help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hall, J. M.
Right arrow Articles by McDonnell, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hall, J. M.
Right arrow Articles by McDonnell, D. P.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Molecular Endocrinology 14 (12): 2010-2023
Copyright © 2000 by The Endocrine Society

Development of Peptide Antagonists That Target Estrogen Receptor ß-Coactivator Interactions

Julie M. Hall, Ching-yi Chang and Donald P. McDonnell

Department of Pharmacology and Cancer Biology Duke University Medical Center Durham, North Carolina 27710


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The biological actions of estrogen are manifest through two genetically distinct estrogen receptors (ER{alpha} and ERß) that display nonidentical expression patterns in target tissues. The phenotypic alterations in response to estrogens in mice disrupted for either or both of these receptors are not identical, suggesting that each subtype plays a unique role in ER-action. However, the lack of subtype-specific agonists and antagonists has made it difficult to define the processes that are regulated by ER{alpha} and/or ERß. Previously, we have reported the identification and characterization of a series of LXXLL-containing peptide antagonists that block estrogen signaling by preventing the association of ER{alpha} with required coactivators. As expected, given the similarity of the coactivator binding pockets among nuclear receptors, most of the peptide antagonists identified inhibited the activity of multiple receptors. However, by altering sequences flanking the core LXXLL motif, some receptor selectivity was afforded. Building on this observation, we have screened combinatorial phage libraries, expressing peptides in the format X7LXXLLX7, for peptides that interact in a specific manner with ERß. Using this approach, a series of highly specific, potent peptide antagonists have been identified that efficiently inhibit ERß-mediated estrogen signaling when introduced into target cells. Interestingly, in cells where both ER subtypes were expressed, these ERß antagonists were capable of attenuating ER action, suggesting that ER{alpha} and ERß do indeed form functional heterodimeric complexes. We believe that suitably formulated versions of these peptides can be used to study ERß action in vitro and in vivo. In addition, the unanticipated specificity of the peptides identified should serve as an impetus to investigate the use of this approach to develop peptide antagonists of other nuclear receptors and unrelated transcription factors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The human estrogen receptor (ER) belongs to the nuclear receptor superfamily of ligand-inducible transcription factors (1), whose members include the receptors for steroids, thyroid hormone, retinoic acid, vitamin D, and orphan receptors for which no ligands have yet been identified. The mechanism of action of ER is similar to that of other nuclear receptors (2). In the absence of hormone, the receptor is sequestered within the nuclei of target cells in an inactive state. The binding of ligand induces an activating conformational change within ER, an event that permits the receptor to interact with transcriptional coactivators such as steroid receptor coactivator 1 (SRC-1) and glucocorticoid receptor interacting protein 1 (GRIP1) (3, 4), and which facilitates the association of the resulting complex with specific DNA response elements (EREs) located within the regulatory regions of target genes. Depending on the promoter context, the DNA-bound receptor can then exert either a positive or negative effect on target gene transcription (2, 5).

Until recently it was thought that all of the biological actions of estrogens and antiestrogens were manifest through a single receptor located within target cell nuclei. However, the identification of a second estrogen receptor, ERß (6, 7), has indicated that estrogen signaling is more complex. The two ER subtypes, ER{alpha} and ERß, share extensive amino acid similarity in their ligand- and DNA-binding domains, but minimal homology within their amino-terminal regions. Not surprisingly therefore, these receptors exhibit similar, but not identical, ligand binding characteristics (8) and interact with the same DNA response elements. The most obvious difference between the two receptors is that ER{alpha} is a more efficient activator of ERE-containing genes than ERß under most circumstances (7, 9, 10, 11). In addition, it has been noted that ERß can interact in a constitutive manner with target promoters and can attenuate the ligand-activated transcriptional activity of ER{alpha} (11). Thus, in cells where both receptors are expressed, overall estrogen responsiveness is reduced.

In parallel with studies performed in vitro, the creation and characterization of mice in which either ER{alpha} and/or ERß have been disrupted ({alpha}ERKO, ßERKO and {alpha}ßERKO, respectively) have demonstrated that the two receptors are not functionally equivalent and that each subtype plays a unique role in ER action in vivo (12, 13). However, it is clear that in addition to these mouse models, there is a need for subtype-selective agonists and antagonists that will permit the transient manipulation of receptor function in intact animals. Consequently, to complement the efforts of others who are engaged in screening for small molecules that interact with the ligand-binding pockets of ER{alpha} and ERß (15), we have undertaken a novel approach to develop subtype-specific antagonists that inhibit ERß action in a manner distinct from known antiestrogens.

All of the currently available ER antagonists function by 1) binding to the receptor ligand-binding domain, thereby blocking agonist access, and 2) inducing a conformational change within the receptor that prevents it from interacting efficiently with transcriptional coactivators such as SRC-1, GRIP1, and amplified in breast cancer 1 (AIB-1). Specifically, it has been shown that agonist binding to the receptor induces a conformational change that permits the formation of a hydrophobic pocket (16, 17), enabling the receptor to interact with the LXXLL motif contained within the receptor interaction domains of most of the validated coactivators (18, 19). The conformational changes induced in ER upon antagonist binding do not permit coactivator recruitment (19). Clearly, the most direct method of inhibiting ER function would be to develop drugs that bind directly to the coactivator binding pockets within ER{alpha} or ERß and block coactivator recruitment. Given that the coactivator binding pockets in ER{alpha}, ERß, and other nuclear receptors are structurally similar and that most of the known coactivators do not appear to demonstrate receptor selectivity, it was not obvious that the receptor-cofactor binding pocket was a bona fide drug target. However, we have recently identified a series of LXXLL-containing peptides that interact very well with the coactivator binding pocket of ERß, but which demonstrate distinct preferences in their ability to interact with other receptors (20). Thus, all LXXLL motifs are not functionally equivalent. Building on this observation, in the current study we have identified LXXLL-containing peptides that interact specifically with ERß and inhibit its transcriptional activity. We believe that these novel peptide antagonists will serve as useful tools to evaluate the role of ERß in estrogen signaling. In addition, we anticipate that the general approach used to obtain these ERß antagonists can be applied to the development of peptide antagonists of other nuclear receptors and unrelated transcription factors.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Affinity Selection of ERß-Binding LXXLL-Containing Peptides Using Phage Display
A critical step in ER action is the ligand-dependent recruitment of transcriptional coactivators to target gene promoters. Antiestrogens manifest their inhibitory activities by altering ER structure and independently blocking cofactor binding (19, 22). In this study, the feasibility of targeting ER-coactivator interactions directly as a mechanism of developing human ERß-specific antagonists was evaluated. Using combinatorial phage display technology (21), we created and screened a phage library that expressed 19-mer peptides containing a central fixed Leu-X-X-Leu-Leu motif flanked by seven random amino acids on each side. Since we used an NNK nucleic acid format in the construction of this library it has a theoretical complexity of 1.2 x 1024. However, since our library contained only 108 independent clones, we are only surveying a fraction of the potential LXXLL motifs that can interact with ERß. This random LXXLL library was screened for phage that bound to ERß either in the absence or presence of estradiol, and 70 of the most avid interactors identified were brought forward for further analysis. A secondary enzyme-linked immunosorbent assay (ELISA) was used to confirm the ERß-binding characteristics of the plaque-purified phage. Cross-screening, using a similar approach, revealed that 37 of the phage identified bound to both ER subtypes whereas 33 interacted selectively with ERß. The latter subset of phage expressing LXXLL-containing peptides were brought forward for further analysis.

Characterization of the ERß-Selective LXXLL-Containing Peptides in Intact Cells
We performed a mammalian two-hybrid assay to assess the ability of the peptide sequences identified by phage display to interact selectively with ERß in intact cells. Each of the 33 ERß-selective peptides identified in vitro were expressed as a yeast Gal 4 DNA-binding domain (Gal4DBD) fusion protein and tested for their ability to interact with ER{alpha} and/or ERß expressed as fusions to the VP16 activation domain. Expression of the peptide-fusions was confirmed by Western immunoblotting (data not shown). A Gal4DBD-fusion of the NR-box of the ER coactivator SRC-1 (containing three LXXLL motifs), shown previously to interact with both ER{alpha} and ERß, was used in this assay as a positive control. When analyzed in the two-hybrid assay, it was found that 15 of the 33 peptides studied interacted with ERß, but not ER{alpha}. Representative examples are shown in Fig. 1Go of those peptides that were isolated in the screen with the apo-ERß (Fig. 1AGo), and those identified with the agonist-liganded receptor (Fig. 1BGo). Interestingly, several of the peptides were able to bind ERß in the absence of ligand, suggesting either that a portion of the ERß aporeceptor resides in an active conformation, or that the binding of LXXLL-containing motifs to the receptor may facilitate activation. Using the mammalian-two hybrid assay, it was also shown that the introduction of inactivating point mutations into the AF-2 region of ERß (11) completely abolished the interaction of each peptide with the receptor (see Fig. 7AGo, below). These results suggested that the peptides were targeting the coactivator binding pocket, and thus would be able to antagonize ERß transcriptional activity.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Evaluation of ERß-Selective LXXLL-Containing Peptides in Intact Cells

Mammalian two-hybrid assays were performed to examine the interactions between the peptides and ER{alpha} or ERß in mammalian cells. Each ER expression construct includes the VP16 activation domain sequence fused 5' to the complete coding sequence for the human ER{alpha} or ERß. A, Analysis of the interaction of peptides that were isolated in the screen with apo-ERß (four representative peptides are shown). B, Analysis of the interaction of peptides that were isolated in the screen with agonist-liganded ERß (five representative peptides are shown). HepG2 cells were transiently transfected with the pVP16-ER{alpha} expression vector or the pVP16-ERß expression vector together with each peptide-Gal4DBD fusion construct, the 5x-GAL4-TATA-Luc reporter, and the pCMV-ß-gal control plasmid. The SRC-1 (NR-box)-Gal4DBD fusion was used as a control. Cells were induced with vehicle (nh) or 10-7 M 17ß-estradiol (E2) for 24 h, and luciferase assays were performed. Each value was normalized to the ß-galactosidase activity. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. The Specificity of the ERß-Interacting Peptides Is Maintained within the Context of an ER{alpha}/ERß Heterodimer

A, Mammalian two-hybrid assays were performed to examine the interactions between the peptides and ERß or ERß(3x). ERß(3x) contains three point mutations introduced into AF-2, which nullify the AF-2 activity of the receptor. HepG2 cells were transiently transfected with the pVP16-ERß or pVP16-ERß(3x) expression vector together with each peptide-Gal4DBD fusion construct, the 5x-GAL4-TATA-Luc reporter, and the pCMV-ß-gal control plasmid. B, Mammalian two-hybrid assays were performed to examine the interactions between the peptides and ER{alpha}/ERß heterodimers or ER{alpha}/ERß(3x) heterodimers. The interaction of four representative peptides are shown. HepG2 cells were transiently transfected with the pVP16-ERß or pVP16-ERß(3x) expression vector and an ER{alpha} expression vector together with each peptide-Gal4DBD fusion construct, the 5x-GAL4-TATA-Luc reporter, and the pCMV-ß-gal control plasmid. After transfection, cells were treated with vehicle (nh) or 10-7 M 17ß-estradiol (E2). After 24 h, cells were harvested and assayed for luciferase activity, and all transfections were normalized for efficiency using the internal pCMV-ß-gal control plasmid. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%.

 
ERß-Selective LXXLL Peptides Display Hormone Specificity
The interaction of LXXLL-containing coactivators such as SRC-1 or GRIP1 with ER{alpha} and ERß has been shown to require agonist activation of the receptor (3, 4, 5). The surprising finding that some LXXLL-containing peptides can interact with apo-ER begged a reevaluation of the role of ligand in regulating ERß-LXXLL interactions. This was accomplished using the mammalian two-hybrid assay to examine the effect of different ER ligands on peptide binding. As expected, the interactions between the Gal4DBD-SRC-1, and Gal4DBD-GRIP1 NR-box fusions and ERß were enhanced by the addition of the agonists 17ß-estradiol and genistein (Fig. 2AGo). However, administration of antiestrogens alone antagonized the basal receptor-peptide interactions. Interestingly, both of the control peptide fusions showed significant levels of hormone-independent interaction with ERß. A similar observation was made in vitro, where glutathione-Stransferase (GST)-pull down assays revealed that both SRC-1 and GRIP1 interacted with ERß in the absence of hormone (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. ERß-Selective LXXLL Peptides Display Hormone Specificity

Mammalian two-hybrid assays were performed to examine the interactions between the peptides and ERß in the presence of different ER ligands. HepG2 cells were transiently transfected with the pVP16-ERß expression vector together with each peptide-Gal4DBD fusion construct, the 5x-GAL4-TATA-Luc reporter, and the pCMV-ß-gal control plasmid. After transfection, cells were treated with vehicle (nh) or either 10-7 M 17ß-estradiol (E2), ICI182,780 (ICI), 4-hydroxytamoxifen (4OH-T), raloxifene (RAL), GW7604, RU486, or 10-6 M genistein. After 24 h cells were harvested and assayed for luciferase activity, and all transfections were normalized for efficiency using the internal pCMV-ß-gal control plasmid. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%. A, The SRC-1 NR-box and GRIP1 NR-box were used as controls. Based upon the pattern of interactions, the peptides were divided into two classes: B, hormone-independent (six peptides) and C, hormone-dependent (nine peptides). The activities of three representative peptides are shown in both parts B and C, and these illustrate the three different patterns of interactions observed in each case.

 
When the ERß-selective peptides were analyzed in this assay, we were able to divide them into two classes: those that interacted with the receptor in the absence of hormone (Fig. 2BGo) and those whose interaction was strictly agonist dependent (Fig. 2CGo). The profiles of three representative peptides from each group are shown. Several of the peptide fusions (ERß-interacting peptides EBIP-37 and EBIP-44) interacted equally well with ERß in the absence of hormone and in the presence of agonist (Fig. 2BGo). However, these interactions were antagonized by antiestrogen administration. Interestingly, peptide EBIP-51 interacted most efficiently with apo-ERß, suggesting the existence of cofactors that prefer to associate with ERß in a constitutive manner (see Discussion). The binding of LXXLL motifs to ERß in the absence of hormone was puzzling, in view of the fact that it was previously observed that the human ERß does not demonstrate ligand-independent transcriptional activity (11). This result suggests that the aporeceptor may recruit cofactors in some contexts, but that this interaction is not transcriptionally productive. In these studies, we also observed that the antiprogestin RU486 was able to decrease interactions between the peptides and receptor in these assays, a result that agrees with recent reports that RU486 can function as an ERß antagonist (23).

Nine of the peptide fusions studied were found to interact only with agonist-activated ERß. Interestingly, within this class, three distinct binding patterns were observed (Fig. 2CGo). Specifically, peptide EBIP-92 appeared to interact more efficiently with genisteinactivated ERß than that activated by 17ß-estradiol, whereas the estradiol-activated receptor interacted equally as well with EPIP-49, and more efficiently with EBIP-53. These data, indicating that genistein and estradiol do not function in the same manner when assayed on ERß, were interesting in light of the unique functional properties that have recently been ascribed to genistein (8, 24). Similar differences in efficacy were noted when the experiments were repeated over a full range of ligand concentrations (data not shown). These results suggest that estradiol and genistein induce unique conformational changes within ERß. This hypothesis is supported by recent crystallography studies that showed that ERß helix 12 (AF-2) assumes a distinct position when occupied by genistein compared with the distinctive agonist position observed for helix 12 of the estradiol-bound ER{alpha} (16, 25). If the estradiol-ER{alpha} crystallographic data are extrapolated to ERß, it is possible that genistein-liganded ERß interacts with cofactors in a different manner than the estradiol-activated receptor or that the former complex recruits a unique coactivator in some settings.

Affinity Does Not Explain the Hormone-Independent Interaction of LXXLL Peptides with ERß
One of the most interesting classes of peptides identified in this study were those that interacted with ERß in a constitutive manner but that were unable to interact with the receptor when occupied by antagonists. A trivial explanation for these observed binding characteristics was that these peptides had a higher affinity for ERß than the peptides that required ligand. Alternatively, these peptides may interact in a unique manner with the coactivator binding pocket within ERß. These different possibilities were tested using a quantitative phage ELISA. Specifically, the phage stocks of each peptide-expressing clone were titered, and then the binding of different concentrations of phage expressing peptides to ERß was tested in the presence and absence of estradiol. The results of this analysis, shown in Fig. 3Go, indicated that even at the lowest input phage concentrations, the hormone-independent peptides maintained their ligand-independent interactions with ERß; two representative peptides are shown. This was in contrast to the hormone-dependent peptides, which maintained their estradiol-dependent interaction with ERß throughout the range of phage concentrations (representative example shown in Fig. 3CGo). Neither the absolute numbers of phage binding to each target nor the apparent binding affinity were significantly different. These results indicate that receptor-binding affinity is not what distinguishes peptides that interact with ERß in a ligand-dependent manner from those that bind constitutively, but rather these classes of LXXLL-containing peptides interact in different ways with the ERß-coactivator binding pocket.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Affinity Does Not Explain the Hormone-Independent Interaction of LXXLL Peptides with ERß

The binding of each titered phage clone to ERß was measured by ELISA. Purified ERß protein was added to 96-well plates, and 50 µl of each phage stock or serial dilutions were added to individual wells and incubated with the ER target for 1 h at room temperature. The assays were performed in the absence and presence of 10-6 M 17ß-estradiol. The wells were washed with PBST to remove nonbinding phage and incubated with a horseradish peroxidase-conjugated anti-M13 antibody. Immunocomplexes were detected with ABTS (2', 2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid) supplemented with 0.05% H2O2. The colorimetric change was quantitated by measuring the absorbance at 405 nm. The binding patterns of two representative peptides from the hormone-independent class (A and B), and the binding of one representative peptide from the hormone-dependent class (C) are shown.

 
Disruption of ERß Transcriptional Activity by LXXLL-Containing Peptides
The ability of the ERß-interacting peptides to function as ER subtype-selective antagonists in target cells was next assessed. This was accomplished using transcriptional interference assays in mammalian cells transfected with either ER{alpha} or ERß, together with an empty Gal4DBD vector (pM) or Gal4DBD fusions of the peptides. The EBIP-37, EBIP-41, and EBIP-45 peptides were used in these initial experiments, because they appeared to interact most efficiently with ERß in the mammalian two-hybrid system (Fig. 1AGo). Under the conditions of this assay, we noted that the transcriptional activity of ER{alpha} was unaffected by overexpression of the ERß-selective peptides (Fig. 4AGo). Coexpression of the GRIP1 NR-box sequence (three LXXLL motifs), however, inhibited ER{alpha} transcriptional activity by 77%, thus validating the use of LXXLL peptides as antagonists of ER transcriptional responses. When the effect of our peptides on ERß activity was assessed, we observed that all of the LXXLL sequences functioned as effective antagonists (Fig. 4BGo). Significantly, coexpression of peptide EBIP-37 with ERß resulted in 100% inhibition of the transcriptional response, whereas the EBIP-41, EBIP-45, and GRIP-1 (NR-box) peptide fusions produced 85, 70, and 90% inhibition, respectively. Western immunoblotting revealed that expression of the peptides did not alter the cellular levels of ERß (data not shown). These results indicate that it is possible to target ERß-coactivator interactions in a selective manner and validate this general approach to develop antagonists of additional members of the nuclear receptor superfamily.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Disruption of ERß Transcriptional Activity by LXXLL-Containing Peptides

The effects of three LXXLL-containing peptides (EBIP-37, EBIP-41, and EBIP-45) on ER{alpha} and ERß transcriptional activity were examined. A peptide containing the LXXLL motifs (NR box) of the coactivator GRIP1 was used as a control. HepG2 cells were transiently transfected with either the ER{alpha} (A) or ERß (B) expression vector, together with the empty Gal4DBD vector (pM) or the Gal4DBD-peptide fusion constructs and the 3x-ERE-TATA-Luc reporter and pCMV-ß-gal control plasmid. Cells were induced with vehicle (nh) or increasing concentrations (ranging from 10-12 M to 10-6 M) of 17ß-estradiol (E2) for 24 h, and luciferase assays were performed. Each value was normalized to the ß-galactosidase activity. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%.

 
ERß-Selective LXXLL-Containing Peptides Show Distinct Preferences for Other Nuclear Receptors
One of the major objectives of this study is to develop highly specific inhibitors that can be used to evaluate the relative contributions of the two ER subtypes in estrogen signaling. Consequently, we next examined the ability of the 15 ERß-selective peptides to interact with other members of the nuclear receptor superfamily. This was accomplished using the mammalian two-hybrid assay to examine interactions of each peptide with ER{alpha}, ERß, and 11 different nuclear receptors. Table 1Go summarizes the interactions observed between each of the peptides and receptors in the presence of their cognate ligands. No clear pattern emerged from these studies, as each receptor appeared to exhibit distinct peptide binding preferences. Based on these results, it is possible that most of the receptors will eventually be found to display different cofactor preferences. The observation that the androgen receptor (AR) did not interact with any of the peptides tested and that ROR{alpha} interacted with only two of the 15 peptides suggest that these receptors might have very specific coactivator requirements.


View this table:
[in this window]
[in a new window]
 
Table 1. ERß-Selective LXXLL-Containing Peptides Show Distinct Preferences for Other Nuclear Receptors

 
Interestingly, the peptides identified in our screen using unliganded ERß as bait (EBIP-37, EBIP-41, EBIP-44, EBIP-45), and which interacted with the receptor in an agonist-independent manner in mammalian cells (Fig. 3Go), were found to interact with most of the nuclear receptors tested. The most important result, however, was that EBIP-56 and EBIP-92 interacted exclusively with ERß and did not interact with any other receptor under the conditions tested. Other peptides, such as EBIP-87 and EBIP-96, were found to interact with multiple receptors. Cumulatively, the results of these studies indicate that it is possible to identify LXXLL-containing peptides that interact in a highly specific manner with ERß.

Evaluation of the Antagonist Properties of Peptides That Interact in a Specific Manner with ERß
The antagonist efficacy of the ERß-specific peptides, EBIP-56 and EBIP-92, was next evaluated. The nuclear receptor interaction regions of most of the well validated coactivators have been shown to contain multiple LXXLL domains, which facilitate the interaction of these proteins with the AF-2 coactivator binding pocket of their targeted receptor (18). Reflecting this observation, we created two-copy Gal4DBD fusions of our peptides. The two LXXLL motifs were separated by sequences corresponding to the linker region between NR-box 2 and NR-box 3 of GRIP1. When expressed in mammalian cells, we observed that while the GRIP1 NR-box sequences inhibited the activity of ER{alpha} by 60%, the peptides 2xEBIP-56 and 2xEBIP-92 had no effect on transcriptional response (Fig. 5AGo). However, when tested on ERß, it was found that the 2xEBIP-56 and 2xEBIP-92 peptides suppressed estrogen-stimulated transcriptional activity by 82% and 97%, respectively (Fig. 5BGo). Similar results were obtained using 1xEBIP-56 and 1xEBIP-92, although higher levels of expression of these peptides were required to attain the same degree of antagonism as their dimeric counterparts. Western immunoblotting was used to demonstrate that expression of these peptides did not alter cellular levels of ERß (data not shown). Thus, ERß-specific LXXLL-containing peptides can function as potent inhibitors of ERß transcriptional activity.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Evaluation of the Antagonist Properties of Peptides That Interact in a Specific Manner with ERß

The ability of the ERß-specific LXXLL peptides EBIP-56 and EBIP-92 to disrupt the transcriptional activities of ER{alpha} and ERß was examined. For these experiments, constructs containing two copies of the peptides (2x-EBIP-56 and 2x-EBIP-92) were used. A peptide containing the three LXXLL motifs (NR-boxes) of the coactivator GRIP1 was used as a control. HepG2 cells were transiently transfected with the ER{alpha} (A) or ERß (B) expression vector together with the empty Gal4DBD vector (pM) or the Gal4DBD-peptide fusion constructs and the 3x-ERE-TATA-Luc and pCMV-ß-gal plasmids. After transfection, cells were treated with vehicle (nh) or increasing concentrations (ranging from 10-12 M to 10-6 M) of 17ß-estradiol (E2) for 24 h, and luciferase assays were performed. Each value was normalized to the ß-galactosidase activity. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%.

 
ERß-Specific LXXLL-Containing Peptides Disrupt the Transcriptional Activity of ER{alpha}/ERß Heterodimers
We and others have demonstrated that the transcriptional activity of agonist-activated ER{alpha} is significantly greater than ERß in most cell and promoter contexts (7, 9, 10, 11). Not surprisingly, therefore, in cells engineered to produce both ER subtypes, the overall response to estradiol is reduced. This suggests that one of the functions of ERß is to modulate ER{alpha} transcriptional activity in target cells. At subsaturating concentrations of agonist, ERß completely suppresses ER{alpha} transcriptional activity, whereas no inhibition is observed when the assay is performed in the presence of saturating concentrations of 17ß-estradiol (11). These findings suggest that the role of ERß in estrogen signaling is complex. Previously, we have shown that ERß is bound constitutively to DNA in the absence of hormone (11). Consequently, at subsaturating concentrations of hormone, the receptor is capable of competitively inhibiting the activity of ER{alpha} homodimers and ER{alpha}/ERß heterodimers by blocking their ability to interact with target gene promoters. Under saturating concentrations of hormone, we have proposed that ER{alpha}/ERß heterodimers form, and that the functional properties of this complex are similar to that of an ER{alpha} homodimer. However, without a specific ERß antagonist, it has not been possible to prove that the heterodimeric ER{alpha}/ERß complex was functionally active in cells.

The identification of specific peptide antagonists of ERß has enabled us to evaluate the functional significance of ER{alpha}/ERß heterodimers. This was accomplished by determining the impact of expressing the 2xEBIP-92 antagonist in cells and examining its impact on ER{alpha} and ERß-mediated transcriptional activity. The results of this analysis are shown in Fig. 6Go. As observed previously, expression of 2x-EBIP-92 in cells had no effect on ER{alpha} transcriptional activity, whereas it completely suppressed ERß activity. Importantly, however, in cells expressing both receptor subtypes it was demonstrated that the ERß-specific antagonist, 2xEBIP-92, was capable of significantly reducing the transcriptional activity of the ER{alpha}/ERß heterodimer. To rule out the possibility that, in the context of the heterodimer, the ERß-specific peptides may interact directly with ER{alpha} we used mammalian two-hybrid assays to assess the interaction of the heterodimeric complexes with a subset of the EBIPs. For this purpose, we created an ERß mutant that disrupts AF-2 but that has no effect on the receptor’s ligand binding characteristics. As shown in Fig. 7AGo, an ERß-VP16, but not an ERß-3x-VP16, chimera was able to interact with the LXXLL peptides when tested in the two-hybrid assay. Since ERß-3x heterodimerizes with ER{alpha} in a manner that was indistinguishable from ERß it was possible to use this mutant to test the interaction of the ERß-interacting peptides with the ER {alpha}/ß heterodimer (11). First, we demonstrated that expression of ER{alpha} in target cells had no effect on the ability of ERß to interact with EBIPs 37, 41, 56, or 92 (Fig. 7BGo). Although it would be difficult to quantitate the amount of heterodimer formed under the conditions of this assay, the results suggest that ERß specificity is maintained in this context. The most important result, however, was that in cells expressing ER{alpha}, the ERß-3x-VP16 chimera was inactive in the two-hybrid assay (Fig. 7BGo). Given the characteristics of the ERß-3x chimera, a positive interaction in the two-hybrid assay would only have been possible if the peptides were able to interact with the coactivator binding pocket of ER{alpha}. We conclude from this experiment that even within the context of an ER{alpha}/ERß heterodimer that the ER-interacting characteristics of the EBIPs are maintained. Therefore, the inhibitory effects of 2xEBIP-92 on the ER{alpha}/ß heterodimer is mediated by blocking ERß function. Thus, although it has been shown previously that ER{alpha} and ERß preferentially form heterodimers when coexpressed (26, 27), we now demonstrate ERß contributes in a positive manner to the overall activity of the complex under agonist saturating conditions.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. ERß-Specific LXXLL Containing Peptides Disrupt the Transcriptional Activity of ER{alpha}/ERß Heterodimers

HepG2 cells were transiently transfected with either the ER{alpha} or ERß expression vectors, or equal quantities of both vectors together with the pM (Gal4DBD) empty vector (A) or the 2XEBIP-92 peptide-Gal4DBD fusion construct (B) and the 3x-ERE-TATA-Luc and pCMV-ß-gal plasmids. Cells were induced with vehicle (nh) or increasing concentrations (ranging from 10-12 M to 10-6 M) of 17ß-estradiol (E2) for 24 h, and luciferase assays were performed. Each value was normalized to the ß-galactosidase activity. Each data point is the average of triplicate determinations, and the average coefficient of variance for each value is <10%.

 
Comparison of the Amino Acid Sequences of the ERß-Interacting Peptides
Alignment of the three classes of ERß-interacting peptides identified (hormone-independent, hormone-dependent, and ERß-specific) was next performed (Table 2Go). Surprisingly, minimal homology was observed outside of the conserved LXXLL motif between members within the same class. However, we observed that the two ERß specific peptides, EBIP-56 and EBIP-92, contain a tryptophan residue at position -5 that was not found in any of the other 68 ERß-interacting peptides that were isolated in the primary screen. Therefore, we postulated that the tryptophan influenced the specificity of the peptide-ERß interactions. To test this hypothesis, the tryptophan residue in the EBIP-92 peptide was converted to glutamine (an amino acid found at this position in many of the peptides identified). Analysis using a mammalian two-hybrid revealed that while the wild-type EBIP-92 interacted with ERß in a hormone-dependent manner, a variant peptide in which the tryptophan residue at position -5 was mutated was unable to interact with ERß (data not shown). These studies demonstrate the importance of the sequences surrounding LXXLL motifs in determining receptor selectivity and suggest that it may be possible to use site-directed mutagenesis to optimize the interactions of the peptides identified with their protein targets.


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of the Amino Acid Sequences of the ERß-Interacting Peptides

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Development of ER Peptide Antagonists
The most important outcome of this series of studies was the identification of highly potent, specific ERß antagonists. Using these peptides, it is possible to efficiently inhibit ERß transcriptional activity by disrupting interactions between the receptor and cellular coactivators. These reagents are important tools that will facilitate an evaluation of the role of this ER subtype in estrogen signaling. For instance, we have used these peptides to demonstrate that ER{alpha}/ERß heterodimeric complexes can form within cells, and that ERß contributes in a positive manner to the overall activity of the estrogen-activated complex.

Recently, it has been suggested that the two ER subtypes may oppose the actions of each other in target organs. Although controversial, this hypothesis is supported by the observation that the ßERKO mouse displays epithelial hyperplasia in the prostate and bladder (14), an increase in bone mineral content (28), and an increased responsiveness to estrogen in the uterus (29), reflecting possibly an enhancement of ER{alpha}-mediated transcriptional activity. Using an appropriate delivery system, it may be possible to antagonize ERß action using the receptor-specific peptides and test directly the hypothesis that ERß functions as an ER{alpha} modulator in some tissues.

It has recently been shown that both ER subtypes are expressed in breast tumors (30, 31, 32) and that ERß expression is up-regulated in tumors that have developed tamoxifen resistance (32). Thus, there is an unmet medical need to develop novel ER antagonists as 1) potential breast cancer therapeutics and 2) tools to specifically define the role of ERß in breast cancer cell biology. The finding that none of the LXXLL-containing sequences in this study interact with antiestrogen-liganded receptor suggests that suitably formulated ER peptide antagonists could be coadministered with tamoxifen to completely block estrogen-stimulated proliferative pathways in the breast, using two mechanistically distinct modes of antagonism. Recent studies provide evidence that tamoxifen resistance in breast tumors may arise from the up-regulation of coactivator proteins, which may permit cells to recognize tamoxifen as an agonist and growth stimulant (22). The identification of peptides that disrupt receptor-coactivator interactions provides a novel mechanism by which the mitogenic actions of activated ER can be blocked in both antiestrogen-responsive and -resistant breast cancer cells. Theoretically, the peptide antagonists that we have identified could be developed as second line pharmaceutical treatments for ER-positive, tamoxifen-refractory tumors.

Previous studies in our laboratory (20) reported the identification of the ERß selective peptide 293. However, while the peptide displays selectivity for ERß over ER{alpha}, 293 was found to interact with many of the other nuclear receptors. In this study our goal was to develop peptides that interacted in a completely specific manner with ERß, which was accomplished in the discovery of peptides EBIP-56 and EBIP-92. A similar study was recently reported (33) in which a panel of LXXLL-containing peptides were identified that demonstrated selectivity for ERß over thyroid hormone receptor (TR). However, the authors of that study indicated that most of their ERß-interacting peptides cross-react with ER{alpha}. Thus, EBIP-56 and EBIP-92 represent the only reagents available that can be used to specifically inhibit ERß transcriptional activity.

Ligand-Independent Recruitment of LXXLL Motifs
One of the most important findings of this study was that the unliganded ERß is capable of recruiting many of the LXXLL peptides. Interestingly, studies with ER{alpha} showed that LXXLL-containing sequences were capable of a low but significant basal level of interaction in the absence of hormone (20). These results suggested that a fraction of the ER{alpha} molecules in a cell might reside in an active conformation, thus permitting recruitment of LXXLL motifs in the absence of receptor agonists. This may explain why ER{alpha} can activate transcription in some contexts in the absence of hormone. Surprisingly, although apo-ERß is capable of binding several different LXXLL-containing peptides, this form of the receptor does not activate transcription in the absence of agonist (11). Consistent with this observation, we have shown using in vitro protein-protein interaction studies that ERß, but not ER{alpha}, can bind to GRIP1 in the absence of ligand (our unpublished results). One possibility is that the ERß aporeceptor is present in an inhibitory complex containing both coactivators and corepressors, and that the binding of hormone enhances the functionality of associated activators and promotes the dissociation of repressor proteins. Alternatively, unliganded ERß may bind to some cofactors in a manner that is not transcriptionally productive. An activity of this nature has not yet been demonstrated for ERß; however, it has been shown that unliganded peroxisome proliferator activated receptor-{gamma} (PPAR{gamma}) interacts with the coactivator PGC-1 (PPAR{gamma} coactivator 1, a protein that has no apparent coactivator activity), and this protein is responsible for recruiting SRC-1 when agonist is added (34).

The ability of nuclear receptors to interact with LXXLL motifs in their apo- state raises the possibility that ligand regulation of coactivator recruitment may have evolved to enable receptor activity to respond to changes in cellular homeostasis. Consistent with this hypothesis is the observation that several orphan receptors [estrogen-receptor-related proteins (ERR1, ERR2, and ERR3)] that have not yet been shown to require ligands bind SRC-1, GRIP1, or activator of thyroid receptor (ACTR) in a ligand-independent manner (35, 36). Similarly, the orphan receptor 1/ retinoid X receptor (OR1/RXR) heterodimer is capable of ligand-independent cofactor recruitment (37). Recent studies have also illustrated that ligand-independent signaling pathways can result in activation of ERß by promoting agonist-independent coactivator binding (38). These observations suggest that the general mechanisms of hormone-dependent and independent transcriptional activation by nuclear receptors may be similar, and that in some cases the role of ligand may be as a catalyst, but not as a required part of receptor activation. Thus, ERß may be a receptor whose state of evolution is intermediate between the orphan receptors and the more classical steroid receptors.

Nuclear Hormone Receptors Have Distinct Preferences for LXXLLs
A recurring theme in these studies is that nuclear receptors have distinct preferences for LXXLL motifs. Previous work in our laboratory using peptide display has demonstrated that the sequences flanking the core LXXLL domain are important determinants of receptor selectivity (20). Mutagenesis studies have also been used to identify residues important for both receptor binding affinity and specificity (18, 39). McInerney et al. demonstrated that of the three helical LXXLL-containing regions of SRC-1, a single helical domain was sufficient for ER activation, whereas a combination of two distinct helical regions were required for PR, TR, retinoic acid receptor (RAR), and PPAR{gamma} actions (40). These studies indicate that different receptors can interact with the same cofactor in different ways.

To complement these previous studies, we observed that peptide EBIP-37 (identical to an LXXLL motif in RIP140) interacted selectively with ERß, but not ER{alpha}. Therefore, since RIP140 can bind to and repress the transcriptional activities of both ER{alpha} and ERß (Ref. 41 and our unpublished data), it is likely that each receptor subtype utilizes distinct LXXLL motifs within this factor, enabling them to bind. The observation that each of the receptors examined in our study displayed a unique pattern of interaction with LXXLL peptides also provides evidence that the receptors may bind different coactivators, or alternatively, recruit the same factors by utilizing distinct binding regions. It is likely therefore, that it will be possible to develop LXXLL-containing antagonists for many of the nuclear receptors. It was surprising, given the structural conservation among the nuclear receptors and associated cofactors, that peptides could be identified which block these interactions in a highly specific manner. However, given that it has been possible to develop specific ERß antagonists using this approach, we believe that it will be feasible to identify inhibitors of a wide variety of transcription factors by interfering with specific protein-protein interactions.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Biochemicals
DNA restriction and modification enzymes were obtained from Roche Molecular Biochemicals (Indianapolis, IN), New England Biolabs, Inc. (Beverly, MA), or Promega Corp. (Madison, WI). PCR reagents were obtained from Perkin Elmer Corp. (Norwalk, CT) or Promega Corp. 17ß-Estradiol, genistein, 4-hydroxytamoxifen, 9-cis-retinoic acid, dexamethasone, 5{alpha}-dihydrotestosterone, T3, progesterone, 22R-hydroxycholesterol, and chenodeoxycholic acid were purchased from Sigma (St. Louis, MO). RU486 was a gift from Ligand Pharmaceuticals, Inc. (San Diego, CA). The estrogen receptor antagonist ICI 182,780 was a gift from Dr. Alan Wakeling (Zeneca Pharmaceuticals, Macclesfield, UK). Raloxifene was a gift from Dr. Eric Larsen (Pfizer, Inc., Groton, CT). GW7604 was a gift from Dr. Tim Willson (GlaxoWellcome, Research Triangle Park, NC); 1,25-dihydroxyvitamin D3 was purchased from Duphar Pharmaceuticals (Daweesp, The Netherlands). The mouse monoclonal anti-Gal4DBD antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The rabbit polyclonal ERß antibody was a gift from Dr. Geoffrey Greene (University of Chicago, Chicago, IL). Secondary antibodies, Hybond-C extra transfer membranes, and ECL reagents were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL).

Affinity Selection of ERß-Binding Peptides
Baculovirus-expressed human ERß (amino acids 1–477) was purchased from PanVera Corp. (Madison, WI). ERß (4 pmol) was added to 100 µl of NaHCO3, pH 8.5, in single wells of a 96-well Immulon 4 plate (Dynex Technologies, Inc.). The protein was then incubated in the absence or presence of 10-6 M 17ß-estradiol overnight at 4 C. A duplicate well containing BSA alone was used as a control. The wells were blocked with 150 µl of 0.1% BSA in NaHCO3 for 1 h at room temperature and then washed five times with PBST (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.3, 0.1% Tween 20). Twenty five microliters of the phage library (>1010 phage) were preincubated on ice for 1 h in 125 µl PBST, 0.1% BSA, and 10-6 M 17ß-estradiol or vehicle. The phage library was added to the wells, and the plate was sealed and incubated at room temperature for 8 h with gentle agitation. The wells were washed five times with PBST to remove nonbinding phage. The binding phage were eluted with 100 µl of 50 mM glycine-HCl, pH 2.0 (prewarmed to 50 C), and subsequently eluted with 100 µl of 100 mM ethanolamine, pH 11.0. The first eluant was neutralized with 200 µl of 200 mM Na2HPO4, pH 8.5, before being combined with the second eluant. The bound phage were amplified in DH5{alpha}F' cells for 6 h and recovered by centrifugation. The amplified phage were used for subsequent rounds of panning. Three rounds of panning were performed. The enrichment of ERß binding phage in each round of panning was confirmed by ELISA. Individual phage clones were purified after the third round of panning. The single-stranded phage DNA was isolated from each clone, and the peptide sequences were determined by DNA sequencing.

ELISA
Purified ERß protein (0.4 pmol) was added to 96-well Immulon 4 plates as detailed above. Fifty microliters of each purified phage were added to an individual well and incubated with the ER target for 1 h at room temperature. The assays were performed in the absence and presence of 10-6 M of various ER ligands. The wells were washed five times with PBST to remove nonbinding phage. The binding of each peptide to full-length ER{alpha} (provided by Panvera Corp.) in the presence of various ER ligands was also tested in this assay. A horseradish peroxidase-conjugated anti-M13 antibody (Amersham Pharmacia Biotech) was diluted 1:5000 in PBST, 100 µl of the mixture was added to each well, and the solutions were incubated for 1 h at room temperature. The wells were washed five times with PBST, and immunocomplexes were detected with ABTS (2',2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid) supplemented with 0.05% H2O2. The colorimetric change was quantitated by measuring the absorbance at 405 nm on a plate reader (Multiskan MS; Labsystems, Marlboro, MA).

Plasmids
The Gal4DBD-peptide fusions were constructed as follows. The peptides were excised from the mBAX phage vectors with XbaI and XhoI. The parent pMsx vector (20) (containing the Gal4DBD) was digested with SalI and XbaI. The peptides were then ligated in frame to the pMsx vector, creating Gal4DBD-peptide fusion constructs. The constructs containing two copies of the LXXLL-containing peptides (2x-EBIP-56 and 2x-EBIP-92) were created as follows: pM-EBIP-56 and pM-EBIP-92 were digested with XbaI. The linker region between the second and third LXXLL motifs within the GRIP1 cDNA was amplified by PCR, digested with NheI and XbaI, and ligated into pM-EBIP-56 and pM-EBIP-92, at the 3' of the peptide coding region. These vectors were then digested with SalI and XbaI and an oligonucleotide encoding a second copy of the peptide was inserted into these sites 3' to the GRIP1 linker. The construction of pM-SRC-1 (NR-box) and pM-GRIP1 (NR-box) has been described previously (20).

The mammalian expression plasmid for the peptide EBIP-92 mutant was constructed by site-directed mutagenesis as follows. The pM-EBIP-92 vector was used as the template, and a point mutation in the conserved tryptophan residue was created using PCR-based oligonucleotide-directed mutagenesis, according to the manufacturer’s protocol (Stratagene, La Jolla, CA). The sequences of the oligonucleotides used for PCR were 5'-CTCGAGAAGTGTTGAGCCGGGTCCGGAGCTGCTTAAGCTGCTGTCGGGGACGAGTGTGGCGGAG (forward) and 3'-CTCCGCCACACTCGTCCCCGACAGCAGCTTAAGCAGCTCCGGACCCGGCTCAACACTTCTCGAG (reverse).

pVP16ER{alpha}, pVP16ERß, pVP16RAR{alpha}, and pVP16RXR{alpha} have been described previously (20). VP16GR, VP16PR-A, VP16PR-B, and VP16AR expression plasmids were gifts from J. Miner (VP16GR), D. X. Wen (VP16PR-A and VP16PR-B), and K. Marschke (VP16AR) (Ligand Pharmaceuticals, Inc., San Diego, CA). VP16VDR was a gift of J. W. Pike (University of Cincinnati, Cincinnati, OH), and the VP16TRß expression plasmid (pCMX-VP-F-hTRß) was provided by D. D. Moore (Baylor College of Medicine, Houston, TX). pVP16ROR{alpha}-LBD was a gift from A. R. Means (Duke University Medical Center, Durham, NC). The cDNAs for the human liver X receptor (LXR) and rat farnesoid X receptor (FXR) were provided by D. J. Mangelsdorf (University of Texas, Dallas, TX). pVP16LXR, and pVP16FXR were created as described previously for the other nuclear receptor VP16 fusions (20).

The mammalian expression plasmids for ER{alpha} (pRST7ER) and ERß (pRST7ERß) have been described previously (11, 42). The reporter 5x-GAL4-TATA-Luc (a gift from Dr. Xiao-Fan Wang, Duke University Medical Center) contains five palindromic copies of the GAL4 transcription factor response element cloned into pGL2-TATA-Inr (Stratagene). The 3x-ERE-TATA-Luc reporter contains three copies of the vitellogenin ERE (43).

All of the PCR-based constructs were sequenced to verify the accuracy of the amplified sequences.

Cell Culture and Transient Transfection Assays
HepG2 cells were maintained in MEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FCS (Life Technologies, Inc.), 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate. Cells were plated in 24-well plates (coated with gelatin for transfections of HepG2 cells) 24 h before transfection. DNA was introduced into the cells using lipofectin (Life Technologies, Inc.). Triplicate transfections were performed using 3 µg of total DNA. In standard mammalian two-hybrid assays, 1,500 ng of reporter (5x-GAL4-TATA-Luc), 500 ng of receptor-VP16 fusion, 500 ng of pM (Gal4DBD)-peptide fusion constructs, 100 ng of the pCMV-ßgal normalization vector (44), and 400 ng of the control vector pBSII-KS (Stratagene) were used. For receptor disruption studies, 1,500 ng of reporter (3x-ERE-TATA-Luc), 250 ng of receptor (either pRST7ER{alpha} or pRST7ERß), 1000 ng of pM-peptide fusion constructs or the parent pM vector, 100 ng of pCMV-ßgal, and 150 ng of pBSII-KS were used. Cells were incubated with the DNA/lipofectin mix for 3 to 6 h and then washed with PBS and the transfection mix was replaced with phenol red-free MEM containing 10% charcoal-stripped FCS (HyClone Laboratories, Inc., Logan, UT). The receptor ligands were added to the cells 20–24 h before the assays. Luciferase and ß-galactosidase assays were performed as described previously (45). All experiments were repeated a minimum of three times.


    ACKNOWLEDGMENTS
 
We thank Drs. D. J. Mangelsdorf, K. Marschke, A. R. Means, J. Miner, D. D. Moore, M. G. Parker, J. W. Pike, X.-F. Wang, and D. X. Wen for their generous gifts of plasmids. We would also like to thank Dr. Geoffrey Greene for the rabbit polyclonal ERß antibody. We are also grateful to members of our laboratory for critical review of the manuscript and for their help with the phage display technology.


    FOOTNOTES
 
Address requests for reprints to: Dr. Donald P. McDonnell, Department of Pharmacology and Cancer Biology, Duke University Medical Center, Box 3813, Durham, North Carolina 27710. E-mail: mcdon016{at}acpub.duke.edu

J.M.H. is supported by a Predoctoral Fellowship (DAMD17–97-1–7277) and C.-Y.C. by a postdoctoral fellowship (DAMD17–99-1–9173) from the US Army Medical Research Acquisition Activity (USAMRAA). This work was supported by a National Institute of Health Grant DK-48807 (to D.P.M.).

Received for publication April 10, 2000. Revision received July 24, 2000. Accepted for publication August 15, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Evans RM 1988 The steroid and thyroid receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  2. Tsai M, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  3. Oñate SA, Tsai, S-Y, Tsai M-J, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  4. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  5. Shibata H, Spencer TE, Oñate SA, Jenster G, Tsai S-Y, Tsai M-J, O’Malley BW 1997 Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–164
  6. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J- 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  7. Mosselman S, Polman J, Dijkema R 1996 ERß: identification and characterization of a novel human estrogen receptor. FEBS Let 392:49–53[CrossRef][Medline]
  8. Kuiper GGJM, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson J- 1997 Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology 138:863–870[Abstract/Free Full Text]
  9. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  10. Cowley SM, Parker MG 1999 A comparison of the transcriptional activation by ER{alpha} and ERß. J Steroid Biochem Mol Biol 69:165–175[CrossRef][Medline]
  11. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  12. Couse JF, Curtis Hewitt S, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS 1999 Postnatal sex reversal of the ovaries in mice lacking estrogen receptors {alpha} and ß. Science 286:2328–2331[Abstract/Free Full Text]
  13. Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358–417[Abstract/Free Full Text]
  14. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson J-, Smithies O 1998 Generation and reproductive phenotypes of mice lacking estrogen receptor ß. Proc Natl Acad Sci USA 95:15677–15682[Abstract/Free Full Text]
  15. Sun J, Meyers MJ, Fink BE, Rajendran R, Katzenellenbogen JA, Katzenellenbogen BS 1999 Novel ligands that function as selective estrogens or antiestrogens for estrogen receptor-{alpha} or estrogen receptor-ß. Endocrinology 140:800–804[Abstract/Free Full Text]
  16. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson J-, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  17. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  18. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  19. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  20. Chang C-Y, Norris JD, Grøn H, Paige LA, Hamilton PT, Kenan DJ, Fowlkes D, McDonnell DP 1999 Dissection of the LXXLL nuclear receptor-coactivator interaction motif using combinatorial peptide libraries: discovery of peptide antagonists of estrogen receptors {alpha} and ß. Mol Cell Biol 19:8226–8239[Abstract/Free Full Text]
  21. Sparks AB, Adey NB, Cwirla S, Kay BK 1996 Screening phage-displayed random peptide libraries. In: Kay BK, Winter J, McCafferty J (eds) Phage Display of Peptides and Proteins: A Laboratory Manual. Academic Press, Inc., San Diego, CA, pp 227–253
  22. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T-M, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  23. Zou A, Marschke KB, Arnold KE, Berger EM, Fitzgerald P, Mais DE, Allegretto EA 1999 Estrogen receptor beta activates the human retinoic acid receptor {alpha}-1 promoter in response to tamoxifen and other estrogen receptor antagonists, but not in response to agonists. Mol Endocrinol 13:418–430[Abstract/Free Full Text]
  24. Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J-, Nilsson S 1998 Differential response of estrogen receptor {alpha} and estrogen receptor ß to partial estrogen agonists/antagonists. Mol Pharmacol 54:105–112[Abstract/Free Full Text]
  25. Pike ACW, Brzozowski AM, Hubbard RE, Bonn T, Thorsell A-G, Engstrom O, Ljunggren J, Gustafsson J-, Carlquist M 1999 Structure of the ligand-binding domain of oestrogen receptor ß in the presence of a partial agonist and a full antagonist. EMBO J 18:4608–4618[CrossRef][Medline]
  26. Cowley SM, Hoarse S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  27. Pettersson K, Grandien K, Kuiper GGJM, Gustafsson, J- 1997 Mouse estrogen receptor ß forms estrogen response element-binding heterodimers with estrogen receptor {alpha}. Mol Endocrinol 11:1486–1496[Abstract/Free Full Text]
  28. Windahl SH, Vidal O, Andersson G, Gustafsson J-A, Ohlsson C 1999 Increased cortical bone mineral content but unchanged trabecular bone mineral density in female ERß (-/-) mice. J Clin Invest 104:895–901[Medline]
  29. Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M, Gustafsson J-A 2000 Estrogen receptor (ER) ß, a modulator of ER{alpha} in the uterus. Proc Natl Acad Sci USA 97:5936–5941[Abstract/Free Full Text]
  30. Dotzlaw H, Leygue E, Watson PH, Murphy LC 1996 Expression of estrogen receptor-ß in human breast tumors. J Clin Endocrinol Metab 82:2371–2374[Abstract/Free Full Text]
  31. Leygue E, Dotzlaw H, Watson PH, Murphy LC 1998 Altered estrogen receptor {alpha} and ß messenger RNA expression during human breast tumorigenesis. Cancer Res 58:3197–3201[Abstract/Free Full Text]
  32. Speirs V, Parkes AT, Kerin MJ, Walton DS, Carleton PJ, Fox JN, Atkin SL 1999 Coexpression of estrogen receptor {alpha} and ß: poor prognostic factors in human breast cancer? Cancer Res 59:525–528[Abstract/Free Full Text]
  33. Northrup JP, Nguyen D, Piplani S, Olivan SE, Kwan ST-S, Go NF, Hart CP, Schatz PJ 2000 Selection of estrogen receptor ß-, thyroid hormone receptor ß-specific coactivator-mimetic peptides using recombinant peptide libraries. Mol Endocrinol 14:605–622[Abstract/Free Full Text]
  34. Puigserver P, Adelmant G, Wu Z, Fan M, Xu J, O’Malley BW, Spiegelman BM 1999 Activation of PPAR{gamma} coactivator-1 through transcription factor docking. Science 286:1368–1371[Abstract/Free Full Text]
  35. Hong H, Yang L, Stallcup MR 1999 Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274:22618–22626[Abstract/Free Full Text]
  36. Xie W, Hong H, Yang NN, Lin RJ, Simon CM, Stallcup MR, Evans RM 1999 Constitutive activation of transcription and binding of coactivator by estrogen-related receptors 1 and 2. Mol Endocrinol 13:2151–2162[Abstract/Free Full Text]
  37. Wiebel FF, Steffensen KR, Treuter E, Feltkamp D, Gustafsson J- 1999 Ligand-independent coregulator recruitment by the triply activatable OR1/retinoid X receptor-{alpha} nuclear receptor heterodimer. Mol Endocrinol 13:1105–1118[Abstract/Free Full Text]
  38. Tremblay A, Tremblay GB, Labrie F, Giguere V 1999 Ligand-independent recruitment of SRC-1 to estrogen receptor ß through phosphorylation of activation function AF-1. Mol Cell 3:513–519[CrossRef][Medline]
  39. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  40. McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J, Torchia J, Nolte RT, Assa-Munt M, Milburn MV, Glass CK, Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 12:3357–3368[Abstract/Free Full Text]
  41. Eng FCS, Barsalou A, Akutsu N, Mercier I, Zechel C, Mader S, White JH 1998 Different classes of coactivators recognize distinct but overlapping binding sites on the estrogen receptor ligand binding domain. J Biol Chem 273:28371–28377[Abstract/Free Full Text]
  42. Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract/Free Full Text]
  43. Norris JD, Fan D, Stallcup MR, McDonnell DP 1998 Enhancement of estrogen receptor transcriptional activity by the coactivator GRIP-1 highlights that role of activation function 2 in determining estrogen receptor pharmacology. J Biol Chem 273:6679–6688[Abstract/Free Full Text]
  44. Norris JD, Fan D, Aleman C, Marks JR, Futreal PA, Wiseman RW, Iglehart JD, Deininger PL, McDonnell DP 1995 Identification of a new subclass of Alu DNA repeats which can function as estrogen receptor-dependent transcriptional enhancers. J Biol Chem 270:22777–22782[Abstract/Free Full Text]
  45. Norris JD, Fan D, Wagner BL, McDonnell DP 1996 Identification of the sequences within the human C3 promoter required for estrogen responsiveness provides insight into the mechanism of tamoxifen mixed agonist activity. Mol Endocrinol 10:1605–1616[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum ReprodHome page
X. Di, L. Yu, A.B. Moore, L. Castro, X. Zheng, T. Hermon, and D. Dixon
A low concentration of genistein induces estrogen receptor-alpha and insulin-like growth factor-I receptor interactions and proliferation in uterine leiomyoma cells
Hum. Reprod., August 1, 2008; 23(8): 1873 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. D. DuSell, M. Umetani, P. W. Shaul, D. J. Mangelsdorf, and D. P. McDonnell
27-Hydroxycholesterol Is an Endogenous Selective Estrogen Receptor Modulator
Mol. Endocrinol., January 1, 2008; 22(1): 65 - 77.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. B. Mettu, T. B. Stanley, M. A. Dwyer, M. S. Jansen, J. E. Allen, J. M. Hall, and D. P. McDonnell
The Nuclear Receptor-Coactivator Interaction Surface as a Target for Peptide Antagonists of the Peroxisome Proliferator-Activated Receptors
Mol. Endocrinol., October 1, 2007; 21(10): 2361 - 2377.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Hall and D. P. McDonnell
The Molecular Mechanisms Underlying the Proinflammatory Actions of Thiazolidinediones in Human Macrophages
Mol. Endocrinol., August 1, 2007; 21(8): 1756 - 1768.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Wang, C. Zhang, S. K. Nordeen, and D. J. Shapiro
In Vitro Fluorescence Anisotropy Analysis of the Interaction of Full-length SRC1a with Estrogen Receptors {alpha} and beta Supports an Active Displacement Model for Coregulator Utilization
J. Biol. Chem., February 2, 2007; 282(5): 2765 - 2775.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Gaillard, M. A. Dwyer, and D. P. McDonnell
Definition of the Molecular Basis for Estrogen Receptor-Related Receptor-{alpha}-Cofactor Interactions
Mol. Endocrinol., January 1, 2007; 21(1): 62 - 76.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. van de Wijngaart, M. E. van Royen, R. Hersmus, A. C. W. Pike, A. B. Houtsmuller, G. Jenster, J. Trapman, and H. J. Dubbink
Novel FXXFF and FXXMF Motifs in Androgen Receptor Cofactors Mediate High Affinity and Specific Interactions with the Ligand-binding Domain
J. Biol. Chem., July 14, 2006; 281(28): 19407 - 19416.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
J. M. Hall and D. P. McDonnell
Coregulators in Nuclear Estrogen Receptor Action: From Concept to Therapeutic Targeting
Mol. Interv., December 1, 2005; 5(6): 343 - 357.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S K Nair, T J Thomas, N J Greenfield, A Chen, H He, and T Thomas
Conformational dynamics of estrogen receptors {alpha} and {beta} as revealed by intrinsic tryptophan fluorescence and circular dichroism
J. Mol. Endocrinol., October 1, 2005; 35(2): 211 - 223.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
C. J. Larson, D. L. Osburn, K. Schmitz, L. Giampa, S.-M. Mong, K. Marschke, H. M. Seidel, J. Rosen, and A. Negro-Vilar
Peptide Binding Identifies an ER{alpha} Conformation That Generates Selective Activity in Multiple In Vitro Assays
J Biomol Screen, September 1, 2005; 10(6): 590 - 598.
[Abstract] [PDF]


Home page
Mol. Endocrinol.Home page
M. S. Ozers, K. M. Ervin, C. L. Steffen, J. A. Fronczak, C. S. Lebakken, K. A. Carnahan, R. G. Lowery, and T. J. Burke
Analysis of Ligand-Dependent Recruitment of Coactivator Peptides to Estrogen Receptor Using Fluorescence Polarization
Mol. Endocrinol., January 1, 2005; 19(1): 25 - 34.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C M Klinge, S C Jernigan, K A Mattingly, K E Risinger, and J Zhang
Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors {alpha} and {beta} by coactivators and corepressors
J. Mol. Endocrinol., October 1, 2004; 33(2): 387 - 410.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Nakajima, S. Fujino, G. Nakanishi, Y.-S. Kim, and A. M. Jetten
TIP27: a novel repressor of the nuclear orphan receptor TAK1/TR4
Nucleic Acids Res., August 9, 2004; 32(14): 4194 - 4204.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Cabanes, M. Wang, S. Olivo, S. DeAssis, J.-A. Gustafsson, G. Khan, and L. Hilakivi-Clarke
Prepubertal estradiol and genistein exposures up-regulate BRCA1 mRNA and reduce mammary tumorigenesis
Carcinogenesis, May 1, 2004; 25(5): 741 - 748.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-L. Hsu, Y.-L. Chen, S. Yeh, H.-J. Ting, Y.-C. Hu, H. Lin, X. Wang, and C. Chang
The Use of Phage Display Technique for the Isolation of Androgen Receptor Interacting Peptides with (F/W)XXL(F/W) and FXXLY New Signature Motifs
J. Biol. Chem., June 20, 2003; 278(26): 23691 - 23698.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Bai and V. Giguere
Isoform-Selective Interactions between Estrogen Receptors and Steroid Receptor Coactivators Promoted by Estradiol and ErbB-2 Signaling in Living Cells
Mol. Endocrinol., April 1, 2003; 17(4): 589 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Hall and K. S. Korach
Analysis of the Molecular Mechanisms of Human Estrogen Receptors alpha and beta Reveals Differential Specificity in Target Promoter Regulation by Xenoestrogens
J. Biol. Chem., November 8, 2002; 277(46): 44455 - 44461.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Sathya, M. S. Jansen, S. C. Nagel, C. E. Cook, and D. P. MCDonnell
Identification and Characterization of Novel Estrogen Receptor-{beta}-Sparing Antiprogestins
Endocrinology, August 1, 2002; 143(8): 3071 - 3082.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. M. Willson and J. T. Moore
Minireview: Genomics Versus Orphan Nuclear Receptors--A Half-Time Report
Mol. Endocrinol., June 1, 2002; 16(6): 1135 - 1144.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C.-Y. Chang and D. P. McDonnell
Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes
Mol. Endocrinol., April 1, 2002; 16(4): 647 - 660.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Hall, D. P. McDonnell, and K. S. Korach
Allosteric Regulation of Estrogen Receptor Structure, Function, and Coactivator Recruitment by Different Estrogen Response Elements
Mol. Endocrinol., March 1, 2002; 16(3): 469 - 486.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. S. Bramlett, Y. Wu, and T. P. Burris
Ligands Specify Coactivator Nuclear Receptor (NR) Box Affinity for Estrogen Receptor Subtypes
Mol. Endocrinol., June 1, 2001; 15(6): 909 - 922.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hall, J. M.
Right arrow Articles by McDonnell, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hall, J. M.
Right arrow Articles by McDonnell, D. P.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals