| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INSERM U540 (G.L.) "Endocrinologie Moléculaire et
Cellulaire des Cancers" 34090 Montpellier, France
Institut de Biologie Animale (G.L., L.C., D.S., W.W.)
Université de Lausanne 1015 Lausanne, Switzerland
| ABSTRACT |
|---|
|
|
|---|
, ß, and
activate the transcription of
multiple genes involved in lipid metabolism. Several natural and
synthetic ligands have been identified for each PPAR isotype but little
is known about the phosphorylation state of these receptors. We show
here that activators of protein kinase A (PKA) can enhance mouse PPAR
activity in the absence and the presence of exogenous ligands in
transient transfection experiments. Activation function 1 (AF-1) of
PPARs was dispensable for transcriptional enhancement, whereas
activation function 2 (AF-2) was required for this effect. We also show
that several domains of PPAR can be phosphorylated by PKA in
vitro. Moreover, gel retardation experiments suggest that PKA
stabilizes binding of the liganded PPAR to DNA. PKA inhibitors
decreased not only the kinase-dependent induction of PPARs but also
their ligand-dependent induction, suggesting an interaction between
both pathways that leads to maximal transcriptional induction by
PPARs. Moreover, comparing PPAR
knockout (KO) with PPAR
WT mice,
we show that the expression of the acyl CoA oxidase (ACO) gene can be
regulated by PKA-activated PPAR
in liver. These data demonstrate
that the PKA pathway is an important modulator of PPAR activity, and we
propose a model associating this pathway in the control of fatty acid
ß-oxidation under conditions of fasting, stress, and exercise. | INTRODUCTION |
|---|
|
|
|---|
, ß, and
(NR1C1, NR1C2, NR1C3) (1), which are encoded by separate genes and
exhibit distinct tissue distribution, belong to the nuclear receptor
superfamily (2). This family includes receptors for sexual and adrenal
steroids, retinoids, thyroid hormone, vitamin D, ecdysone, and a number
of so-called orphan receptors whose ligands are still unknown (3, 4).
PPARs were first shown to be activated by substances that induce
peroxisome proliferation (5, 6). PPARs share a common structure of five
domains named A/B, C, D, and E (the F domain is absent from PPARs
compared with other members of the superfamily) (7). Key functions have
been assigned to each of these domains (for review Refs. 2, 8). The
N-terminal A/B domain contains the ligand-independent transcription
activation function 1 (AF-1) (9). The C domain has a characteristic
helix-loop-helix structure stabilized by two zinc atoms and is
responsible for the binding to peroxisome proliferator response
elements (PPREs) in the promoter region of target genes. The D domain
is a hinge region that can modulate the DNA binding ability of the
receptor and that is involved in corepressor binding (10). The E domain
has a ligand binding function and exhibits a strong ligand-dependent
activation function (AF-2). In a classical manner, the ligand binding
domain facilitates the heterodimerization of PPAR with the retinoid X
receptor (RXR). In its active state, this heterodimer is able to
associate with coactivators (11, 12, 13) and, when bound to a PPRE, to
modulate the expression of target genes. It was also recently demonstrated that phosphorylation can modulate PPAR activity (14, 15, 16, 17, 18, 19, 20, 21), but there are no data available concerning the phosphorylation of PPAR by the protein kinase A (PKA) pathway. PKA activity is enhanced in the liver under conditions of stress, fasting, or exercise (22, 23). Under these conditions, PPAR target genes such as acyl-CoA oxidase are up-regulated (24, 25, 26).
The purpose of this work was to investigate whether PKA
activators, mimicking stress, fasting, or exercise, could modulate the
activity of PPARs. We performed a detailed analysis of the effects of
PKA on the activity of the mouse PPAR
, ß, and
isotypes. We
observed a PKA-dependent enhancement of the activity of all three
isotypes in a ligand-independent and ligand-dependent manner on two
distinct promoters. Several, but not all, PKA activators were able to
produce this effect. Moreover, PKA inhibitors were able to repress the
action of PKA activators. Interestingly, PKA inhibitors were able to
repress the effect of PPAR ligands by 5075%, suggesting that these
ligands might act in part with the help of the PKA pathway. By using
glutathione-S-transferase (GST) fusions of PPARs, we
demonstrate that PKA is able to phosphorylate different subdomains of
PPARs in vitro, the DNA-binding domain (DBD) being the main
phosphorylation target. Finally, using hepatocytes isolated from
wild-type (WT) and PPAR
KO mice, we show that PKA activators can
enhance the expression of certain PPAR
target genes and that PKA
inhibitors repress WY 14,643-dependent stimulation of these genes.
These findings highlight the involvement of the PKA pathway in PPAR
action and furthermore suggest that it might be essential for the
regulation of gene activation by PPAR ligands.
| RESULTS |
|---|
|
|
|---|
Activity on PPRE-Containing
Promoters
expression vector along
with the PPRE-containing 2CYPA6-TK-CAT reporter construct or the
thymidine kinase-chloramphenicol acetyltransferase (TK-CAT)
construct as a control (Fig. 1
ligand) and/or cholera
toxin (CT) as a PKA activator. In the absence or the presence of
cotransfected PPAR
, expression of the TK-CAT construct was not
significantly affected by WY 14,643 or by CT. In the absence of
PPAR
, the 2CYPA6-TK-CAT construct, which contains functional PPREs,
was not stimulated by WY 14,643 or by CT. When the PPAR
expression
vector was cotransfected, PPAR
stimulated the activity of the
2CYPA6-TK-CAT construct in the presence of WY 14,643 (up to 7-fold
compared with PPAR
in the absence of ligand). Addition of CT to the
WY 14,643 treatment produced a further enhancement of PPAR
activity
of about 2-fold compared with WY 14,643 treatment alone. In the absence
of WY 14,643, CT by itself also had a stimulatory effect of about
2-fold. These results demonstrate that PKA activators can enhance
PPAR
activity.
|
, ß, and
expression vectors along with the
2CYPA6-TK-CAT reporter construct (Fig. 2
, bromopalmitate for mPPARß, and BRL
49,653 for mPPAR
) and/or CT. PPAR
stimulated the activity of the
reporter construct in a WY 14,643 dose-dependent manner. Addition of CT
to the WY 14,643 treatment produced a further enhancement of PPAR
activity even at saturating concentrations of WY 14,643. The same
enhancement of activity by CT in the presence of ligand was obtained
with PPARß and with PPAR
. Since these observations were made with
mPPARs, we tested whether amphibian PPARs would behave similarly. We
observed that amphibian PPAR activity was also enhanced by PKA in a
ligand-independent and ligand-dependent manner (data not shown), thus
suggesting that the PPAR response to the PKA pathway is well conserved
throughout evolution.
|
, ß, and
in the presence of
exogenous ligands, even though the effect was less pronounced than with
the 2CYPA6-TK-CAT reporter gene. Addition of CT was able to increase
PPAR activity 2 to 3 times. Interestingly, the ligand-independent
effect of CT on PPAR activity was more pronounced on the ACO-TK-CAT
reporter than on the 2CYPA6-TK-CAT reporter. These data suggest that
the enhancement by PKA of PPAR activity can be mediated by distinct
PPREs that might modulate the extent of the response.
|
expression vector and the 2CYPA6-TK-CAT reporter construct
(Fig. 4B
|
,
ß, and
activity but also the ligand-dependent activation as well
as the activation due to CT and ligand used together. In addition, the
basal receptor activity, in the absence of exogenous ligand, was also
repressed. These data suggest that PKA affects both the basal and
ligand-regulated activities of the PPARs. To ensure that the effects
observed with CT or H89 were not due to a change in PPAR expression, we
checked by Western blot the levels of expression PPAR
after
treatment with WY 14,643, CT, or H89 (Fig. 5B
protein was
detected only after transfection of PPAR
expression vector.
Moreover, PPAR
protein levels were unchanged after treatment with WY
14,643, CT, or H89, alone or in combination. These data demonstrate
that the effects observed in transfection assays are not due to changes
in PPAR expression levels.
|
whole-cell extract (WCE) in the absence of added
drug. Surprisingly, WY 14,643 treatment decreased PPAR
DNA binding
ability. CT also diminished PPAR
DNA binding ability but to a lesser
extent. Interestingly, the combination of WY 14,643 and CT enabled PPAR
to bind to DNA more strongly than WY 14,643 or CT treatment alone. This
in agreement with the situation observed for ER
(NR3A1) for which
PKA inhibits the dimerization of the receptor in the absence of ligand
(28). Finally, H89 had the same ability to reduce PPAR DNA binding as
did WY 14,643. These data suggest that CT acts by stabilizing the
decreased DNA binding ability of the liganded receptor in this in
vitro assay.
RXR Contributes to PPAR Activation by PKA
As RXR is an obligate heterodimerization partner of the
PPARs for DNA binding and transactivation, we determined whether RXR
could be involved in the PKA activation of PPAR
(Fig. 6A
). In the absence of transfected RXR or
PPAR, the activity of the 2CYPA6-TK-CAT construct was very low and not
modulated by the WY 14,643 and CT. In the absence of transfected RXR,
transfected PPAR was active and modulated by PKA in HEK-293 cells, as
these cells express low levels of endogenous RXR. In contrast,
transfection of RXR alone in these cells had almost no effect on the
expression of the 2CYP4A6-TK-CAT reporter gene even in the presence of
9-cis-retinoic acid (9cRA, a ligand of RXR). However, we
observed an enhancement of PPAR
activity in the presence of 9cRA and
CT both in the absence and in the presence of WY 14,643.
Indeed, enhancement of the PPAR
activity was even more potent with
CT + 9cRA than with WY 14,643 + 9cRA. On the contrary, in the presence
of WY 14,643, 9c-RA had only a minor effect. By overexpressing RXR and
PPAR
simultaneously, in the absence of 9cRA, we observed an increase
by about 30% of PPAR
activation by WY 14,643, and a 2-fold activity
enhancement in the presence of CT and without ligand compared with
PPAR
without cotransfected RXR. RXR affected PPAR
activation only
moderately (
20%) by WY 14,643 + CT. In the presence of RXR and 9cRA
and in the absence of WY 14,643 and CT, we observed a 3-fold
enhancement of PPAR
activity compared with cells without 9cRA. In
the presence of WY 14,643 or WY 14,643 + CT, 9cRA increased the
activity by only 30% of that seen in the absence of 9cRA. Finally,
9cRA was unable to affect CT induction of PPAR
in the absence of WY
14,643. These data suggest that RXR cooperates with PPAR
in the
absence of exogenous ligand to increase both the basal and CT-induced
activity of PPAR
on PPREs. We next examined whether RXR was itself
the target of PKA when bound to its preferred binding site (DR1). To do
so, we used the DR1-TK-CAT construct containing a strong RXR binding
site (Fig. 6B
). We observed a strong activation of the construct by RXR
in the presence of retinoic acid (RA). CT treatment increased both
ligand-independent and ligand-dependent activity of RXR. Thus, it is
possible that RXR might enhance PPAR activity on PPREs by being itself
the target of PKA.
|
(Fig. 7A
AB mPPAR
), and the two others lacked the
AF-2 domain as the entire ligand-binding domain (LBD) (
LBD mPPAR
)
or the last 13 C-terminal residues (
AF2 mPPAR
) were deleted (Fig. 7A
AB mPPAR
construct had approximately the
same transactivation ability and exhibited the same enhancement of
activity by CT as the WT mPPAR
. On the contrary, the
LBD and
AF2 constructs were totally insensitive to WY 14,643 or CT
treatments. These data suggest that the AF-2 region is required for the
effects of PKA activators on PPARs and that the AF-1 region is not
essential. As a control, we checked the DNA binding ability of the
mutants by performing a gel shift assay using ACO PPRE (Fig. 7B
AB had the same ability to bind to DNA as WT PPAR
,
whereas
AF2 and
LBD had a weak or not detectable binding ability,
respectively. This lack of binding of
LBD mutant is in agreement
with previous reports (29). However, the weaker DNA binding ability of
the
AF2 mutant cannot explain entirely the lack of responsiveness to
CT and we hypothesized that the AF2 function was involved in PKA
stimulation. To confirm this hypothesis, we constructed GAL4 chimera
comprising either the AB domain or the LBD of PPAR
or the
full-length PPAR
fused to the GAL4 DBD (Fig. 7C
|
and
ß. The fusion proteins produced in bacteria were then purified on
Glutathione Sepharose columns and submitted to PKA treatment with
recombinant enzyme in the presence of
-[32P]-ATP (Fig. 8A
and PPARß,
suggesting that the DBD is the main phosphorylation target. These data
are in agreement with the effects of CT on DNA binding of PPAR
(see
above). Interestingly, the AB domain of mPPAR
was also
phosphorylated at a low level. We then mapped the putative sites of PKA
phosphorylation (Fig. 8B
|
Target Genes
in vivo,
and particularly in liver, which is one of the main sites of PPAR
action. To this end, isolated hepatocytes either from WT mice or from
PPAR
KO mice (30) were cultured in vitro and treated with
PKA activators or inhibitors in the absence or the presence of WY
14,643. The expression of the ACO (peroxisomal acyl-CoA oxidase) and
the FABP (fatty acid binding protein) genes, two PPAR
target genes,
was analyzed by Northern blot (Fig. 9A
ligand-dependent activation. In contrast, PPAR
KO hepatocytes were
not sensitive to CT or to WY 14,643 treatment, demonstrating that
PPAR
was required for the WY 14,643 and CT synergism in the
stimulation of the ACO gene. The expression of the FABP gene was
strongly enhanced by WY 14,643 in WT hepatocytes but not in PPAR
KO
hepatocytes, suggesting that distinct factors are required for ACO and
FABP stimulation by PPAR
. In WT hepatocytes, addition of CT did not
significantly affect FABP expression in the absence and in the presence
of WY 14,643. On the contrary, H89 reduced by about 90% the WY 14,643
induction of FABP expression, which is in agreement with our
transfection experiments. In PPAR
KO hepatocytes, the expression of
the FABP gene was not significantly affected by WY 14,643, CT, or H89,
demonstrating that PPAR
was required for FABP induction. In
conclusion, our data suggest that ligand and PKA activation of PPAR
converge in the stimulation of the PPAR target genes in
hepatocytes.
|
| DISCUSSION |
|---|
|
|
|---|
Early work from Shalev et al. (14) has shown that insulin
treatment can phosphorylate PPAR
. Insulin can also increase PPAR
and PPAR
2 activity in transient transfections. Insulin stimulation
of PPAR
involves mitogen-activated protein (MAP) kinases (15, 19).
On the contrary, other pathways stimulated by EGF (epidermal growth
factor) and PDGF (platelet-derived growth factor) also involving MAP
kinase have a negative effect on mPPAR
1 activity by phosphorylating
serine 82 in the AB domain, which corresponds to serine 112 of
mPPAR
2 (16, 17, 20). Further studies have demonstrated that this
negative effect of MAP kinase was due to the inhibition of ligand
binding resulting from an alteration of the three-dimensional structure
of the receptor (32).
Here we demonstrate by transient transfection experiments that PKA
activators can stimulate PPAR activity in an exogenous
ligand-independent manner. Moreover, a combination of PKA activators
and PPAR ligands leads to an increased activation of PPAR target genes.
Interestingly, this effect was obtained even at saturating
concentrations of PPAR ligands. Moreover, we show that these effects
are not due to a change in PPAR expression. This stimulatory effect of
PKA is in agreement with the results obtained with other nuclear
receptors. Most studies report an activation of nuclear receptors such
as estrogen receptor (ER
), glucocorticoid receptor (GR) (NR3C1),
mineralocorticoid receptor (MR) (NR3C2), progesterone receptor (PR)
(NR3C3), androgen receptor (AR) (NR3C4), or steroidogenic factor-1
(SF-1) (NR5A1) by PKA (28, 33, 34, 35, 36, 37, 38), whereas HNF4 (NR2A1) has been shown
to be down-regulated by PKA (39). Moreover, PKA-activated PPARs were
able to stimulate two types of PPREs, even though the amplitude of
response was different. Interestingly, PKA activators were nearly as
effective as PPAR ligands in activating the ACO PPRE, whereas they
could only activate the CYPA6 PPRE to levels corresponding to 2530%
of those obtained with PPAR ligands. Such differences were also found
with ER
according to the cell type and the promoter used
(40, 41, 42).
Using different PKA pathway activators, we observed that the most
potent ones were those affecting adenylate cyclase activity and not
those leading to a direct increase of cAMP, which can be obtained by
supplementation with cAMP analogs or inhibition of phosphodiesterase
activity. To address the question whether ligands by themselves would
activate the PKA pathway, we treated cells with H89, an inhibitor of
PKA (27). Interestingly, we observed that H89 could reduce not only the
CT induction of PPARs but also their induction by ligands such as WY
14,643, bromopalmitate, and BRL 49,653, suggesting that these ligands
might act in part through the PKA pathway. This result was not due to a
change in PPAR levels as shown by Western blot. An attractive
hypothesis would be that the ligands can also act indirectly by
modulating intracellular cAMP levels. Such observations have indeed
been reported for estrogens, which are able to increase intracellular
cAMP levels, which in turn activate PKA and increases ER
activity
(34).
As PPARs act essentially as heterodimers, it was of particular interest
to determine whether their heterodimer partner (RXR) could be involved
in PPAR activation by PKA. Surprisingly, in the absence of 9cRA (RXR
ligand), cotransfection of RXR moderately affected PPAR
activity in
the presence of WY 14,643, but increased PPAR
activity by about
2-fold without any ligand, leading to an activation by CT equal to the
one with WY 14,643. In the presence of RA, RXR conferred an even
stronger ligand-independent activity on PPAR
. This might be
explained by the fact that RXR is itself activated by PKA as shown on
the DR1-TK-CAT construct. RAR and RXR activation by PKA have been
previously reported (43, 44, 45). Thus, in the absence of WY 14,643 but in
the presence of RA, it seems that the PKA action on RXR heterodimerized
with PPAR leads to a major enhancement of the activity of PPAR/RXR
heterodimers. However, we cannot exclude the possibility that other
factors, such as coactivators or general transcription factors, could
also be the targets of PKA.
Using truncated PPAR
constructs, we determined that the AF-2 domain
was most important for transactivation by PKA. Deletion of the AB
domain from PPAR
only slightly affected its basal and
ligand-induced activity, which is in agreement with previous data
(29). Interestingly, CT was still able to potentiate WY 14,643
induction of the truncated PPAR
, demonstrating that the AF-1
function was not involved in the potentiation by PKA. On the contrary,
AF-2 deletion completely abolished WY 14,643 as well as CT activation
of PPAR
. Our data obtained with the GAL4 chimeras clearly confirm
that AF2, but not AF1, is required for PKA action. The demonstration
that AF2 is the target of PKA is in agreement with the results found
for PKA activation of ER
(42, 46) or SF-1 (38). However, for AR (37)
and MR (47), the N-terminal portion seemed to be involved in PKA
effects. Interestingly, CT had no effect on the ligand-independent
activity of the GAL-AF2 chimera, suggesting that other domains of the
receptors are necessary. To better characterize the domains involved,
we analyzed the phosphorylation of different domains of PPAR by using
GST-PPAR fusions. We observed a very strong phosphorylation of the DBD,
a weaker one for the AB domain, and a faint one for the LBD, again
suggesting that several domains are involved in the activation of PPARs
by the PKA pathway. This result is confirmed by the mapping of the most
conserved putative PKA sites, which are present in the A/B, DBD, and
LBD domains. As the main phosphorylation site is present in the DBD, we
analyzed whether the drugs used could modulate the DNA binding ability
of PPAR
in vitro. To our surprise, WY 14,643 and CT
strongly inhibited PPAR
DNA binding. However, cotreatment with WY
14,643 and CT led only to a limited decreased binding. We thus propose
that CT might act in part by preventing the decreased binding of PPAR
liganded with WY 14,643. This stabilization would, in turn, increase
PPAR activity. This in agreement with a previous report (28), which
shows that ER
DNA binding is inhibited by PKA only in the absence of
estradiol. This report also shows that the target of PKA is in the DBD
of ER
. Rangarajan et al. (33) have also demonstrated that
PKA enhancement of liganded GR required specific residues of the DBD.
In this case, however, they observed an enhancement of GR binding in
the presence of PKA. This suggests that, depending on the receptors,
the mechanisms of enhancement of the activity by PKA requires different
functions of the receptor. To summarize the mechanism of PPAR
activation by PKA, our data suggest that several events might occur:
the phosphorylation of PPAR, the involvement of PPAR AF-2 domain, the
modulation of PPAR DNA binding, the activation of RXR, and maybe the
involvement of other factors such as coactivators or basal
transcription factors. It might be the combination of all of these
events that leads to PPAR activation.
A crucial question was whether PKA does modulate the expression of PPAR
target genes? To answer this question, we focused on the role of
PPAR
in the liver and took advantage of PPAR
KO mice. We analyzed
the expression of two target genes, ACO and FABP (48, 49). In WT mice
hepatocytes cultured in vitro, we demonstrated that
cotreatment with WY 14,643 and CT led to a synergistic activation of
the ACO gene expression. On the other hand, the FABP gene was only
weakly affected by addition of exogenous PKA activators, but addition
of PKA inhibitors strongly diminished its induction by WY 14,643,
confirming the results obtained in transient transfection experiments.
In PPAR
KO mice, ACO was not subjected to stimulation by WY 14,643
or CT alone or in combination, confirming that PPAR
was essential to
PKA activation of the ACO gene. In these mice, FABP induction by WY
14,643 was completely abolished. FABP, which is involved in fatty acid
(FA) binding in hepatocytes, and ACO in ß-oxidation of FA,
could therefore be integrated in the following model involving the PKA
pathway (Fig. 9B
): Under conditions of stress, fasting, or exercise,
brain and muscles rely on increased energy fuel availability,
essentially glucose and ketone bodies. One way for the organism to meet
these needs is to stimulate gluconeogenesis and ketogenesis. The
adipose tissue hydrolyzes triglycerides to liberate free nonesterified
fatty acids, which are released into the blood circulation and are then
rapidly taken up by the liver to be transformed into ketone bodies.
PPAR
and PPAR
are directly involved in the regulation of several
key enzymes of these pathways. Stress, fasting, or exercise are also
associated with an increased glucagon production (one of the key
factors increasing cAMP levels in cells and thus activating PKA) by the
adrenal gland (50). PKA increases PPAR
activity in liver, which in
turn stimulates the ß-oxidation and in particular the conversion of
FA into acetyl-CoA used in the production of ketone bodies (51).
Results from our laboratory (52) have also demonstrated that fasting
did not affect FABP expression in WT mice. On the contrary, ACO gene
expression has been shown to be up-regulated by fasting in WT mice but
not in PPAR
KO mice (24, 26), confirming the scheme of regulation we
propose. In addition, PPAR
KO mice exhibited an increased
accumulation of FA in liver, due to impaired ß-oxidation (53).
In conclusion, our results suggest that under conditions of stress,
fasting, and exercise, PPAR
activity is increased by the PKA pathway
and leads to an enhancement of ß-oxidation and production of glucose
and ketone bodies, which serve as fuel for muscles and brain.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotide Sequences
ACO1: GCCACCGCCTATGCCTTCCACTTT ACO2:
CGGCTTGCACGGCTCTGTCTTGA LPL1: CCTGCGGGCCCTATGTTTG LPL2:
CTCGCCGATGTCTTTGTCCAGT mFABP1: CAATTGCAGAGCCAGGAGAACTTT
mFABP2: CAATGTCGCCCAATGTCA
Plasmids
The reporter plasmid 2CYP-TK-CAT contains two copies of the
CYP4A6 PPRE cloned in opposite orientations upstream of the minimal
herpes simplex virus thymidine kinase (TK) promoter in the pBLCAT8+
plasmid (54). ACO-TK-CAT plasmid corresponds to the Acyl-CoA oxidase
promoter PPRE cloned in PBLCAT8+ as described by Dreyer et
al. (6). DR1-TK-CAT corresponds to the perfect DR1 sequence
(AGCTTCATTCTAGGTCAAAGGTCATCCCCT) cloned in the
pBLCAT8+ plasmid. pG5CAT reporter plasmid (CLONTECH Laboratories, Inc., Palo Alto, CA) corresponds to five Gal4 binding sites
upstream of the E1b minimal promoter. Mouse and Xenopus PPAR
, ß, and
cDNAs were cloned into the BamHI site of
the pSG5 mammalian expression vector. For PKA in vitro
assays, portions of mPPAR cDNAs were amplified by PCR and then
subcloned into the BamHI site of the prokaryotic expression
vector pGEX1. mPPAR
AB [amino acids (aa) 1101] was cloned into
the SmaI/BamHI sites of pGEX1. mPPAR
DBD
domain (aa 98203), mPPARß DBD domain (aa 68129), mPPAR
LBD (aa
202468), and mPPARß LBD (aa 136396) were cloned into the
BamHI site of pGEX1. pSG5-mPPAR
AB was obtained by
removing aa 1101 from WT mPPAR
by PCR and pSG5-mPPAR
LBD by
removing sequences downstream from residue 247. pSG5-mPPAR
AF2
was obtained by removing the last 13 residues from WT mPPAR
.
GAL-AF1, GAL-AF2, and Gal-PPAR expression plasmids correspond to the AB
domain (aa 1100), LBD domain (aa 165468), or full-length receptor
(aa 1468), respectively, cloned in Gal4 DBD pM vector (CLONTECH Laboratories, Inc.).
In Vitro Translation
In vitro translation was performed using the TNT kit
(Promega Corp.). Briefly, 1 µg of expression vector was
mixed to 25 µl of TNT rabbit reticulocyte lysate, 2 µl of TNT
buffer, 1 µl of mix containing all amino acids, 1 µl of RNAsin (50
U/µl), and 1 µl of T7 RNA polymerase (20 U/µl). A control
reaction was performed under the same conditions but
[35S]methionine (15 µCi/µl) was used to
label the protein produced. The final reaction volume was 50 µl. The
reaction was performed for 1.5 h at 30 C. The translation
efficiency was checked by loading 1 µl of labeled lysate on an
SDS-PAGE gel.
Gel Mobility Shift Assays
Gel mobility shift assays were carried out as previously
described (55). Briefly, [32P]-labeled ACoA
(GATCCCGAACGTGACCTTTGTCCTGGTCCCGATC) double strand oligonucleotide (56)
was combined with in vitro translated PPAR or HEK-293 WCE
and, when indicated, mRXRß2 Sf9 cellular
extract. Protein-DNA complexes were separated from the free probe by
nondenaturating gel electrophoresis with 4% polyacrylamide (29/1) gels
in 0.5x TBE (Tris-borate-EDTA).
Cell Culture and Transient Transfection
HEK-293 cells (human embryonic kidney cells) were cultured in
10% FCS DMEM-F12 with 5% CO2. Cells were plated
in 24-well plates in 10% CDFCS-phenol-free DMEM 24 h before
transfection. Transfections were performed by lipofection
(lipofectamine, Life Technologies, Inc., Gaithersburg, MD)
using 200 ng of CAT reporter construct, 400 ng of the internal
reference ß-galactosidase reporter plasmid (pCH110), and 100 ng of
pSG5-PPAR or pSG5-hRXR
expression vectors per well. After
lipofection, the cells were grown in 10% CDFCS-DMEM in the presence of
different ligands for 36 h. Transactivation ability was determined
by CAT activity on the WCE as previously described (55).
Hepatocyte Isolation and Culture
Hepatocytes were isolated from liver of adult male WT (SV129) or
PPAR
KO mice using a two-step in situ portal vein
collagenase A (Roche Molecular Biochemicals, Indianapolis,
IN) perfusion method (57). Freshly isolated hepatocytes were filtered
through a nylon membrane to remove tissue debris and cell clumps. The
cell suspension was washed in Leibovitzs L-15 medium and resuspended
twice after centrifugation. The isolated hepatocytes were suspended in
Williams medium E supplemented with 10% FCS, 100 µg/ml
streptomycin, and 100 µg/ml penicillin and seeded in dishes at the
density of 5.105 cells/ml medium. The medium was
renewed 4 h later to remove dead cells. Cells were then treated
with or without WY 14,643 (10 µM) and CT (1
µg/ml), in the presence or not of H89 (10
µM). Cultures were maintained at 37 C in a
humidified air/CO2 incubator (5%
CO2, 95% air) for 24 h.
WCE Preparation and Western Blot
HEK-293 cells were harvested, washed in PBS, and resuspended in
TEG (10 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, and
10% glycerol)/0.4 M KCl containing 5 µg/ml aprotinin,
leupeptin, and pepstatin A and 0.1 mM phenylmethylsulfonyl
fluoride. Then, cells were sonicated and the cellular debris was
pelleted by centrifugation at 14,000 rpm for 20 min in microfuge tubes.
Thirty micrograms of WCE proteins were subjected to SDS-PAGE followed
by electrotransfer onto a nitrocellulose membrane. The blot was probed
with anti-PPAR
AB antibody (1:1,000) (polyclonal rabbit antibody
produced in our laboratory and directed against mPPAR
AB region) and
then incubated with rabbit antirabbit IgG horseradish
peroxidase-conjugated antibody (1 µg/ml). An ECL kit from
Amersham Pharmacia Biotech (Arlington, IL) was used for
protein detection.
RNA Isolation and Northern Blot
Total RNA was isolated from isolated hepatocytes using the
Trizol reagent from Life Technologies, Inc. as described
by the manufacturer. ACO and FABP probes were amplified by RT-PCR. The
amplifying primers were as follows: ACO1 and ACO2
primers for mouse peroxisomal ACO probe (10361690); mFABP1 and mFABP2
for mouse fatty acid binding protein (FABP) probe (61394) (see
above).
For Northern blot analysis, 20 µg of total RNA was electrophorized in a 2.2 M formaldehyde-1% agarose gel in MOPS buffer and then hybridized with the different probes as previously described (58).
Production of GST Fusion Proteins
Production of GST fusion proteins was performed as previously
described (13). Protein concentration was estimated by the Bradford
method. The levels of expressed fusion proteins were determined by an
in vitro binding assay followed by SDS-PAGE and a Coomassie
blue staining.
In Vitro PKA Assays with Glutathione Sepharose
Glutathione Sepharose (Pharmacia Biotech, Uppsala,
Sweden) was equilibrated with NET binding buffer [150 mM
NaCl, 50 mM Tris-HCl (pH 7.4), 5 mM EDTA].
Crude bacterial extract containing GST fusion proteins was incubated at
4 C with 25 µl of beads for 2.5 h. After two washes with NETN
(NET + 0.5% NP40), the beads were washed twice with PKA buffer [50
mM Tris-HCl (pH 7.5), 10 mM NaCl, 1
mM DTT, 10 mM MgCl2, 10%
glycerol]. The beads were then incubated in a mix containing 50 µl
of PKA buffer, 45 U of PKA catalytic subunit, 0.5 µl
-[32P]ATP, and 0.5 µl ATP 2.5
mM for 45 min at 30 C. After two washes with NETN, beads
were boiled in SDS loading buffer, and a quarter of the proteins were
run on SDS-PAGE. The gel was then stained with Coomassie blue. After
extensive washes with a solution containing 20% methanol and 10%
acetic acid, the gel was submitted to autoradiography.
| ACKNOWLEDGMENTS |
|---|
and mPPARß cDNAs, respectively. We are also grateful to
Dr. F. J. Gonzalez for the PPAR
KO mice. We thank Dr. L.
Michalik for the gift of mPPAR antibody and Dr. A. K. Hihi for the gift
of mRXRß2 Sf9 cellular extract. We thank
J. Y. Cance for the photography work. | FOOTNOTES |
|---|
This work was supported by grants from INSERM, the Swiss National Foundation and the Etat de Vaud.
Received for publication March 24, 2000. Revision received September 13, 2000. Accepted for publication September 14, 2000.
| REFERENCES |
|---|
|
|
|---|
. Importance of
-helical structure in the
transactivating function. J Biol Chem 274:3515235158
is a phosphoprotein: regulation by insulin. Endocrinology 137:44994502[Abstract]
. J
Biol Chem 271:3177131774
is inhibited by phosphorylation at a consensus
mitogen-activated protein kinase site. J Biol Chem 272:51285132
in rat Fao cells and stimulation by ciprofibrate. Biochem
Pharmacol 58:10011008[CrossRef][Medline]
by
phosphorylation of a ligand-independent trans-activating domain. J
Biol Chem 274:1050510510
.
Science 274:21002103
(PPAR-
)-differential
activity of PPAR-
-1 and -2 isoforms and influence of insulin. J
Biol Chem 272:2023020235
controls the hepatic
CYP4A induction adaptive response to starvation and diabetes. J
Biol Chem 273:3158131589
) in the
cellular fasting response: The PPAR
-null mouse as a model of fatty
acid oxidation disorders. Proc Natl Acad Sci USA 96:74737478
by protein kinase A regulates dimerization.
Mol Cell Biol 19:10021015
isoform of the peroxisome proliferator-activated receptor
gene in mice results in abolishment of the pleiotropic effects of
peroxisome proliferators. Mol Cell Biol 15:30123022[Abstract]
. Nature 396:377380[CrossRef][Medline]
: evidence that
the AF-1 region functions in a cell-specific manner. Nucleic Acids Res 24:264271
by protein kinase A. Mol Endocrinol 9:860871
and RAR
is indispensable for differentiation of F9 cells upon
retinoic acid and cAMP treatment. EMBO J 16:64526465[CrossRef][Medline]
(PPAR-
). J Biol Chem 273:56785684
mediates
the adaptive response to fasting. J Clin Invest 103:14891498[Medline]
-isoform deficiency
leads to progressive dyslipidemia with sexually dimorphic obesity and
steatosis. J Biol Chem 273:2957729585
-leukotriene B4 pathway to inflammation
control. Nature 384:3943[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Y. Park, H. K. Shin, J. H. Lee, C. D. Kim, W. S. Lee, B. Y. Rhim, and K. W. Hong Cilostazol Ameliorates Metabolic Abnormalities with Suppression of Proinflammatory Markers in a db/db Mouse Model of Type 2 Diabetes via Activation of Peroxisome Proliferator-Activated Receptor {gamma} Transcription J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 571 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Gan, J. Huang, R. Zhou, J. Niu, X. Zhu, J. Wang, Z. Zhang, and T. Tong PPAR{gamma} accelerates cellular senescence by inducing p16INK4{alpha} expression in human diploid fibroblasts J. Cell Sci., July 1, 2008; 121(13): 2235 - 2245. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Coll, E. Eyre, R. Rodriguez-Calvo, X. Palomer, R. M. Sanchez, M. Merlos, J. C. Laguna, and M. Vazquez-Carrera Oleate Reverses Palmitate-induced Insulin Resistance and Inflammation in Skeletal Muscle Cells J. Biol. Chem., April 25, 2008; 283(17): 11107 - 11116. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gomberg-Maitland and H. Olschewski Prostacyclin therapies for the treatment of pulmonary arterial hypertension Eur. Respir. J., April 1, 2008; 31(4): 891 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamamoto, H. Shimano, N. Inoue, Y. Nakagawa, T. Matsuzaka, A. Takahashi, N. Yahagi, H. Sone, H. Suzuki, H. Toyoshima, et al. Protein Kinase A Suppresses Sterol Regulatory Element-binding Protein-1C Expression via Phosphorylation of Liver X Receptor in the Liver J. Biol. Chem., April 20, 2007; 282(16): 11687 - 11695. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chen, X. Cheng, M. Z. Dieter, Y. Tanaka, and C. D. Klaassen Activation of cAMP-Dependent Signaling Pathway Induces Mouse Organic Anion Transporting Polypeptide 2 Expression Mol. Pharmacol., April 1, 2007; 71(4): 1159 - 1164. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Michalik, V. Zoete, G. Krey, A. Grosdidier, L. Gelman, P. Chodanowski, J. N. Feige, B. Desvergne, W. Wahli, and O. Michielin Combined Simulation and Mutagenesis Analyses Reveal the Involvement of Key Residues for Peroxisome Proliferator-activated Receptor{alpha} Helix 12 Dynamic Behavior J. Biol. Chem., March 30, 2007; 282(13): 9666 - 9677. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Avallone, A. Demers, A. Rodrigue-Way, K. Bujold, D. Harb, S. Anghel, W. Wahli, S. Marleau, H. Ong, and A. Tremblay A Growth Hormone-Releasing Peptide that Binds Scavenger Receptor CD36 and Ghrelin Receptor Up-Regulates Sterol Transporters and Cholesterol Efflux in Macrophages through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway Mol. Endocrinol., December 1, 2006; 20(12): 3165 - 3178. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, T. Wang, C. Ma, T. Xiong, Y. Zhu, and X. Wang Calcitonin gene-related peptide inhibits interleukin-1beta-induced endogenous monocyte chemoattractant protein-1 secretion in type II alveolar epithelial cells Am J Physiol Cell Physiol, September 1, 2006; 291(3): C456 - C465. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wagatsuma Upregulation of gene encoding adipogenic transcriptional factors C/EBP{alpha} and PPAR{gamma}2 in denervated muscle Exp Physiol, July 1, 2006; 91(4): 747 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Paumelle, C. Blanquart, O. Briand, O. Barbier, C. Duhem, G. Woerly, F. Percevault, J.-C. Fruchart, D. Dombrowicz, C. Glineur, et al. Acute Antiinflammatory Properties of Statins Involve Peroxisome Proliferator-Activated Receptor-{alpha} via Inhibition of the Protein Kinase C Signaling Pathway Circ. Res., February 17, 2006; 98(3): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Li, Z. Zhu, Y. Lu, and J. G. Granneman Metabolic and cellular plasticity in white adipose tissue II: role of peroxisome proliferator-activated receptor-{alpha} Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E617 - E626. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Al-Rasheed, R. S. Chana, R. J. Baines, G. B. Willars, and N. J. Brunskill Ligand-independent Activation of Peroxisome Proliferator-activated Receptor-{gamma} by Insulin and C-peptide in Kidney Proximal Tubular Cells: DEPENDENT ON PHOSPHATIDYLINOSITOL 3-KINASE ACTIVITY J. Biol. Chem., November 26, 2004; 279(48): 49747 - 49754. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Blanquart, R. Mansouri, R. Paumelle, J.-C. Fruchart, B. Staels, and C. Glineur The Protein Kinase C Signaling Pathway Regulates a Molecular Switch between Transactivation and Transrepression Activity of the Peroxisome Proliferator-Activated Receptor {alpha} Mol. Endocrinol., August 1, 2004; 18(8): 1906 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Su, D. J. Mancuso, P. E. Bickel, C. M. Jenkins, and R. W. Gross Small Interfering RNA Knockdown of Calcium-independent Phospholipases A2 {beta} or {gamma} Inhibits the Hormone-induced Differentiation of 3T3-L1 Preadipocytes J. Biol. Chem., May 21, 2004; 279(21): 21740 - 21748. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Froment, S. Fabre, J. Dupont, C. Pisselet, D. Chesneau, B. Staels, and P. Monget Expression and Functional Role of Peroxisome Proliferator-Activated Receptor-{gamma} in Ovarian Folliculogenesis in the Sheep Biol Reprod, November 1, 2003; 69(5): 1665 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Francis, J.-S. Annicotte, and J. Auwerx PPAR-{alpha} effects on the heart and other vascular tissues Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H1 - H9. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Welch, M. Ricote, T. E. Akiyama, F. J. Gonzalez, and C. K. Glass PPAR{gamma} and PPAR{delta} negatively regulate specific subsets of lipopolysaccharide and IFN-{gamma} target genes in macrophages PNAS, May 27, 2003; 100(11): 6712 - 6717. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Teruel, R. Hernandez, M. Benito, and M. Lorenzo Rosiglitazone and Retinoic Acid Induce Uncoupling Protein-1 (UCP-1) in a p38 Mitogen-activated Protein Kinase-dependent Manner in Fetal Primary Brown Adipocytes J. Biol. Chem., January 3, 2003; 278(1): 263 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lim and S. K. Dey Minireview: A Novel Pathway of Prostacyclin Signaling--Hanging Out with Nuclear Receptors Endocrinology, September 1, 2002; 143(9): 3207 - 3210. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Muoio, P. S. MacLean, D. B. Lang, S. Li, J. A. Houmard, J. M. Way, D. A. Winegar, J. C. Corton, G. L. Dohm, and W. E. Kraus Fatty Acid Homeostasis and Induction of Lipid Regulatory Genes in Skeletal Muscles of Peroxisome Proliferator-activated Receptor (PPAR) alpha Knock-out Mice. EVIDENCE FOR COMPENSATORY REGULATION BY PPARdelta J. Biol. Chem., July 12, 2002; 277(29): 26089 - 26097. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Schoppee, J. C. Garmey, and J. D. Veldhuis Putative Activation of the Peroxisome Proliferator-Activated Receptor {gamma} Impairs Androgen and Enhances Progesterone Biosynthesis in Primary Cultures of Porcine Theca Cells Biol Reprod, January 1, 2002; 66(1): 190 - 198. [Abstract] [Full Text] |
||||
![]() |
D. P. Kelly The Pleiotropic Nature of the Vascular PPAR Gene Regulatory Pathway Circ. Res., November 23, 2001; 89(11): 935 - 937. [Full Text] [PDF] |
||||
![]() |
D. A. Schreihofer, E. M. Resnick, V. Y. Lin, and M. A. Shupnik Ligand-Independent Activation of Pituitary ER: Dependence on PKA-Stimulated Pathways Endocrinology, August 1, 2001; 142(8): 3361 - 3368. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Bendixen, N. K. Shevde, K. M. Dienger, T. M. Willson, C. D. Funk, and J. W. Pike IL-4 inhibits osteoclast formation through a direct action on osteoclast precursors via peroxisome proliferator-activated receptor gamma 1 PNAS, February 15, 2001; (2001) 41493198. [Abstract] [Full Text] |
||||
![]() |
W. Cao, A. V. Medvedev, K. W. Daniel, and S. Collins beta -Adrenergic Activation of p38 MAP Kinase in Adipocytes. cAMP INDUCTION OF THE UNCOUPLING PROTEIN 1 (UCP1) GENE REQUIRES p38 MAP KINASE J. Biol. Chem., July 13, 2001; 276(29): 27077 - 27082. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Bendixen, N. K. Shevde, K. M. Dienger, T. M. Willson, C. D. Funk, and J. W. Pike IL-4 inhibits osteoclast formation through a direct action on osteoclast precursors via peroxisome proliferator-activated receptor gamma 1 PNAS, February 27, 2001; 98(5): 2443 - 2448. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |