help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN
Molecular Endocrinology 14 (4): 518-534
Copyright © 2000 by The Endocrine Society

Subnuclear Trafficking of Estrogen Receptor-{alpha} and Steroid Receptor Coactivator-1

David L. Stenoien, Maureen G. Mancini, Kavita Patel, Elizabeth A. Allegretto*, Carolyn L. Smith and Michael A. Mancini

Department of Molecular and Cellular Biology (D.L.S., M.G.M., K.P., C.L.S., M.A.M.) Baylor College of Medicine Houston, Texas 77030
Ligand Pharmaceuticals, Inc. (E.A.A.) San Diego, California 92121


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have *analyzed ligand-dependent, subnuclear movements of the estrogen receptor-{alpha} (ER{alpha}) in terms of both spatial distribution and solubility partitioning. Using a transcriptionally active green fluorescent protein-ER{alpha} chimera (GFP-ER{alpha}), we find that 17ß-estradiol (E2) changes the normally diffuse nucleoplasmic pattern of GFP-ER{alpha} to a hyperspeckled distribution within 10–20 min. A similar reorganization occurs with the partial antagonist 4-hydroxytamoxifen; only a subtle effect was observed with the pure antagonist ICI 182,780. To examine the influence of ligand upon ER{alpha} association with nuclear structure, MCF-7 cells were extracted to reveal the nuclear matrix (NM). Addition of E2, 4-hydroxytamoxifen, or ICI 182,780 causes ER{alpha} to partition with the NM-bound fraction on a similar time course (10–20 min) as the spatial reorganization suggesting that the two events are related. To determine the effects of E2 on the redistribution and solubility of GFP-ER{alpha}, individual cells were directly examined during both hormone addition and NM extraction and showed that GFP-ER{alpha} movement and NM association were coincident. Colocalization experiments were performed with antibodies to identify sites of transcription (RNA pol IIo) and splicing domains (SRm160). Using E2 treated MCF-7 cells, minor overlap was observed with transcription sites and a small amount of the total ER{alpha} pool. Experiments performed with bioluminescent derivatives of ER{alpha} and steroid receptor coactivator-1 (SRC-1) demonstrated both proteins colocalize to the same NM-bound foci in response to E2 but not the antagonists tested. Deletion mutagenesis and in situ analyses indicate intranuclear colocalization requires a central SRC-1 domain containing LXXLL motifs. Collectively, our data suggest that ER{alpha} transcription function is dependent upon dynamic early events including intranuclear rearrangement, NM association, and SRC-1 interactions.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogen receptor-{alpha} (ER{alpha}) is a well characterized member of the nuclear receptor (NR) superfamily that regulates transcription of specific target genes in response to hormone (reviewed in Refs. 1, 2, 3). ER{alpha} contains several functional domains including a C-terminal, ligand-binding domain (LBD) and a centrally located zinc finger DNA-binding domain. Transcriptional activation is mediated by at least two activation function domains (AFs). Activation by AF-2, located in the LBD, is dependent upon agonist binding (4), while the amino terminal AF-1 domain can be activated independently of agonist (5). The LBD of ER{alpha} recognizes a variety of compounds including the endogenous agonist 17ß-estradiol (E2) and the pure antagonists ICI 182,780 and ICI 164,384. The synthetic ligands 4-hydroxytamoxifen (4HT) and raloxifene act as partial antagonists that exert differential effects on ER{alpha} activity depending upon cell type, tissue, and promoter context (5, 6, 7).

A number of biochemical and yeast two-hybrid studies have identified proteins capable of interacting with NRs and influencing their transcriptional activity. These include corepressors and several classes of coactivators. Proteins belonging to the p160 family of steroid receptor coactivators, such as SRC-1/N-CoA1 (8, 9) and Grip-1/TIF2/N-CoA2 (10, 11, 12), associate with ER{alpha} and other NRs and enhance transcriptional activation (13, 14, 15). These coactivators interact with the agonist-bound LBDs via a motif, LXXLL, known as the NR box (16, 17) using the AF-2 interaction surface (18). Once bound to the NR, coactivators are thought to enhance NR-based transcription by several mechanisms (19). The discovery that many coactivators including SRC-1 possess intrinsic histone acetylase activity (20) suggests that chromatin remodeling plays an important role in transactivation. Coactivators may also mediate interactions with other transcription factors and play a role in the assembly and stabilization of the transcriptional preinitiation complex.

A key question remains as to how transcriptional complexes containing steroid receptors, coactivators, and other components are organized in terms of nuclear architecture. Many reports in recent years indicate that nuclear metabolism is organized in discrete subnuclear compartments (reviewed in Refs. 21, 22, 23). Transcription appears to be organized into transcriptional factories that contain newly synthesized mRNA (24, 25) and the active, hyperphosphorylated form of the RNA polymerase II large subunit [pol IIo (26, 27, 28)]. Transcription factories are limited to several thousand sites representing less than 5% of the nuclear volume (23, 29). Splicing factors such as SC-35 and SRm160 are also primarily localized to nuclear foci, referred to as splicing speckles, that can be distinct from transcription sites (30, 31, 32). Interestingly, transcription sites, splicing speckles, newly synthesized mRNA, and actively transcribed genes have all been reported to associate with the biochemically and morphologically defined nuclear matrix (NM) (22, 33, 34, 35, 36, 37, 38). Furthermore, a number of transcription factors, including steroid receptors, have long been known to associate with the NM (39, 40, 41, 52). Given that many of the components involved in transcription are NM associated, it is possible to argue that the NM plays an important role in the organization and regulation of transcription (23, 39, 40).

In the present study we examine the effects of ligand binding on the organization of ER{alpha} and its interactions with subnuclear domains, the NM, and the steroid receptor coactivator, SRC-1. High-resolution fluorescence microscopy performed upon fixed and live cells in conjunction with biochemical partitioning assays reveal ER{alpha} to be a surprisingly dynamic nuclear regulator whose function is linked to rapid, ligand-based changes in its nuclear distribution and association with nuclear architecture, and with SRC-1.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Characterization of a Monoclonal ER{alpha} Antibody
To characterize the dynamic changes that ER{alpha} undergoes in response to ligand, we have developed several experimental protocols involving microscopic and Western blot analyses of both endogenous and transfected ER{alpha}. For many of these studies, a monoclonal antibody, ERnt (42) was used that recognizes the amino terminus of ER. On Western blots this antibody recognizes a band of 66 kDa in MCF-7 cells that expresses endogenous ER{alpha} (Fig. 1Go A, lane 1) and HeLa cells that are transiently transfected with an ER{alpha} expression plasmid (Fig. 1AGo, lane 3). In untransfected HeLa cells, no ERnt immunoreactivity was observed by Western blot (Fig. 1AGo, lane 2) or immunofluorescence (data not shown). Immunofluorescence on whole-fixed and hormone-treated (10 nM E2; 1 h) MCF-7 cells that endogenously express ER{alpha} reveals a staining pattern dispersed throughout the nucleoplasm (Fig. 1Go, B and C). The ligand-independent, nuclear pattern obtained with the ERnt mAb is similar to that reported previously in cells that endogenously express ER{alpha} and occurs in both the presence and absence of hormone (43, 44, 45). To determine whether the staining pattern of exogenously expressed ER{alpha} is similar to that observed in MCF-7 cells, immunofluorescence was performed on transfected, hormone-treated HeLa cells. In these cells, ERnt immunoreactivity is exclusively nuclear in a pattern similar to MCF-7 cells (Fig. 1Go, D and E). To obtain high-resolution images, we employed a deconvolution-based, immunofluorescence approach [Applied Precision, Inc. (46, 47)]; shown in Fig. 1Go, C and E, are the corresponding deconvolved images from Fig. 1Go, B and D, respectively. The deconvolved images provide considerably more detail than conventional immunofluorescence and demonstrate that in the presence of E2, ER{alpha} is distributed throughout the nucleoplasm in a distinctly hyperspeckled pattern.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 1. Characterization of a Monoclonal ER{alpha} Antibody

The ERnt antibody recognizes a band of the correct molecular mass for ER{alpha} (~66 kDa) in MCF-7 cells (panel A, lane 1). This antibody does not react with any bands in untransfected HeLa cells (panel A, lane 2) but does recognize a 66-kDa band in HeLa cells transfected with an ER{alpha} mammalian expression plasmid (panel A, lane 3). In HeLa cells transfected with a GFP-ER{alpha} expression vector (pEGFP-C1-hER{alpha}), the ERnt antibody recognizes a band corresponding to the correct molecular mass (~94 kDa) for the GFP-ER{alpha} fusion protein (panel A, lane 4). In untransfected MCF-7 cells treated with estradiol (10 nM, 1 h), ERnt immunoreactivity is predominantly nuclear and punctate (B and C). No immunoreactivity is observed in untransfected HeLa cells (data not shown) but in HeLa cells transfected with an ER{alpha} expression plasmid, ERnt immunoreactivity is similar to that observed in MCF-7 cells (D and E). Panels C and E represent the corresponding deconvolved images from panels b and d. the same punctate pattern can be observed in both the raw and deconvolved images, but the deconvolution process removes background fluorescence and lens spherical aberrations to generate images that approximate the theoretical limits of resolution. all immunofluorescent assays were performed in the presence of 10 nM e2. Bar = 10 µm.

 
Characterization of GFP-ER{alpha}
To study the dynamic distribution of ER{alpha} in living cells, we subcloned the ER{alpha} coding region into the pEGFP-C1 vector (CLONTECH Laboratories, Inc., Palo Alto, CA) to generate a green fluorescent protein-ER{alpha} expression plasmid (pEGFP-C1-hER; GFP-ER{alpha}). On Western blots of transfected HeLa cells, the ERnt antibody recognizes a band of approximately 94 kDa corresponding to the predicted molecular mass of GFP-ER{alpha} (Fig. 1Go, lane 4). To ensure that the GFP portion of our GFP-ER{alpha} construct does not interfere with ER{alpha} activity, GFP-ER{alpha} and ER{alpha} plasmids were cotransfected along with an ER-responsive reporter plasmid, ERE-E1b-Luc (48) (Fig. 2AGo). As shown in this figure, the overall activity levels of GFP-ER{alpha} and untagged ER{alpha} in the presence of hormone are very similar. In the absence of hormone the basal activities of both receptors were similarly low.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 2. Characterization of GFP-ER{alpha}

Activity assays were performed to compare the relative activities of GFP-ER{alpha} and untagged ER{alpha} (A). The pEGFP-C1-hER{alpha} plasmid (GFP-ER{alpha}) or a plasmid in which the GFP was removed from the original GFP vector (pEGFP-C1-hER-ER{alpha} -GFP; ER{alpha}) was cotransfected with a luciferase reporter plasmid under the control of an ER response element (ERE-E1b-luc; 47). In the absence of hormone the relative luciferase units of GFP-ER{alpha} (11.8 ± 1.9, n = 5) and ER{alpha} (14.8 ± 5.2, n = 5) were low. However, in the presence of 10 nM E2, a substantial increase in both GFP-ER{alpha} and ER{alpha} induced luciferase activity. The relative luciferase activity of GFP-ER{alpha} was set to 100 (n = 5). untagged ER{alpha} was slightly more active than GFP-ER{alpha} (122.6 ± 17.7, n = 5). the subcellular distribution of GFP-ER{alpha} was tested by transfecting HeLa, HepG2, and MCF-7 cells (B). in the absence of hormone, GFP-ER{alpha} was nuclear with a diffuse distribution in all cell lines tested. in the presence of E2 (10 nM; 1Hr), GFP-ER reorganized from a diffuse to punctate distribution. Images are deconvolved and represent a single Z-section. Bar = 10 µm.

 
Analysis of GFP-ER{alpha} in Living Cells
To determine the effects of ligand binding on GFP-ER{alpha} distribution, HeLa cells were transfected, transferred to a live cell, closed perfusion chamber (Bioptechs, Inc., Butler, PA) and maintained at 37 C in CO2-equilibrated, HEPES-buffered DMEM containing 5% dextran charcoal-stripped FBS. Before hormone addition, GFP-ER{alpha} had a diffuse distribution throughout the nucleoplasm but was excluded from nucleoli (Fig. 2BGo, top left). After hormone treatment (10 nM E2, 1 h), the same cells were examined and GFP-ER{alpha} was found in a punctate distribution (Fig. 2BGo; top right). Hormone also induced a similar reorganization of GFP-ER{alpha} in both HepG2 (middle row) and MCF-7 cells (bottom row). The time course of GFP-ER{alpha} redistribution was determined by performing, time-lapse microscopy on live HeLa cells over the course of 40 min. Initial experiments indicated that excessive exposure of cells to light can diminish GFP-ER{alpha} signal and inhibit intranuclear dynamics, therefore, neutral density filters and low exposure times were used (see Materials and Methods). This results in a slight loss in resolution but facilitates study of intranuclear dynamics. Perfusion of E2 (10 nM; Fig. 3Go, first row) resulted in a redistribution of GFP-ER{alpha} from diffuse to punctate. Detectable differences in GFP-ER{alpha} relocalization were observed within 10 min and reached a maximum by 30 min. To determine whether this reorganization occurred with other ER{alpha} ligands, 4HT and the pure antagonists ICI 164,384 and ICI 182,780 were also tested. In the presence of 4HT (10 nM; Fig. 3Go, second row) GFP-ER{alpha} underwent a similar reorganization as with E2. Addition of ICI 164,384 (10 nM; Fig. 3Go, third row) had little effect on GFP-ER{alpha} distribution in transfected HeLa cells. With ICI 182,780 (10 nM; Fig. 3Go, bottom row), a subtle alteration in GFP-ER{alpha} distribution was observed. These results are similar to those obtained in a recent investigation by Htun et al. (45), examining the effects of ligands on GFP-ER{alpha} distribution. This group studied GFP-ER{alpha} localization in a number of cell lines including MCF-7 cells and found reorganization occurs in response to E2, 4HT, and ICI 182,780. In those experiments, however, different cells were imaged before and after hormone addition. Our experimental design has allowed us to directly determine the dynamics and timing of ligand-induced, intranuclear ER{alpha} movements and demonstrate they occur in a time scale of 10–20 min.



View larger version (124K):
[in this window]
[in a new window]
 
Figure 3. Time Course of GFP-ER{alpha} Redistribution

HeLa cells were transiently transfected with pEGFP-C1-hER{alpha}, and live cells expressing GFP-ER{alpha} were analyzed at 10-min intervals. Before ligand addition, GFP-ER{alpha} was nuclear but diffuse. Addition of E2 (10 nM; top row) resulted in a rapid reorganization of GFP-ER{alpha} within 10 min. Addition of 4HT (10 nM; second row) resulted in a similar redistribution during the same timecourse. Addition of ICI 164,384 (10 nM; third row) had little effect on GFP-ER{alpha} localization. ICI 182,780 addition (10 nM; bottom row) altered the distribution of GFP-ER{alpha} although this redistribution was not as pronounced as that observed with E2 and 4HT. All images are deconvolved. Bar = 10 µm.

 
Association of ER{alpha} with the NM
The spatial organization of ER{alpha} and many other nuclear constituents suggests that an underlying structure exists that aids in partitioning nuclear metabolism to specific subnuclear domains (22, 23, 36, 37, 38, 39, 40). ER{alpha} and other members of the steroid receptor family have been reported to remain associated with the insoluble NM fraction after various types of extraction (41, 49, 50, 51). To determine the extent of ER{alpha} NM association, a series of extractions was performed on MCF-7 cells treated with and without hormone. NM extractions were performed by incubating cells with cytoskeletal (CSK) buffer containing 0.5% Triton X-100 followed by deoxyribonuclease I (DNase I) digestion and treatment with 0.25 M ammonium sulfate and 2 M NaCl to remove DNA, DNA-associated proteins, and proteins loosely associated with the NM. Shown on the Western blots in Fig. 4AGo are whole-cell lysates (lane 1), CSK supernatants (lane 2), DNase I supernatants (lane 3), ammonium sulfate supernatants (lane 4), NaCl supernatants (lane 5), and the remaining NM bound fraction (lane 6). Since little to no ER{alpha} is eluted in lanes 4 and 5, these samples were omitted from Fig. 4Go, B and C, to conserve space. In the absence of hormone, the vast majority of the endogenous ER{alpha} is extracted during a 3-min incubation in CSK buffer (Fig. 4AGo, top row). Extreme overexposure of the Western blot shows only a trace amount of ER{alpha} that is NM associated (data not shown). In contrast, in cells treated for 1 h with E2 (10 nM), nearly all of the ER{alpha} was found in the DNase I fraction or associated with the NM (Fig. 4AGo, second row). Mock DNase I experiments indicate the ER{alpha} released during this step is due to prolonged exposure to detergent, not nuclease activity (see below, Fig. 4BGo). Negligible ER{alpha} is eluted in 0.25 M ammonium sulfate or 2 M NaCl indicating that the remaining ER{alpha} is very tightly associated with the NM. In contrast, Htun et al. (45) examined the NM association of transiently transfected GFP-ER{alpha} and found that hormone had little effect on matrix targeting. Under some conditions we have also noticed a similar result specifically when working with transfected receptors. In comparison to the endogenous receptor in MCF-7 cells, we see more matrix association in the absence of hormone and more soluble receptor with hormone with transfected ER{alpha} (data not shown). In our experience, even in well titered transfection experiments, there are cells that express vastly different amounts of receptor. This can lead to oversaturation of binding sites or alternatively to the formation of insoluble protein aggregates in highly expressing cells; in both cases, these issues alter hormone influences upon ER-NM extractions. Because of these problems, we chose to perform the Western blots on endogenous ER{alpha} in MCF-7 cells.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. NM Association of ER{alpha} in MCF-7 Cells

MCF-7 cells were maintained in stripped media for 48 h and then treated 1 h with vehicle or 10 nM E2, 4HT, or ICI 182,780 (A). Shown are whole-cell lysates (lane 1) and the extractable ER{alpha} after Triton X-100 (lane 2), DNase I (lane 3), 0.25 M ammonium sulfate (lane 4), 2.0 M NaCl (lane 5) treatments. The remaining unextractable or NM-bound ER{alpha} was solubilized by boiling in SDS sample buffer and loaded in lane 6. To prevent the high salt from disrupting the migration of protein in lane 6, one lane (-) was loaded with sample buffer alone. In the absence of ligand, almost all of the ER{alpha} is soluble in detergent. Treatment with E2, 4HT, and ICI 182,780 (10 nM) results in a shift of ER{alpha} to a nm-bound fraction. A fraction of the ER{alpha} pool is also extracted after DNase I treatment when cells were treated with E2 and 4HT. to determine whether this DNase I fraction represented a DNA binding form of ER{alpha}, DNase I and mock (buffer without added DNase I) digestions were performed on E2-treated cells (B). as no ER{alpha} is ever observed in lanes 4 and 5, these lanes were omitted from these gels for convenience. ER{alpha} has a similar elution pattern in the presence or absence of DNase I, suggesting that elution is due to extended exposure to detergent. to determine the time course of nm association, MCF-7 cells were treated for 0, 10, 20, or 30 min with 10 nM E2, 4HT or ICI 182,780 (C). All ligands tested resulted in the detectable NM association of ER{alpha} within 10 min and by 20 min, the steady state distribution of ER{alpha} observed at 1 h and longer time points was established.

 
To determine whether ER{alpha} antagonists had a similar effect on NM association, MCF-7 cells were treated for 1 h with 10 nM 4HT or ICI 182,780. ICI 164,384 was also used and yielded similar results as ICI 182,780 (data not shown). Surprisingly, all of the antagonists tested resulted in a shift in ER{alpha} distribution from a soluble to a NM-bound fraction (Fig. 4AGo). With both E2 and 4HT, there is a fraction of ER{alpha} that is removed after treatment with DNase I. This fraction is absent or substantially reduced in matrix preparations from cells treated with either of the ICI compounds. To determine whether this fraction corresponds to a DNA binding fraction that is removed after DNA digestion, a mock digestion was performed in the absence of DNase I. No differences were observed in DNase I or mock treated cells (Fig. 4BGo), suggesting that the ER{alpha} removed during this treatment represents a differentially detergent resistant-fraction as observed previously with the Pit-1 transcription factor (52). As our live cell studies indicated that GFP-ER{alpha} redistributes rapidly in response to hormone, we tested whether NM association occurs in the same time frame. All of the ligands used above resulted in a rapid NM association within 10 min, and by 20 min all of the ER{alpha} had a NM association similar to that observed at 1 h and longer time points (Fig. 4CGo).

Ligand-Induced Foci Are NM Associated
As ligand-induced matrix association occurs on the same time scale as GFP-ER{alpha} redistribution, we examined whether ligand-induced foci of GFP-ER{alpha} were matrix associated. To analyze this, we used a novel extraction procedure that allows us to perform detergent and NM extractions on GFP-transfected cells in real time. This method involves using a live cell chamber to perfuse in buffers enabling us to examine individual cells before and after detergent and NM extraction. This procedure allows us to bypass an artifact caused by overexpression in a subpopulation of the transiently transfected cells in which receptor aggregation results in apparent NM association. A demonstration of this is presented in Fig. 5AGo showing two transfected cells expressing vastly different amounts of GFP-ER{alpha} in the absence of added ligand. The relative mean fluorescent intensities of each cell were determined before and after detergent extraction. The overexpressing cell on the left retained approximately 84% of its fluorescence while the lower expressing cell on the right (in outline to denote its location) retained only 2.2% of its fluorescence. This direct, cell-based observation, clearly indicates immunoblot-based NM analyses on transiently transfected cells should be interpreted with caution.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 5. Real Time Detergent Extractions and Matrix Preparations

HeLa cells were transiently transfected with GFP-ER{alpha} and imaged live before and after extraction with CSK buffer containing 0.5% Triton X-100. To test if overexpression affects NM association, we first performed extractions on cells in the absence of hormone. Shown in panel A are the raw images of two cells expressing vastly different amounts of protein. When extractions are performed on the overexpressing cell on the left, approximately 83% of the fluorescence remains after detergent extraction. In the lower expressing cell on the right (shown with the nucleus in outline), only 2% of the fluorescence remains after detergent extraction. Since overexpression leads to artefactual NM association, we limited our analysis to cells expressing relatively low levels of GFP-ER{alpha}. Addition of hormone resulted in the redistribution of GFP-ER{alpha} as seen in Figs. 2Go and 3Go. To determine whether the redistributed GFP-ER{alpha} was resistant to detergent extraction, the same cells were followed after the addition of CSK buffer containing 0.5% Triton X-100. Most of the GFP-ER{alpha} remained after detergent extraction (B). To determine whether redistributed GFP-ER{alpha} was associated with the NM, a full NM preparation was performed on individual cells imaged before and after the matrix extraction, and most of the punctate ER{alpha} remained (C). Both reorganization and NM association requires the presence of the LBD as deletion of this region (GFP-ER282) eliminates both activities (D). The images shown in B, C, and D are deconvolved. Bar = 10 µm.

 
Since overexpression can cause artefactual extraction resistance even in the absence of hormone, the following experiments were performed on cells expressing relatively low amounts of GFP-ER{alpha}. Figure 5BGo shows an individual cell that was imaged before hormone, after hormone, and after detergent extraction in CSK buffer. Cells imaged before and after CSK treatment are very similar in appearance with the exception that diffuse GFP-ER{alpha} fluorescence is removed leaving the punctate foci containing GFP-ER{alpha}. In some cases, specific GFP-ER{alpha} foci can be identified before and after CSK treatment, indicating that these domains are preformed and are not an artifact of the detergent extraction. Specific GFP-ER{alpha} foci can also appear shifted relative to one another, making it difficult to identify individual spots before and after CSK treatment. This may be a consequence of the changes that are occurring in the nucleus as a result of the removal of the majority of the cellular protein and the slight shrinkage that occurs (22). Although GFP-ER{alpha} remains tightly bound on the nucleoskeleton, core filaments themselves may still be free to move in relation to one another so that GFP-ER{alpha} foci might move in and out of different focal planes during the experiment.

An advantage of the real time extraction procedure is it allows quantification of GFP-ER{alpha} fluorescence remaining in the nucleus on a number of individual cells. In the absence of hormone only 5.3% ± 2.6 of the fluorescence is retained after detergent extraction compared with 69% ± 6.7 in the presence of added E2 (10 nM; 1 Hr). Each quantitative evaluation was performed four times with a minimum of 10 cells each. A full matrix extraction was performed on E2-treated cells (Fig. 5CGo) and demonstrated that ER{alpha} foci remain after DNase I and high-salt treatments consistent with our Western blot results. The amount of GFP-ER{alpha} fluorescence remaining after a full NM extraction is slightly less, 55.5% ± 12.9 (n = 3) compared with the 69% observed after detergent alone.

The above experiments demonstrate that ligand binding is required for both NM association and receptor reorganization. As a further test of this, we generated a GFP-ER{alpha} C-terminal truncation containing the first 282 amino acids, GFP-ER282, that lacks the LBD. As seen in Fig. 5DGo, GFP-ER282 has a diffuse nucleoplasmic staining that does not change upon hormone addition and is completely soluble in CSK buffer. While this simple mapping experiment points to the significance of the LBD for both receptor reorganization and NM association, this issue is complicated by the position of many functional subdomains within this carboxy-terminal region (e.g. ligand binding, heat shock protein binding, coactivator binding, etc.).

Colocalization of ER{alpha} with Markers of Nuclear Metabolism
The immunolabeling of ER{alpha} in MCF-7 and transfected HeLa cells yields a punctate staining pattern similar to that observed previously for NM-bound transcription sites (23, 24, 25, 26, 27). Colocalization studies using antibodies recognizing ER{alpha} and phosphorylated RNA polymerase II (pol IIo) that has been previously shown to label sites of nascent RNA transcription was performed on E2- treated (10 nM, 1 h) MCF-7 cells. The overall immunolabeling patterns of ER{alpha} (Fig. 6AGo) and pol IIo (Fig. 6CGo) are very similar with multiple foci of both scattered throughout the nucleus. Interestingly however, only a small subset of ER{alpha} foci are coincident with pol IIo (Fig. 6EGo). Colocalization using antibodies recognizing ER{alpha} (Fig. 6BGo) and the splicing domain protein, SRm160 (Ref. 31 ; Fig. 6DGo) was also performed in E2-treated MCF-7 cells. Minor overlap at the periphery of the splicing speckles was observed (Fig. 6FGo), however, most ER foci did not coincide with splicing speckles. These results indicate that most of the ER{alpha} pool is not directly involved in transcription. A recent colocalization study using a variety of other transcription factors has also shown that most transactivators do not overlap with sites of transcription (53).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. Colocalization of ER{alpha} with RNA Polymerase II and Splicing Domains

To determine whether ER overlapped with sites of nascent RNA transcription or splicing domains, colocalization studies were performed in MCF-7 cells on endogenous proteins using immunofluorescence. Shown in the left column are ER{alpha} (A in green), phosphorylated RNA polymerase II (pol IIo; C in red) and the merged image on the bottom where places of overlap will appear yellow (E). As can be seen, both ER{alpha} and pol IIo are distributed in numerous foci throughout the nucleoplasm; however, only a small subset of these foci overlap. Shown in the right column are ER{alpha} (B in green) and the RNA splicing factor, SRm160 (D in red). Most of the ER{alpha} foci do not overlap with the larger foci representing the splicing domains (F). All images are deconvolved. All images are deconvolved. Bar = 10 µm.

 
Localization of ER{alpha} and SRC-1
Since transcriptional activation by steroid receptors is thought to involve interactions with coactivators, we analyzed the distribution of a functional GFP-SRC-1 (S. A. Onate and M. A. Mancini, unpublished observations) transfected with ER{alpha} in HeLa cells. The SRC-1 construct used in Figs. 7Go and 8Go contained the full-length SRC-1a isoform (15). A CFP-ER{alpha} construct was generated and used in cotransfection studies with GFP-SRC-1. Although the emission spectrum for CFP (emission max at 475 nm with a minor peak at 501 nm) partially overlaps with the emission spectrum of GFP (emission max = 507 nm), use of a higher wavelength fluorescein isothiocyanate (FITC) emission filter set minimized bleed through of the CFP signal. In cells expressing low levels of CFP-ER{alpha} (Fig. 7AGo), negligible signal is observed using FITC filters and identical exposures (Fig. 7BGo). In cells expressing only GFP-SRC-1 (Fig. 7DGo), no signal is observed using CFP filters (Fig. 7CGo). The dynamics of the E2- induced interaction of ER{alpha} and SRC-1 was examined in live cells using CFP-ER{alpha}- and GFP-SRC-1-transfected HeLa cells. Before hormone addition, both CFP-ER{alpha} (Fig. 7EGo) and GFP-SRC-1 (Fig. 7FGo) had a diffuse intranuclear distribution as observed above in singly transfected cells. After E2 addition (10 nM, 30 min), the same cells were analyzed, and CFP-ER{alpha} (Fig. 7GGo) and GFP-SRC-1 (Fig. 7HGo) were found to redistribute together. Arrows point out some of the domains where obvious overlap of CFP-ER and GFP-SRC-1 occur.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 7. Colocalization of ER{alpha} and SRC-1

HeLa cells were singly transfected with CFP-ER{alpha} or GFP-SRC-1. CFP-ER{alpha} (A) had a similar intranuclear distribution as GFP-ER{alpha} and showed minimal fluorescence when imaged with FITC filters (B). GFP-SRC-1 is nuclear (D) and does not produce a detectable signal when imaged with CFP filters (C). The dynamic reorganization of CFP-ER{alpha} and GFP-SRC-1 was analyzed in doubly transfected HeLa cells (E–H). Before hormone, both CFP-ER{alpha} (E) and GFP-SRC-1 (F) were diffusely distributed in the nucleoplasm. After 30 min of E2 treatment, the same cell was analyzed and CFP-ER{alpha} (G) and GFP-SRC-1 (H) were found to colocalize (bottom row). Arrows point to some of the regions containing both CFP-ER{alpha} and GFP-SRC-1. All images are deconvolved. Bar = 10 µm.

 


View larger version (54K):
[in this window]
[in a new window]
 
Figure 8. SRC-1 Is Extraction Resistant Only in the Presence of ER{alpha} and E2

To test the effects of ligand on the solubility partitioning of cotransfected CFP-ER{alpha} and GFP-SRC-1, cells were subjected to a real time detergent extraction (panel A). Cells were treated for 1 h with no ligand (top row), E2 (10 nM; second row), 4HT (10 nM; third row) or ICI 182,780 (10 nM; bottom row) and imaged before (whole) and after detergent extraction (CSK). CFP-ER{alpha} is shown in the left two columns, GFP-SRC-1 is shown in the right two columns. In the absence of added ligand, most of the CFP-ER{alpha} and GFP-SRC-1 fluorescence was removed after treatment with detergent. In cells treated with E2, both CFP-ER and GFP-SRC-1 fluorescence was retained after detergent extraction. 4HT and ICI 182,780 resulted in retention of CFP-ER{alpha}; however, most of the GFP-SRC-1 fluorescence was removed after the extraction procedure. To quantify the amount of NM association of CFP-ER{alpha} and GFP-SRC-1, the mean CFP and GFP fluorescent intensities of each nucleus were determined before and after detergent extraction. While a substantial amount of CFP-ER is retained when cells are pretreated with E2, 4HT, and ICI 780,180 (70.4 ± 5.7%, 70.4 ± 4.5% and 82.3 ± 4.2% respectively; n = 4), only E2 treatment led to substantial retention of GFP-SRC-1 (42.1 ± 8.2%). Before and after images were taken using the same exposure conditions and the mean fluorescent intensities of each nucleus was determined using Adobe PhotoShop. The images shown and those used for analysis are raw images. For data analysis, each experiment represents a separate transfection in which at least 10 cells were imaged before and after the extraction procedure. Bar = 10 µm.

 
Agonist-Dependent Tethering of SRC-1 to ER{alpha}
The solubility of CFP-ER{alpha} and GFP-SRC-1 was analyzed by performing CSK extractions on cells in real time as in Fig. 5Go. Shown in Fig. 8AGo are CFP-ER{alpha} (left two columns) and GFP-SRC-1 (right two columns) in the same cells before (whole) and after (CSK) extraction with CSK buffer containing 0.5% Triton X-100. In the absence of ligand (Fig. 8AGo, top row), most of the CFP-ER{alpha} and GFP-SRC-1 fluorescence was removed after detergent extraction. In E2- treated cells (10 nM, 1 h, Fig. 8AGo, second row) both CFP-ER{alpha} and GFP-SRC-1 remained after extraction. With 4HT (10 nM, 1 h, Fig. 8AGo, third row) and ICI 182,780 (10 nM, 1 h, Fig. 8AGo, bottom row), CFP-ER{alpha} remained after detergent; however, most of the GFP-SRC-1 fluorescence was removed, suggesting ER{alpha} and SRC-1 interactions are much weaker in the presence of these antagonists. The relative amounts of CFP-ER{alpha} and GFP-SRC-1 remaining after detergent extraction were quantified and are shown in Fig. 8BGo. While E2, 4HT, and ICI 180,780 all led to similar retention of CFP-ER{alpha} in the nucleus (70.4 ± 5.7%, 70.4 ± 4.5%, and 82.3 ± 4.2%, respectively; n = 4), only E2 led to substantial retention of GFP-SRC-1 (42.1 ± 8.2%; n = 4) after detergent extraction. Full matrix extractions (not shown) on E2-treated cells cotransfected with CFP-ER{alpha} and GFP-SRC-1 showed that much of the GFP-SRC-1 (34.8 ± 5.4; n = 2) remained associated with the NM.

Colocalization and Tethering of SRC-1 Depends upon the Presence of LXXLL Motifs
Two major isoforms of SRC-1 are widely expressed in a variety of cell lines and tissues (9, 17). The SRC-1a isoform used above consists of 1441 amino acids. The SRC-1e isoform is identical to SRC-1a up to amino acid 1385 but lacks 56 amino acids found in SRC-1a and contains 14 unique amino acids at the C terminus (Fig. 9AGo). SRC-1e has been reported to be a more potent coactivator for ER{alpha} and binds more efficiently to ER{alpha} using in vitro binding assays (17). We therefore tested whether these two isoforms showed differences in their ability to colocalize with ER{alpha} and tether to the NM in an agonist-dependent manner. Shown in Fig. 9BGo are E2-treated nuclei cotransfected with CFP-ER{alpha} and GFP-SRC-1a (top row) or GFP-SRC-1e (second row). The intranuclear distribution of both isoforms is very similar in terms of their ability to colocalize with CFP-ER{alpha}. When cells are extracted before fixation, both GFP-SRC-1a (Fig. 9CGo, top row) and GFP-SRC-1e remain associated with CFP-ER{alpha} (Fig. 9CGo, second row) in the presence of added E2 (10 nM, 1 h).



View larger version (78K):
[in this window]
[in a new window]
 
Figure 9. SRC-1 Interactions with ER{alpha} Require the Presence of LXXLL Motifs

The domain structure of two major isoforms of SRC-1, SRC-1a, and SRC-1e are shown (A). Both isoforms are identical for the first 1385 amino acids but differ at the C terminus where SRC-1a has 51 unique amino acids and SRC-1e has 14 unique amino acids. SRC-1e is a more potent coactivator of ER{alpha} suggesting a suppressor domain (SD) exists in the SRC-1a tail. Both SRCs contain two activation domains (AD) and LXXLL motifs (*) three of which are located between amino acids 630 and 780. The ability of GFP-SRC-1 isoforms as well as several deletion constructs to colocalize with CFP-ER{alpha} was tested in the presence of E2 (10 nM; 1 h). Shown in Fig. 9BGo are whole fixed HeLa cells transfected with CFP-ER{alpha} (left column) and GFP-SRC-1a (top row), GFP-SRC-1e (second row), GFP-SRC780 (containing the first 780 amino acids of SRC-1; third row), GFP-SRC630 (fourth row), and GFP-SRC570–780 (bottom row). All constructs except for GFP-SRC630, which lacks the LXXLL motifs, colocalized with CFP-ER{alpha} in an agonist dependent manner. Note that GFP-SRC570–780 (shown at a lower magnification to depict the whole cell) has a substantial cytoplasmic localization. This cytoplasmic distribution is predominant in cells transfected with GFP-SRC570–780 alone or in cotransfected cells in the absence of agonist (data not shown). The ability of these GFP-SRC-1 constructs to tether to CFP-ER{alpha} was tested in cells that were pre-extracted with CSK buffer containing 0.5% Triton-X-100. All constructs with the exception of GFP-SRC630 remained associated with CFP-ER{alpha} sites after detergent extraction. All images are deconvolved. Images are at the same magnification with the exception of the whole fixed cells transfected with YFP-SRC 570–780 (bottom left). Bars = 10 µm.

 
In vitro binding assays have demonstrated the importance of LXXLL motifs for steroid receptor binding (16, 17, 54). SRC-1 contains three LXXLL motifs located in the region between amino acids 630 and 780. To test whether these motifs were required for colocalization and tethering of SRC-1 to ER{alpha}, we generated C-terminal deletion constructs of SRC-1 as fusion proteins with yellow fluorescent protein (YFP). The YFP proteins behave similarly to their GFP counterparts but since the YFP excitation and emission spectra are shifted away from the CFP spectra, this further minimizes bleedthrough potential. A YFP construct containing the first 780 amino acids of SRC-1 colocalizes with CFP-ER{alpha} (Fig. 9BGo, third row) and resists extraction (Fig. 9CGo, third row). Further deletion to eliminate the LXXLL motifs, YFP-SRC630, eliminates both colocalization (Fig. 9BGo, fourth row) and tethering (Fig. 9CGo, fourth row). Finally, we generated a YFP construct containing amino acids 570–780 to test whether this region was sufficient for ER{alpha} interactions in a cellular context. The resulting YFP-SRC570–780 protein is predominantly cytoplasmic in the absence of cotransfected CFP-ER{alpha} or in the absence of added E2 (data not shown). When cells were treated with E2 (10 nM, 2 h), YFP-SRC570–780 was able to accumulate in the nucleus at sites containing CFP-ER{alpha} (Fig. 9BGo, bottom row). When extracted with detergent, most of the cytoplasmic YFP-SRC570–780 fluorescence was removed whereas nuclear YFP-SRC570–780 remained associated with sites containing CFP-ER{alpha} (Fig. 9CGo, bottom row). As shown for GFP-SRC-1a in Fig. 8Go, colocalization and tethering of all constructs shown in Fig. 9Go occurred only in the presence of agonist and not antagonists (data not shown). These results demonstrate that the region containing the LXXLL motifs is required for SRC-1 interaction with ER{alpha} within the nucleus and in the context of nuclear architecture.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The nuclear localization of some steroid receptors is dependent upon ligand binding when the receptor translocates from the cytoplasm to the nucleus. This has been shown in live cells using GFP versions of the glucocorticoid receptor (55, 56), the thyroid hormone receptor (57), the vitamin D receptor (58), and the mineralocorticoid receptor (59). This provides a very obvious and efficient mechanism for preventing transcription by unliganded receptors. In the case of ER{alpha}, which is predominantly nuclear regardless of its liganded state (43, 44, 45), other mechanisms must exist to prevent activation of specific target genes by unliganded receptor. By combining approaches to examine transfected and endogenous receptors, we show that ligand-induced changes in ER{alpha} localization and partitioning are early events involved in receptor activation. We demonstrate that while both agonist and antagonists lead to formation of NM-bound foci of ER{alpha}, only agonist recruits SRC-1 to these sites, suggesting that both NM association and coactivator recruitment are necessary for ER{alpha} function.

In confirmation of results reported previously by Htun et al. (45), we show that GFP-tagged ER{alpha} (GFP-ER{alpha}) is active in terms of its ability to activate an ERE reporter gene and undergo changes in its intranuclear distribution (Fig. 2Go). The use of GFP-tagged receptors and high-resolution microscopy allows GFP-ER{alpha} localization to be examined in live cells. This provides certain advantages in that it circumvents potential artifacts caused by fixation or antibody labeling. In the absence of ligand, GFP-ER{alpha} is diffusely distributed throughout the nucleoplasm being excluded from nucleolar regions. Htun et al. and we find that GFP-ER{alpha} develops a punctate distribution after the addition of E2 and 4HT, and to a lesser extent, ICI 182,780. By following the distribution of GFP-ER{alpha} in individual cells during ligand addition, we demonstrate that reorganization occurs on a rapid timescale of 10–20 min (Fig. 3Go).

ER{alpha} has long been known to associate with the NM (41), and addition of estrogen results in the transformation of ER{alpha} from a loosely bound nuclear form to a tightly bound or NM-associated form of ER{alpha} (60, 61). We chose to examine the effects of ligand on this transition first in MCF-7 cells expressing endogenous receptor. In the absence of added ligand, the majority of endogenous ER{alpha} is extracted after brief exposure to CSK buffer containing 0.5% Triton X-100, indicating that it is loosely bound or soluble. Addition of agonist or antagonists results in NM association of ER{alpha} (Fig. 4AGo). With both E2 and 4HT, but not with either of the ICI compounds tested, we find that some of the ER{alpha} is eluted during digestion with DNase I. This fraction could correspond to a DNA binding form of ER{alpha}; however, this does not appear to be the case as we observe no differences when cells are treated with DNase I or with digestion buffer alone (Fig. 4BGo). It is more likely that the ER{alpha} found in the DNase I fraction represents a less tightly NM bound form that is eluted during prolonged exposure to buffer containing detergent as reported previously for the Pit-1 transcription factor (52).

Early attempts using immunocytochemistry to characterize the biochemically defined loose and NM-bound forms of ER{alpha} failed to identify differences in their intranuclear distribution (61, 62, 63). We have directly examined this issue by performing real-time detergent extractions and NM preparations on unfixed cells transfected with GFP-ER{alpha}. We find when working with transfected receptors, overexpression in a subpopulation of cells can lead to a misrepresentation of the soluble and NM-bound forms of ER{alpha} analyzed on Western blots (data not shown). By selecting cells that express relatively low levels of GFP-tagged molecules, we are able to bypass potential problems caused by overexpression. When individual cells expressing similar levels of GFP-ER{alpha} are treated with or without E2 (Fig. 5Go), differences in the extractability of receptor are readily observed. These results are very reproducible when care is taken to select cells with comparable expression levels. However, when cells that express very high levels of protein are used, substantial GFP fluorescence can remain even in the absence of hormone (Fig. 5AGo). Thus, differences in expression levels may explain the lack of estrogen-dependent change in NM association reported previously (45). Using this procedure to analyze NM association of GFP-ER{alpha} demonstrates that transfected GFP-labeled receptor behaves similarly to endogenous receptor in terms of its ability to interact with the NM in a ligand-dependent manner. Furthermore, this method demonstrates that ligand-induced foci are NM associated and links receptor reorganization with the NM. Agonist-induced foci of the mineralocorticoid receptor have also been reported to associate with the NM (59).

While NM association of steroid receptors has long been recognized (41), the functional significance of this interaction has remained unclear. There have been numerous reports that have linked transcription to nuclear architecture. Both mRNA and proteins involved in transcription, including RNA polymerase II, associate with the NM (23, 24, 25, 26, 27, 35, 36, 37, 38, 39, 40). Early reports have also shown actively transcribed genes to be NM associated (33, 34). Cumulatively, these studies indicate that the NM may play a role in the organization of transcription components. In the work presented here, we demonstrate a clear dependence upon ligand for NM association of ER{alpha} and show that addition of E2 and 4HT results in ER{alpha} redistribution in live cells and yields comparable partitioning patterns during NM preparations. We observe that E2- and 4HT-induced ER{alpha} foci remain after detergent extraction and NM preparations, suggesting that the NM is involved in the organization of receptor complexes. As both E2 and 4HT [in some cellular contexts (5, 6, 7)] can act as ER{alpha} agonists, it is not surprising that they have similar effects on ER{alpha} partitioning. The NM association of ER{alpha} induced by the pure antagonists ICI 164,384 and ICI 182,780 suggests that this association alone is not sufficient for transcription to occur. These compounds do not activate the receptor and exert different effects on the localization and solubility partitioning of ER{alpha} than observed above for E2 and 4HT. With ICI 164,384 we do not see a significant change in GFP-ER{alpha} localization; with ICI 182,780, the effects on GFP-ER{alpha} are much less dramatic than with agonist. In partitioning studies, however, we find that these two antagonists result in the rapid association of ER{alpha} with the NM. Interestingly, we do not see ER{alpha} in the differentially soluble "DNase I" fraction (see Fig. 4BGo), suggesting that these ligands drive ER{alpha} directly to a tightly bound NM fraction.

With the ability to identify sites of RNA synthesis using Br-UTP and/or antibodies to the hyperphosphorylated large subunit of RNA polymerase II [pol IIo (23, 24, 25, 26, 53)], it is possible to visualize where nuclear regulators are relative to sites of new message synthesis. With increasing capability to detect brief (~1 min) pulses in Br-UTP, the estimate of the number of transcription sites per nucleus has risen over the years from several hundred to several thousand (23). Regardless of this wide range in the number of sites, there is agreement that most of the nuclear volume is transcriptionally silent. The number and appearance of pol IIo immunoreactive foci are similar to the endogenous and exogenous ER{alpha} foci in low expressing cells. However, high-resolution microscopic analysis reveals that most ER{alpha} foci do not overlap with transcription sites (Fig. 6Go). Although only a few transcription factors have been examined, it is clear that there is much less colocalization between RNA synthesis foci and transcription factors than expected. A quantitative, high-resolution immunofluorescence study of several transcription factors revealed that, in whole cells, labeled foci generally did not overlap with sites of transcription (53). This could mean that complexes containing transcription factors are in a dynamic state of assembly/disassembly and that the time they spend actively transcribing genes is minimal. Moreover, as agonists/antagonists (E2, 4HT, ICIs) each drive ER{alpha} to the matrix and greatly alter receptor half -lives [e.g., E2 and ICIs lead to receptor turnover while 4HT stabilizes (64)], it is possible that nontranscription site receptor targeting may reflect, in part, sites of receptor turnover/stabilization.

Adding complexity to this issue is that NRs, including ER{alpha}, interact with a growing list of coregulator molecules that include corepressors and coactivators (reviewed in Ref. 65). As ER{alpha} has been reported to associate with steroid receptor coactivators in an agonist-dependent manner, we used biologically active, GFP and YFP SRC-1 chimeras to study live cell dynamics in relation to bioluminescent (cyan) ER{alpha}. In the absence of hormone, both proteins are nuclear and relatively diffuse. Addition of E2 results in a substantial overlap between the two complementary bioluminescent signals, suggesting that a significant portion of the SRC-1 is associated with ER{alpha}. In the cells examined, E2 causes GFP-SRC-1 to become punctate and overlap with the distribution of CFP-ER{alpha}. Also, E2, but not antagonists, leads to NM association of GFP-SRC-1, indicating agonist leads to increased affinities to protein or RNA components of nuclear architecture. In HeLa cells singly transfected with GFP-SRC-1, we see no effects of adding E2 on GFP-SRC-1 localization or NM attachment (data not shown), suggesting that these events are mediated through CFP-ER{alpha}. These experiments also reveal that less interaction between CFP-ER{alpha} and GFP-SRC-1 occurs in the presence of 4HT and ICI 182,780, complementing biochemical studies (17, 66).

Structural studies demonstrate that ligand binding results in conformational changes in ER{alpha} that may affect interactions with coactivators (67, 68). Coactivators interact with the agonist-bound LBD via an LXXLL motif known as the NR box (16) using an AF-2 interaction surface (18). Here, using fluorescent protein chimeras of ER{alpha} and SRC-1a/e, we show that the presence of the LXXLL motifs is required for agonist-dependent ER{alpha} colocalization in vivo (Fig. 9Go). Recently, the structure of ER{alpha} bound to agonist and a NR box peptide from the coactivator GRIP1 was determined and the NR box peptide was found in a hydrophobic groove formed by helices 3, 4, 5, and 12 of the LBD (68). In this same study, the structure bound to tamoxifen was also determined and showed that helix 12 was in a position to occlude coactivator binding by mimicking interactions between the NR box and the LBD. These structural studies show that agonist and antagonist binding to ER{alpha} result in structural changes that affect interactions with steroid receptor coactivators. Conformational changes induced by agonists and antagonists may also expose molecular domains that enable ER{alpha} to interact with the NM and undergo intranuclear rearrangement. Early changes in receptor solubility and localization appear to be necessary for, but do not guarantee, transactivation, as antagonists have similar effects as agonists. While all ligands tested result in NM association, only E2 causes detectable interactions between ER{alpha} and SRC-1 in situ. These results suggest that ER{alpha} transcription function requires early intranuclear dynamics that include receptor relocalization, NM association, and coactivator interactions.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mammalian Expression Plasmids
To generate the GFP-ER{alpha} construct, PCR primers were designed to add a KpnI site at the 5'-end and the entire human ER{alpha} sequence was amplified from pRST7-ER (5). The PCR product was cut with KpnI and BamHI and inserted in the correct reading frame into pEGFP-C1 (CLONTECH Laboratories, Inc.) cut with the same two enzymes. The major portion of hER{alpha} generated by PCR was replaced with a SmaI-BamHI fragment from the original hER{alpha} plasmid. Sequence analysis was performed on the remaining hER{alpha} sequence generated by PCR to ensure that no errors had occurred. To compare GFP vs. non-GFP proteins, the GFP coding sequence was removed by digesting with AgeI and BspEI and religating the parent vector (pEGFP-C1-hER-GFP). To generate CFP-ER, the region encoding CFP was cut out of the pECFP-C1 vector (CLONTECH Laboratories, Inc.) using AgeI and KpnI and placed into our original GFP-ER vector. GFP-ER282 was generated by PCR to create a stop codon after amino acid 282 followed by a BamHI site for subcloning into pEGFP-C1. GFP-SRC-1 was generated by PCR amplification of the GFP sequence from pEGFP-C1 using the primers 5'-EGFP (CATGGTACCATGGTGAGCAAGGGCGAGGA) and 3'-EGFP (CTGCAGAACCACCA CACTGGACTTGTACAGCTCG TCCATGC) to create a GFP fragment with a 5'-KpnI site and a 3'-BstXI site used for subcloning into pCR3.1-hSCR-1a vector (15) resulting in a plasmid called pCR3.1-GFP-hSRC-1a. To generate GFP-SRC-1e, pCR3.1-hSRC-1e (gift of Martin Dutertre) was digested with ApaI and BamHI and placed into the pCR3.1-GFP-hSRC-1a vector cut with the same two enzymes. YFP-SRC780 was generated by performing a partial digest with BsrG1 and a full digest with BamHI of pCR3.1-GFP-hSRC-1a and ligation of this fragment into pEYFP-C1 (CLONTECH Laboratories, Inc.) cut with the same two enzymes. YFP-SRC630 was generated by PCR to create a stop codon after amino acid 630 followed by an XbaI site used for subcloning into pEYFP-C1. YFP-SRC570–780 was generated by digesting pCR3.1-hSRC-1a with EcoRI and BamHI and ligating this fragment into pEYFP-C1 cut with the same two enzymes.

Cell Culture and Labeling
HeLa cells were maintained in Opti-MEM I media (Life Technologies, Inc., Gaithersburg, MD) containing 4% FBS (Life Technologies, Inc.). MCF-7 cells (gift from Dr. Richard Santen, University of Virginia, Charlottesville, VA) were maintained in Improved MEM Zinc Option media (Life Technologies, Inc.) supplemented with 10% FBS. MCF-7 cells were transferred to DMEM containing 5% dextran charcoal-stripped FBS, PS, 25 mM HEPES, and 110 mg/liter sodium pyruvate referred to as stripped media and grown for 48 h before use. HepG2 cells were maintained in DMEM high glucose (Life Technologies, Inc.) containing 10% FBS, 1% nonessential amino acids, and 1.6% L-glutamine. Twenty four hours before transfection, cells were plated onto poly-D-lysine-coated coverslips in 35-mm wells at a concentration of 105 cells per well in stripped media. Transient expression of ER{alpha}, GFP-ER{alpha}, CFP-ER{alpha}, and GFP-SRC-1 vectors was accomplished using a calcium phosphate transfection kit (5'->3', Inc., Boulder, CO). Twelve hours after transfection, cells were shocked with 10% dimethylsulfoxide and allowed to recover 6 h in stripped media before addition of hormone. For the transcription assays shown in Fig. 2AGo, HeLa cells were cotransfected with 1 µg ERE-E1b-Luc (48) and either 100 ng of pEGFP-C1-hER or pEGFP-C1-hER-GFP using Lipofectin (Life Technologies, Inc.).For fixed cell experiments, vehicle (EtOH), 10 nM 17ß-estradiol (E2, Sigma, St. Louis, MO), 10 nM 4-HT (gift from D. Salin-Drouin, Laboratoires Besins Iscovesco, Paris, France), 10 nM ICI 164,384 or 10 nM ICI 182,780 (both gifts from Alan Wakeling, Zeneca Pharmaceuticals, Macclesfield, UK) were added for the appropriate time before fixation in 4% formaldehyde in PEM (80 mM K-piperazine-N,N'-bis(2-ethanesulfonic acid), 5 mM EGTA, 2 mM MgCl2, pH 6.8) for 30 min at 4 C. Cells were quenched in 1 mg/ml NaBH4 in PEM and permeabilized for 30 min in 0.5% Triton X-100 in PEM. Coverslips were blocked for 1 h at room temperature in 5% dry milk in TBST (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.4) and incubated for 2 h at room temperature with primary mouse monoclonal anti-ERnt diluted 1:2000 in blocking buffer. Splicing domains were labeled with the SRm160 antibody [diluted 1:10; Blencowe et al. (36)]. Transcription sites were labeled with antiphosphorylated RNA pol II (RNA pol IIo; diluted 1:4). Primary antibodies were detected using the appropriate Texas Red or FITC-conjugated secondary antibodies (1:600; Southern Biotechnology Associates) recognizing mouse or rabbit primary antibodies. Cells were counterstained for 1 min in 4,6-diamidino-2-phenylindole (1 µg/ml) in TBST and mounted in Slow Fade reagent (Molecular Probes, Inc., Eugene, OR).

Immunoblotting
After hormone addition, cells were lysed in 1x Laemmli sample buffer and samples (~2 x 105 cells per well) were electrophoresed on a 10% SDS-PAGE gel and transferred to Immobilon (Millipore Corp., Bedford, MA) using a liquid transfer apparatus (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was blocked for 1 h in 5% dry milk in TBST, incubated with anti-ERnt mouse monoclonal antibody (0.1 µg/ml) for 2 h, washed in TBST, incubated with horse radish peroxidase-conjugated secondary antibody (1:2000; Pierce Chemical Co., Rockford, IL) for 1 h, and washed in TBST. Signal was detected using the enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Arlington Heights, IL).

Preparation of Core NM
HeLa and MCF-7 cells were extracted using established protocols (22, 52, 69) while attached to poly-D-lysine-coated substrates. Cells were washed in PBS and sequentially treated in the following manner. Soluble proteins were extracted by treatment for 3 min with ice-cold CSK buffer (10 mM piperazine-N,N'-bis(2-ethanesulfonic acid), 300 mM sucrose, 100 mM NaCl, 3 mM MgCl2, 0.5% Triton X-100, pH 6.80) containing protease inhibitors (aprotinin, leupeptin, pepstatin A, antipain, phenylmethylsulfonyl fluoride) and vanadyl ribonucleoside complex (VRC). Chromatin was removed by digesting with RNAse-free DNase I (400 U/ml; Roche Molecular Biochemicals, Indianapolis, IN) in digestion buffer (same as CSK but with 50 mM NaCl) containing protease inhibitors and VRC for 50 min at 32 C. The DNase I digestion buffer was removed and replaced with 187.5 µl of fresh digestion buffer and 1 M ammonium sulfate was added slowly, drop-wise, to a final concentration of 0.25 M and cells were incubated for 5 min at room temperature. The ammonium sulfate was removed and replaced with 125 µl of digestion buffer, 4 M NaCl in digestion buffer was added to a final concentration of 2 M NaCl and cells were incubated 5 min at room temperature. Cells were washed twice in digestion buffer and either fixed in 4% formaldehyde in digestion buffer or lysed in SDS-PAGE sample buffer for Western blot analysis. For CSK-fixed cells, cells were extracted for 3 min in CSK buffer followed by fixation in 4% formaldehyde in CSK buffer. For the Western blot analysis shown in Fig. 4Go, equivalent samples of unextracted cells (whole), CSK supernatant (CSK), DNase I supernatant, ammonium sulfate supernatant, NaCl supernatant, and NM-extracted cells were loaded.

Fluorescent and Deconvolution Microscopy
Conventional immunofluorescence microscopy and differential interference contrast microscopy were performed using a Carl Zeiss (Thornwood, NY) AxioPhot microscope. Deconvolution microscopy was performed on a Carl Zeiss AxioVert S100 TV microscope and a DeltaVision Restoration Microscopy System (Applied Precision, Inc., Issaquah, WA). A Z-series of focal planes were digitally imaged and deconvolved with the DeltaVision constrained iterative algorithm (46, 47) to generate high resolution images. All image files were digitally processed for presentation using Adobe Photoshop and printed at 300 dots per inch using a Codonics NP 1600 dye diffusion printer (Codonics, Inc., Middleburg Heights, OH).

Live Microscopy
Live microscopy was performed on cells transfected with GFP-ER{alpha} (Figs. 2Go, 3Go, and 5Go) or CFP-ER{alpha} and fluorescent SRC-1 plasmids ( Figs. 7–9GoGoGo). Cells were grown on 40- mm coverslips in 60-mm plates and transfected with 2.5 mg of each test plasmid using the calcium phosphate transfection procedure. After the dimethylsulfoxide shock, cells were allowed to recover for 4–8 h and were transferred to a live cell, closed chamber (Bioptechs, Inc., Butler, PA) and maintained in DMEM with 5% stripped FBS at 37 C. This medium was recirculated using a peristaltic pump to which ligand was added after the 0 time point exposure. To minimize photo damage, cells were imaged using neutral density filters to allow only 30% of the total light and 1 sec exposure times. Focal planes were limited to approximately 5 per cell and used to create three-dimensional reconstructions. Images were taken at 5-min intervals in Fig. 3Go, and every other time point (10-min interval) is shown. To perform real time detergent extractions shown in Figs. 5Go and 8Go, CSK buffer with 0.5% Triton X-100 was circulated into the cell chamber for 3 min at room temperature. To perform full-scale NM preps, cells were extracted with CSK buffer as above before buffer containing DNase I was circulated into the chamber and remained for 50 min at 32 C. Digested chromatin was removed by sequentially circulating buffer containing 0.25 M ammonium sulfate and 2.0 M NaCl. All extraction buffers were replaced with CSK buffer without detergent before imaging as Triton X-100 partially quenched GFP fluorescence.


    ACKNOWLEDGMENTS
 
The authors extend thanks to J. Nickerson and B. O’Malley for many helpful discussions throughout this project.


    FOOTNOTES
 
Address requests for reprints to: Michael A. Mancini, Department of Cell Biology, Baylor College of Medicine, Houston, Texas 77030.

This work was supported by NIH Grant RO1 DK-55622 and a National American Heart Association Scientist Development Award (9630033N) to M.A.M., an NIH postdoctoral fellowship to D.L.S. (1F32DK09787), NIH RO1 DK-53002 to C.L.S., and funds from the Department of Cell Biology, Baylor College of Medicine.

Received for publication July 26, 1999. Revision received December 21, 1999. Accepted for publication December 28, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  2. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  3. Beato M, Chavez S, Truss M 1996 Transcriptional regulation by steroid hormones. Steroids 61:240–251[CrossRef][Medline]
  4. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941–951[CrossRef][Medline]
  5. Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract/Free Full Text]
  6. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  7. Grese TA, Sluka JP, Bryant HU, Cullinan GJ, Glasebrook AL, Jones CD, Matsumoto K, Palkowitz AD, Sato M, Termine JD, Winter MA, Yang NN, Dodge JA 1997 Molecular determinants of tissue selectivity in estrogen receptor modulators. Proc Natl Acad Sci USA 94:14105–14110[Abstract/Free Full Text]
  8. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  9. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 1996 85:403–414
  10. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  11. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  12. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  13. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  14. Glass CK, Rosenfeld MG, Rose DW, Kurokawa R, Kamei Y, Xu L, Torchia J, Ogliastro MH, Westin S 1997 Mechanisms of transcriptional activation by retinoic acid receptors. Biochem Soc Trans 25:602–605[Medline]
  15. Jenster G, Spencer TE, Burcin MM, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor induction of gene transcription: a two-step model. Proc Natl Acad Sci USA 94:7879–7884[Abstract/Free Full Text]
  16. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  17. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  18. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  19. Jenster G 1998 Coactivators and corepressors as mediators of nuclear receptor function: an update. Mol Cell Endocrinol 143:1–7[CrossRef][Medline]
  20. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  21. Spector DL 1993 Nuclear organization of pre-mRNA processing. Curr Opin Cell Biol 5:442–447[CrossRef][Medline]
  22. Nickerson JA, Blencowe BJ, Penman S 1995 The architectural organization of nuclear metabolism. Int Rev Cytol 162A:67–123
  23. Cook PR 1999 The organization of replication and transcription. Science 284:1790–1795[Abstract/Free Full Text]
  24. Wansink DG, Schul W, van der Kraan I, van Steensel B, van Driel R, de Jong L 1993 Fluorescent labeling of nascent RNA reveals transcription by RNA polymerase II in domains scattered throughout the nucleus. J Cell Biol 122:283–293[Abstract/Free Full Text]
  25. Jackson DA, Hassan AB, Errington RJ, Cook PR 1993 Visualization of focal sites of transcription within human nuclei. EMBO J 12:1059–1065[Medline]
  26. Bregman DB, Du L, van der Zee S, Warren SL 1995 Transcription-dependent redistribution of the large subunit of RNA polymerase II to discrete nuclear domains. J Cell Biol 129:287–298[Abstract/Free Full Text]
  27. Mortillaro MJ, Blencowe BJ, Wei X, Nakayasu H, Du L, Warren SL, Sharp PA, Berezney R 1996 A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix. Proc Natl Acad Sci USA 93:8253–8257[Abstract/Free Full Text]
  28. Zeng C, Kim E, Warren SL, Berget SM 1997 Dynamic relocation of transcription and splicing factors dependent upon transcriptional activity. EMBO J 16:1401–1412[CrossRef][Medline]
  29. Jackson DA, Iborra FJ, Manders EM, Cook PR 1998 Numbers and organization of RNA polymerases, nascent transcripts, and transcription units in HeLa nuclei. Mol Biol Cell 9:1523–1536[Abstract/Free Full Text]
  30. Huang S, Spector DL 1996 Dynamic organization of pre-mRNA splicing factors. J Cell Biochem 62:191–197[CrossRef][Medline]
  31. Blencowe BJ, Issner R, Nickerson JA, Sharp, PA 1998 A coactivator of pre-mRNA splicing. Genes Dev 12:996–1009[Abstract/Free Full Text]
  32. Smith KP, Moen PT, Wydner KL, Coleman JR, Lawrence JB 1999 Processing of endogenous pre-mRNAs in association with SC-35 domains is gene specific. J Cell Biol 144:617–629[Abstract/Free Full Text]
  33. Ciejek EM, Tsai MJ, O’Malley BW 1983 Actively transcribed genes are associated with the nuclear matrix. Nature 306:607–609[CrossRef][Medline]
  34. Robinson SI, Small D, Idzerda R, McKnight GS, Vogelstein B 1983 The association of transcriptionally active genes with the nuclear matrix of the chicken oviduct. Nucleic Acids Res 11:5113–5130[Abstract/Free Full Text]
  35. Wan KM, Nickerson JA, Krockmalnic G, Penman S 1994 The B1C8 protein is in the dense assemblies of the nuclear matrix and relocates to the spindle and pericentriolar filaments at mitosis. Proc Natl Acad Sci USA 91:594–598[Abstract/Free Full Text]
  36. Blencowe BJ, Nickerson JA, Issner R, Penman S, Sharp PA 1994 Association of nuclear matrix antigens with exon-containing splicing complexes. J Cell Biol 127:593–607[Abstract/Free Full Text]
  37. Zeitlin S, Parent A, Silverstein S, Efstratiadis A 1987 Pre-mRNA splicing and the nuclear matrix. Mol Cell Biol 7:111–120[Abstract/Free Full Text]
  38. Stein GS, van Wijnen AJ, Stein J, Lian JB, Montecino M 1995 Contributions of nuclear architecture to transcriptional control. Int Rev Cytol 162A:251–278
  39. Stein GS, van Wijnen AJ, Stein JL, Lian JB, Pockwinse S, McNeil S 1998 Interrelationships of nuclear structure and transcriptional control: functional consequences of being in the right place at the right time. J Cell Biochem 70:200–212[CrossRef][Medline]
  40. Stenoien D, Sharp ZD, Smith CL, Mancini MA 1998 Functional subnuclear partitioning of transcription factors. J Cell Biochem 70:213–221[CrossRef][Medline]
  41. Barrack ER 1987 Steroid hormone receptor localization in the nuclear matrix: interaction with acceptor sites. J Steroid Biochem 27:115–121[CrossRef][Medline]
  42. Zou A, Marschke KB, Arnold KE, Berger EM, Fitzgerald P, Mais DE, Allegretto EA 1999 Estrogen receptor ß activates the human retinoic acid receptor alpha-1 promoter in response to tamoxifen and other estrogen receptor antagonists, but not in response to estrogen. Mol Endocrinol 13:418–430[Abstract/Free Full Text]
  43. King WJ, Greene GL 1984 Monoclonal antibodies localize oestrogen receptor in the nuclei of target cells. Nature 307:745–747[CrossRef][Medline]
  44. Welshons WV, Lieberman ME, Gorski J 1984 Nuclear localization of unoccupied oestrogen receptors. Nature 307:747–749[CrossRef][Medline]
  45. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization of the human estrogen receptor alpha reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471–486[Abstract/Free Full Text]
  46. Agard, DA 1984 Optical sectioning microscopy: cellular architecture in three dimensions. Annu Rev Biophys Bioeng 13:191–219[CrossRef][Medline]
  47. Swedlow JR, Sedat JW, Agard DA 1997 Deconvolution in optical microscopy. In: Jansson PA (ed) Deconvolution of Images and Spectra, ed 2. Academic Press, New York, pp 284–309
  48. Nawaz Z, Lonard DM, Smith CL, Lev-Lehman E, Tsai SY, Tsai MJ, O’Malley BW 1999 The Angelman syndrome-associated protein, E6-AP, is a coactivator for the nuclear hormone receptor superfamily. Mol Cell Biol 19:1182–1189[Abstract/Free Full Text]
  49. Getzenberg RH, Pienta KJ, Coffey DS 1990 The tissue matrix: cell dynamics and hormone action. Endocr Rev 11:399–417[Abstract/Free Full Text]
  50. van Steensel B, Jenster G, Damm K, Brinkmann AO, van Driel R 1995 Domains of the human androgen receptor and glucocorticoid receptor involved in binding to the nuclear matrix. J Cell Biochem 57:465–478[CrossRef][Medline]
  51. Tang Y, DeFranco DB 1996 ATP-dependent release of glucocorticoid receptors from the nuclear matrix. Mol Cell Biol 16:1989–2001[Abstract]
  52. Mancini MG, Liu B, Sharp ZD, Mancini MA 1999 Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J Cell Biochem 72:322–338[CrossRef][Medline]
  53. Grande MA, van der Kraan I, de Jong L, van Driel R 1997 Nuclear distribution of transcription factors in relation to sites of transcription and RNA polymerase II. J Cell Sci 110:1781–1791[Abstract]
  54. Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ, Edwards DP, O’Malley BW 1998 The steroid receptor coactivator-1 contains multiple receptor interacting and activation domains that cooperatively enhance the activation function 1 (AF1) and AF2 domains of steroid receptors. J Biol Chem 273:12101–12108[Abstract/Free Full Text]
  55. Htun H, Barsony J, Renyi I, Gould DL, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850[Abstract/Free Full Text]
  56. Galigniana MD, Housley PR, DeFranco DB, Pratt WB 1999 Inhibition of glucocorticoid receptor nucleocytoplasmic shuttling by okadaic acid requires intact cytoskeleton. J Biol Chem 274:16222–16227[Abstract/Free Full Text]
  57. Zhu XG, Hanover JA, Hager GL, Cheng SY 1998 Hormone-induced translocation of thyroid hormone receptors in living cells visualized using a receptor green fluorescent protein chimera. J Biol Chem 273:27058–27063[Abstract/Free Full Text]
  58. Racz A, Barsony J 1999 Hormone-dependent translocation of vitamin D receptors is linked to transactivation. J Biol Chem 274:19352–19360[Abstract/Free Full Text]
  59. Fejes-Toth G, Pearce D, Naray-Fejes-Toth 1998 A subcellular localization of mineralocorticoid receptors in living cells: effects of receptor agonists and antagonists. Proc Natl Acad Sci USA 95:2973–2978[Abstract/Free Full Text]
  60. Greene GL, Press MF 1986 Structure and dynamics of the estrogen receptor. J Steroid Biochem 24:1–7[CrossRef][Medline]
  61. Press MF, Xu SH, Wang JD, Greene GL 1989 Subcellular distribution of estrogen receptor and progesterone receptor with and without specific ligand. Am J Pathol 135:857–864[Abstract]
  62. Vazquez-Nin GH, Echeverria OM, Fakan S, Traish AM, Wotiz HH, Martin TE 1991 Immunoelectron microscopic localization of estrogen receptor on pre-mRNA containing constituents of rat uterine cell nuclei. Exp Cell Res 192:396–404[CrossRef][Medline]
  63. Yamashita S 1995 Intranuclear localization of hormone-occupied and -unoccupied estrogen receptors in the mouse uterus: application of 1 nm immunogold-silver enhancement procedure to ultrathin frozen sections. J Electron Microsc (Tokyo) 44:22–29[Abstract/Free Full Text]
  64. Seo HS, Larsimont D, Querton G, El Khissiin A, Laios I, Legros N, Leclercq G 1998 Estrogenic and anti-estrogenic regulation of estrogen receptor in MCF-7 breast-cancer cells: comparison of immunocytochemical data with biochemical measurements. Int J Cancer 78:760–765[CrossRef][Medline]
  65. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  66. Freedman LP 1999 Increasing the complexity of coactivation in nuclear receptor signaling. Cell 97:5–8[CrossRef][Medline]
  67. Halachmi S, Marden E, Martin G, MacKay H, Abbondanza C, Brown M 1994 Estrogen receptor-associated proteins: possible mediators of hormone-induced transcription. Science 264:1455–1458[Abstract/Free Full Text]
  68. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  69. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  70. Mancini MA, Shan B, Nickerson, JA, Penman S, Lee WH 1994 The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein. Proc Natl Acad Sci USA 91:418–422[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. J. Lee, C. Chae, and M. M. Wang
p150/Glued Modifies Nuclear Estrogen Receptor Function
Mol. Endocrinol., May 1, 2009; 23(5): 620 - 629.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Picard, C. Charbonneau, M. Sanchez, A. Licznar, M. Busson, G. Lazennec, and A. Tremblay
Phosphorylation of Activation Function-1 Regulates Proteasome-Dependent Nuclear Mobility and E6-Associated Protein Ubiquitin Ligase Recruitment to the Estrogen Receptor {beta}
Mol. Endocrinol., February 1, 2008; 22(2): 317 - 330.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Damdimopoulos, G. Spyrou, and J.-A. Gustafsson
Ligands Differentially Modify the Nuclear Mobility of Estrogen Receptors {alpha} and
Endocrinology, January 1, 2008; 149(1): 339 - 345.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. M. Wittmann, A. Sherk, and D. P. McDonnell
Definition of Functionally Important Mechanistic Differences among Selective Estrogen Receptor Down-regulators
Cancer Res., October 1, 2007; 67(19): 9549 - 9560.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Amazit, L. Pasini, A. T. Szafran, V. Berno, R.-C. Wu, M. Mielke, E. D. Jones, M. G. Mancini, C. A. Hinojos, B. W. O'Malley, et al.
Regulation of SRC-3 Intercompartmental Dynamics by Estrogen Receptor and Phosphorylation
Mol. Cell. Biol., October 1, 2007; 27(19): 6913 - 6932.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Penttinen, J. Jaehrling, A. E. Damdimopoulos, J. Inzunza, J. G. Lemmen, P. van der Saag, K. Pettersson, G. Gauglitz, S. Makela, and I. Pongratz
Diet-Derived Polyphenol Metabolite Enterolactone Is a Tissue-Specific Estrogen Receptor Activator
Endocrinology, October 1, 2007; 148(10): 4875 - 4886.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Qiu, Y. Huang, G. Chen, Z. Chen, D. J. Tweardy, and S. Dong
Aberrant Chromatin Remodeling by Retinoic Acid Receptor {alpha} Fusion Proteins Assessed at the Single-Cell Level
Mol. Biol. Cell, October 1, 2007; 18(10): 3941 - 3951.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
D. Nonclercq, F. Journe, I. Laios, C. Chaboteaux, R.-A. Toillon, G. Leclercq, and G. Laurent
Effect of nuclear export inhibition on estrogen receptor regulation in breast cancer cells
J. Mol. Endocrinol., August 1, 2007; 39(2): 105 - 118.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sanchez, K. Sauve, N. Picard, and A. Tremblay
The Hormonal Response of Estrogen Receptor beta Is Decreased by the Phosphatidylinositol 3-Kinase/Akt Pathway via a Phosphorylation-dependent Release of CREB-binding Protein
J. Biol. Chem., February 16, 2007; 282(7): 4830 - 4840.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Li, R.-C. Wu, L. Amazit, S. Y. Tsai, M.-J. Tsai, and B. W. O'Malley
Specific Amino Acid Residues in the Basic Helix-Loop-Helix Domain of SRC-3 Are Essential for Its Nuclear Localization and Proteasome-Dependent Turnover
Mol. Cell. Biol., February 15, 2007; 27(4): 1296 - 1308.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Padron, L. Li, E. M. Kofoed, and F. Schaufele
Ligand-Selective Interdomain Conformations of Estrogen Receptor-{alpha}
Mol. Endocrinol., January 1, 2007; 21(1): 49 - 61.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. L. Arnett-Mansfield, J. D. Graham, A. R. Hanson, P. A. Mote, A. Gompel, L. L. Scurr, N. Gava, A. de Fazio, and C. L. Clarke
Focal Subnuclear Distribution of Progesterone Receptor Is Ligand Dependent and Associated with Transcriptional Activity
Mol. Endocrinol., January 1, 2007; 21(1): 14 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Z. D. Sharp, M. G. Mancini, C. A. Hinojos, F. Dai, V. Berno, A. T. Szafran, K. P. Smith, T. T. Lele, D. E. Ingber, and M. A. Mancini
Estrogen-receptor-{alpha} exchange and chromatin dynamics are ligand- and domain-dependent
J. Cell Sci., October 1, 2006; 119(19): 4101 - 4116.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Wu, H. Kawate, K. Ohnaka, H. Nawata, and R. Takayanagi
Nuclear Compartmentalization of N-CoR and Its Interactions with Steroid Receptors.
Mol. Cell. Biol., September 1, 2006; 26(17): 6633 - 6655.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. M. Schaaf, L. Willetts, B. P. Hayes, B. Maschera, E. Stylianou, and S. N. Farrow
The Relationship between Intranuclear Mobility of the NF-{kappa}B Subunit p65 and Its DNA Binding Affinity
J. Biol. Chem., August 4, 2006; 281(31): 22409 - 22420.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Grenier, A. Trousson, A. Chauchereau, J. Cartaud, M. Schumacher, and C. Massaad
Differential Recruitment of p160 Coactivators by Glucocorticoid Receptor between Schwann Cells and Astrocytes
Mol. Endocrinol., February 1, 2006; 20(2): 254 - 267.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M-B Debril, L Dubuquoy, J-N Feige, W Wahli, B Desvergne, J Auwerx, and L Gelman
Scaffold attachment factor B1 directly interacts with nuclear receptors in living cells and represses transcriptional activity
J. Mol. Endocrinol., December 1, 2005; 35(3): 503 - 517.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W.-Y. Chen, L.-J. Juan, and B.-c. Chung
SF-1 (Nuclear Receptor 5A1) Activity Is Activated by Cyclic AMP via p300-Mediated Recruitment to Active Foci, Acetylation, and Increased DNA Binding
Mol. Cell. Biol., December 1, 2005; 25(23): 10442 - 10453.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Fan, A. Park, and K. P. Nephew
CHIP (Carboxyl Terminus of Hsc70-Interacting Protein) Promotes Basal and Geldanamycin-Induced Degradation of Estrogen Receptor-{alpha}
Mol. Endocrinol., December 1, 2005; 19(12): 2901 - 2914.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Kawate, Y. Wu, K. Ohnaka, R.-H. Tao, K.-i. Nakamura, T. Okabe, T. Yanase, H. Nawata, and R. Takayanagi
Impaired Nuclear Translocation, Nuclear Matrix Targeting, and Intranuclear Mobility of Mutant Androgen Receptors Carrying Amino Acid Substitutions in the Deoxyribonucleic Acid-Binding Domain Derived from Androgen Insensitivity Syndrome Patients
J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6162 - 6169.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. F. Zheng, R.-C. Wu, C. L. Smith, and B. W. O'Malley
Rapid Estrogen-Induced Phosphorylation of the SRC-3 Coactivator Occurs in an Extranuclear Complex Containing Estrogen Receptor
Mol. Cell. Biol., September 15, 2005; 25(18): 8273 - 8284.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller
Antiandrogens prevent stable DNA-binding of the androgen receptor
J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Takahashi, M. Ohmichi, J. Kawagoe, C. Ohshima, M. Doshida, T. Ohta, M. Saitoh, A. Mori-Abe, B. Du, H. Igarashi, et al.
Growth Factors Change Nuclear Distribution of Estrogen Receptor-{alpha} via Mitogen-Activated Protein Kinase or Phosphatidylinositol 3-Kinase Cascade in a Human Breast Cancer Cell Line
Endocrinology, September 1, 2005; 146(9): 4082 - 4089.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. He, J.-M. Sun, L. Li, and J. R. Davie
Differential Intranuclear Organization of Transcription Factors Sp1 and Sp3
Mol. Biol. Cell, September 1, 2005; 16(9): 4073 - 4083.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. C. Valley, R. Metivier, N. M. Solodin, A. M. Fowler, M. T. Mashek, L. Hill, and E. T. Alarid
Differential Regulation of Estrogen-Inducible Proteolysis and Transcription by the Estrogen Receptor {alpha} N Terminus
Mol. Cell. Biol., July 1, 2005; 25(13): 5417 - 5428.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. N. Day and F. Schaufele
Imaging Molecular Interactions in Living Cells
Mol. Endocrinol., July 1, 2005; 19(7): 1675 - 1686.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. J. M. Schaaf, L. J. Lewis-Tuffin, and J. A. Cidlowski
Ligand-Selective Targeting of the Glucocorticoid Receptor to Nuclear Subdomains Is Associated with Decreased Receptor Mobility
Mol. Endocrinol., June 1, 2005; 19(6): 1501 - 1515.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. N. Feige, L. Gelman, C. Tudor, Y. Engelborghs, W. Wahli, and B. Desvergne
Fluorescence Imaging Reveals the Nuclear Behavior of Peroxisome Proliferator-activated Receptor/Retinoid X Receptor Heterodimers in the Absence and Presence of Ligand
J. Biol. Chem., May 6, 2005; 280(18): 17880 - 17890.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. R. Singh, C. Song, Z. Yang, and R. Kumar
Nuclear Localization and Chromatin Targets of p21-activated Kinase 1
J. Biol. Chem., May 6, 2005; 280(18): 18130 - 18137.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Narayanan, D. P. Edwards, and N. L. Weigel
Human Progesterone Receptor Displays Cell Cycle-Dependent Changes in Transcriptional Activity
Mol. Cell. Biol., April 15, 2005; 25(8): 2885 - 2898.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Kim, R. Barhoumi, R. Burghardt, and S. Safe
Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer
Mol. Endocrinol., April 1, 2005; 19(4): 843 - 854.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. L. Ruas, L. Poellinger, and T. Pereira
Role of CBP in regulating HIF-1-mediated activation of transcription
J. Cell Sci., January 15, 2005; 118(2): 301 - 311.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wu, R. Burghardt, and S. Safe
Vitamin D-interacting Protein 205 (DRIP205) Coactivation of Estrogen Receptor {alpha} (ER{alpha}) Involves Multiple Domains of Both Proteins
J. Biol. Chem., December 17, 2004; 279(51): 53602 - 53612.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Cui, M. Zhang, R. Pestell, E. M. Curran, W. V. Welshons, and S. A. W. Fuqua
Phosphorylation of Estrogen Receptor {alpha} Blocks Its Acetylation and Regulates Estrogen Sensitivity
Cancer Res., December 15, 2004; 64(24): 9199 - 9208.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Narayanan, V. A. T. Sepulveda, M. Falzon, and N. L. Weigel
The Functional Consequences of Cross-talk between the Vitamin D Receptor and ERK Signaling Pathways Are Cell-specific
J. Biol. Chem., November 5, 2004; 279(45): 47298 - 47310.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Nair, S. K. Mishra, Z. Yang, S. Balasenthil, R. Kumar, and R. K. Vadlamudi
Potential Role of a Novel Transcriptional Coactivator PELP1 in Histone H1 Displacement in Cancer Cells
Cancer Res., September 15, 2004; 64(18): 6416 - 6423.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. E. Damdimopoulos, A. Miranda-Vizuete, E. Treuter, J.-A. Gustafsson, and G. Spyrou
An Alternative Splicing Variant of the Selenoprotein Thioredoxin Reductase Is a Modulator of Estrogen Signaling
J. Biol. Chem., September 10, 2004; 279(37): 38721 - 38729.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Dong, D. L. Stenoien, J. Qiu, M. A. Mancini, and D. J. Tweardy
Reduced Intranuclear Mobility of APL Fusion Proteins Accompanies Their Mislocalization and Results in Sequestration and Decreased Mobility of Retinoid X Receptor {alpha}
Mol. Cell. Biol., May 15, 2004; 24(10): 4465 - 4475.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Botos, W. Xian, D. F. Smith, and C. L. Smith
Progesterone Receptor Deficient in Chromatin Binding Has an Altered Cellular State
J. Biol. Chem., April 9, 2004; 279(15): 15231 - 15239.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Elbi, D. A. Walker, G. Romero, W. P. Sullivan, D. O. Toft, G. L. Hager, and D. B. DeFranco
Molecular chaperones function as steroid receptor nuclear mobility factors
PNAS, March 2, 2004; 101(9): 2876 - 2881.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. L. Arnett-Mansfield, A. deFazio, P. A. Mote, and C. L. Clarke
Subnuclear Distribution of Progesterone Receptors A and B in Normal and Malignant Endometrium
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1429 - 1442.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. L. Smith and B. W. O'Malley
Coregulator Function: A Key to Understanding Tissue Specificity of Selective Receptor Modulators
Endocr. Rev., February 1, 2004; 25(1): 45 - 71.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. M. Lonard, S. Y. Tsai, and B. W. O'Malley
Selective Estrogen Receptor Modulators 4-Hydroxytamoxifen and Raloxifene Impact the Stability and Function of SRC-1 and SRC-3 Coactivator Proteins
Mol. Cell. Biol., January 1, 2004; 24(1): 14 - 24.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. Ochiai, K.-i. Matsuda, M. Nishi, H. Ozawa, and M. Kawata
Imaging Analysis of Subcellular Correlation of Androgen Receptor and Estrogen Receptor {alpha} in Single Living Cells Using Green Fluorescent Protein Color Variants
Mol. Endocrinol., January 1, 2004; 18(1): 26 - 42.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Marsaud, A. Gougelet, S. Maillard, and J.-M. Renoir
Various Phosphorylation Pathways, Depending on Agonist and Antagonist Binding to Endogenous Estrogen Receptor {alpha} (ER{alpha}), Differentially Affect ER{alpha} Extractability, Proteasome-Mediated Stability, and Transcriptional Activity in Human Breast Cancer Cells
Mol. Endocrinol., October 1, 2003; 17(10): 2013 - 2027.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. P. Pilipuk, M. D. Galigniana, and J. Schwartz
Subnuclear Localization of C/EBP{beta} Is Regulated by Growth Hormone and Dependent on MAPK
J. Biol. Chem., September 12, 2003; 278(37): 35668 - 35677.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ben-Yehoyada, I. Ben-Dor, and Y. Shaul
c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association
J. Biol. Chem., September 5, 2003; 278(36): 34475 - 34482.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Amazit, Y. Alj, R. K. Tyagi, A. Chauchereau, H. Loosfelt, C. Pichon, J. Pantel, E. Foulon-Guinchard, P. Leclerc, E. Milgrom, et al.
Subcellular Localization and Mechanisms of Nucleocytoplasmic Trafficking of Steroid Receptor Coactivator-1
J. Biol. Chem., August 22, 2003; 278(34): 32195 - 32203.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
K. De Bosscher, W. Vanden Berghe, and G. Haegeman
The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression
Endocr. Rev., August 1, 2003; 24(4): 488 - 522.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. T. Alarid, M. T. Preisler-Mashek, and N. M. Solodin
Thyroid Hormone Is an Inhibitor of Estrogen-Induced Degradation of Estrogen Receptor-{alpha} Protein: Estrogen-Dependent Proteolysis Is Not Essential for Receptor Transactivation Function in the Pituitary
Endocrinology, August 1, 2003; 144(8): 3469 - 3476.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Zhang, L. Liao, S.-Q. Kuang, and J. Xu
Spatial Distribution of the Messenger Ribonucleic Acid and Protein of the Nuclear Receptor Coactivator, Amplified in Breast Cancer-3, in Mice
Endocrinology, April 1, 2003; 144(4): 1435 - 1443.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Dan, J. C. Y. Cheung, D. R. L. Scriven, and E. D. W. Moore
Epitope-dependent localization of estrogen receptoralpha , but not -beta , in en face arterial endothelium
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1295 - H1306.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen
Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors
J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. J. M. Schaaf and J. A. Cidlowski
Molecular Determinants of Glucocorticoid Receptor Mobility in Living Cells: the Importance of Ligand Affinity
Mol. Cell. Biol., March 15, 2003; 23(6): 1922 - 1934.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. N. Day, T. C. Voss, J. F. Enwright III, C. F. Booker, A. Periasamy, and F. Schaufele
Imaging the Localized Protein Interactions Between Pit-1 and the CCAAT/Enhancer Binding Protein {alpha} in the Living Pituitary Cell Nucleus
Mol. Endocrinol., March 1, 2003; 17(3): 333 - 345.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kino and G. P. Chrousos
Tumor Necrosis Factor alpha Receptor- and Fas-associated FLASH Inhibit Transcriptional Activity of the Glucocorticoid Receptor by Binding to and Interfering with Its Interaction with p160 Type Nuclear Receptor Coactivators
J. Biol. Chem., January 24, 2003; 278(5): 3023 - 3029.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. A. Figtree, D. McDonald, H. Watkins, and K. M. Channon
Truncated Estrogen Receptor {alpha} 46-kDa Isoform in Human Endothelial Cells: Relationship to Acute Activation of Nitric Oxide Synthase
Circulation, January 7, 2003; 107(1): 120 - 126.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
O. J. Rivera, C. S. Song, V. E. Centonze, J. D. Lechleiter, B. Chatterjee, and A. K. Roy
Role of the Promyelocytic Leukemia Body in the Dynamic Interaction between the Androgen Receptor and Steroid Receptor Coactivator-1 in Living Cells
Mol. Endocrinol., January 1, 2003; 17(1): 128 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Ruas, L. Poellinger, and T. Pereira
Functional Analysis of Hypoxia-inducible Factor-1alpha -mediated Transactivation. IDENTIFICATION OF AMINO ACID RESIDUES CRITICAL FOR TRANSCRIPTIONAL ACTIVATION AND/OR INTERACTION WITH CREB-BINDING PROTEIN
J. Biol. Chem., October 4, 2002; 277(41): 38723 - 38730.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K.-i. Matsuda, I. Ochiai, M. Nishi, and M. Kawata
Colocalization and Ligand-Dependent Discrete Distribution of the Estrogen Receptor (ER){alpha} and ER{beta}
Mol. Endocrinol., October 1, 2002; 16(10): 2215 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J.-B. Lazaro, P. J. Bailey, and A. B. Lassar
Cyclin D-cdk4 activity modulates the subnuclear localization and interaction of MEF2 with SRC-family coactivators during skeletal muscle differentiation
Genes & Dev., July 15, 2002; 16(14): 1792 - 1805.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. B. DeFranco
Navigating Steroid Hormone Receptors through the Nuclear Compartment
Mol. Endocrinol., July 1, 2002; 16(7): 1449 - 1455.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Vottero, T. Kino, H. Combe, P. Lecomte, and G. P. Chrousos
A Novel, C-Terminal Dominant Negative Mutation of the GR Causes Familial Glucocorticoid Resistance through Abnormal Interactions with p160 Steroid Receptor Coactivators
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2658 - 2667.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. C. Nye, R. R. Rajendran, D. L. Stenoien, M. A. Mancini, B. S. Katzenellenbogen, and A. S. Belmont
Alteration of Large-Scale Chromatin Structure by Estrogen Receptor
Mol. Cell. Biol., May 15, 2002; 22(10): 3437 - 3449.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Mulholland, H. Cheng, K. Reid, P. S. Rennie, and C. C. Nelson
The Androgen Receptor Can Promote beta -Catenin Nuclear Translocation Independently of Adenomatous Polyposis Coli
J. Biol. Chem., May 10, 2002; 277(20): 17933 - 17943.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. J. Lloyd, R. C. Trembath, and S. Shackleton
A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies
Hum. Mol. Genet., April 1, 2002; 11(7): 769 - 777.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Saitoh, R. Takayanagi, K. Goto, A. Fukamizu, A. Tomura, T. Yanase, and H. Nawata
The Presence of Both the Amino- and Carboxyl-Terminal Domains in the AR Is Essential for the Completion of a Transcriptionally Active Form with Coactivators and Intranuclear Compartmentalization Common to the Steroid Hormone Receptors: A Three-Dimensional Imaging Study
Mol. Endocrinol., April 1, 2002; 16(4): 694 - 706.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. E. Akiyama, C. T. Baumann, S. Sakai, G. L. Hager, and F. J. Gonzalez
Selective Intranuclear Redistribution of PPAR Isoforms by RXR{alpha}
Mol. Endocrinol., April 1, 2002; 16(4): 707 - 721.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. V. Weatherman, C.-Y. Chang, N. J. Clegg, D. C. Carroll, R. N. Day, J. D. Baxter, D. P. McDonnell, T. S. Scanlan, and F. Schaufele
Ligand-Selective Interactions of ER Detected in Living Cells by Fluorescence Resonance Energy Transfer
Mol. Endocrinol., March 1, 2002; 16(3): 487 - 496.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. AEsoy, G. Mellgren, K.-I. Morohashi, and J. Lund
Activation of cAMP-Dependent Protein Kinase Increases the Protein Level of Steroidogenic Factor-1
Endocrinology, January 1, 2002; 143(1): 295 - 303.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Schaufele, J. F. Enwright III, X. Wang, C. Teoh, R. Srihari, R. Erickson, O. A. MacDougald, and R. N. Day
CCAAT/Enhancer Binding Protein {alpha} Assembles Essential Cooperating Factors in Common Subnuclear Domains
Mol. Endocrinol., October 1, 2001; 15(10): 1665 - 1676.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. L. Sunn, T.-A. Cock, L. A. Crofts, J. A. Eisman, and E. M. Gardiner
Novel N-Terminal Variant of Human VDR
Mol. Endocrinol., September 1, 2001; 15(9): 1599 - 1609.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. L. Stenoien, A. C. Nye, M. G. Mancini, K. Patel, M. Dutertre, B. W. O'Malley, C. L. Smith, A. S. Belmont, and M. A. Mancini
Ligand-Mediated Assembly and Real-Time Cellular Dynamics of Estrogen Receptor {alpha}-Coactivator Complexes in Living Cells
Mol. Cell. Biol., July 1, 2001; 21(13): 4404 - 4412.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev, July 1, 2001; 81(3): 1097 - 1142.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-Y. Choi, J. Pratap, A. Javed, S. K. Zaidi, L. Xing, E. Balint, S. Dalamangas, B. Boyce, A. J. van Wijnen, J. B. Lian, et al.
Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development
PNAS, June 28, 2001; (2001) 151236498.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Pasqualini, D. Guivarc'h, J.-V. Barnier, B. Guibert, J.-D. Vincent, and P. Vernier
Differential Subcellular Distribution and Transcriptional Activity of {{Sigma}}E3, {{Sigma}}E4, and {{Sigma}}E3-4 Isoforms of the Rat Estrogen Receptor-{{alpha}}
Mol. Endocrinol., June 1, 2001; 15(6): 894 - 908.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. H. Price Jr., C. A. Butler, P. Webb, R. Uht, P. Kushner, and R. J. Handa
A Splice Variant of Estrogen Receptor {beta} Missing Exon 3 Displays Altered Subnuclear Localization and Capacity for Transcriptional Activation
Endocrinology, May 1, 2001; 142(5): 2039 - 2049.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
C. Herrmann and M. Mancini
The Cdk9 and cyclin T subunits of TAK/P-TEFb localize to splicing factor-rich nuclear speckle regions
J. Cell Sci., January 4, 2001; 114(8): 1491 - 1503.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
J Nickerson
Experimental observations of a nuclear matrix
J. Cell Sci., January 2, 2001; 114(3): 463 - 474.
[Abstract] [PDF]


Home page
Mol. Endocrinol.Home page
F. Schaufele, C.-y. Chang, W. Liu, J. D. Baxter, S. K. Nordeen, Y. Wan, R. N. Day, and D. P. McDonnell
Temporally Distinct and Ligand-Specific Recruitment of Nuclear Receptor-Interacting Peptides and Cofactors to Subnuclear Domains Containing the Estrogen Receptor
Mol. Endocrinol., December 1, 2000; 14(12): 2024 - 2039.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
R. K. Tyagi, Y. Lavrovsky, S. C. Ahn, C. S. Song, B. Chatterjee, and A. K. Roy
Dynamics of Intracellular Movement and Nucleocytoplasmic Recycling of the Ligand-Activated Androgen Receptor in Living Cells
Mol. Endocrinol., August 1, 2000; 14(8): 1162 - 1174.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Prufer, A. Racz, G. C. Lin, and J. Barsony
Dimerization with Retinoid X Receptors Promotes Nuclear Localization and Subnuclear Targeting of Vitamin D Receptors
J. Biol. Chem., December 22, 2000; 275(52): 41114 - 41123.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. T. Baumann, P. Maruvada, G. L. Hager, and P. M. Yen
Nuclear Cytoplasmic Shuttling by Thyroid Hormone Receptors. MULTIPLE PROTEIN INTERACTIONS ARE REQUIRED FOR NUCLEAR RETENTION
J. Biol. Chem., March 30, 2001; 276(14): 11237 - 11245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Tomura, K. Goto, H. Morinaga, M. Nomura, T. Okabe, T. Yanase, R. Takayanagi, and H. Nawata
The Subnuclear Three-dimensional Image Analysis of Androgen Receptor Fused to Green Fluorescence Protein
J. Biol. Chem., July 20, 2001; 276(30): 28395 - 28401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-M. Sun, H. Y. Chen, and J. R. Davie
Effect of Estradiol on Histone Acetylation Dynamics in Human Breast Cancer Cells
J. Biol. Chem., December 21, 2001; 276(52): 49435 - 49442.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-Y. Choi, J. Pratap, A. Javed, S. K. Zaidi, L. Xing, E. Balint, S. Dalamangas, B. Boyce, A. J. van Wijnen, J. B. Lian, et al.
Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development
PNAS, July 17, 2001; 98(15): 8650 - 8655.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. T. Preisler-Mashek, N. Solodin, B. L. Stark, M. K. Tyriver, and E. T. Alarid
Ligand-specific regulation of proteasome-mediated proteolysis of estrogen receptor-alpha
Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E891 - E898.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals