specific primers to the FSHR (mFSHR2 5'-GGGGAAGCTTTTGGAGGTAATAGAGGCAGAT-3' and mFSHR3 5'-GGGGTCTAGAGCCTTAAAATAGACTTGTTGCA-3'). In these samples, FSHR was detected only in the Sertoli cell preparations.

Isolation of Mouse Sertoli and Germ Cells
Seminiferous tubules were prepared from mouse testes (from either 27- or 50-day- old animals) as described elsewhere but with slight modification (38). For isolation of mouse seminiferous tubules, the order of collagenase and trypsin treatments was reversed. Tubules were cultured in Ham’s F12 media containing 5% FBS, 1.47 mM L-glutamine, 1.5 mM HEPES, 1% penicillin/streptomycin, and 3 µg/ml cytosine arabinoside at 37 C in 5% CO2. After 5 days, germ cells were collected by dislodging the loosely adherent germ cells into the media with several rounds of pipeting. The collected media were then subjected to centrifugation (200 x g for 6 min) to pellet the germ cells. Sertoli cells were collected 2–4 days later.

Transfection and Enzyme Analysis
The mouse Sertoli cell line MSC-1 (39) was seeded onto six-well plates (35-mm/well) at a density of 250,000 cells per well. Unless otherwise stated, cells were transfected with 1 µg luciferase reporter, 50 ng pRL-TK, and 0.5 µg expression vector using 5 µl lipofectamine reagent (Life Technologies, Inc.), as described previously (17). pRL-TK expresses Renilla luciferase from the herpes simplex virus thymidine kinase promoter and was included to control for transfection efficiency (Promega Corp. Madison, WI). Sixty hours after transfection, the cells were lysed and assayed for both firefly and Renilla luciferase activities using the Dual-Luciferase Reporter Assay System (Promega Corp.). Specifics of the transfection procedure are described elsewhere (17, 40). Data were averaged over a minimum of three independent experiments.

In Vivo Footprinting
Primary rat Sertoli cells were cultured on 150-mm culture dishes as described previously (38). RCHO cells were grown as described (41). Cells were treated with a concentration of 0.1% DMS (Sigma-Aldrich Corp., St. Louis, MO) in prewarmed media for 2 min, washed three times with PBS, and lysed to isolate genomic DNA. Genomic DNA was isolated and extracted as described elsewhere (42). Both in vivo DMS-treated DNA and control in vitro treated DNA were prepared simultaneously and subsequently cleaved at methylated guanines using piperidine (Sigma-Aldrich Corp.) diluted 1:10 in water. Piperidine was removed by repeated DNA precipitation and resuspension in H2O. DNA samples were resuspended in water and the concentration determined by reading the absorbency at 260 nm. Isolated genomic DNA (2 µg) was analyzed by ligand-mediated (LM)-PCR as described elsewhere (42). Oligodeoxynucleotides used for the ligated linker are published elsewhere (42). LM-PCR primers to the FSHR gene, designed according to parameters and specification described in Ref. 42 are as follows: +168 bp to +143 bp, Tm=60.7 C, (AS) 5'-d (GACACAGCCAGTGATGACATCCAGAT)-3'; +151 bp to +123 bp, Tm = 64.3 C, (AS) 5'-d(CATCCAGATCCCGTGCCCAAGAATGC)-3'; +151 bp to +118 bp, Tm = 70.1 C, (AS) 5'-d(CATCCAGATCCCGTGCCCAAGAATGCCAGCAAGG)-3'. The first primer extends a FSHR-specific promoter fragment. The second primer, in combination with the linker primer (described in Ref. 42), amplifies the fragments. The last primer is labeled to a high specific activity with P32-ATP using T4 kinase (New England Biolabs, Inc., Beverly, MA) and used to label amplified fragments. Amplified products were fractionated on a 8% denaturing gel, dried, and analyzed by autoradiography. Optical densities were quantified for autoradiography bands using Gel-Pro Analyzer image analysis software (Media Cybernetics, Silver Spring, MD). To adjust for loading differences across the gel, optical densities of seven different bands were normalized, and the relative intensity of the E box was calculated for each. The average of the seven values was then used to determine the change in the optical density of the E box bands between treated and naked DNA samples.

Preparation of Nuclear Extracts and EMSA
To prepare nuclear extracts, cells were washed with ice-cold buffer (25 mM HEPES, pH 7.4, 1 mM dithiothreitol (DTT), 1.5 mM EDTA, 10% glycerol) and scraped from plates into the above buffer with 0.5 mM phenylmethylsulfonyl fluoride (PMSF) added. Cells were lysed using 30 strokes of a Dounce homogenizer (B pestle), and the nuclei were pelleted by centrifugation (16,000 x g) for 1 min. The supernatant was removed and nuclei resuspended in extraction buffer (25 mM HEPES, pH 7.9, 1 mM DTT, 1.5 mM EDTA, 10% glycerol, and 0.5 M KCl). Nuclei were extracted on ice for 10 min, and then frozen on dry ice. Nuclei were then thawed and centrifuged (85,000 x g) for 6 min. Supernatants were immediately aliquoted and placed at -80 C. Protein concentration was determined by the BCA method (Pierce Chemical Co., Rockford, IL) using BSA as a standard.

For EMSAs, nuclear extracts (6–10 µg protein) were incubated with 25 fmol of radiolabeled double-stranded oligonucleotide in the presence of 10 mM HEPES, pH 7.9, 3 mM MgCl2, 30 mM KCl, 0.5 mM DTT, 12% glycerol, 0.6 mM EDTA, 0.2 mM PMSF, 50 ng salmon sperm DNA, 1 µg dIdC, 10 µM ZnCl, and 1 µg/ml BSA in a 20 µl reaction volume as described elsewhere (17). Addition of competitors or antibodies to the reaction immediately preceded the addition of extract. Reactions were incubated on ice for 10 min before addition of probe, and then an additional 30 min on ice before being loaded onto the gel unless otherwise noted. Protein-DNA complexes were resolved on a 4% nondenaturing polyacrylamide gel (acrylamide:bis-acrylamide = 40:1) run in 25 mM Tris (pH 8.5), 190 mM glycine at 250 V for 1.5 h at 4 C. Gels were dried and analyzed by autoradiography. Antibodies for USF1 (C-20)X, USF2 (C-20)X, and c-Myc (N-262)X were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). These antibodies are supplied as rabbit polyclonal IgG and were used directly as supplied by the manufacturer at 1 µg IgG per binding reaction.

Western Blot Analysis
MSC-1 cells were transfected with 1.5 58 g of each USF mutant as described above. Whole cell extracts were resolved on 10% SDS-polyacrylamide gels (acrylamide:bis-acrylamide = 30:0.8) with the discontinuous buffer formulation of Laemmli (43) and transferred to nitrocellulose membranes (Bio-Rad Laboratories, Inc. Hercules, CA) using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad Laboratories, Inc. Hercules, CA). Membrane-bound proteins were probed overnight at 4 C with anti-USF1 or anti-USF2 antibodies, diluted 1:10,000 in TBST (15 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween-20), and then subsequently incubated with goat antirabbit horseradish peroxidase- conjugated antibody for 90 min at room temperature. Specific protein complexes were visualized with the enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Arlington Heights, IL).


    ACKNOWLEDGMENTS
 
We thank the Center of Reproductive Sciences at the University of Kansas Medical Center and Wen-ge Ma for the generation of the transgenic mice.


    FOOTNOTES
 
Address requests for reprints to: Leslie L. Heckert, Department of Molecular and Integrative Physiology, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160. E-mail: lheckert{at}kumc.edu

This work was supported in part by NIH Grants R29HD-3521701A1 and R03HD-35871 (to L.L.H.), RO1CA-79578 (to M. S.), and National Research Service Award F32 HD-08500 (to M.F.D.).

Received for publication March 13, 2000. Revision received June 23, 2000. Accepted for publication August 9, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Clermont Y 1993 Introduction to the Sertoli cell. In: Russell LD, Griswold MD (eds) The Sertoli Cell. Cache River Press, Clearwater, FL, pp xxi-xxv
  2. Wilson RM, Griswold MD 1979 Secreted proteins from rat Sertoli cells. Exp Cell Res 123:127–135[CrossRef][Medline]
  3. Bardin CW, Cheng CY, Mustow NA, Gunsalus GL 1994 The Sertoli cell. In: Knobil E, Neill JD (eds) The Physiology of Reproduction, ed 2. Raven Press, Ltd., New York, vol 1:1291–1333
  4. Griswold MD 1988 Protein secretions of Sertoli cells. Int Rev Cytol 110:133–156[Medline]
  5. Magre S, Jost A 1991 Sertoli cells and testicular differentiation in the rat fetus. J Electron Microsc Tech 19:172–188[CrossRef][Medline]
  6. Magre S, Jost A 1980 The initial phases of testicular organogenesis in the rat. An electron microscopy study. Arch Anat Microsc Morphol Exp 69:297–318[Medline]
  7. McLaren A 1991 Development of the mammalian gonad: the fate of the supporting cell lineage. Bioessays 13:151–156[CrossRef][Medline]
  8. McLaren A 1998 Gonad development: assembling the mammalian testis. Curr Biol 8:R175–R177
  9. Karl J, Capel B 1998 Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev Biol 203:323–333[CrossRef][Medline]
  10. Heckert, L, MD Griswold. 1992 The changing functions of follicle-stimulating hormone in the testes of prenatal, newborn, immature, and adult rats. In: Hunzicker-Dunn M, Schwartz NB (eds) Follicle-Stimulating Hormone: Regulation of Secretion and Molecular Mechanisms of Action. Springer-Verlag, New York, pp 237–245
  11. Heckert LL, Griswold MD 1991 Expression of follicle-stimulating hormone receptor mRNA in rat testes and Sertoli cells. Mol Endocrinol 5:670–677[Abstract/Free Full Text]
  12. Zirkin BR, Awoniyi C, Griswold MD, Russell LD, Sharpe R 1994 Is FSH required for adult spermatogenesis? J Androl 15:273–276[Free Full Text]
  13. Camp TA, Rahal JO, Mayo KE 1991 Cellular localization and hormonal regulation of follicle-stimulating hormone and luteinizaing hormone receptor messenger RNAs in the rat ovary. Mol. Endocrinol 5:1405–1417
  14. Rannikki AS, Zhang F-P, Huhtaniemi IT 1995 Ontogeny of follicle-stimulating hormone receptor gene expression in the rat testis and ovary. Mol Cell Endocrinol 107:199–210[CrossRef][Medline]
  15. Orth J, Christensen AK 1978 Autoradiographic localization of FSH-binding sites on Sertoli cells and spermatogonia in testes from hypophysectomized rats. In: McKerns KW (ed) Structure and Function of the Gonadotropins. Plenum Press, New York, pp 111–137
  16. Simoni M, Gromoll J, Nieschlag E 1997 The follicle-stimulating hormone receptor: biochemistry, molecular biology, physiology, and pathophysiology. Endocr Rev 18:739–773[Abstract/Free Full Text]
  17. Heckert LL, Daggett MA, Chen J 1998 Multiple promoter elements contribute to activity of the follicle-stimulating hormone receptor (FSHR) gene in testicular Sertoli cells [In Process Citation]. Mol Endocrinol 12:1499–1512[Abstract/Free Full Text]
  18. Linder CC, Heckert LL, Goetz TL, Griswold MD 1994 Follicle-stimulating hormone receptor gene promoter activity. Endocrine 2:957–966
  19. Goetz TL, Lloyd TL, Griswold MD 1996 Role of E box and initiatory region in the expression of the rat follicle- stimulating hormone receptor. J Biol Chem 271:33317–33324[Abstract/Free Full Text]
  20. Gromoll J, Dankbar B, Gudermann T 1994 Characterization of the 5' flanking region of the human follicle-stimulating hormone receptor gene. Mol Cell Endocrinol 102:93–102[CrossRef][Medline]
  21. Sirito M, Lin Q, Maity T, Sawadogo M 1994 Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acid Res. 22:427–433
  22. Gregor PD, Sawadogo M, Roeder RG 1990 The adenovirus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer. Genes Dev 4:1730–1740[Abstract/Free Full Text]
  23. Landschultz WH, Johnson PF, McKnight SL 1988 The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240:1759–1764[Abstract/Free Full Text]
  24. Roy AL, Du H, Gregor PD, Novina CD, Martinez E, Roeder RG 1997 Cloning of an inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO J 16:7091–7104[CrossRef][Medline]
  25. Luo X, Sawadogo M 1996 Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains. Mol Cell Biol 16:1367–1375[Abstract]
  26. Howcroft TK, Murphy C, Weissman JD, Huber SJ, Sawadogo M, Singer DS 1999 Upstream stimulatory factor regulates major histocompatibility complex class I gene expression: the U2DeltaE4 splice variant abrogates E-box activity. Mol Cell Biol 19:4788–4797[Abstract/Free Full Text]
  27. Griswold MD, Heckert LL, Linder CC 1995 The molecular biology of the FSH receptor. J Steroid Biochem Mol Biol 53:215–218[CrossRef][Medline]
  28. Heckert LL, Daley IJ, Griswold MD 1992 Structural organization of the follicle-stimulating hormone receptor gene. Mol Endocrinol 6:70–80[Abstract/Free Full Text]
  29. Viollet B, Lefrancois-Martinez AM, Henrion A, Kahn A, Raymondjean M, Martinez A 1996 Immunochemical characterization and transacting properties of upstream stimulatory factor isoforms. J Biol Chem 271:1405–1415[Abstract/Free Full Text]
  30. Lin Q, Luo X, Sawadogo M 1994 Archaic structure of the gene encoding transcription factor USF. J Biol Chem 269:23894–23903[Abstract/Free Full Text]
  31. Qyang Y, Luo X, Lu T, Ismail PM, Krylov D, Vinson C, Sawadogo M 1999 Cell-type-dependent activity of the ubiquitous transcription factor USF in cellular proliferation and transcriptional activation. Mol Cell Biol 19:1508–1517[Abstract/Free Full Text]
  32. Ismail PM, Lu T, Sawadogo M 1999 Loss of USF transcriptional activity in breast cancer cell lines. Oncogene 18:5582–5591[CrossRef][Medline]
  33. McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245:494–499[Abstract/Free Full Text]
  34. Sprengel R, Braun T, Nikolics K, Segaloff DL, Seeburg PH 1990 The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA. Mol Endocrinol 4:525–530[Abstract/Free Full Text]
  35. Dufau ML, Tsai-Morris CH, Hu ZZ, Buczko E 1995 Structure and regulation of the luteinizing hormone receptor gene. J Steroid Biochem Mol Biol 53:283–291[CrossRef][Medline]
  36. Hefnawy EI, Krawczyk Z, Nikula H, Vihera I, Huhtaniemi I 1996 Regulation of function of the murine luteinizing hormone receptor promoter by cis- and trans-acting elements in mouse Leydig tumor cells. Mol Cell Endocrinol 119:207–217[CrossRef][Medline]
  37. Hamalainen T, Poutanen M, Huhtaniemi I 1999 Age- and sex-specific promoter function of a 2-kilobase 5'-flanking sequence of the murine luteinizing hormone receptor gene in transgenic mice. Endocrinology 140:5322–5329[Abstract/Free Full Text]
  38. Karl AF, Griswold MD 1990 Sertoli cells of the testis: preparation of cell cultures and effects of retinoids. Methods Enzymol 190:71–75[Medline]
  39. McGuinness MP, Linder CC, Morales CR, Heckert LL, Pikus P, Griswold MD 1994 Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 51:116–124[Abstract]
  40. Heckert LL, Schultz K, Nilson JH 1995 Different composite regulatory elements direct expression of the human {alpha} subunit gene to pituitary and placenta. J Biol Chem 270:26497–26504[Abstract/Free Full Text]
  41. Faria TN, Soares MJ 1991 Trophoblast cell differentiation: establishment, characterization, and modulation of a rat trophoblast cell line expressing members of the placental prolactin family. Endocrinology 129:2895–2906[Abstract/Free Full Text]
  42. Mueller PR, Garrity PA, Wold B 1994 Ligation-mediated PCR for genomic sequencing and footprinting, In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) Current Protocols in Molecular Biology. Greene and Wiley Inter-Science, New York, pp 15.5.1–15.5.26
  43. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature 227:680–685[CrossRef][Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
N. Lei, T. Karpova, K. I. Hornbaker, D. A. Rice, and L. L. Heckert
Distinct Transcriptional Mechanisms Direct Expression of the Rat Dmrt1 Promoter in Sertoli Cells and Germ Cells of Transgenic Mice
Biol Reprod, July 1, 2009; 81(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. A. Wood and W. H. Walker
USF1/2 Transcription Factor DNA-Binding Activity Is Induced During Rat Sertoli Cell Differentiation
Biol Reprod, January 1, 2009; 80(1): 24 - 33.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. P. Hermann, K. Hornbaker, D. A. Rice, M. Sawadogo, and L. L. Heckert
In Vivo Regulation of Follicle-Stimulating Hormone Receptor by the Transcription Factors Upstream Stimulatory Factor 1 and Upstream Stimulatory Factor 2 Is Cell Specific
Endocrinology, October 1, 2008; 149(10): 5297 - 5306.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. S. Tash, B. Attardi, S. A. Hild, R. Chakrasali, S. R. Jakkaraj, and G. I. Georg
A Novel Potent Indazole Carboxylic Acid Derivative Blocks Spermatogenesis and Is Contraceptive in Rats after a Single Oral Dose
Biol Reprod, June 1, 2008; 78(6): 1127 - 1138.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Utsunomiya, Y.-H. Cheng, Z. Lin, S. Reierstad, P. Yin, E. Attar, Q. Xue, G. Imir, S. Thung, E. Trukhacheva, et al.
Upstream Stimulatory Factor-2 Regulates Steroidogenic Factor-1 Expression in Endometriosis
Mol. Endocrinol., April 1, 2008; 22(4): 904 - 914.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Bhardwaj, M. K. Rao, R. Kaur, M. R. Buttigieg, and M. F. Wilkinson
GATA Factors and Androgen Receptor Collaborate To Transcriptionally Activate the Rhox5 Homeobox Gene in Sertoli Cells
Mol. Cell. Biol., April 1, 2008; 28(7): 2138 - 2153.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Lei, K. I Hornbaker, D. A Rice, T. Karpova, V. A Agbor, and L. L Heckert
Sex-Specific Differences in Mouse DMRT1 Expression Are Both Cell Type- and Stage-Dependent During Gonad Development
Biol Reprod, September 1, 2007; 77(3): 466 - 475.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Ghoneim, M. Soula-Rothhut, C. Blanchevoye, L. Martiny, F. Antonicelli, and B. Rothhut
Activating Transcription Factor-1-mediated Hepatocyte Growth Factor-induced Down-regulation of Thrombospondin-1 Expression Leads to Thyroid Cancer Cell Invasion
J. Biol. Chem., May 25, 2007; 282(21): 15490 - 15497.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. P. Hermann and L. L. Heckert
Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron
Mol. Endocrinol., August 1, 2005; 19(8): 2112 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Selva, K. N. Hogeveen, and G. L. Hammond
Repression of the Human Sex Hormone-binding Globulin Gene in Sertoli Cells by Upstream Stimulatory Transcription Factors
J. Biol. Chem., February 11, 2005; 280(6): 4462 - 4468.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Scobey, C. A. Fix, and W. H. Walker
The Id2 Transcriptional Repressor Is Induced by Follicle-stimulating Hormone and cAMP
J. Biol. Chem., April 16, 2004; 279(16): 16064 - 16070.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Lei and L. L. Heckert
Gata4 Regulates Testis Expression of Dmrt1
Mol. Cell. Biol., January 1, 2004; 24(1): 377 - 388.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Yamada, H. Kawata, T. Mizutani, T. Arima, T. Yazawa, K. Matsuura, Z. Shou, T. Sekiguchi, M. Yoshino, T. Kajitani, et al.
Gene Expression of Basic Helix-Loop-Helix Transcription Factor, SHARP-2, Is Regulated by Gonadotropins in the Rat Ovary and MA-10 Cells
Biol Reprod, January 1, 2004; 70(1): 76 - 82.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Falender, R. Lanz, D. Malenfant, L. Belanger, and J. S. Richards
Differential Expression of Steroidogenic Factor-1 and FTF/LRH-1 in the Rodent Ovary
Endocrinology, August 1, 2003; 144(8): 3598 - 3610.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Charron, J. N. DeCerbo, and W. W. Wright
A GC-Box Within the Proximal Promoter Region of the Rat Cathepsin L Gene Activates Transcription in Sertoli Cells of Sexually Mature Rats
Biol Reprod, May 1, 2003; 68(5): 1649 - 1656.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Charron, J. S. Folmer, and W. W. Wright
A 3-Kilobase Region Derived from the Rat Cathepsin L Gene Directs In Vivo Expression of a Reporter Gene in Sertoli Cells in a Manner Comparable to That of the Endogenous Gene
Biol Reprod, May 1, 2003; 68(5): 1641 - 1648.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. K. Rao, C. M. Wayne, M. L. Meistrich, and M. F. Wilkinson
Pem Homeobox Gene Promoter Sequences that Direct Transcription in a Sertoli Cell-Specific, Stage-Specific, and Androgen-Dependent Manner in the Testis in Vivo
Mol. Endocrinol., February 1, 2003; 17(2): 223 - 233.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. P. Scherrer, D. A. Rice, and L. L. Heckert
Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within Its Proximal Promoter
Biol Reprod, November 1, 2002; 67(5): 1509 - 1521.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
L. L. Heckert and M. D. Griswold
The Expression of the Follicle-stimulating Hormone Receptor in Spermatogenesis
Recent Prog. Horm. Res., January 1, 2002; 57(1): 129 - 148.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-H. Chen, M. D. Layne, M. Watanabe, S.-F. Yet, and M. A. Perrella
Upstream Stimulatory Factors Regulate Aortic Preferentially Expressed Gene-1 Expression in Vascular Smooth Muscle Cells
J. Biol. Chem., December 7, 2001; 276(50): 47658 - 47663.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
W. Xing and M. R. Sairam
Role of CACC-Box in the Regulation of Ovine Follicle-Stimulating Hormone Receptor Expression
Biol Reprod, October 1, 2001; 65(4): 1142 - 1149.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. S. Richards
Perspective: The Ovarian Follicle--A Perspective in 2001
Endocrinology, June 1, 2001; 142(6): 2184 - 2193.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. L. Heckert
Activation of the Rat Follicle-Stimulating Hormone Receptor Promoter by Steroidogenic Factor 1 Is Blocked by Protein Kinase A and Requires Upstream Stimulatory Factor Binding to a Proximal E Box Element
Mol. Endocrinol., May 1, 2001; 15(5): 704 - 715.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
K. Yamada, T. Mizutani, Z. Shou, T. Yazawa, T. Sekiguchi, M. Yoshino, T. Inazu, and K. Miyamoto
Cloning and Functional Expression of an E Box-Binding Protein from Rat Granulosa Cells
Biol Reprod, May 1, 2001; 64(5): 1315 - 1319.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heckert, L. L.
Right arrow Articles by Chen, J. k.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heckert, L. L.
Right arrow Articles by Chen, J. k.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals