| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pharmacology and Cancer Biology Duke University Medical Center Durham, North Carolina 27710
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ERß)
that display nonidentical expression patterns in target tissues. The
phenotypic alterations in response to estrogens in mice disrupted for
either or both of these receptors are not identical, suggesting that
each subtype plays a unique role in ER-action. However, the lack of
subtype-specific agonists and antagonists has made it difficult to
define the processes that are regulated by ER and/or ERß.
Previously, we have reported the identification and characterization of
a series of LXXLL-containing peptide antagonists that block estrogen
signaling by preventing the association of ER with required
coactivators. As expected, given the similarity of the coactivator
binding pockets among nuclear receptors, most of the peptide
antagonists identified inhibited the activity of multiple receptors.
However, by altering sequences flanking the core LXXLL motif, some
receptor selectivity was afforded. Building on this observation, we
have screened combinatorial phage libraries, expressing peptides in the
format X7LXXLLX7, for
peptides that interact in a specific manner with ERß. Using this
approach, a series of highly specific, potent peptide antagonists have
been identified that efficiently inhibit ERß-mediated estrogen
signaling when introduced into target cells. Interestingly, in cells
where both ER subtypes were expressed, these ERß antagonists were
capable of attenuating ER action, suggesting that ER and ERß do
indeed form functional heterodimeric complexes. We believe that
suitably formulated versions of these peptides can be used to study
ERß action in vitro and in vivo. In addition,
the unanticipated specificity of the peptides identified should serve
as an impetus to investigate the use of this approach to develop
peptide antagonists of other nuclear receptors and unrelated
transcription factors. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Until recently it was thought that all of the biological actions of
estrogens and antiestrogens were manifest through a single receptor
located within target cell nuclei. However, the identification of a
second estrogen receptor, ERß (6, 7), has indicated that estrogen
signaling is more complex. The two ER subtypes, ER and ERß, share
extensive amino acid similarity in their ligand- and DNA-binding
domains, but minimal homology within their amino-terminal regions. Not
surprisingly therefore, these receptors exhibit similar, but not
identical, ligand binding characteristics (8) and interact with the
same DNA response elements. The most obvious difference between the two
receptors is that ER is a more efficient activator of ERE-containing
genes than ERß under most circumstances (7, 9, 10, 11). In addition, it
has been noted that ERß can interact in a constitutive manner with
target promoters and can attenuate the ligand-activated transcriptional
activity of ER (11). Thus, in cells where both receptors are
expressed, overall estrogen responsiveness is reduced.
In parallel with studies performed in vitro, the creation
and characterization of mice in which either ER and/or ERß have
been disrupted (ERKO, ßERKO and ßERKO, respectively) have
demonstrated that the two receptors are not functionally equivalent and
that each subtype plays a unique role in ER action in vivo
(12, 13). However, it is clear that in addition to these mouse models,
there is a need for subtype-selective agonists and antagonists that
will permit the transient manipulation of receptor function in intact
animals. Consequently, to complement the efforts of others who are
engaged in screening for small molecules that interact with the
ligand-binding pockets of ER and ERß (15), we have undertaken a
novel approach to develop subtype-specific antagonists that inhibit
ERß action in a manner distinct from known antiestrogens.
All of the currently available ER antagonists function by 1) binding to
the receptor ligand-binding domain, thereby blocking agonist access,
and 2) inducing a conformational change within the receptor that
prevents it from interacting efficiently with transcriptional
coactivators such as SRC-1, GRIP1, and amplified in breast cancer 1
(AIB-1). Specifically, it has been shown that agonist binding to the
receptor induces a conformational change that permits the formation of
a hydrophobic pocket (16, 17), enabling the receptor to interact with
the LXXLL motif contained within the receptor interaction domains of
most of the validated coactivators (18, 19). The conformational changes
induced in ER upon antagonist binding do not permit coactivator
recruitment (19). Clearly, the most direct method of inhibiting ER
function would be to develop drugs that bind directly to the
coactivator binding pockets within ER or ERß and block coactivator
recruitment. Given that the coactivator binding pockets in ER,
ERß, and other nuclear receptors are structurally similar and that
most of the known coactivators do not appear to demonstrate receptor
selectivity, it was not obvious that the receptor-cofactor binding
pocket was a bona fide drug target. However, we have recently
identified a series of LXXLL-containing peptides that interact very
well with the coactivator binding pocket of ERß, but which
demonstrate distinct preferences in their ability to interact with
other receptors (20). Thus, all LXXLL motifs are not functionally
equivalent. Building on this observation, in the current study we have
identified LXXLL-containing peptides that interact specifically with
ERß and inhibit its transcriptional activity. We believe that these
novel peptide antagonists will serve as useful tools to evaluate the
role of ERß in estrogen signaling. In addition, we anticipate that
the general approach used to obtain these ERß antagonists can be
applied to the development of peptide antagonists of other nuclear
receptors and unrelated transcription factors.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Characterization of the ERß-Selective LXXLL-Containing Peptides
in Intact Cells
We performed a mammalian two-hybrid assay to assess the
ability of the peptide sequences identified by phage display to
interact selectively with ERß in intact cells. Each of the 33
ERß-selective peptides identified in vitro were expressed
as a yeast Gal 4 DNA-binding domain (Gal4DBD) fusion protein and tested
for their ability to interact with ER and/or ERß expressed as
fusions to the VP16 activation domain. Expression of the
peptide-fusions was confirmed by Western immunoblotting (data not
shown). A Gal4DBD-fusion of the NR-box of the ER coactivator SRC-1
(containing three LXXLL motifs), shown previously to interact with both
ER and ERß, was used in this assay as a positive control. When
analyzed in the two-hybrid assay, it was found that 15 of the 33
peptides studied interacted with ERß, but not ER. Representative
examples are shown in Fig. 1
of those
peptides that were isolated in the screen with the apo-ERß (Fig. 1A),
and those identified with the agonist-liganded receptor (Fig. 1B).
Interestingly, several of the peptides were able to bind ERß in the
absence of ligand, suggesting either that a portion of the ERß
aporeceptor resides in an active conformation, or that the binding of
LXXLL-containing motifs to the receptor may facilitate activation.
Using the mammalian-two hybrid assay, it was also shown that the
introduction of inactivating point mutations into the AF-2 region of
ERß (11) completely abolished the interaction of each peptide with
the receptor (see Fig. 7A, below). These results suggested that the
peptides were targeting the coactivator binding pocket, and thus would
be able to antagonize ERß transcriptional activity.
|
|
and ERß has been shown to require agonist activation
of the receptor (3, 4, 5). The surprising finding that some
LXXLL-containing peptides can interact with apo-ER begged a
reevaluation of the role of ligand in regulating ERß-LXXLL
interactions. This was accomplished using the mammalian two-hybrid
assay to examine the effect of different ER ligands on peptide binding.
As expected, the interactions between the Gal4DBD-SRC-1, and
Gal4DBD-GRIP1 NR-box fusions and ERß were enhanced by the addition of
the agonists 17ß-estradiol and genistein (Fig. 2A). However, administration of
antiestrogens alone antagonized the basal receptor-peptide
interactions. Interestingly, both of the control peptide fusions showed
significant levels of hormone-independent interaction with ERß. A
similar observation was made in vitro, where
glutathione-Stransferase (GST)-pull down assays
revealed that both SRC-1 and GRIP1 interacted with ERß in the absence
of hormone (data not shown).
|
) and those whose
interaction was strictly agonist dependent (Fig. 2C). The profiles of
three representative peptides from each group are shown. Several of the
peptide fusions (ERß-interacting peptides EBIP-37 and EBIP-44)
interacted equally well with ERß in the absence of hormone and in the
presence of agonist (Fig. 2B). However, these interactions were
antagonized by antiestrogen administration. Interestingly, peptide
EBIP-51 interacted most efficiently with apo-ERß, suggesting the
existence of cofactors that prefer to associate with ERß in a
constitutive manner (see Discussion). The binding of LXXLL
motifs to ERß in the absence of hormone was puzzling, in view of the
fact that it was previously observed that the human ERß does not
demonstrate ligand-independent transcriptional activity (11). This
result suggests that the aporeceptor may recruit cofactors in some
contexts, but that this interaction is not transcriptionally
productive. In these studies, we also observed that the antiprogestin
RU486 was able to decrease interactions between the peptides and
receptor in these assays, a result that agrees with recent reports that
RU486 can function as an ERß antagonist (23).
Nine of the peptide fusions studied were found to interact only with
agonist-activated ERß. Interestingly, within this class, three
distinct binding patterns were observed (Fig. 2C). Specifically,
peptide EBIP-92 appeared to interact more efficiently with
genisteinactivated ERß than that activated by 17ß-estradiol,
whereas the estradiol-activated receptor interacted equally as well
with EPIP-49, and more efficiently with EBIP-53. These data, indicating
that genistein and estradiol do not function in the same manner when
assayed on ERß, were interesting in light of the unique functional
properties that have recently been ascribed to genistein (8, 24).
Similar differences in efficacy were noted when the experiments were
repeated over a full range of ligand concentrations (data not shown).
These results suggest that estradiol and genistein induce unique
conformational changes within ERß. This hypothesis is supported by
recent crystallography studies that showed that ERß helix 12 (AF-2)
assumes a distinct position when occupied by genistein compared with
the distinctive agonist position observed for helix 12 of the
estradiol-bound ER (16, 25). If the estradiol-ER crystallographic
data are extrapolated to ERß, it is possible that genistein-liganded
ERß interacts with cofactors in a different manner than the
estradiol-activated receptor or that the former complex recruits a
unique coactivator in some settings.
Affinity Does Not Explain the Hormone-Independent Interaction of
LXXLL Peptides with ERß
One of the most interesting classes of peptides identified in this
study were those that interacted with ERß in a constitutive manner
but that were unable to interact with the receptor when occupied by
antagonists. A trivial explanation for these observed binding
characteristics was that these peptides had a higher affinity for ERß
than the peptides that required ligand. Alternatively, these peptides
may interact in a unique manner with the coactivator binding pocket
within ERß. These different possibilities were tested using a
quantitative phage ELISA. Specifically, the phage stocks of each
peptide-expressing clone were titered, and then the binding of
different concentrations of phage expressing peptides to ERß was
tested in the presence and absence of estradiol. The results of this
analysis, shown in Fig. 3, indicated that
even at the lowest input phage concentrations, the hormone-independent
peptides maintained their ligand-independent interactions with
ERß; two representative peptides are shown. This was in contrast to
the hormone-dependent peptides, which maintained their
estradiol-dependent interaction with ERß throughout the
range of phage concentrations (representative example shown in Fig. 3C). Neither the absolute numbers of phage binding to each target nor
the apparent binding affinity were significantly different. These
results indicate that receptor-binding affinity is not what
distinguishes peptides that interact with ERß in a ligand-dependent
manner from those that bind constitutively, but rather these classes of
LXXLL-containing peptides interact in different ways with the
ERß-coactivator binding pocket.
|
or ERß, together with an empty
Gal4DBD vector (pM) or Gal4DBD fusions of the peptides. The EBIP-37,
EBIP-41, and EBIP-45 peptides were used in these initial experiments,
because they appeared to interact most efficiently with ERß in the
mammalian two-hybrid system (Fig. 1A). Under the conditions of this
assay, we noted that the transcriptional activity of ER was
unaffected by overexpression of the ERß-selective peptides (Fig. 4A). Coexpression of the GRIP1 NR-box
sequence (three LXXLL motifs), however, inhibited ER transcriptional
activity by 77%, thus validating the use of LXXLL peptides as
antagonists of ER transcriptional responses. When the effect of our
peptides on ERß activity was assessed, we observed that all of the
LXXLL sequences functioned as effective antagonists (Fig. 4B).
Significantly, coexpression of peptide EBIP-37 with ERß resulted in
100% inhibition of the transcriptional response, whereas the EBIP-41,
EBIP-45, and GRIP-1 (NR-box) peptide fusions produced 85, 70, and 90%
inhibition, respectively. Western immunoblotting revealed that
expression of the peptides did not alter the cellular levels of ERß
(data not shown). These results indicate that it is possible to target
ERß-coactivator interactions in a selective manner and validate this
general approach to develop antagonists of additional members of the
nuclear receptor superfamily.
|
, ERß, and 11
different nuclear receptors. Table 1
summarizes the interactions observed between each of the peptides and
receptors in the presence of their cognate ligands. No clear pattern
emerged from these studies, as each receptor appeared to exhibit
distinct peptide binding preferences. Based on these results, it is
possible that most of the receptors will eventually be found to display
different cofactor preferences. The observation that the androgen
receptor (AR) did not interact with any of the peptides tested and that
ROR interacted with only two of the 15 peptides suggest that these
receptors might have very specific coactivator requirements.
|
), were found to interact with most of the
nuclear receptors tested. The most important result, however, was that
EBIP-56 and EBIP-92 interacted exclusively with ERß and did not
interact with any other receptor under the conditions tested. Other
peptides, such as EBIP-87 and EBIP-96, were found to interact with
multiple receptors. Cumulatively, the results of these studies indicate
that it is possible to identify LXXLL-containing peptides that interact
in a highly specific manner with ERß.
Evaluation of the Antagonist Properties of Peptides That Interact
in a Specific Manner with ERß
The antagonist efficacy of the ERß-specific peptides, EBIP-56
and EBIP-92, was next evaluated. The nuclear receptor interaction
regions of most of the well validated coactivators have been shown to
contain multiple LXXLL domains, which facilitate the interaction of
these proteins with the AF-2 coactivator binding pocket of their
targeted receptor (18). Reflecting this observation, we created
two-copy Gal4DBD fusions of our peptides. The two LXXLL motifs were
separated by sequences corresponding to the linker region between
NR-box 2 and NR-box 3 of GRIP1. When expressed in mammalian cells, we
observed that while the GRIP1 NR-box sequences inhibited the activity
of ER by 60%, the peptides 2xEBIP-56 and 2xEBIP-92 had no effect on
transcriptional response (Fig. 5A).
However, when tested on ERß, it was found that the 2xEBIP-56 and
2xEBIP-92 peptides suppressed estrogen-stimulated transcriptional
activity by 82% and 97%, respectively (Fig. 5B). Similar results were
obtained using 1xEBIP-56 and 1xEBIP-92, although higher levels of
expression of these peptides were required to attain the same degree of
antagonism as their dimeric counterparts. Western immunoblotting was
used to demonstrate that expression of these peptides did not alter
cellular levels of ERß (data not shown). Thus, ERß-specific
LXXLL-containing peptides can function as potent inhibitors of ERß
transcriptional activity.
|
/ERß Heterodimers is significantly greater than ERß in most
cell and promoter contexts (7, 9, 10, 11). Not surprisingly, therefore, in
cells engineered to produce both ER subtypes, the overall response to
estradiol is reduced. This suggests that one of the functions of ERß
is to modulate ER transcriptional activity in target cells. At
subsaturating concentrations of agonist, ERß completely suppresses
ER transcriptional activity, whereas no inhibition is observed when
the assay is performed in the presence of saturating concentrations of
17ß-estradiol (11). These findings suggest that the role of ERß in
estrogen signaling is complex. Previously, we have shown that ERß is
bound constitutively to DNA in the absence of hormone (11).
Consequently, at subsaturating concentrations of hormone, the receptor
is capable of competitively inhibiting the activity of ER homodimers
and ER/ERß heterodimers by blocking their ability to interact with
target gene promoters. Under saturating concentrations of hormone, we
have proposed that ER/ERß heterodimers form, and that the
functional properties of this complex are similar to that of an ER
homodimer. However, without a specific ERß antagonist, it has not
been possible to prove that the heterodimeric ER/ERß complex was
functionally active in cells.
The identification of specific peptide antagonists of ERß has enabled
us to evaluate the functional significance of ER/ERß heterodimers.
This was accomplished by determining the impact of expressing the
2xEBIP-92 antagonist in cells and examining its impact on ER and
ERß-mediated transcriptional activity. The results of this analysis
are shown in Fig. 6. As observed
previously, expression of 2x-EBIP-92 in cells had no effect on ER
transcriptional activity, whereas it completely suppressed ERß
activity. Importantly, however, in cells expressing both receptor
subtypes it was demonstrated that the ERß-specific antagonist,
2xEBIP-92, was capable of significantly reducing the transcriptional
activity of the ER/ERß heterodimer. To rule out the possibility
that, in the context of the heterodimer, the ERß-specific peptides
may interact directly with ER we used mammalian two-hybrid assays to
assess the interaction of the heterodimeric complexes with a subset of
the EBIPs. For this purpose, we created an ERß mutant that disrupts
AF-2 but that has no effect on the receptor’s ligand binding
characteristics. As shown in Fig. 7A, an
ERß-VP16, but not an ERß-3x-VP16, chimera was able to interact with
the LXXLL peptides when tested in the two-hybrid assay. Since ERß-3x
heterodimerizes with ER in a manner that was indistinguishable from
ERß it was possible to use this mutant to test the interaction of the
ERß-interacting peptides with the ER /ß heterodimer (11). First,
we demonstrated that expression of ER in target cells had no effect
on the ability of ERß to interact with EBIPs 37, 41, 56, or 92 (Fig. 7B). Although it would be difficult to quantitate the amount of
heterodimer formed under the conditions of this assay, the results
suggest that ERß specificity is maintained in this context. The most
important result, however, was that in cells expressing ER, the
ERß-3x-VP16 chimera was inactive in the two-hybrid assay (Fig. 7B).
Given the characteristics of the ERß-3x chimera, a positive
interaction in the two-hybrid assay would only have been possible if
the peptides were able to interact with the coactivator binding
pocket of ER. We conclude from this experiment that even within the
context of an ER/ERß heterodimer that the ER-interacting
characteristics of the EBIPs are maintained. Therefore, the inhibitory
effects of 2xEBIP-92 on the ER/ß heterodimer is mediated by
blocking ERß function. Thus, although it has been shown previously
that ER and ERß preferentially form heterodimers when coexpressed
(26, 27), we now demonstrate ERß contributes in a positive manner
to the overall activity of the complex under agonist saturating
conditions.
|
). Surprisingly, minimal homology was
observed outside of the conserved LXXLL motif between members within
the same class. However, we observed that the two ERß specific
peptides, EBIP-56 and EBIP-92, contain a tryptophan residue at position
-5 that was not found in any of the other 68 ERß-interacting
peptides that were isolated in the primary screen. Therefore, we
postulated that the tryptophan influenced the specificity of the
peptide-ERß interactions. To test this hypothesis, the tryptophan
residue in the EBIP-92 peptide was converted to glutamine (an amino
acid found at this position in many of the peptides identified).
Analysis using a mammalian two-hybrid revealed that while the wild-type
EBIP-92 interacted with ERß in a hormone-dependent manner, a variant
peptide in which the tryptophan residue at position -5 was mutated was
unable to interact with ERß (data not shown). These studies
demonstrate the importance of the sequences surrounding LXXLL motifs in
determining receptor selectivity and suggest that it may be possible to
use site-directed mutagenesis to optimize the interactions of the
peptides identified with their protein targets.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
/ERß heterodimeric complexes can form within
cells, and that ERß contributes in a positive manner to the overall
activity of the estrogen-activated complex.
Recently, it has been suggested that the two ER subtypes may oppose the
actions of each other in target organs. Although controversial, this
hypothesis is supported by the observation that the ßERKO mouse
displays epithelial hyperplasia in the prostate and bladder (14), an
increase in bone mineral content (28), and an increased responsiveness
to estrogen in the uterus (29), reflecting possibly an enhancement of
ER-mediated transcriptional activity. Using an appropriate delivery
system, it may be possible to antagonize ERß action using the
receptor-specific peptides and test directly the hypothesis that ERß
functions as an ER modulator in some tissues.
It has recently been shown that both ER subtypes are expressed in breast tumors (30, 31, 32) and that ERß expression is up-regulated in tumors that have developed tamoxifen resistance (32). Thus, there is an unmet medical need to develop novel ER antagonists as 1) potential breast cancer therapeutics and 2) tools to specifically define the role of ERß in breast cancer cell biology. The finding that none of the LXXLL-containing sequences in this study interact with antiestrogen-liganded receptor suggests that suitably formulated ER peptide antagonists could be coadministered with tamoxifen to completely block estrogen-stimulated proliferative pathways in the breast, using two mechanistically distinct modes of antagonism. Recent studies provide evidence that tamoxifen resistance in breast tumors may arise from the up-regulation of coactivator proteins, which may permit cells to recognize tamoxifen as an agonist and growth stimulant (22). The identification of peptides that disrupt receptor-coactivator interactions provides a novel mechanism by which the mitogenic actions of activated ER can be blocked in both antiestrogen-responsive and -resistant breast cancer cells. Theoretically, the peptide antagonists that we have identified could be developed as second line pharmaceutical treatments for ER-positive, tamoxifen-refractory tumors.
Previous studies in our laboratory (20) reported the identification of
the ERß selective peptide 293. However, while the peptide displays
selectivity for ERß over ER, 293 was found to interact with many
of the other nuclear receptors. In this study our goal was to develop
peptides that interacted in a completely specific manner with ERß,
which was accomplished in the discovery of peptides EBIP-56 and
EBIP-92. A similar study was recently reported (33) in which a panel of
LXXLL-containing peptides were identified that demonstrated selectivity
for ERß over thyroid hormone receptor (TR). However, the authors of
that study indicated that most of their ERß-interacting peptides
cross-react with ER. Thus, EBIP-56 and EBIP-92 represent the only
reagents available that can be used to specifically inhibit ERß
transcriptional activity.
Ligand-Independent Recruitment of LXXLL Motifs
One of the most important findings of this study was that
the unliganded ERß is capable of recruiting many of the LXXLL
peptides. Interestingly, studies with ER showed that
LXXLL-containing sequences were capable of a low but significant basal
level of interaction in the absence of hormone (20). These results
suggested that a fraction of the ER molecules in a cell might reside
in an active conformation, thus permitting recruitment of LXXLL motifs
in the absence of receptor agonists. This may explain why ER can
activate transcription in some contexts in the absence of hormone.
Surprisingly, although apo-ERß is capable of binding several
different LXXLL-containing peptides, this form of the receptor does not
activate transcription in the absence of agonist (11). Consistent with
this observation, we have shown using in vitro
protein-protein interaction studies that ERß, but not ER, can bind
to GRIP1 in the absence of ligand (our unpublished results). One
possibility is that the ERß aporeceptor is present in an inhibitory
complex containing both coactivators and corepressors, and that the
binding of hormone enhances the functionality of associated activators
and promotes the dissociation of repressor proteins. Alternatively,
unliganded ERß may bind to some cofactors in a manner that is not
transcriptionally productive. An activity of this nature has not yet
been demonstrated for ERß; however, it has been shown that unliganded
peroxisome proliferator activated receptor-
(PPAR) interacts with
the coactivator PGC-1 (PPAR coactivator 1, a protein that has no
apparent coactivator activity), and this protein is responsible for
recruiting SRC-1 when agonist is added (34).
The ability of nuclear receptors to interact with LXXLL motifs in their apo- state raises the possibility that ligand regulation of coactivator recruitment may have evolved to enable receptor activity to respond to changes in cellular homeostasis. Consistent with this hypothesis is the observation that several orphan receptors [estrogen-receptor-related proteins (ERR1, ERR2, and ERR3)] that have not yet been shown to require ligands bind SRC-1, GRIP1, or activator of thyroid receptor (ACTR) in a ligand-independent manner (35, 36). Similarly, the orphan receptor 1/ retinoid X receptor (OR1/RXR) heterodimer is capable of ligand-independent cofactor recruitment (37). Recent studies have also illustrated that ligand-independent signaling pathways can result in activation of ERß by promoting agonist-independent coactivator binding (38). These observations suggest that the general mechanisms of hormone-dependent and independent transcriptional activation by nuclear receptors may be similar, and that in some cases the role of ligand may be as a catalyst, but not as a required part of receptor activation. Thus, ERß may be a receptor whose state of evolution is intermediate between the orphan receptors and the more classical steroid receptors.
Nuclear Hormone Receptors Have Distinct Preferences for LXXLLs
A recurring theme in these studies is that nuclear receptors have
distinct preferences for LXXLL motifs. Previous work in our laboratory
using peptide display has demonstrated that the sequences flanking the
core LXXLL domain are important determinants of receptor selectivity
(20). Mutagenesis studies have also been used to identify residues
important for both receptor binding affinity and specificity (18, 39).
McInerney et al. demonstrated that of the three helical
LXXLL-containing regions of SRC-1, a single helical domain was
sufficient for ER activation, whereas a combination of two distinct
helical regions were required for PR, TR, retinoic acid receptor (RAR),
and PPAR actions (40). These studies indicate that different
receptors can interact with the same cofactor in different ways.
To complement these previous studies, we observed that peptide
EBIP-37 (identical to an LXXLL motif in RIP140) interacted selectively
with ERß, but not ER. Therefore, since RIP140 can bind to and
repress the transcriptional activities of both ER and ERß (Ref. 41
and our unpublished data), it is likely that each receptor
subtype utilizes distinct LXXLL motifs within this factor, enabling
them to bind. The observation that each of the receptors examined in
our study displayed a unique pattern of interaction with LXXLL peptides
also provides evidence that the receptors may bind different
coactivators, or alternatively, recruit the same factors by utilizing
distinct binding regions. It is likely therefore, that it will be
possible to develop LXXLL-containing antagonists for many of the
nuclear receptors. It was surprising, given the structural conservation
among the nuclear receptors and associated cofactors, that peptides
could be identified which block these interactions in a highly specific
manner. However, given that it has been possible to develop specific
ERß antagonists using this approach, we believe that it will be
feasible to identify inhibitors of a wide variety of transcription
factors by interfering with specific protein-protein interactions.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-dihydrotestosterone, T3, progesterone,
22R-hydroxycholesterol, and chenodeoxycholic acid were
purchased from Sigma (St. Louis, MO). RU486 was a gift
from Ligand Pharmaceuticals, Inc. (San Diego, CA). The
estrogen receptor antagonist ICI 182,780 was a gift from Dr. Alan
Wakeling (Zeneca Pharmaceuticals, Macclesfield, UK).
Raloxifene was a gift from Dr. Eric Larsen (Pfizer, Inc.,
Groton, CT). GW7604 was a gift from Dr. Tim Willson
(GlaxoWellcome, Research Triangle Park, NC); 1,25-dihydroxyvitamin
D3 was purchased from Duphar Pharmaceuticals
(Daweesp, The Netherlands). The mouse monoclonal anti-Gal4DBD antibody
was purchased from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). The rabbit polyclonal ERß antibody was a gift from
Dr. Geoffrey Greene (University of Chicago, Chicago, IL). Secondary
antibodies, Hybond-C extra transfer membranes, and ECL reagents were
purchased from Amersham Pharmacia Biotech (Arlington
Heights, IL).
Affinity Selection of ERß-Binding Peptides
Baculovirus-expressed human ERß (amino acids 1–477) was
purchased from PanVera Corp. (Madison, WI). ERß (4 pmol) was added to
100 µl of NaHCO3, pH 8.5, in single wells of a
96-well Immulon 4 plate (Dynex Technologies, Inc.). The protein was
then incubated in the absence or presence of
10-6 M 17ß-estradiol overnight at
4 C. A duplicate well containing BSA alone was used as a control. The
wells were blocked with 150 µl of 0.1% BSA in
NaHCO3 for 1 h at room temperature and then
washed five times with PBST (137 mM NaCl, 2.7
mM KCl, 4.3 mM
Na2HPO4, 1.4 mM
KH2PO4, pH 7.3, 0.1% Tween
20). Twenty five microliters of the phage library
(>1010 phage) were preincubated on ice for
1 h in 125 µl PBST, 0.1% BSA, and 10-6
M 17ß-estradiol or vehicle. The phage library was added
to the wells, and the plate was sealed and incubated at room
temperature for 8 h with gentle agitation. The wells were washed
five times with PBST to remove nonbinding phage. The binding phage were
eluted with 100 µl of 50 mM glycine-HCl, pH 2.0
(prewarmed to 50 C), and subsequently eluted with 100 µl of 100
mM ethanolamine, pH 11.0. The first eluant was neutralized
with 200 µl of 200 mM
Na2HPO4, pH 8.5, before
being combined with the second eluant. The bound phage were amplified
in DH5F' cells for 6 h and recovered by centrifugation. The
amplified phage were used for subsequent rounds of panning. Three
rounds of panning were performed. The enrichment of ERß binding phage
in each round of panning was confirmed by ELISA. Individual phage
clones were purified after the third round of panning. The
single-stranded phage DNA was isolated from each clone, and the peptide
sequences were determined by DNA sequencing.
ELISA
Purified ERß protein (0.4 pmol) was added to 96-well Immulon 4
plates as detailed above. Fifty microliters of each purified phage were
added to an individual well and incubated with the ER target for 1
h at room temperature. The assays were performed in the absence and
presence of 10-6 M of various ER ligands. The
wells were washed five times with PBST to remove nonbinding phage. The
binding of each peptide to full-length ER (provided by Panvera
Corp.) in the presence of various ER ligands was also tested in this
assay. A horseradish peroxidase-conjugated anti-M13 antibody
(Amersham Pharmacia Biotech) was diluted 1:5000 in PBST,
100 µl of the mixture was added to each well, and the solutions were
incubated for 1 h at room temperature. The wells were washed five
times with PBST, and immunocomplexes were detected with ABTS
(2',2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid) supplemented
with 0.05% H2O2. The
colorimetric change was quantitated by measuring the absorbance at 405
nm on a plate reader (Multiskan MS; Labsystems, Marlboro, MA).
Plasmids
The Gal4DBD-peptide fusions were constructed as follows. The
peptides were excised from the mBAX phage vectors with XbaI
and XhoI. The parent pMsx vector (20) (containing the
Gal4DBD) was digested with SalI and XbaI. The
peptides were then ligated in frame to the pMsx vector, creating
Gal4DBD-peptide fusion constructs. The constructs containing two copies
of the LXXLL-containing peptides (2x-EBIP-56 and 2x-EBIP-92) were
created as follows: pM-EBIP-56 and pM-EBIP-92 were digested with
XbaI. The linker region between the second and third LXXLL
motifs within the GRIP1 cDNA was amplified by PCR, digested with
NheI and XbaI, and ligated into pM-EBIP-56 and
pM-EBIP-92, at the 3' of the peptide coding region. These
vectors were then digested with SalI and XbaI and
an oligonucleotide encoding a second copy of the peptide was inserted
into these sites 3' to the GRIP1 linker. The construction of pM-SRC-1
(NR-box) and pM-GRIP1 (NR-box) has been described previously (20).
The mammalian expression plasmid for the peptide EBIP-92 mutant was constructed by site-directed mutagenesis as follows. The pM-EBIP-92 vector was used as the template, and a point mutation in the conserved tryptophan residue was created using PCR-based oligonucleotide-directed mutagenesis, according to the manufacturer’s protocol (Stratagene, La Jolla, CA). The sequences of the oligonucleotides used for PCR were 5'-CTCGAGAAGTGTTGAGCCGGGTCCGGAGCTGCTTAAGCTGCTGTCGGGGACGAGTGTGGCGGAG (forward) and 3'-CTCCGCCACACTCGTCCCCGACAGCAGCTTAAGCAGCTCCGGACCCGGCTCAACACTTCTCGAG (reverse).
pVP16ER, pVP16ERß, pVP16RAR, and pVP16RXR have been
described previously (20). VP16GR, VP16PR-A, VP16PR-B, and VP16AR
expression plasmids were gifts from J. Miner (VP16GR), D. X. Wen
(VP16PR-A and VP16PR-B), and K. Marschke (VP16AR) (Ligand Pharmaceuticals, Inc., San Diego, CA). VP16VDR was a gift of
J. W. Pike (University of Cincinnati, Cincinnati, OH), and the
VP16TRß expression plasmid (pCMX-VP-F-hTRß) was provided by D.
D. Moore (Baylor College of Medicine, Houston, TX). pVP16ROR-LBD was
a gift from A. R. Means (Duke University Medical Center, Durham,
NC). The cDNAs for the human liver X receptor (LXR) and rat farnesoid X
receptor (FXR) were provided by D. J. Mangelsdorf (University of
Texas, Dallas, TX). pVP16LXR, and pVP16FXR were created as described
previously for the other nuclear receptor VP16 fusions (20).
The mammalian expression plasmids for ER (pRST7ER) and ERß
(pRST7ERß) have been described previously (11, 42). The reporter
5x-GAL4-TATA-Luc (a gift from Dr. Xiao-Fan Wang, Duke University
Medical Center) contains five palindromic copies of the GAL4
transcription factor response element cloned into pGL2-TATA-Inr
(Stratagene). The 3x-ERE-TATA-Luc reporter contains three
copies of the vitellogenin ERE (43).
All of the PCR-based constructs were sequenced to verify the accuracy of the amplified sequences.
Cell Culture and Transient Transfection Assays
HepG2 cells were maintained in MEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FCS (Life Technologies, Inc.), 0.1 mM nonessential amino
acids, and 1 mM sodium pyruvate. Cells were plated in
24-well plates (coated with gelatin for transfections of HepG2 cells)
24 h before transfection. DNA was introduced into the cells using
lipofectin (Life Technologies, Inc.). Triplicate
transfections were performed using 3 µg of total DNA. In standard
mammalian two-hybrid assays, 1,500 ng of reporter (5x-GAL4-TATA-Luc),
500 ng of receptor-VP16 fusion, 500 ng of pM (Gal4DBD)-peptide fusion
constructs, 100 ng of the pCMV-ßgal normalization vector (44), and
400 ng of the control vector pBSII-KS (Stratagene) were
used. For receptor disruption studies, 1,500 ng of reporter
(3x-ERE-TATA-Luc), 250 ng of receptor (either pRST7ER or
pRST7ERß), 1000 ng of pM-peptide fusion constructs or the parent pM
vector, 100 ng of pCMV-ßgal, and 150 ng of pBSII-KS were used. Cells
were incubated with the DNA/lipofectin mix for 3 to 6 h and then
washed with PBS and the transfection mix was replaced with phenol
red-free MEM containing 10% charcoal-stripped FCS (HyClone Laboratories, Inc., Logan, UT). The receptor ligands were added
to the cells 20–24 h before the assays. Luciferase and
ß-galactosidase assays were performed as described previously (45).
All experiments were repeated a minimum of three times.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
J.M.H. is supported by a Predoctoral Fellowship (DAMD17–97-1–7277) and C.-Y.C. by a postdoctoral fellowship (DAMD17–99-1–9173) from the US Army Medical Research Acquisition Activity (USAMRAA). This work was supported by a National Institute of Health Grant DK-48807 (to D.P.M.).
Received for publication April 10, 2000. Revision received July 24, 2000. Accepted for publication August 15, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1996 Cloning of a novel estrogen receptor expressed in rat
prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930 1997 Comparison of the ligand
binding specificity and transcript tissue distribution of estrogen
receptors and ß. Endocrinology 138:863–870 and ERß. J Steroid Biochem Mol Biol 69:165–175[CrossRef][Medline]
transcriptional activity and is a key regulator of the cellular
response to estrogens and antiestrogens. Endocrinology 140:5566–5578 and ß. Science 286:2328–2331, Smithies O 1998 Generation and
reproductive phenotypes of mice lacking estrogen receptor ß. Proc
Natl Acad Sci USA 95:15677–15682 or estrogen
receptor-ß. Endocrinology 140:800–804, Carlquist M 1997 Molecular
basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
and ß. Mol Cell Biol 19:8226–8239-1 promoter in response to tamoxifen and
other estrogen receptor antagonists, but not in response to agonists.
Mol Endocrinol 13:418–430, Nilsson S 1998 Differential response of estrogen
receptor and estrogen receptor ß to partial estrogen
agonists/antagonists. Mol Pharmacol 54:105–112, Carlquist M 1999 Structure of the ligand-binding domain of oestrogen receptor ß in the
presence of a partial agonist and a full antagonist. EMBO J 18:4608–4618[CrossRef][Medline]
and ß form heterodimers on DNA. J Biol Chem 272:19858–19862 1997 Mouse estrogen receptor ß forms estrogen response
element-binding heterodimers with estrogen receptor . Mol Endocrinol 11:1486–1496 in the uterus. Proc Natl Acad Sci USA 97:5936–5941 and ß messenger RNA expression during
human breast tumorigenesis. Cancer Res 58:3197–3201 and ß: poor
prognostic factors in human breast cancer? Cancer Res 59:525–528 coactivator-1 through
transcription factor docking. Science 286:1368–1371 1999 Ligand-independent coregulator recruitment by the triply
activatable OR1/retinoid X receptor- nuclear receptor heterodimer.
Mol Endocrinol 13:1105–1118This article has been cited by other articles:
 |
|
 |
|
  C. D. DuSell, E. R. Nelson, B. M. Wittmann, J. A. Fretz, D. Kazmin, R. S. Thomas, J. W. Pike, and D. P. McDonnell Regulation of Aryl Hydrocarbon Receptor Function by Selective Estrogen Receptor Modulators Mol. Endocrinol., January 1, 2010; 24(1): 33 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. van de Wijngaart, H. J. Dubbink, M. Molier, C. de Vos, J. Trapman, and G. Jenster Functional Screening of FxxLF-Like Peptide Motifs Identifies SMARCD1/BAF60a as an Androgen Receptor Cofactor that Modulates TMPRSS2 Expression Mol. Endocrinol., November 1, 2009; 23(11): 1776 - 1786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Di, L. Yu, A.B. Moore, L. Castro, X. Zheng, T. Hermon, and D. Dixon A low concentration of genistein induces estrogen receptor-alpha and insulin-like growth factor-I receptor interactions and proliferation in uterine leiomyoma cells Hum. Reprod., August 1, 2008; 23(8): 1873 - 1883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. DuSell, M. Umetani, P. W. Shaul, D. J. Mangelsdorf, and D. P. McDonnell 27-Hydroxycholesterol Is an Endogenous Selective Estrogen Receptor Modulator Mol. Endocrinol., January 1, 2008; 22(1): 65 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. B. Mettu, T. B. Stanley, M. A. Dwyer, M. S. Jansen, J. E. Allen, J. M. Hall, and D. P. McDonnell The Nuclear Receptor-Coactivator Interaction Surface as a Target for Peptide Antagonists of the Peroxisome Proliferator-Activated Receptors Mol. Endocrinol., October 1, 2007; 21(10): 2361 - 2377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Hall and D. P. McDonnell The Molecular Mechanisms Underlying the Proinflammatory Actions of Thiazolidinediones in Human Macrophages Mol. Endocrinol., August 1, 2007; 21(8): 1756 - 1768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wang, C. Zhang, S. K. Nordeen, and D. J. Shapiro In Vitro Fluorescence Anisotropy Analysis of the Interaction of Full-length SRC1a with Estrogen Receptors {alpha} and beta Supports an Active Displacement Model for Coregulator Utilization J. Biol. Chem., February 2, 2007; 282(5): 2765 - 2775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gaillard, M. A. Dwyer, and D. P. McDonnell Definition of the Molecular Basis for Estrogen Receptor-Related Receptor-{alpha}-Cofactor Interactions Mol. Endocrinol., January 1, 2007; 21(1): 62 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. van de Wijngaart, M. E. van Royen, R. Hersmus, A. C. W. Pike, A. B. Houtsmuller, G. Jenster, J. Trapman, and H. J. Dubbink Novel FXXFF and FXXMF Motifs in Androgen Receptor Cofactors Mediate High Affinity and Specific Interactions with the Ligand-binding Domain J. Biol. Chem., July 14, 2006; 281(28): 19407 - 19416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Hall and D. P. McDonnell Coregulators in Nuclear Estrogen Receptor Action: From Concept to Therapeutic Targeting Mol. Interv., December 1, 2005; 5(6): 343 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S K Nair, T J Thomas, N J Greenfield, A Chen, H He, and T Thomas Conformational dynamics of estrogen receptors {alpha} and {beta} as revealed by intrinsic tryptophan fluorescence and circular dichroism J. Mol. Endocrinol., October 1, 2005; 35(2): 211 - 223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Larson, D. L. Osburn, K. Schmitz, L. Giampa, S.-M. Mong, K. Marschke, H. M. Seidel, J. Rosen, and A. Negro-Vilar Peptide Binding Identifies an ER{alpha} Conformation That Generates Selective Activity in Multiple In Vitro Assays J Biomol Screen, September 1, 2005; 10(6): 590 - 598. [Abstract] [PDF]
|
|
|
|
|
|
M. S. Ozers, K. M. Ervin, C. L. Steffen, J. A. Fronczak, C. S. Lebakken, K. A. Carnahan, R. G. Lowery, and T. J. Burke Analysis of Ligand-Dependent Recruitment of Coactivator Peptides to Estrogen Receptor Using Fluorescence Polarization Mol. Endocrinol., January 1, 2005; 19(1): 25 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C M Klinge, S C Jernigan, K A Mattingly, K E Risinger, and J Zhang Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors {alpha} and {beta} by coactivators and corepressors J. Mol. Endocrinol., October 1, 2004; 33(2): 387 - 410. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nakajima, S. Fujino, G. Nakanishi, Y.-S. Kim, and A. M. Jetten TIP27: a novel repressor of the nuclear orphan receptor TAK1/TR4 Nucleic Acids Res., August 9, 2004; 32(14): 4194 - 4204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cabanes, M. Wang, S. Olivo, S. DeAssis, J.-A. Gustafsson, G. Khan, and L. Hilakivi-Clarke Prepubertal estradiol and genistein exposures up-regulate BRCA1 mRNA and reduce mammary tumorigenesis Carcinogenesis, May 1, 2004; 25(5): 741 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-L. Hsu, Y.-L. Chen, S. Yeh, H.-J. Ting, Y.-C. Hu, H. Lin, X. Wang, and C. Chang The Use of Phage Display Technique for the Isolation of Androgen Receptor Interacting Peptides with (F/W)XXL(F/W) and FXXLY New Signature Motifs J. Biol. Chem., June 20, 2003; 278(26): 23691 - 23698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Bai and V. Giguere Isoform-Selective Interactions between Estrogen Receptors and Steroid Receptor Coactivators Promoted by Estradiol and ErbB-2 Signaling in Living Cells Mol. Endocrinol., April 1, 2003; 17(4): 589 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Hall and K. S. Korach Analysis of the Molecular Mechanisms of Human Estrogen Receptors alpha and beta Reveals Differential Specificity in Target Promoter Regulation by Xenoestrogens J. Biol. Chem., November 8, 2002; 277(46): 44455 - 44461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Sathya, M. S. Jansen, S. C. Nagel, C. E. Cook, and D. P. MCDonnell Identification and Characterization of Novel Estrogen Receptor-{beta}-Sparing Antiprogestins Endocrinology, August 1, 2002; 143(8): 3071 - 3082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Willson and J. T. Moore Minireview: Genomics Versus Orphan Nuclear Receptors--A Half-Time Report Mol. Endocrinol., June 1, 2002; 16(6): 1135 - 1144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-Y. Chang and D. P. McDonnell Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes Mol. Endocrinol., April 1, 2002; 16(4): 647 - 660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Hall, D. P. McDonnell, and K. S. Korach Allosteric Regulation of Estrogen Receptor Structure, Function, and Coactivator Recruitment by Different Estrogen Response Elements Mol. Endocrinol., March 1, 2002; 16(3): 469 - 486. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Bramlett, Y. Wu, and T. P. Burris Ligands Specify Coactivator Nuclear Receptor (NR) Box Affinity for Estrogen Receptor Subtypes Mol. Endocrinol., June 1, 2001; 15(6): 909 - 922. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
