Molecular Endocrinology 14 (2): 255-271
Copyright © 2000 by The Endocrine Society
Dual Regulation Of Somatostatin Receptor Subtype 1 Gene Expression By Pit-1 In Anterior Pituitary GH3 Cells
Hans Baumeister,
Michael Wegner,
Dietmar Richter and
Wolfgang Meyerhof
Abteilung Molekulare Genetik (H.B., W.M.) Deutsches Institut
für Ernährungsforschung und Universität Potsdam
D-14558 Potsdam-Rehbrücke, Germany
Institut für
Zellbiochemie und klinische Neurobiologie (D.R.) Zentrum für
Molekulare Neurobiologie Hamburg (M.W.)
Universitäts-Krankenhaus Eppendorf D-20256
Hamburg, Germany
 |
ABSTRACT
|
|---|
Somatostatin represents a major release
inhibiting factor for hypophyseal hormones and mediates its action via
five receptor subtypes, sst1sst5, that are all present in the
anterior pituitary. The pituitary specific transcription factor Pit-1
is essential for the pituitary development and pituitary-specific gene
expression. Here the transcriptional regulation of the sst1
gene, which contains putative Pit-1-binding sites, was studied in
anterior pituitary GH3 cells. We found that a fragment of 2 kb suffices
to drive the expression of a reporter gene specifically in this cell
line. Positive and negative cis-regulatory elements
contributed to the promoter activity. Among these elements two
functional binding sites for Pit-1 were identified. While the proximal
site mediated transcriptional activation, the distal site attenuated
transcription of reporter gene constructs. Mutations of the proximal
Pit-1 site prevented expression of the reporter gene. Targeting
Pit-1 mRNA by antisense oligonucleotides caused inhibition
of transcription of reporter gene constructs containing the proximal
Pit-1-binding site. Moreover, the expression of the endogenous
sst1 gene in GH3 anterior pituitary cells was blocked. This
resulted in reduced sst1 levels at the plasma membrane. Reduced sst1
levels were associated with a diminished antisecretory response to the
sst1-specific agonist CH-275 and somatostatin. These results
demonstrate the importance of Pit-1 for the expression of the
sst1 gene, which hence is placed under common genetic
control with the genes for hypophysiotropic hormones and the gene for
the receptor of GH-releasing hormone.
 |
INTRODUCTION
|
|---|
The peptide hormone somatostatin (SST), which exists in two
biologically active forms, SST-14 and SST-28, represents the release
inhibiting factor of three pituitary hormones (1). Synthesized in the
hypothalamus, it is released into and transported by the
hypothalamo-hypophyseal portal blood vessels to the anterior pituitary
gland. There it inhibits, under certain conditions, the release of GH,
PRL, and TSH from somatotroph, lactotroph, and thyrotroph cells,
respectively. In addition to its effects on hormone secretion, SST
inhibits proliferation of various cell lines including pituitary cells
(2, 3) and of pituitary tumors (4, 5). The actions of SST are mediated
by at least five heptahelical receptors (sst1sst5) for which cDNAs
and genes have been isolated from different species (for review see
Ref. 6). The ssts differ in their predicted amino acid sequences and
pharmacological properties (7, 8, 9). Binding sites for SST are widespread
and derived from individual sst mRNA species that are tissue
specifically expressed displaying overlapping distribution patterns in
many tissues and organs (6). Even a single cell may contain more than
one sst subtype (10). sst1 mRNA has, for example, been
observed in brain, pituitary, and gastrointestinal organs. In the rat
pituitary, sst1 gene expression overlaps with that of the
other four ssts (11, 12).
Pharmacological studies using the sst2-specific agonist octreotide
suggested that binding of SST to sst2 is responsible for the inhibition
of hormone release (7, 9). However, it is also assumed that SST
receptors other than sst2 participate in the inhibition of GH release
(13). For instance, in only 60% of acromegalic patients that exhibited
GH hypersecretion could GH levels be normalized by octreotide (14).
Transcripts for sst1, an SST receptor subtype that does not
bind octreotide, have been shown to occur in 50% of somatotroph
adenomas while mRNA for sst4, the other subtype that does
not bind octreotide, has not been detected (15, 16). The contribution
of sst1 to the release-inhibiting actions of SST has not yet been
explored systematically as an sst1-specific ligand, CH-275, has become
available only recently (17). However, CH-275 mediates the inhibition
of voltage-operated calcium channels, suggesting that sst1 may well be
engaged in the inhibition of hormone release (18).
During pituitary organogenesis the sst1 receptor may play an important
role. By semiquantitative RT-PCR it has been shown (19) that
sst1 transcripts are predominant among the five
sst mRNA subtypes during postnatal development until day 14.
Thereafter its level declines. At this stage of pituitary development
somato-lactotroph cells appear and differentiate to lactotrophs and
somatotrophs (20). Interestingly, GH3 cells that represent a
somato-lactotroph cell type express among the sst genes
predominantly the sst1 gene (21). Colocalization studies in
adult rats revealed that sst1 transcripts are present in
somatotrophs, lactotrophs, and thyrotrophs (12). These three cell types
share two properties, i.e. they respond to SST and their
differentiation from a common cell lineage depends on the presence of
the pituitary-specific transcription factor Pit-1 (20). Pit-1 is
essential for the tissue-specific gene expression in pituitary cells
(20, 22). It regulates the highly restricted expression of the
GH (23), PRL (24), and TSHß genes
(25) in somatotrophs, lactotrophs, and thyrotrophs. Defects in the
Pit-1 gene result in a failure of somatotrophs, lactotrophs,
and thyrotrophs to differentiate (26). In the sst1 gene two
consensus sequences for Pit-1 binding sites were detected, suggesting
that Pit-1 may be responsible for the pituitary expression of the
sst1 gene (21).
To study the transcriptional regulation of the sst1 gene in
the hypophysis, GH3 cells were used as model because these cells
represent a pituitary cell type and predominantly express the
sst1 gene (21). Previous studies with GH3 cells and other
pituitary cell cultures revealed that sst1 gene expression
is regulated by extracellular factors, such as SST (27),
glucocorticoids (28), and 17ß-estradiol (29). In the present article,
the molecular mechanisms underlying the sst1 gene expression
in anterior pituitary GH3 cells are analyzed, and several lines of
evidence suggest the critical involvement of Pit-1.
 |
RESULTS
|
|---|
Cell Type Specificity of the sst1 Gene Promoter
GH3 cells were chosen as a model to study the regulation of the
sst1 gene promoter in anterior pituitary cells because this
cell line endogenously expresses the sst1 gene (Fig. 1
and Ref. 21). Transfection of GH3 cells
with sst1Luc (Fig. 1A
), a construct that contains the luciferase
reporter gene under the control of 2 kb upstream DNA of the
sst1 gene spanning the region from +190 to -1985 (21),
resulted in a 15-fold increase of the reporter gene activity (Fig. 1B
).
However, in cells that do not express the sst1 gene
endogenously (Fig. 1C
), none or only a 2-fold increase in luciferase
activity was observed (Fig. 1B
). These results suggest that the 2-kb
promoter fragment suffices to control the cell type-specific expression
of the sst1 gene in anterior pituitary GH3 cells. The low
reporter gene activity found in Chinese hamster ovary (CHO), NIH3T3,
and IEC18/16 cells may represent a low level expression from a basal
promoter.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 1. Cell Type Specificity of the sst1
Gene Expression and sst1 Promoter Activity
A, A 2175-bp sst1 gene fragment ranging from -1985 bp
to +190 bp (indicated by the thick black line) was
subcloned upstream of the luciferase gene coding region (Luc) resulting
in the sst1Luc plasmid. pbasicLuc does not contain any regulatory
element. B and C, Anterior pituitary GH3 cells, Chinese hamster ovary
(CHO) cells, NIH3T3 fibroblasts, intestinal IEC18/16 and IEC6 cells,
and H-4-II-E hepatocytes were analyzed for luciferase activities after
transfections with psst1Luc and pbasicLuc (B) and for endogenous
sst1 gene expression by RT-PCR (C). B, Luciferase
activities obtained after transfection with psst1Luc were set in
relation to luciferase activities obtained after transfection with
pbasicLuc. The relative expression was determined by considering the
different transfection efficiencies of the cell lines by using
cotransfections with a ß-galactosidase expression plasmid. The
data represent the mean of two independent experiments carried out in
triplicate. C, The PCR reactions were performed with RNA (R) and the
corresponding cDNA (D) of each cell line as templates. The size of the
sst1 amplicon corresponds to the expected fragment
lengths of 318 bp. With ß-actin-specific primers, a product of 571 bp
was amplified, indicating that the cDNA is not contaminated with
genomic DNA.
|
|
Mapping of the sst1 Gene Promoter for Regions
Containing Functional Elements
To determine the location of regulatory elements within the 2 kb
upstream DNA, the promoter activities of various 5'-deletion mutants of
sst1Luc were analyzed in GH3 and for control in CHO cells. The results
revealed that three regions are important for the activity of the
sst1 gene promoter in anterior pituitary cells (Fig. 2
). The first is located between -1985
and -324. Progressive elimination of this DNA stretch resulted in a
7-fold increase in the activity of the reporter gene in discrete steps
and is therefore indicative of the presence of several negative
regulatory elements scattered in this region. These silencers reduced
but did not abolish the activity of the sst1 gene promoter
in GH3 cells. The second region is located between -324 and -117.
Deletion of this region resulted in an 8-fold decrease in reporter gene
activity, suggesting the presence of positive regulating elements. Some
luciferase activity was still detected in GH3 cells using the -48
sst1Luc construct. This activity was abolished when an
additional 100 bp were eliminated. Thus, a third region of
functional importance is present around the transcriptional start site
between -48 and +52 and likely contains the basal sst1 gene
promoter. In CHO cells the sst1 gene promoter activity
remained almost unaffected by the 5'-deletions to -48, suggesting that
the two upstream regions do not contribute to the low level activity of
the sst1 gene promoter in this cell line. However, reporter
activity is abolished using the +52 sst1Luc construct, supporting the
assumption that the basal promoter, which is active in CHO cells, has
been truncated.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2. Analysis of 5'-Deletion Mutants of the
sst1 Gene Promoter
The relative expression of full-length sst1Luc and various 5'-deletion
mutants (-1962sst1Luc, -1534 sst1Luc, -969 sst1Luc, -324 sst1Luc,
-165 sst1Luc, -117 sst1Luc, -48 sst1Luc, and +52 sst1Luc) were
determined after transfection of GH3 or CHO cells as described in the
legend of Fig. 1 . The luciferase activity of the basicLuc construct in
GH3 or CHO cells was set as 1. The data represent the mean of two
independent experiments carried out in triplicate. The positions of the
proximal and distal Pit-1 binding sites (pPit-1 and dPit-1, see text)
are indicated by open boxes. A putative Pit-1 binding
site identified in Ref. 21 is not functional (results not shown) and
was not considered here.
|
|
Footprint Analysis
The deletion analysis of the upstream DNA of the
sst1 gene revealed the presence of positive
cis-regulatory elements between -324 and +52 and of
negative cis-regulatory elements further upstream.
Deoxyribonuclease I (DNase I) protection assays were used to detect
binding sites for transcriptional regulators. Clearly, three DNA
segments in the positive regulatory region between -324 and +52 were
protected from DNase I digestion by nuclear proteins extracted from GH3
cells (Fig. 3
, A, B, and C). The presence
of additional weakly protected DNA regions cannot be excluded, but has
not been followed up further. The first footprint, fp1, spans the site
of transcription initiation and is located between -3 and +19 (Fig. 3A
). This footprint may correspond to the binding site of an initiation
factor guiding the basal apparatus to the mRNA start point. Sequence
analysis of the protected region revealed homology to binding sites for
the transcriptional regulators SP1 and HIP-1 (Table 1
). The second protected region, fp2, is
located between -158 and -136 (Fig. 3B
) and contains an A/T-rich DNA
element, TTATTAATCATTCAT. This element includes two sequences, TTAATCAT
and TCATTCAT, which correspond to consensus binding sites for the
pituitary-specific transcription factor Pit-1 (Table 1
). The fp2 DNA contains an additional
consensus sequence, in reverse orientation, for binding of the
ubiquitous transcription factor AP-1 (Table 1
). A third footprint, fp3,
at -287 to -268 contains the consensus sequence of a CCAAT/enhancer
binding protein (C/EBP) binding site (Fig. 3C
and Table 1
). The
location of these elements in the DNA region with promoter activity
suggests that they may be involved in the transcriptional activation of
the sst1 gene. A fourth footprint, fp4, was detected between
-1971 and -1942 (Fig. 3D
) within the silencer region that contains
consensus sequences for binding of Pit-1, AP-1, and Oct-1 (Table 1
). In
contrast to fp2, in the fp4 region the single Pit-1 motif is in reverse
and the AP-1 motif in direct orientation. Moreover, the fp4 sequence
contains the Hepta motif that has been shown to bind the ubiquitous
transcription factor Oct-1, which like Pit-1, is a POU-domain
transcription factor (30). Interestingly, the proximal putative Pit-1
site is part of the promoter region that activates sst1 gene
transcription, while the distal putative Pit-1 site is located in the
silencer region mediating transcriptional attenuation.

View larger version (92K):
[in this window]
[in a new window]
|
Figure 3. DNAse I Footprinting of the sst1
Gene Upstream Region
Appropriate fragments of the sst1 gene were end labeled
and treated with DNase I in the absence or presence of nuclear extracts
prepared from GH3 cells. The reaction products were analyzed by an 8%
sequencing gel. To identify the sequences of the protected sites, the
same fragments that were used for the protection assay have been
sequenced by chemical treatment as described in Materials and
Methods. The sequence of the protected sites and their
positions in the sst1 gene are indicated. Four
footprints (AD) have so far been detected. DNA, DNA treated with
DNase I in absence of nuclear proteins; GH3, DNA treated with DNase I
in the presence of nuclear protein extracts (10 and 20 µg protein,
respectively) from GH3 cells; G+A, purine-specific chemical sequence
reaction. *, Position of the mRNA start point.
|
|
Identification of Transcription Factors That Bind to fp2 and fp4
DNA
Electrophoretic mobility shift assays (EMSAs) were carried out to
prove the prediction that Pit-1, AP-1 and Oct-1 may bind at the fp2
and/or fp4 sites. For this purpose, radiolabeled oligonucleotides
corresponding to fp2 or fp4 were incubated with nuclear protein
extracts from GH3 cells. Four DNA-protein complexes were detected with
both probes (see Figs. 4
and 5
), suggesting binding of the same
hypophyseal proteins to the fp2 and fp4 DNA regions. Addition of an
anti-Pit-1 antiserum selectively eliminated the two most abundant
complexes 1 and 2 (Fig. 4A
and 4B
, lane
3), indicating the binding of Pit-1 to both fp2 and fp4 DNA. It
is a characteristic property of Pit-1 to bind as monomer and dimer to
target DNA, giving rise to double bands in EMSA analyses (31).
Application of the anti-Oct-1 antiserum resulted in elimination of the
much less abundant complex 4 (Fig. 4A
and 4B
, lane 4) indicating
that Oct-1 also binds at the fp2 and fp4 sites. An Oct-1 binding site,
the Hepta motif, was found within the fp2 region (Table 1
). Oct-1 may
bind there or alternatively at the Pit-1 site which was previously
shown in case of the PRL promoter (32, 33). No effect was
seen after addition of the anti-AP-1 antiserum (Fig. 4A
and 4B
, lane
5). Therefore, under the given conditions, no AP-1 binding could be
observed at both sites. For control, nuclear extracts from NIH3T3 and
CHO cells were used for analysis of Pit-1 and Oct-1 binding to fp2 and
fp4 DNA (data not shown). As expected, binding of the ubiquitously
expressed Oct-1, but not that of the pituitary-specific Pit-1, could be
detected.

View larger version (85K):
[in this window]
[in a new window]
|
Figure 4. EMSAs with fp2 and fp4 DNA
Radiolabeled oligonucleotides corresponding to fp2 (A) and fp4
(B) were incubated with nuclear extracts from GH3 cells or without any
extract (for control). Assays were analyzed on 5% nondenaturing
acrylamide gels. To identify proteins that bind the radiolabeled DNA,
EMSAs were performed in the presence of antisera directed against the
transcription factors Pit-1, Oct-1, and AP-1, respectively. The
antisera were added to the binding reaction before the radiolabeled DNA
was included. Under these conditions antibody-antigene binding inhibits
the formation of protein-DNA complexes.
|
|

View larger version (61K):
[in this window]
[in a new window]
|
Figure 5. EMSAs of fp2 and fp4 DNA in the Presence of
Competitors
As described in Fig. 5 , radiolabeled oligonucleotides corresponding to
fp2 (A) and fp4 (B) were incubated with nuclear extracts from GH3 cells
or for control without any extract. The competitor DNA was added to the
binding reactions in 10-fold and 50-fold excess over the radiolabeled
probe. The oligonucleotide hGH contains the proximal Pit-1 binding site
in the human GH gene (34 ). Additionally, an
oligonucleotide that contains a binding of the transcription factor Sp1
was used as nonspecific competitor.
|
|
The EMSA analyses shown (Fig. 4
) suggested no difference in
protein binding at the fp2 and fp4 DNA. This was confirmed by using fp2
and fp4 DNA as homologous and heterologous competitors. Protein binding
at the radiolabeled fp2 DNA was reduced by 67% and 64% when a 10-fold
excess of fp2 or fp4 DNA was used as competitor or by 95% and 97%
when a 50-fold excess of fp2 or fp4 DNA was used (Fig. 5A
, lanes 510). Similar results were
obtained when protein binding at the radiolabeled fp4 DNA was competed
with a 10-fold (reduction by 87% and 80%) or 50-fold (99% and 98%)
excess of fp2 and fp4 DNA (Fig. 5B
, lanes 510). Human GH (hGH), an
oligonucleotide that contains the proximal Pit-1 binding site of the
human GH gene (34), represents an effective competitor with
both probes (Fig. 5A
and Fig. 5B
, lanes 2, 3, and 4). However, the hGH
oligonucleotide competed more efficiently at the fp2 site, suggesting
that the fp2 and fp4 regions may not be equivalent. This
oligonucleotide competed also for Oct-1 binding. The fact that Oct-1
binds at the proximal Pit-1 binding site of the GH gene is
not very surprising. In previous EMSA analyses (86), a DNA-protein
complex that has not been fully characterized (GHF5) has been
found with striking similarities to the Oct-1/fp2 complex. Moreover,
Oct-1 binding has also been observed at other Pit-1 binding sites, such
as that of the PRL and the Pit-1 gene (32, 33). No
competition was observed when a nonspecific oligonucleotide containing
a SP-1 binding site was used as competitor (Fig. 5A
and 5B
, lanes
1113).
cis-Regulating Activity of the fp2 and fp4 DNA
The ability of fp2 and fp4 DNA to act as cis-regulatory
elements has been tested after the fusion of fp2 DNA or fp4 DNA to the
heterologous SV40 early promoter. Constructs containing the chimeric
promoters upstream of the luciferase reporter gene were transfected
into GH3 and for control in CHO cells. Figure 6
clearly shows that fp2 DNA, which
contains the proximal Pit-1 binding site, activated the heterologous
promoter in an orientation-independent manner specifically in GH3
cells. In contrast, fp4 DNA containing the distal Pit-1 binding site
repressed, independent of its orientation, the heterologous promoter.
Therefore, as predicted by the deletion analysis, the fp2 and fp4 DNA
elements harbor GH3 cell-specific cis-regulating activity
enhancing or attenuating transcription of the reporter gene.
Interestingly, the fp4 DNA serves as an enhancer in CHO cells.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 6. Regulation of a Heterologous Promoter by fp2 and
fp4 DNA
Five copies of fp2 and eight copies of fp4 DNA have been fused to the
SV40 early promoter/luciferase reporter gene (SV40Luc). The elements
were present in the same orientation as in the sst1 gene
(fp2fSV40Luc, fp4fSV40Luc) or in reverse orientation (fp2rSV40Luc,
fp4rSV40Luc). Luciferase activities were determined after transfection
of the corresponding plasmids in GH3 and CHO cells. The luciferase
activity of pbasicLuc was set to 1. A representative experiment
performed in triplicate is shown.
|
|
Transactivation of Promoter/Reporter Gene Constructs by Pit-1
So far the results demonstrate cis-regulating activity
of the fp2 and fp4 elements in GH3 cells and that they bind to Pit-1
in vitro. However, it remained unclear whether binding of
Pit-1 mediates the activity of the fp2 and fp4 DNA. To address this
question CV1 cells were cotransfected with the expression vector
CMVPit-1 and various promoter/reporter gene constructs (Fig. 7
). The promoter activities of the -324
sst1Luc and -165 sst1Luc constructs, which both contain the proximal
Pit-1 site, were enhanced 5-fold and 4-fold, respectively, by
cotransfection of CMVPit-1. The construct -117 sst1Luc, which lacks
this site, neither showed significant promoter activity nor
transactivation by Pit-1. These results indicate that Pit-1
transactivated the reporter gene only in the presence of the proximal
Pit-1 site. A similar, 7-fold increase in reporter activity was
obtained by cotransfection of CV1 cells with CMVPit-1 and the construct
fp2fSV40Luc containing the proximal Pit-1 site in the context of a
heterologous promoter (Fig. 7
). In contrast, the construct fp4fSV40Luc,
with the distal Pit-1 site in the context of the heterologous promoter,
could not be transactivated in the presence of CMVPit-1.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Transactivation of Various sst1 Gene
Promoter/Reporter Constructs after Cotransfection with a Pit-1
Expression Plasmid
CV1 cells were transfected with the constructs -165 sst1Luc, -117
sst1Luc, fp2fSV40Luc, or fp4fSV40Luc in the absence (-) or presence
(+) of the Pit-1 expression plasmid CMVPit-1. Subsequently, the
relative expression was determined as described in the legend to Fig. 1 . A representative experiment performed in triplicate is shown.
|
|
Mutational Analysis of the fp2 Region
As shown above (Fig. 2
) the -324 sst1Luc represents the
most active construct displaying a 90-fold increase of luciferase
activity over pbasicLuc. To evaluate the contribution of the fp2
region, four mutants were generated and analyzed for binding of GH3
cell nuclear proteins (Fig. 8A
), for
promoter activity in GH3 cells (Fig. 8B
), and in transactivation assays
in CV1 cells (Fig. 8C
). As shown in Fig. 8A
, protein binding to the
mutants m1fp2, m2fp2, m3fp2, and m4fp2 was reduced by 92 ± 3%,
66 ± 3%, 80 ± 5%, and 35 ± 5%, respectively.
Figure 8B
shows the resulting promoter activities when GH3 cells were
transfected with the mutant constructs. The constructs
-324m1sst1Luc, -324m2sst1Luc, and
-324m3sst1Luc with mutations that most strongly affected
protein binding did not show any promoter activity. This suggests that
the fp2 region is essential for the promoter activity of the -324
sst1Luc construct. The mutation -324m4sst1Luc with only a
moderate effect on protein binding displayed residual promoter
activity. To ensure that Pit-1 represents the necessary factor for
transactivation of the -324 sst1Luc promoter through binding the
proximal Pit-1 site, CV1 cells were transfected with mutant constructs
in absence or presence of the expression plasmid pCMVPit-1 (Fig. 8C
).
In line with the above described experiments, the mutants
-324m1sst1Luc, -324m2sst1Luc, and
-324m3sst1Luc did not show any promoter activity and could
not be transactivated by Pit-1 while the -324m4sst1Luc
construct could be transactivated 2-fold by Pit-1.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 8. Mutational Analysis of the fp2 Region
A, Four double stranded oligonucleotides, termed m1fp2m4fp2,
were generated with three consecutive nucleotide exchanges. The
positions of the two Pit-1 binding sites as revealed by sequence
analysis (Table 1 ) are indicated. Binding of GH3 cell nuclear proteins
was examined by EMSA with radiolabeled fp2 DNA as probe and the
oligonucleotides m1fp2m4fp2 and fp2 DNA as competitor. Band
intensities were quantified using the phosphoimager. B and C,
Corresponding mutations were introduced into the most active -324
sst1Luc construct and the resulting four plasmids,
-324m1sst1Luc to -324m4sst1Luc, were
transfected in GH3 (B) and CV1 cells (C). CV1 cells were transfected in
the absence (-) or presence (+) of the Pit-1 expression plasmid
CMVPit-1. Relative expression was determined as described in Fig. 1 .
Representative experiments performed in triplicate are shown.
|
|
The Presence of Pit-1 Is Essential for sst1 Gene
Expression in GH3 Cells
To obtain definite proof for the role of Pit-1 in
sst1 gene regulation, an antisense oligonucleotide approach
was designed to monitor the function of Pit-1 in viable anterior
pituitary cells. Therefore, the enhanced green fluorescent protein
(EGFP) coding region was used as a reporter gene driven by
sst1 gene promoter fragments. To establish that this
reporter system can be activated in a Pit-1-dependent fashion, GH3
cells were transfected with the construct -165 sst1EGFP containing the
proximal Pit-1 site or with the construct -117 sst1EGFP lacking this
site. When the -165 sst1EGFP construct was employed, intense green
fluorescence in a number of cells indicated significant promoter
activity (Fig. 9B
).
Monitoring GH3 cells transfected with -117 sst1EGFP revealed only very
low green fluorescence in a much smaller number of cells (data not
shown). This result confirmed that the 48-bp region containing the
proximal Pit-1 site is essential for sst1 gene promoter
activity also in viable GH3 cells.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 9. Treatment of GH3 Cells with Pit-1
Antisense Oligonucleotides
A, GH3 cells were preincubated for 8 days in the absence or presence of
control or antisense oligonucleotides and electroporated with -165
sst1EGFP. The cells were analyzed 24 h later for
Pit-1, sst1, and ß-actin mRNA levels by
semiquantitative RT-PCR. For control, RNA from untreated GH3 cells was
examined for the presence of Pit-1 mRNA (lane 1).
Subsequently, the PCR products were hybridized with a
third oligonucleotide specific for rat Pit-1 transcripts
(lane 2). The sizes of the amplified DNA fragments are indicated. The
numbers above the gel images refer to the cycle numbers
of the PCR reactions. H2O, No DNA control. RNA, PCR
reactions carried out in the absence of reverse transcription. B, C,
and D, Untreated GH3 cells and GH3 cells that were treated with
control or antisense oligonucleotides were analyzed for EGFP
fluorescence. E, F, and G, To demonstrate comparable cell numbers the
corresponding phase contrast micrographs are shown. H, The number of
fluorescent cells is given in percent of the number of cells that
fluoresced green after tranfection with pCMVEGFP. Transfection of this
plasmid, which contains the EGFP reporter gene under control of the GH3
cells in very active CMV (cytomegalovirus) promoter (85 ),
resulted in 10% fluorescent cells. I, Reduction of the numbers of the
endogenous somatostatin receptors in GH3 cells. After exposure to
oligonucleotides or vehicle a 125I-Tyr11-SST-14
binding assay was performed in the absence (w/o) or presence of the
analogs octreotide (1 µM) or CH-275 (1 µM).
100% binding of 125I-Tyr11-SST-14, which
corresponds to the amount of radioactive SST-14 that could be competed
by 1 µM SST-14 is calculated for each group and given in
counts per min.
|
|
Next, GH3 cells were treated with Pit-1 antisense
oligonucleotides that correspond to a short sequence of exon 6 of the
Pit-1 gene, which is present in all known Pit-1
splice variants (35), or with control oligonucleotides and transfected
with -165 sst1EGFP. Treatment of the cells with the antisense
oligonucleotides is expected to result in a decrease of
Pit-1 mRNA levels and therefore should diminish the levels
of Pit-1 protein. If Pit-1 is essential for activation of the
sst1 gene promoter, the antisense oligonucleotide treatment
should also reduce the activity of the -165 sst1EGFP construct. In
line with these assumptions, exposure of GH3 cells to the antisense
oligonucleotides caused a severe reduction of Pit-1 mRNA
levels (Fig. 9A
, top panel). The specificity of this effect
is indicated by the observation that ß-actin transcripts are not
affected (Fig. 9A
, bottom panel). Transfection of
-165 sst1EGFP in cells that have been pretreated with antisense
oligonucleotides resulted approximately in a 10-fold decrease in the
number of EGFP expressing cells when compared with control cells (Fig. 9
, B, C, D, and H). These experiments provide strong evidence for the
dependence of the sst1 gene promoter on Pit-1 in GH3
cells.
If this is true, then it should also be possible to observe reduced
levels of endogenous sst1 mRNA and sst1-mediated plasma
membrane binding sites for radiolabeled SST. Figure 9A
clearly shows
that antisense oligonucleotide treatment caused a profound reduction of
the amount of sst1 mRNA. To examine whether the number of
sst1 receptors is also affected in these cells,
[125I]Tyr11-SST-14
binding experiments were performed in the absence or presence of
octreotide and CH-275 as competitors. Octreotide displays clear
preference for sst2 and sst5 whereas CH-275 represents an
sst1-selective agonist (for review see Ref. 6). Figure 9I
reveals that
GH3 cells treated with control oligonucleotides bind specifically
[125I]Tyr11-SST-14 and
that CH-275 but not octreotide functions as an efficient competitor.
This is in agreement with the fact that GH3 cells are comparably rich
in sst1 mRNA, while sst2 mRNA is less abundant
(21). Binding of the radioligand to sites that cannot be competed using
octreotide and CH-275 is probably due to other ssts present in these
cells. In fact, mRNAs of all five ssts have been detected in GH3 cells
(21, 27). In GH3 cells that have been treated with antisense
oligonucleotides, the specific binding of
[125I]Tyr11-SST-14 is
reduced by about 50%. Moreover,
[125I]Tyr11-SST-14 could
not be displaced with the sst1-selective compound CH-275. The ability
of octreotide to compete for binding of
[125I]Tyr11-SST-14 was
unaffected. These results indicate that the number of sst1 receptors is
almost completely lost in these cells and demonstrate that expression
of the sst1 gene in anterior pituitary GH3 cells depends on
the presence of Pit-1.
Effect of Reduced sst1 Levels on the Secretion of PRL from GH3
Cells
To elucidate whether reduced sst1 levels on the plasma membranes
of GH3 cells influence the secretion of PRL, the major hormone released
from these cells, an antisense experiment was designed. GH3 cells were
incubated in the presence of an sst1 gene-specific antisense
oligonucleotide. For control, cells were incubated in the presence of
an unspecific oligonucleotide or in the absence of any oligonucleotide.
Treatment of the GH3 cells with the sst1 gene antisense
oligonucleotide resulted in a decrease of plasma membrane sst1
receptors by 61 ± 2% (Fig. 10A
).
The number of octreotide-sensitive binding sites remained
unaffected.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 10. Treatment of GH3 Cells with sst1 Antisense
Oligonucleotides
GH3 cells were preincubated for 7 days in the absence or presence of
control or antisense oligonucleotides directed against sst1
transcripts and thereafter analyzed for SST-14 binding sites (A) and
PRL release (B). A, The binding assay with
125I-Tyr11-SST-14 was performed as described in
Fig. 9 . One hundred percent binding of
125I-Tyr11-SST-14, which corresponds to the
amount of radioactive SST-14 that could be competed by 1
µM SST-14 is calculated for each group and given in
counts per min. B, The PRL release was stimulated by incubation of the
GH3 cells with 1 µM forskolin for 3 h in cell
culture medium. To inhibit this effect 0.5 µM
CH-275 or SST-14 was added to the culture medium. One hundred percent
basal PRL release corresponded to 21.6 ± 0.3, 20.7 ± 0.6,
and 27.0 ± 0.9 ng PRL per 100 µl medium and 1 x
105 cells for untreated and cells that had been treated
with control or antisense oligonucleotides.
|
|
PRL secretion was analyzed by RIA after stimulation of the cells with
forskolin in the presence or absence of SST-14 and the sst1-specific
agonist CH-275. Figure 10B
shows that the forskolin-induced PRL release
from GH3 cells could be inhibited by CH-275 and SST-14. In antisense
oligonucleotide-treated cells, but not in cells treated with control
oligonucleotide, the antisecretory effect of CH-275 was completely lost
and that of SST-14 was reduced by 71 ± 2% (Fig. 10B
).
 |
DISCUSSION
|
|---|
To understand the molecular mechanisms underlying the regulation
of the sst1 gene, 2 kb of 5'-upstream sequences of the rat
sst1 gene were analyzed for promoter activity in various rat
cell lines. The sst1 gene fragment extends from -1985 to
+190 including the complete 5'-untranslated region. Transient
expression assays with the luciferase coding region under control of
this fragment revealed that the sst1 gene promoter is active
in pituitary GH3 cells that express the sst1 gene
endogenously (21, 36). Cells that did not transcribe the
sst1 gene endogenously were also not able to activate the
sst1 gene promoter in transient transfection assays.
Therefore, the 2-kb 5'-upstream sequences contain the necessary
elements to control the specific expression the sst1 gene in
anterior pituitary GH3 cells.
Three regions of functional importance within the 2-kb sst1
gene fragment have been identified by promoter analyses of 5'-deletion
mutants. The first region is located between -48 and +52 displaying
basal promoter activity in GH3 cells. This region contains the start
site of transcription (21) and may therefore be important for the
correct initiation of transcription. Indeed, between -3 and +19, a
protein binding site, fp1, was identified by footprinting. Sequence
analysis of fp1 DNA revealed high homology with HIP-1 and SP1 binding
sites. Binding of the transcription factors SP1 and HIP-1 is known for
several initiator regions of gene promoters that, like the
sst1 gene promoter, lack a TATA box (37, 38). Similar to the
sst1 gene, no TATA or CAAT box could be identified in the
sst2, sst3, sst4, and sst5
genes (39, 40, 41, 42). Interestingly, a novel initiator element
(inr) was described in the human sst2 gene (43).
However, no sequence homology between the sst2inr and the
fp1 region in the sst1 gene is observed.
A second region of the sst1 gene promoter exhibiting most of
the positive regulation was located between -324 and -117. Within
this region, two binding sites for transcriptional regulators,
fp2 and fp3, have been identified by footprinting. The latter may bind
to proteins of the C/EBP family that are present in pituitary cells and
hence might activate the sst1 gene (44, 45). An element of
48 bp located between -165 and -117 confers a major part of the
promoter activity and contains the fp2 binding site. Several mutations
introduced into this site abolished binding of nuclear proteins and
promoter activity. Pit-1 binds at the fp2 site and thereby mediates
transcriptional activation of the sst1 gene. Definite proof
of the importance of Pit-1 for the regulation of the sst1
gene promoter stems from the targeting of Pit-1 transcripts
in vivo with antisense oligonucleotides. This treatment not
only caused a clear reduction of reporter activity in transient
transfection assays but also resulted in a decrease of sst1
mRNA and plasma membrane sst1 receptors. Therefore, the presence of
Pit-1 is necessary for the sst1 gene expression in anterior
pituitary GH3 cells.
A third region of the sst1 gene promoter was located between
-1985 and -324. It exhibits strong silencing activity, reducing
expression of the reporter gene about 7-fold. This negative regulation
could be involved in the observed modulation of sst1 gene
expression in response to external signals (27, 28, 46). It is well
documented that signaling molecules including steroid/thyroid hormones
(47, 48, 49), peptides (50), growth factors (51), and extracellular calcium
(52) can elicit increase or attenuation of transcription (53). The
function of the negative regulating elements may be to limit the
sst1 gene promoter activity to a level that is necessary to
provide anterior pituitary GH3 cell with an appropriate amount of
sst1 transcripts. Transcription could then be up-regulated
after signal-mediated relief of repression.
Surprisingly, within the region mediating transcriptional attenuation,
an additional Pit-1 site was identified. This distal Pit-1 site
mediated silencing activity to a heterologous promoter in transfected
GH3 cells that contain Pit-1. Furthermore, it failed to stimulate
reporter activity in the presence of recombinantly expressed Pit-1.
Therefore, the functional analyses suggest that the distal Pit-1 site
is part of the silencer of the sst1 gene promoter. The
failure of the distal Pit-1 site to silence the heterologous promoter
in the cotransfection experiment suggests that, in addition to Pit-1,
another protein is necessary, which is absent from CV1 cells.
Alternatively, a Pit-1 splice variant not encoded by the CMVPit-1
expression plasmid could be responsible for the silencing effect in GH3
cells that express several Pit-1 splice variants (54, 55, 56, 57).
Taken together, the data show that, within the sst1 gene
promoter, two Pit-1 sites were identified with opposing activity, the
distal site displaying negative and the proximal site with positive
regulatory activity. It is particularly noteworthy that no differences
in the binding of nuclear proteins to the distal and proximal Pit-1
sites were observed in the EMSA analysis, although competition
experiments with DNA corresponding to a Pit-1 site of the GH
promoter suggested that both sites may be functionally different. Three
hypotheses may explain the functional difference of the distal and
proximal Pit-1 sites: 1) Pit-1 splice variants bind at the two Pit-1
sites differentially, resulting in DNA-protein complexes that cannot be
distinguished by the EMSA technique. In fact, beyond its role as
transcriptional activator, alternatively spliced forms of Pit-1 have
been shown to repress PRL gene expression (54, 55). 2) Very
recently, it has been reported that Pit-1 is bound and its function
modulated by the nuclear receptor corepressor (N-CoR) and the
coactivator CBP (CREB-binding protein), which by themselves do
not bind DNA (58). In the sst1 gene, the corepressor may be
recruited by Pit-1 bound at the distal site and the
coactivator by Pit-1 bound at the proximal site, leading to
transcriptional attenuation and stimulation, respectively. 3) Another
POU domain transcription factor, Oct-1, binds at both sites with
similar affinities but may form different complexes as the Oct-1
binding site, Hepta, is only present within the fp4 region. It has been
shown that Pit-1 and Oct-1 form a heterodimeric complex leading to
enhanced transcriptional activation of the PRL gene (33).
Whatever the mechanisms might be, a dual transcriptional control by
Pit-1 has been observed before in the case of the autoregulation of the
Pit-1 gene itself (59).
The need of Pit-1 to be present for the sst1 gene expression
is demonstrated in GH3 cells that were treated with
Pit-1-specific antisense oligonucleotides. In these cells,
not only the level of Pit-1 transcripts but also that of
endogenous sst1 transcripts and sst1 receptors on the plasma
membrane is down-regulated. However, does this have any impact on the
response of these cells to SST-14, knowing that sst1 does not represent
the only sst subtype in GH3 cells (Fig. 9I
and 10A
and Ref. 21)? To
answer this question, the inhibitory effects of SST peptides were
analyzed on the forskolin-induced PRL release. Since PRL
gene expression also depends on Pit-1 (22), any effect on hormone
secretion could be due to an effect on the PRL gene itself.
Therefore, instead of diminishing the sst1 level with the
Pit-1-specific antisense oligonucleotide, the cells were
treated with an sst1-specific antisense oligonucleotide.
This treatment resulted in a loss of the CH-275-mediated inhibition of
the forskolin-induced PRL release and a reduction of the antisecretory
effect of SST-14. Thus, it is concluded that a decrease in sst1 levels
by transcriptional regulation via Pit-1 also results in a diminished
antisecretory response. The observed residual antisecretory effect of
SST-14 in sst1 antisense oligonucleotide-treated cells can
mainly be attributed to sst2. Consistent with this assumption is the
observation that SST binding to GH3 cell membranes is sensitive to
octreotide (Figs. 9H
and 10A
), an analog with highest affinity for sst2
(6). sst2 is present in reasonable amounts in GH3 cells (21), and
octreotide has been shown to inhibit the forskolin-induced PRL release
from rat pituitary cells (29).
What does it mean that sst1, a receptor that mediates the antisecretory
effect of SST-14, is under transcriptional control of Pit-1? The
pituitary-specific transcription factor Pit-1 is known as a
necessary regulator of the pituitary-specific hormone gene expression,
i.e., of the GH, PRL, and
TSHß genes (20, 22, 60). Moreover, Pit-1 controls the
expression of the gene encoding the GHRF receptor that is activated by
the GH-releasing hormone (61). Interestingly, SST inhibits hormone
release of GH, PRL, and TSHß in those pituitary cell types that
express Pit-1. The present study indicates that Pit-1 additionally
affects the inhibition of hormone secretion by controlling the
transcription of the sst1 gene that encodes a receptor for a
release-inhibiting hormone. Thus, Pit-1 represents a factor that
enables the coordinated biosynthesis of pituitary hormones but also of
receptors for its releasing and release-inhibiting factors.
The experiment with the Pit-1-specific antisense
oligonucleotide indicates (Fig. 9I
) that the pituitary expression of
the ssts other than sst1 do not depend on Pit-1. In line
with this observation, the sst2, sst3, and
sst5 gene promoters, which have been shown to be active in
pituitary cells, and the sst4 gene promoter do not contain
functional Pit-1 binding sites (39, 40, 41, 42). Therefore, it appears to be a
characteristic property of the sst1 gene to be the only SST
receptor gene that is activated by Pit-1.
The expression of the sst1 gene is not restricted to the
pituitary. In fact, sst1 transcripts are most widespread
among sst mRNAs (6), being detected in distinct areas of the
rat brain (65, 66, 67, 68), the pituitary (12, 67, 69), and the
gastrointestinal tract (70). Because of its highly restricted
expression profile, Pit-1 can only be responsible for the pituitary
expression of the sst1 gene. In cells that do not contain
Pit-1, other factors must activate the sst1 gene. Whether
other POU domain transcription factors that are present in the brain
(71) and/or in the gastrointestinal tract (72) are able to activate the
sst1 gene promoter is subject to further investigation.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
Cells were maintained at 5% CO2 in Hams
F10 supplemented with 2.5% FCS and 15% horse serum (GH3 cells), or
Hams F12 medium supplemented with 10% FCS (CHO cells), or DMEM (4.5
g/liter glucose) with 10% FCS (NIH3T3 and H-4-II-E cells), or DMEM
(4.5 g/liter glucose, without pyruvate) with 5% FCS (CV1) and 0.1 U/ml
insulin (Sigma, St. Louis, MO; IEC6 and IEC18/16
cells).
Cloning of Reporter Gene Constructs
A 2185-bp DNA fragment spanning a region from position -1985 to
+190 of the rat sst1 gene (21) and containing 10 bp of
pBluescript (Stratagene, Heidelberg, Germany) at its
5'-end was amplified by PCR with the primers ES1
(GCTTGATATCGAATTCCACTCTAAC) and ES2 (GATTGGGGAATATCCCAGCTGAAGTG) using
a cloned genomic DNA fragment as template. The amplicon was subcloned
into the SmaI site of pGL3-Basic (Promega Corp., Mannheim, Germany) upstream of the luciferase reporter
gene. The translation start codon at position 179181 bp of the
sst1 gene was changed into ATA to ensure that the
translation of the luciferase reporter gene will initiate at the
correct AUG. This construct was termed sst1Luc. The 5'-deletion mutants
of -969 sst1Luc, -324 sst1Luc, -117 sst1Luc, and +52 sst1Luc were
generated by digestion of the parental plasmid psst1Luc with
SacI, EcoRI/AocI,
EcoRI/SfiI, and
EcoRI/BssHII and religation. In case of double
digestions, 5'-overhangs were filled in with Klenow polymerase before
religation. The mutants -1962sst1Luc and the -1534 sst1Luc were
constructed by linearization of psst1Luc with EcoRI,
treatment with Exonuclease III and S1 nuclease, and religation (76).
The same procedure was employed to generate the -165 sst1Luc and -48
sst1Luc mutants using p-324 sst1Luc and MluI. Constructs
containing the enhanced green fluorescent protein (EGFP) reporter gene
were generated by subcloning of sst1 gene fragments derived
from SacI/HindIII digestions of the plasmids
p-324 sst1Luc, p-165 sst1Luc, and p-117 sst1Luc into the pEGFP-1
plasmid (CLONTECH Laboratories, Inc. Heidelberg, Germany)
linearized with SacI and HindIII. The resulting
constructs were termed -324 sst1EGFP, -165 sst1EGFP, and -117
sst1EGFP. The mutants -324m1sst1Luc,
-324m2sst1Luc, -324m3sst1Luc,
-324m4sst1Luc, -324m5sst1Luc, and
-324m6sst1Luc containing one point mutation, respectively,
within the fp2 region of the -324 sst1Luc plasmid were generated by a
method described by Higuchi (77) using the oligonucleotides m1fp2,
m2fp2, m3fp2, m4fp2, m5fp2, and m6fp2 (Fig. 8A
). For cloning of DNA
fragments containing multiple copies of the sequence protected
from digestion by DNase I in footprint analyses, the two couples of
complementary oligonucleotides C1
(TGTAACATTTTTTTCTCATGAATAATTCAGC-ATCT) and C2
(CAAGATGCTGAATTATTCATGAGAAAAAAA-TGTTA) containing fp4 and C3
(GATGGTGCTGCTTATTAATCATTCATCAGT) and C4
(TCTGGACTGATGAATGATTAATAAGCAGCA) containing fp2 were phosphorylated,
annealed, and ligated. The resulting multimeres were subcloned into the
SmaI site of the pGL3-Promoter plasmid (Promega Corp., Mannheim, Germany) upstream of the SV40 promoter and the
luciferase coding region.
Transient Transfection by Electroporation
All cell lines (except CV1 cells, see below) were transfected by
electroporation (Easyject Plus, Eurogentec, Brussels, Belgium)
according to Baum et al. (78). In brief, 24 x
106 cells were electroporated in 400 µl of the
appropriate culture medium (see above) with 20 µg plasmid DNA (1
µg/µl) under conditions of constant capacity (1050 µF) and
unlimited resistance and pulse time. Voltage was adjusted to 200 V
(H-4-II-E), 260 V (GH3, CHO, and NIH3T3), or 280 V (IEC 6 and IEC
18/16). Electroporated cells were plated in 10 ml of fresh medium and
harvested after 16 h of incubation at 37 C and 5%
CO2. To control the efficiency of transfection,
cells were cotransfected with 10 µg of the plasmid pCMVß
(CLONTECH Laboratories, Inc.) harboring the
ß-galactosidase coding region under control of the cytomegalovirus
promoter. For coexpression experiments, CV1 cells were transfected with
5 µg of the promoter/reporter plasmid and 5 µg of the CMVPit-1
expression plasmid that was described previously (31) using the
Ca-phosphate-DNA precipitation method (79).
Analyses of Luciferase, ß-Galactosidase, and EGFP
Activity
Extracts of the transfected cells were prepared and analyzed for
luciferase activities using a luciferase assay kit (Promega Corp.) in a luminometer (Lucy1, Anthos, Salzburg, Austria).
Light units were normalized to ß-galactosidase activity and protein
concentration using the Bradford dye assay (Bio-Rad Laboratories, Inc. Munich, Germany). The EGFP chromophore was detected by
fluorescence microscopy (Axioplan,Carl Zeiss, Oberkochen,
Germany) with a 450 to 490-nm band-pass excitation filter, a 510-nm
dichroic reflector, and a 520 to 750-nm long-pass emission
filter.
EMSA
Nuclear extracts from various cell lines were prepared as
previously described (80). About 500 µg protein were obtained from
1 x 108 cells. DNA was radiolabeled by the
filling in reaction with Klenow polymerase in the presence of
32P-dCTP and
32P-dGTP. About 1 ng of the radiolabeled DNA
(50,000 cpm) was incubated with 5 µg nuclear protein extract in 20
µl of 20 mM, HEPES pH 7.9, 1 mM EDTA, 5
mM dithiothreitol, 94 mg/ml poly(dI-dC)
(Pharmacia Biotech, Freiburg, Germany), 0.1% Nonidet
P-40, 3% glycerol, and 0.5 mg/ml BSA (Roche Molecular Biochemicals, Mannheim, Germany). In all binding reactions the
nuclear extracts were adjusted to room temperature for 15 min, and
thereafter the probe DNA was added and incubation continued at room
temperature for 15 min. For supershift experiments 2 µl of the
respective antiserum were added before the radiolabeled DNA was
included. For the competition experiments 10 ng, 50 ng, and 100 ng of
competitor DNA (a 10-, 50-, and 100-fold excess over the radiolabeled
DNA) were added to the binding reaction. Supershift experiments were
performed in the presence of 2 µl (1 mg/ml) of Pit-1, Oct-1, or AP-1
antisera (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
Samples were analyzed in a 5% nondenaturing acrylamide containing
0.5 x Tris-borate-EDTA as gel and running buffer. Gels
were dried at 60 C for 30 min and exposed at room temperature overnight
for phosphoimaging (BAS2000, Raytest, Straubenhardt, Germany). The TINA
software (Raytest) was used for quantification of band intensities.
DNase I Footprinting Analyses
To analyze the region between -324 and +52, a sense probe was
generated by digestion of the p-324 sst1Luc plasmid with
KpnI (the KpnI site is located in the polylinker
5' to the sst1 gene fragment) and BssHII
(position +52). The corresponding antisense probe was obtained by
cleavage of the same plasmid with the two enzymes, MluI
(site in the polylinker) and PvuII (position +45 and +173).
Another antisense probe, which spans from -1985 bp to -1867 bp, was
generated by digestion of the psst1Luc plasmid with MluI
(site in polylinker and at -1180 bp) and BbrPI (position
-1867). Cleaved DNA (20 µg) was precipitated with ethanol and
32P labeled by filling in the BssHII
site (sense probe) or the MluI sites (antisense probes) with
the mouse mammary leukemia virus reverse transcriptase (BRL,
Eggenstein, Germany) in the presence of
32P-dCTP and
32P-dGTP. The radiolabeled fragments of 400
bp, 381 bp, and 130 bp, respectively, were isolated from a 5%
polyacrylamide gel. The DNase I protection assay was performed using
the Hotfoot Footprinting Kit (Stratagene, Heidelberg,
Germany). The reactions were analyzed in an 8% sequencing gel.
Treatment of the Cells with Antisense Oligonucleotides
The phosphothioate oligonucleotides (Pit-1
antisense: CTGCCTTCGGTTGC; Pit-1 control: ACCGACCGACGTGT;
sst1 antisense: CAATGATGAGCACG; sst1 control: GTCCCTATACGAAC) were
designed and produced by Biognostik (Göttingen, Germany). The
Pit-1 antisense oligonucleotide corresponds to the position
from 841 to 854 of the Pit-1 mRNA (23). For the use
of antisense oligonucleotides that were directed against
Pit-1 transcripts, 2 x 106 GH3
cells were plated in 10-cm dishes. After 3 days the culture medium was
exchanged and supplemented with 2 µM of
the antisense, control oligonucleotide, or vehicle
(H2O) and maintained for 8 days with one medium
exchange after 3 days. At day 8, cells were harvested and one aliquot
(4 x 106 cells) was electroporated with
p-165 sst1EGFP and pCMVß plasmids under conditions described above in
the presence of 20 µM of the respective
oligonucleotide. Electroporated cells were seeded in 8 ml of culture
medium. Two aliquots of 2 ml were analyzed 24 h later for
EGFP-positive cells by counting the nonfluorescent cells (
2000) and
the green fluorescent cells (between 2 and 200) in the fields of vision
at a 100-fold magnification without changing the focus. To determine
the error, three different fields were counted per aliquot of plated
cells by two persons. To determine the transfection efficiencies,
ß-galactosidase-expressing cells were identified by staining with
XGal (Life Technologies, Eggenstein, Germany) using a
method described by Baum et al. (78) and counted. In line
with previously published results (78), about 31% of the
electroporated GH3 cells were routinely transfected with the
pCMVß plasmid. The presence of sense or antisense oligonucleotides
during the electroporation lowered the transfection efficiency to about
15%. The remaining 4 ml of electroporated cells
(
105 cells per electroporation) were used for
RT-PCR analysis (see below). For the performance of the SST-14 binding
assay (see below), nonelectroporated cells that were pretreated for 8
days with the Pit-1 antisense or sense oligonucleotides or
vehicle were seeded at a density of 4 x 104
cells per well in polylysine-coated 24-well plates and maintained for 8
days more in the presence of 2 µM of the
respective oligonucleotide.
For the treatment with sst1 antisense oligonucleotides, which
corresponded to the position from 729 to 742 of the rat sst1
gene (84), 1 x 105 GH3 cells were seeded in
polylysine-coated 24-well plates 8 days before starting the experiment.
Thereafter, the cell culture medium was supplemented with 2
µM of the antisense or control
oligonucleotide or with vehicle (H2O). Every 2
days the medium was exchanged containing fresh oligonucleotides. After
7 days, either the PRL release was assayed or the SST-14 assay was
performed.
RT-PCR
The total RNA of about 105 cells was
extracted and purified by using RNApure (Peqlab, Erlangen, Germany).
sst1-encoding mRNAs were quantified by semiquantitative amplification
of the corresponding cDNA, using ß-actin as an internal control, as
previously described (19). The same method was used to estimate
Pit-1 encoding transcripts using the primers Pitup
[AAGCGGTGGCTCTTAGTTCT, 81100 of exon 1, (35)] and Pitdown
[CCACAGGCAAGTCTTATCTG, 205224 of exon 6, (35)], which are designed
to amplify the coding region of all known Pit-1 transcripts.
To verify the RT-PCR product amplified with Pitup and Pitdown, a
third oligonucleotide Pithyb [TCTTCAGCCATCCGCATGAT, 6584 of exon 6,
(35)] was used for hybridization under standard conditions.
SST-14 Binding Assay
Cells that had been plated at a density of 410 x
104 cells per well in 24-well plates were washed
twice with PBS (137 mM NaCl, 5 mM KCl, 0.44
mM KH2PO4, 2.1
mM Na2HPO4, pH
7.4) and incubated on ice in serum-free medium supplemented with 0.1%
BSA and 25 pM
[125I]Tyr11-SST-14
(100.000 cpm) for 60 min. After incubation cells were washed twice with
PBS and lysed in 1 M NaOH and counted in a
-counter
(Canberra, Packard, Dreieich, Germany). Specifically bound
[125I]Tyr11-SST-14 was
determined in the presence of 1 µM SST-14.
Inhibition of PRL Release
Before the GH3 cells that had been plated at a density of 1
x105 cells per well of polylysine-coated 24 well
plates were stimulated with forskolin to release PRL, they were washed
twice, 2 h and immediately before the start of the experiment,
with the cell culture medium containing 25 mM HEPES, pH
7.4. Forskolin (1 µM) , vehicle (dimethylsulfoxide),
SST-14 (0.5 µM) , and CH-275 (0.5 µM) were
added to each well in 1 ml of fresh medium. After 3 h of
incubation at 37 C, the cell culture medium was removed from each well
and assayed for PRL by using a double-antibody RIA (Amersham Pharmacia Biotech, Freiburg, Germany).
 |
ACKNOWLEDGMENTS
|
|---|
We thank R. Freund and A. Schulze for expert technical
assistance. CH-275 was kindly provided by Drs. J. Rivier and C. H.
Hoeger (La Jolla, CA).
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Prof. Dr. W. Meyerhof, Abteilung Molekulare Genetik, Deutsches Institut für Ernährungsforschung, Arthur-Scheunert-Allee 114116, D-14558 Ptsdam-Rehbrücke, Germany.
This work was supported by the Deutsche Forschungsgemeinschaft
(SFB232/B4 to W.M and SFB 545/B7 to D.R.) and the Fonds der Chemischen
Industrie (to W.M.).
Received for publication July 15, 1998.
Revision received September 20, 1999.
Accepted for publication October 27, 1999.
 |
REFERENCES
|
|---|
-
Gillies G 1997 Somatostatin: the neuroendocrine story.
Trends Pharmacol Sci 18:8795[CrossRef][Medline]
-
Pelicci G, Pagliacci MC, Lanfrancone L, Pelicci PG, Grignani
F, Nicoletti I 1990 Inhibitory effect of the somatostatin analog
octreotide on rat pituitary tumour cell (GH3)
proliferation in vitro. J Endocrinol Invest 13:657662[Medline]
-
Cheung NW, Boyages SC 1995 Somatostatin-14 and its analog
octreotide exert a cytostatic effect on GH3 rat
pituitary tumor cell proliferation via a transient G0/G1 cell cycle
block. Endocrinology 136:41744181[Abstract]
-
Lamberts SW, Hofland LJ, de Herder WW, Kwekkeboom DJ, Reubi
JC, Krenning EP 1993 octreotide and related somatostatin analogs in the
diagnosis and treatment of pituitary disease and somatostatin receptor
scintigraphy. Front Neuroendocrinol 14:2755[CrossRef][Medline]
-
Lopez F, Esteve JP, Buscail L, Delesque N, Saint-Laurent N,
Vaysse N, Susini C 1996 Molecular mechanisms of the antiproliferative
effect of somatostatin: involvement of a tyrosine phosphatase.
Metabolism 45:1416[CrossRef][Medline]
-
Meyerhof W 1998 The elucidation of somatostatin receptor
functions: a current view. Rev Physiol Biochem Pharmacol 133:55108[Medline]
-
Hoyer D, Lubbert H, Bruns C 1994 Molecular pharmacology of
somatostatin receptors. Naunyn Schmiebergs Arch Pharmacol 350:441453
-
Rens-Domiano S, Law SF, Yamada Y, Seino S, Bell GI, Reisine T 1992 Pharmacological properties of two cloned somatostatin receptors.
Mol Pharmacol 42:2834[Abstract]
-
Raynor K, Murphy WA, Coy DH, Taylor JE, Moreau J-P, Yasuda K,
Bell GI, Reisine T 1993 Cloned somatostatin receptors: identification
of subtype-selective peptides and demonstration of high affinity
binding of linear peptides. Mol Pharmacol 43:838844[Abstract]
-
Perez J, Hoyer D 1995 Coexpression of somatostatin SSTR-4 and
SSTR-3 receptor mRNAs in the rat central nervous system. Neuroscience 64:241253[CrossRef][Medline]
-
Bruno JF, Xu Y, Song J, Berelowitz M 1993 Tissue distribution
of somatostatin receptor subtype messenger ribonucleic acid in the rat.
Endocrinology 133:25612567[Abstract/Free Full Text]
-
OCarroll A-M, Krempels K 1995 Widespread distribution of
somatostatin receptor messenger ribonucleic acids in rat pituitary.
Endocrinology 136:52245227[Abstract]
-
Bertherat J, Chanson P, Dewailly D, Dupuy M, Jaquet P, Peillon
F, Epelbaum J 1993 Somatostatin receptors, adenylate cyclase activity,
and growth hormone (GH) response to octreotide in GH-secreting
adenomas. J Clin Endocrinol Metab 77:15771583[Abstract]
-
Melmed S 1996 Acromegaly. Metabolism 45:5152[CrossRef][Medline]
-
Miller GM, Alexander JM, Bikkal HA, Katznelson L, Zervas NT,
Klibanski A 1995 Somatostatin receptor subtype gene expression in
pituitary adenomas. J Clin Endocrinol Metab 80:13861392[Abstract]
-
Greenman Y, Melmed S 1994 Heterogeneous expression of two
somatostatin receptor subtypes in pituitary tumors. J Clin
Endocrinol Metab 78:398403[Abstract]
-
Liapakis G, Hoeger C, Rivier J, Reisine T 1996 Development of
a selective agonist at the somatostatin receptor subtype sstr1. J
Pharmacol Exp Ther 276:10891094[Abstract/Free Full Text]
-
Roosterman D, Glassmeier G, Baumeister H, Scherübl H,
Meyerhof W 1998 A somatostatin receptor 1 selective ligand inhibits
Ca2+-currents in rat insulinoma 104638 cells. FEBS Lett 425:137140[CrossRef][Medline]
-
Wulfsen I, Meyerhof W, Fehr S, Richter D 1993 Expression
patterns of rat Somatostatin receptor genes in pre- and postnatal brain
and pituitary. J Neurochem 61:15491552[Medline]
-
Andersen B, Rosenfeld MG 1994 Pit-1 determines cell types
during development of the anterior pituitary gland. J Biol Chem 269:2933529338[Free Full Text]
-
Hauser F, Meyerhof W, Wulfsen I, Schönrock C, Richter D 1994 Sequence analysis of the promoter region of the rat somatostatin
receptor subtype 1 gene. FEBS Lett 345:225228[CrossRef][Medline]
-
Theill LE 1993 Transcriptional control of pituitary gene
expression. In: Karin M (ed) Gene Expression: General and
Cell-Type-Specific. Birkhäuser, Boston, pp 243295
-
Bodner M, Castrillo J-L, Theill LE, Deerinck T, Ellisman M,
Karin M 1988 The pituitary-specific transcription factor GHF-1 is a
homeobox-containing protein. Cell 55:505518[CrossRef][Medline]
-
Peers B, Voz ML, Monget P, Mathy-Hartert M, Berwaer M, Belayew
A, Martial JA 1990 Regulatory elements controlling pituitary-specific
expression of the human prolactin gene. Mol Cell Biol 10:46904700[Abstract/Free Full Text]
-
Lin SC, Li S, Drolet DW, Rosenfeld MG 1994 Pituitary ontogeny
of the Snell dwarf mouse reveals Pit-1-independent and Pit-1-dependent
origins of the thyrotrope. Development 120:515522[Abstract]
-
Li S, Crenshaw EBI, Rawson EJ, Simmons DM, Swanson LW,
Rosenfeld MG 1990 Dwarf locus mutants lacking three pituitary cell
types result from mutations in the POU-domain gene pit-1.
Nature 347:528533[CrossRef][Medline]
-
Bruno JF, Xu Y, Berelowitz M 1994 Somatostatin regulates
somatostatin receptor subtype mRNA expression in GH3 cells. Biochem
Biophys Res Commun 202:17381743[CrossRef][Medline]
-
Xu Y, Berelowitz M, Bruno JF 1995 Dexamethasone regulates
Somatostatin receptor subtype messenger ribonucleic acid expression in
rat pituitary GH4C1 cells.
Endocrinology 136:50705075[Abstract]
-
Djordjijevic D, Zhang J, Priam M, Viollet C, Gourdji D, Kordon
C, Epelbaum J 1998 Effect of 17ß-estradiol on somatostatin
receptor expression and inhibitory effect on growth hormone and
prolactin release in rat pituitary cell cultures. Endocrinology 139:22722277[Abstract/Free Full Text]
-
Kemler I, Schreiber E, Müller MM, Matthias P, Schaffner
W 1989 Octamer transcription factors bind to two different sequence
motifs of the immunoglobulin heavy chain promoter. EMBO J 8:20012008[Medline]
-
Ingraham HA, Flynn SE, Voss JW, Albert VR, Kapiloff MS, Wilson
L, Rosenfeld MG 1990 The POU-specific domain of Pit-1 is essential for
sequence-specific, high affinity DNA binding and DNA-dependent
Pit-1-Pit-1 interactions. Cell 61:10211033[CrossRef][Medline]
-
Elsholtz HP, Albert VR, Treacy MN, Rosenfeld MG 1990 A
two-base change in a POU factor-binding site switches
pituitary-specific to lymphoid-specific gene expression. Genes Dev 4:4351[Abstract/Free Full Text]
-
Voss JW, Wilson L, Rosenfeld MG 1991 POU-domain proteins Pit-1
and Oct-1 interact to form a heteromeric complex and can cooperate to
induce expression of the prolactin promoter. Genes Dev 5:13091320[Abstract/Free Full Text]
-
Bodner M, Karin M 1987 A pituitary-specific trans-acting
factor can stimulate transcription from the growth hormone promoter in
extracts of nonexpressing cells. Cell 50:267275[CrossRef][Medline]
-
Theill LE, Hattori K, Lazzaro D, Castrillo J-L, Karin M 1992 Differential splicing of the GHF1 primary transcript gives rise to two
functionally distinct homeodomain proteins. EMBO J 11:22612269[Medline]
-
Garcia PD, Myers RM 1993 Pituitary cell Line GH3 expresses two
somatostatin receptor subtypes that inhibit adenylyl cyclase:
functional expression of rat somatostatin receptor subtypes 1 and 2 in
human embryonic kidney 293 cells. Mol Pharmacol 45:402409[Abstract]
-
Means AL, Farnham PJ 1990 Transcription initiation from the
dihydrofolate reductase promoter is positioned by HIP1 binding at the
initiation site. Mol Cell Biol 10:653661[Abstract/Free Full Text]
-
Smale ST, Schmidt MC, Berk AJ, Baltimore D 1990 Transcriptional activation by Sp1 as directed through TATA or
initiator: specific requirement for mammalian transcription factor IID.
Proc Natl Acad Sci USA 87:45094513[Abstract/Free Full Text]
-
Kraus J, Woltje M, Schonwetter N, Hollt V 1998 Alternative
promoter usage and tissue specific expression of the mouse somatostatin
receptor 2 gene. FEBS Lett 428:165170[CrossRef][Medline]
-
Glos M, Kreienkamp H-J, Hausmann H, Richter D 1998 Characterization of the 5'-flanking promoter region of the rat
somatostatin receptor subtype 3 gene. FEBS Lett 440:3337[CrossRef][Medline]
-
Xu Y, Berelowitz M, Bruno JF 1998 Characterization of
the promoter region of the human somatostatin receptor subtype 2 gene
and localization of sequences required for estrogen-responsiveness. Mol
Cell Endocrinol 139:7177[CrossRef][Medline]
-
Greenwood MT, Panetta R, Robertson LA, Liu J-L, Patel YC 1994 Sequence analysis of the 5'-flanking promoter region of the human
somatostatin receptor 5. Biochem Biophys Res Commun 205:18831890[CrossRef][Medline]
-
Pscherer A, Dörflinger U, Kirfel J, Gawlas K,
Rüschoff J, Buettner R, Schüle R 1996 The helix-loop-helix
transcription factor SEF-2 regulates the activity of a novel initiator
element in the promoter of the human somatostatin receptor II gene.
EMBO J 15:66806690[Medline]
-
Schaufele F 1996 CCAAT/enhancer-binding protein alpha
activation of the rat growth hormone promoter in pituitary progenitor
GHFT15 cells. J Biol Chem 271:2148421489[Abstract/Free Full Text]
-
Wegner M, Cao Z, Rosenfeld MG 1992 Calcium-regulated
phosphorylation within the leucine zipper of C/EBP ß. Science 256:370373[Abstract/Free Full Text]
-
Bruno JF, Xu Y, Song J, Berelowitz M 1994 Pituitary and
hypothalamic somatostatin receptor subtype mRNA expression in the food
deprived and diabetic rat. Endocrinology 133:25612567
-
Bamberger CM, Bamberger AM, Wald M, Chrousos GP, Schulte HM 1997 Inhibition of mineralocorticoid activity by the ß-isoform of the
human glucocorticoid receptor. J Steroid Biochem Mol Biol 60:4350[CrossRef][Medline]
-
Chen S, Wang J, Yu G, Liu W, Pearce D 1997 Androgen and
glucocorticoid receptor heterodimer formation. A possible mechanism for
mutual inhibition of transcriptional activity. J Biol Chem 272:1408714092[Abstract/Free Full Text]
-
Brent GA 1994 The molecular basis of thyroid hormone action.
N Engl J Med 331:847853[Free Full Text]
-
OBrien RM, Granner DK 1991 Regulation of gene expression by
insulin. Biochem J 278:609619
-
Matrisian LM, Ganser GL, Kerr LD, Pelton RW, Wood LD 1992 Negative regulation of gene expression by TGF-ß. Mol Reprod Dev 32:111120[CrossRef][Medline]
-
Okazaki T, Ando K, Igarashi T, Ogata E, Fujita T 1992 Conserved mechanism of negative gene regulation by extracellular
calcium. Parathyroid hormone gene versus atrial natriuretic polypeptide
gene. J Clin Invest 89:12681273
-
Clark AR, Docherty K 1993 Negative regulation of transcription
in eukaryotes. Biochem J 296:521541
-
Day RN, Day KH 1994 An alternatively spliced form of Pit-1
represses prolactin gene expression. Mol Endocrinol 8:374381[Abstract/Free Full Text]
-
Day RN, Day KH 1994 Specific repression of rat prolactin gene
expression in transplanted tumor cells. Mol Endocrinol 8:1220[Abstract/Free Full Text]
-
Haugen BR, Wood WM, Gordon DF, Ridgway EC 1993 A
Thyrotrope-specific variant of Pit-1 transactivates the
thyrotropin ß promoter. J Biol Chem 268:2081820824[Abstract/Free Full Text]
-
Morris AE, Kloss B, McChesney RE, Bancroft C, Chasin LA 1992 An alternatively spliced Pit-1 isoform altered in its ability to
trans-activate. Nucleic Acids Res 20:13551361[Abstract/Free Full Text]
-
Xu L, Lavinsky RM, Dasen JS, Flynn SE, McInerney EM, Mullen
T-M, Heinzel T, Szeto D, Korzus E, Kurokawa R, Aggarwal AK, Rose DW,
Glass CK, Rosenfeld MG 1998 Signal-specific co-activator domain
requirements for Pit-1 activation. Nature 395:301306[CrossRef][Medline]
-
Chen R, Ingraham HA, Treacy MN, Albert VR, Wilson L, Rosenfeld
MG 1990 Autoregulation of pit-1 gene expression mediated by
two cis-active promoter elements. Nature 346:583586[CrossRef][Medline]
-
Treier M, Rosenfeld MG 1996 The hypothalamic-pituitary axis:
co-development of two organs. Curr Opin Cell Biol 8:833843[CrossRef][Medline]
-
Lin C, Lin S-C, Chang C-P, Rosenfeld MG 1992 Pit-1-dependent
expression of the receptor for growth hormone releasing factor mediates
pituitary cell growth. Nature 360:765768[CrossRef][Medline]
-
Tentler JJ, Hadcock JR, Gutierrez-Hartmann A 1997 Somatostatin
acts by inhibiting the cyclic 3', 5'-adenosine monophosphate
(cAMP)/protein kinase A pathway, cAMP response element -binding protein
(CREB) phosphorylation, and CREB transcription potency. Mol Endocrinol 11:859866[Abstract/Free Full Text]
-
Mayo KE, Hammer, RE, Swanson, LW, Brinster, RL,
Rosenfeld, MG, Evans, RM 1988 Dramatic pituitary hyperplasia in
transgenic mice expressing a human growth-hormone-releasing factor
gene. Mol Endocrinol 2:606612[Abstract/Free Full Text]
-
Bertherat J 1997 Nuclear effects of the cAMP pathway
activation in somatotrophs. Horm Res 47:245250[Medline]
-
Meyerhof W, Wulfsen, I, Schönrock, C, Fehr, S, Richter,
D 1992 Molecular cloning of a somatostatin-28 receptor and comparison
of its expression pattern with that of a somatostatin-14 receptor in
rat brain. Proc Natl Acad Sci USA 89:1026710271[Abstract/Free Full Text]
-
Senaris RM, Humphrey PP, Emson PC 1994 Distribution of
somatostatin receptors 1, 2 and 3 mRNA in rat brain and pituitary. Eur
J Neurosci 6:18831896[CrossRef][Medline]
-
Kong H, DePaoli AM, Breder CD, Yasuda K, Bell GI, Reisine T 1994 Differential expression of messenger RNAs for somatostatin
receptor subtypes SSTR1, SSTR2 and SSTR3 in adult rat brain: analysis
by RNA blotting and in situ hybridization histochemistry.
Neuroscience 59:175184[CrossRef][Medline]
-
Beaudet A, Greenspun D, Raelson J, Tannenbaum GS 1995 Patterns
of expression of SSTR1 and SSTR2 somatostatin receptor subtypes in the
hypothalamus of the adult rat: relationship to neuroendocrine function.
Neuroscience 65:551561[CrossRef][Medline]
-
Raulf F, Pérez J, Hoyer D, Bruns C 1994 Differential
expression of five somatostatin receptor subtypes, SSTR15, in the CNS
and peripheral tissue. Digestion 55:4653
-
Krempels K, Hunyady B, OCarroll AM, Mezey E 1997 Distribution of somatostatin receptor messenger RNAs in the rat
gastrointestinal tract. Gastroenterology 112:19481960[CrossRef][Medline]
-
He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW,
Rosenfeld MG 1989 Expression of a large family of POU-domain regulatory
genes in mammalian brain development. Nature 340:3542[CrossRef][Medline]
-
Fuller PJ, Beveridge DJ, Taylor RG 1995 POU-domain gene
expression in the gastrointestinal tract. J Cell Biochem 58:260267[CrossRef][Medline]
-
Li X-J, Forte M, North RA, Ross CA, Snyder SH 1992 Cloning and
expression of a rat somatostatin receptor enriched in brain. J
Biol Chem 267:2130721312[Abstract/Free Full Text]
-
Castrillo J-L, Theill LE, Karin M 1991 Function of the
homeodomain protein GHF1 in pituitary cell proliferation. Science 253:197199[Abstract/Free Full Text]
-
Keri G, Mezo I, Vadasz Z, Horvath A, Idei M, Vantus T, Balogh
A, Bokonyi G, Bajor T, Teplan I 1993 Structure-activity relationship
studies of novel somatostatin analogs with antitumor activity. Pept Res 6:281288[Medline]
-
Guo L-H, Wu, R 1983 Exonuclease III: Use for DNA sequence
analysis and in specific deletions of nucleotides. Methods Enzymol 100:6096[Medline]
-
Higuchi R 1990 Recombinant PCR. In Innis MA, Gelfand DH,
Sninsky JJ, White TJ (eds) PCR Protocols. Academic Press Ltd, London,
pp 177183
-
Baum C, Forster P, Hegewisch-Becker S, Harbers K 1994 An
optimised electroporation protocol applicable to a wide range of cell
lines. Biotechniques 17:10581062[Medline]
-
Chen C, Okayama H 1988 Calcium phosphate-mediated gene
transfer: A highly efficient transfection system for stably
transforming cells with plasmid DNA. Biotechniques 6:632638[Medline]
-
Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res 11:14751489[Abstract/Free Full Text]
-
Janson L, Bark C, Pettersson U 1987 Identification of proteins
interacting with the enhancer of human U2 small nuclear RNA genes.
Nucleic Acids Res 15:49975016[Abstract/Free Full Text]
-
Lee W, Mitchell P, Tjian R 1987 Purified transcription factor
AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741752[CrossRef][Medline]
-
Johnson PF, Landschulz WH, Graves BJ, McKnight SL 1987 Identification of a rat liver nuclear protein that binds to the
enhancer core element of three animal viruses. Genes Dev 1:133146[Abstract/Free Full Text]
-
Meyerhof W, Paust H-J, Schönrock C, Richter D 1991 Cloning of a cDNA encoding a novel putative G-protein-coupled receptor
expressed in specific rat brain regions. DNA Cell Biol 10:689694[Medline]
-
Pasleau F, Tocci MJ, Leung F, Kopchick JJ 1985 Growth
hormone gene expression in eukariotic cells directed by the Rous
sarcoma virus long terminal repeat or cytomegalovirus immediate-early
promoter. Gene 38:227232[CrossRef][Medline]
-
Schaufele F, West LB, Reudelhuber T 1990 Somatotrop- and
lactotroph-specific interactions with the homeobox protein binding
sites in the rat growth hormone gene promoter. Nucleic Acids Res 18:52355243[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Petersenn, A. C. Rasch, C. Bohnke, and H. M. Schulte
Identification of an Upstream Pituitary-Active Promoter of Human Somatostatin Receptor Subtype 5
Endocrinology,
July 1, 2002;
143(7):
2626 - 2634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. W. Woodmansee, R. L. Mouser, D. F. Gordon, J. M. Dowding, W. M. Wood, and E. C. Ridgway
Mutational Analysis of the Mouse Somatostatin Receptor Type 5 Gene Promoter
Endocrinology,
June 1, 2002;
143(6):
2268 - 2276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Salvatori, X. Fan, P. E. Mullis, A. Haile, and M. A. Levine
Decreased Expression of the GHRH Receptor Gene Due to a Mutation in a Pit-1 Binding Site
Mol. Endocrinol.,
March 1, 2002;
16(3):
450 - 458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Andersen and M. G. Rosenfeld
POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease
Endocr. Rev.,
February 1, 2001;
22(1):
2 - 35.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Baumeister and W. Meyerhof
The POU Domain Transcription Factor Tst-1 Activates Somatostatin Receptor 1 Gene Expression in Pancreatic beta -Cells
J. Biol. Chem.,
September 8, 2000;
275(37):
28882 - 28887.
[Abstract]
[Full Text]
[PDF]
|
 |
|