| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
and Steroid Receptor Coactivator-1
Department of Molecular and Cellular Biology (D.L.S., M.G.M., K.P.,
C.L.S., M.A.M.) Baylor College of Medicine Houston, Texas
77030
Ligand Pharmaceuticals, Inc. (E.A.A.)
San Diego, California 92121
| ABSTRACT |
|---|
|
|
|---|
(ER
) in terms of both spatial
distribution and solubility partitioning. Using a transcriptionally
active green fluorescent protein-ER
chimera (GFP-ER
), we find
that 17ß-estradiol (E2) changes the normally
diffuse nucleoplasmic pattern of GFP-ER
to a hyperspeckled
distribution within 1020 min. A similar reorganization occurs with
the partial antagonist 4-hydroxytamoxifen; only a subtle effect was
observed with the pure antagonist ICI 182,780. To examine the influence
of ligand upon ER
association with nuclear structure, MCF-7 cells
were extracted to reveal the nuclear matrix (NM). Addition of
E2, 4-hydroxytamoxifen, or ICI 182,780
causes ER
to partition with the NM-bound fraction on a similar time
course (1020 min) as the spatial reorganization suggesting that the
two events are related. To determine the effects of
E2 on the redistribution and solubility of
GFP-ER
, individual cells were directly examined during both hormone
addition and NM extraction and showed that GFP-ER
movement and NM
association were coincident. Colocalization experiments were performed
with antibodies to identify sites of transcription (RNA pol IIo) and
splicing domains (SRm160). Using E2 treated
MCF-7 cells, minor overlap was observed with transcription sites and a
small amount of the total ER
pool. Experiments performed with
bioluminescent derivatives of ER
and steroid receptor
coactivator-1 (SRC-1) demonstrated both proteins colocalize to the same
NM-bound foci in response to E2 but not the
antagonists tested. Deletion mutagenesis and in situ
analyses indicate intranuclear colocalization requires a central SRC-1
domain containing LXXLL motifs. Collectively, our data suggest that
ER
transcription function is dependent upon dynamic early events
including intranuclear rearrangement, NM association, and SRC-1
interactions. | INTRODUCTION |
|---|
|
|
|---|
(ER
) is a well characterized member of
the nuclear receptor (NR) superfamily that regulates transcription of
specific target genes in response to hormone (reviewed in Refs. 1, 2, 3).
ER
contains several functional domains including a C-terminal,
ligand-binding domain (LBD) and a centrally located zinc finger
DNA-binding domain. Transcriptional activation is mediated by at least
two activation function domains (AFs). Activation by AF-2, located in
the LBD, is dependent upon agonist binding (4), while the amino
terminal AF-1 domain can be activated independently of agonist (5). The
LBD of ER
recognizes a variety of compounds including the endogenous
agonist 17ß-estradiol (E2) and the pure
antagonists ICI 182,780 and ICI 164,384. The synthetic ligands
4-hydroxytamoxifen (4HT) and raloxifene act as partial antagonists that
exert differential effects on ER
activity depending upon cell type,
tissue, and promoter context (5, 6, 7).
A number of biochemical and yeast two-hybrid studies have identified
proteins capable of interacting with NRs and influencing their
transcriptional activity. These include corepressors and several
classes of coactivators. Proteins belonging to the p160 family of
steroid receptor coactivators, such as SRC-1/N-CoA1 (8, 9) and
Grip-1/TIF2/N-CoA2 (10, 11, 12), associate with ER
and other NRs and enhance transcriptional activation (13, 14, 15). These
coactivators interact with the agonist-bound LBDs via a motif, LXXLL,
known as the NR box (16, 17) using the AF-2 interaction surface (18).
Once bound to the NR, coactivators are thought to enhance NR-based
transcription by several mechanisms (19). The discovery that many
coactivators including SRC-1 possess intrinsic histone acetylase
activity (20) suggests that chromatin remodeling plays an important
role in transactivation. Coactivators may also mediate interactions
with other transcription factors and play a role in the assembly and
stabilization of the transcriptional preinitiation complex.
A key question remains as to how transcriptional complexes containing steroid receptors, coactivators, and other components are organized in terms of nuclear architecture. Many reports in recent years indicate that nuclear metabolism is organized in discrete subnuclear compartments (reviewed in Refs. 21, 22, 23). Transcription appears to be organized into transcriptional factories that contain newly synthesized mRNA (24, 25) and the active, hyperphosphorylated form of the RNA polymerase II large subunit [pol IIo (26, 27, 28)]. Transcription factories are limited to several thousand sites representing less than 5% of the nuclear volume (23, 29). Splicing factors such as SC-35 and SRm160 are also primarily localized to nuclear foci, referred to as splicing speckles, that can be distinct from transcription sites (30, 31, 32). Interestingly, transcription sites, splicing speckles, newly synthesized mRNA, and actively transcribed genes have all been reported to associate with the biochemically and morphologically defined nuclear matrix (NM) (22, 33, 34, 35, 36, 37, 38). Furthermore, a number of transcription factors, including steroid receptors, have long been known to associate with the NM (39, 40, 41, 52). Given that many of the components involved in transcription are NM associated, it is possible to argue that the NM plays an important role in the organization and regulation of transcription (23, 39, 40).
In the present study we examine the effects of ligand binding on the
organization of ER
and its interactions with subnuclear domains, the
NM, and the steroid receptor coactivator, SRC-1. High-resolution
fluorescence microscopy performed upon fixed and live cells in
conjunction with biochemical partitioning assays reveal ER
to be a
surprisingly dynamic nuclear regulator whose function is linked to
rapid, ligand-based changes in its nuclear distribution and association
with nuclear architecture, and with SRC-1.
| RESULTS |
|---|
|
|
|---|
Antibody
undergoes in
response to ligand, we have developed several experimental protocols
involving microscopic and Western blot analyses of both endogenous and
transfected ER
. For many of these studies, a monoclonal antibody,
ERnt (42) was used that recognizes the amino terminus of ER. On Western
blots this antibody recognizes a band of 66 kDa in MCF-7 cells that
expresses endogenous ER
(Fig. 1
expression plasmid (Fig. 1A
reveals a staining
pattern dispersed throughout the nucleoplasm (Fig. 1
and occurs in both the presence and absence of hormone (43, 44, 45).
To determine whether the staining pattern of exogenously expressed
ER
is similar to that observed in MCF-7 cells, immunofluorescence
was performed on transfected, hormone-treated HeLa cells. In these
cells, ERnt immunoreactivity is exclusively nuclear in a pattern
similar to MCF-7 cells (Fig. 1
is distributed throughout the
nucleoplasm in a distinctly hyperspeckled pattern.
|

in living cells, we
subcloned the ER
coding region into the pEGFP-C1 vector
(CLONTECH Laboratories, Inc., Palo Alto, CA) to generate a
green fluorescent protein-ER
expression plasmid (pEGFP-C1-hER;
GFP-ER
). On Western blots of transfected HeLa cells, the ERnt
antibody recognizes a band of approximately 94 kDa corresponding to the
predicted molecular mass of GFP-ER
(Fig. 1
construct does not
interfere with ER
activity, GFP-ER
and ER
plasmids were
cotransfected along with an ER-responsive reporter plasmid, ERE-E1b-Luc
(48) (Fig. 2A
and untagged ER
in the
presence of hormone are very similar. In the absence of hormone the
basal activities of both receptors were similarly low.
|
in Living Cells
distribution, HeLa cells were transfected, transferred to a live cell,
closed perfusion chamber (Bioptechs, Inc., Butler, PA) and
maintained at 37 C in CO2-equilibrated,
HEPES-buffered DMEM containing 5% dextran charcoal-stripped FBS.
Before hormone addition, GFP-ER
had a diffuse distribution
throughout the nucleoplasm but was excluded from nucleoli (Fig. 2B
was found in a punctate distribution
(Fig. 2B
in both HepG2 (middle row) and MCF-7 cells (bottom row). The
time course of GFP-ER
redistribution was determined by performing,
time-lapse microscopy on live HeLa cells over the course of 40 min.
Initial experiments indicated that excessive exposure of cells to light
can diminish GFP-ER
signal and inhibit intranuclear dynamics,
therefore, neutral density filters and low exposure times were used
(see Materials and Methods). This results in a slight
loss in resolution but facilitates study of intranuclear dynamics.
Perfusion of E2 (10 nM;
Fig. 3
from diffuse to punctate. Detectable
differences in GFP-ER
relocalization were observed within 10 min and
reached a maximum by 30 min. To determine whether this reorganization
occurred with other ER
ligands, 4HT and the pure antagonists ICI
164,384 and ICI 182,780 were also tested. In the presence of 4HT (10
nM; Fig. 3
underwent a similar reorganization as with E2.
Addition of ICI 164,384 (10 nM; Fig. 3
distribution in
transfected HeLa cells. With ICI 182,780 (10 nM;
Fig. 3
distribution was observed. These results are similar to those obtained
in a recent investigation by Htun et al. (45), examining the
effects of ligands on GFP-ER
distribution. This group studied
GFP-ER
localization in a number of cell lines including MCF-7 cells
and found reorganization occurs in response to
E2, 4HT, and ICI 182,780. In those experiments,
however, different cells were imaged before and after hormone addition.
Our experimental design has allowed us to directly determine the
dynamics and timing of ligand-induced, intranuclear ER
movements and
demonstrate they occur in a time scale of 1020 min.
|
with the NM
and many other nuclear
constituents suggests that an underlying structure exists that aids in
partitioning nuclear metabolism to specific subnuclear domains (22, 23, 36, 37, 38, 39, 40). ER
and other members of the steroid receptor family have
been reported to remain associated with the insoluble NM fraction after
various types of extraction (41, 49, 50, 51). To determine the extent of
ER
NM association, a series of extractions was performed on MCF-7
cells treated with and without hormone. NM extractions were performed
by incubating cells with cytoskeletal (CSK) buffer containing 0.5%
Triton X-100 followed by deoxyribonuclease I (DNase I) digestion and
treatment with 0.25 M ammonium sulfate and 2 M
NaCl to remove DNA, DNA-associated proteins, and proteins loosely
associated with the NM. Shown on the Western blots in Fig. 4A
is eluted in lanes 4
and 5, these samples were omitted from Fig. 4
is extracted during a 3-min incubation in CSK buffer (Fig. 4A
that is NM associated (data not shown). In
contrast, in cells treated for 1 h with E2
(10 nM), nearly all of the ER
was found in the
DNase I fraction or associated with the NM (Fig. 4A
released during
this step is due to prolonged exposure to detergent, not nuclease
activity (see below, Fig. 4B
is eluted in 0.25
M ammonium sulfate or 2 M
NaCl indicating that the remaining ER
is very tightly associated
with the NM. In contrast, Htun et al. (45) examined the NM
association of transiently transfected GFP-ER
and found that hormone
had little effect on matrix targeting. Under some conditions we have
also noticed a similar result specifically when working with
transfected receptors. In comparison to the endogenous receptor in
MCF-7 cells, we see more matrix association in the absence of hormone
and more soluble receptor with hormone with transfected ER
(data not
shown). In our experience, even in well titered transfection
experiments, there are cells that express vastly different amounts of
receptor. This can lead to oversaturation of binding sites or
alternatively to the formation of insoluble protein aggregates in
highly expressing cells; in both cases, these issues alter hormone
influences upon ER-NM extractions. Because of these problems, we chose
to perform the Western blots on endogenous ER
in MCF-7 cells.
|
antagonists had a similar effect on NM
association, MCF-7 cells were treated for 1 h with 10
nM 4HT or ICI 182,780. ICI 164,384 was also used and
yielded similar results as ICI 182,780 (data not shown). Surprisingly,
all of the antagonists tested resulted in a shift in ER
distribution
from a soluble to a NM-bound fraction (Fig. 4A
that is
removed after treatment with DNase I. This fraction is absent or
substantially reduced in matrix preparations from cells treated with
either of the ICI compounds. To determine whether this fraction
corresponds to a DNA binding fraction that is removed after DNA
digestion, a mock digestion was performed in the absence of DNase I. No
differences were observed in DNase I or mock treated cells (Fig. 4B
removed during this treatment represents a
differentially detergent resistant-fraction as observed previously with
the Pit-1 transcription factor (52). As our live cell studies indicated
that GFP-ER
redistributes rapidly in response to hormone, we tested
whether NM association occurs in the same time frame. All of the
ligands used above resulted in a rapid NM association within 10 min,
and by 20 min all of the ER
had a NM association similar to that
observed at 1 h and longer time points (Fig. 4C
Ligand-Induced Foci Are NM Associated
As ligand-induced matrix association occurs on the same time scale
as GFP-ER
redistribution, we examined whether ligand-induced foci of
GFP-ER
were matrix associated. To analyze this, we used a novel
extraction procedure that allows us to perform detergent and NM
extractions on GFP-transfected cells in real time. This method involves
using a live cell chamber to perfuse in buffers enabling us to examine
individual cells before and after detergent and NM extraction. This
procedure allows us to bypass an artifact caused by overexpression in a
subpopulation of the transiently transfected cells in which receptor
aggregation results in apparent NM association. A demonstration of this
is presented in Fig. 5A
showing two
transfected cells expressing vastly different amounts of GFP-ER
in the absence of added ligand. The relative mean fluorescent
intensities of each cell were determined before and after detergent
extraction. The overexpressing cell on the left retained
approximately 84% of its fluorescence while the lower expressing cell
on the right (in outline to denote its location) retained
only 2.2% of its fluorescence. This direct, cell-based observation,
clearly indicates immunoblot-based NM analyses on transiently
transfected cells should be interpreted with caution.
|
. Figure 5B
fluorescence is removed leaving the punctate foci
containing GFP-ER
. In some cases, specific GFP-ER
foci can be
identified before and after CSK treatment, indicating that these
domains are preformed and are not an artifact of the detergent
extraction. Specific GFP-ER
foci can also appear shifted relative to
one another, making it difficult to identify individual spots before
and after CSK treatment. This may be a consequence of the changes that
are occurring in the nucleus as a result of the removal of the majority
of the cellular protein and the slight shrinkage that occurs (22).
Although GFP-ER
remains tightly bound on the nucleoskeleton, core
filaments themselves may still be free to move in relation to one
another so that GFP-ER
foci might move in and out of different focal
planes during the experiment.
An advantage of the real time extraction procedure is it allows
quantification of GFP-ER
fluorescence remaining in the nucleus on a
number of individual cells. In the absence of hormone only 5.3% ± 2.6
of the fluorescence is retained after detergent extraction compared
with 69% ± 6.7 in the presence of added E2 (10
nM; 1 Hr). Each quantitative evaluation was performed four
times with a minimum of 10 cells each. A full matrix extraction was
performed on E2-treated cells (Fig. 5C
) and
demonstrated that ER
foci remain after DNase I and high-salt
treatments consistent with our Western blot results. The amount of
GFP-ER
fluorescence remaining after a full NM extraction is slightly
less, 55.5% ± 12.9 (n = 3) compared with the 69% observed after
detergent alone.
The above experiments demonstrate that ligand binding is required for
both NM association and receptor reorganization. As a further test of
this, we generated a GFP-ER
C-terminal truncation containing the
first 282 amino acids, GFP-ER282, that lacks the LBD. As seen in Fig. 5D
, GFP-ER282 has a diffuse nucleoplasmic staining that does not change
upon hormone addition and is completely soluble in CSK buffer. While
this simple mapping experiment points to the significance of the LBD
for both receptor reorganization and NM association, this issue is
complicated by the position of many functional subdomains within this
carboxy-terminal region (e.g. ligand binding, heat shock
protein binding, coactivator binding, etc.).
Colocalization of ER
with Markers of Nuclear Metabolism
The immunolabeling of ER
in MCF-7 and transfected HeLa cells
yields a punctate staining pattern similar to that observed previously
for NM-bound transcription sites (23, 24, 25, 26, 27). Colocalization studies using
antibodies recognizing ER
and phosphorylated RNA polymerase II (pol
IIo) that has been previously shown to label sites of nascent RNA
transcription was performed on E2-
treated (10 nM, 1 h) MCF-7
cells. The overall immunolabeling patterns of ER
(Fig. 6A
) and pol IIo (Fig. 6C
) are very
similar with multiple foci of both scattered throughout the nucleus.
Interestingly however, only a small subset of ER
foci are coincident
with pol IIo (Fig. 6E
). Colocalization using antibodies recognizing
ER
(Fig. 6B
) and the splicing domain protein, SRm160 (Ref. 31 ; Fig. 6D
) was also performed in E2-treated MCF-7 cells.
Minor overlap at the periphery of the splicing speckles was observed
(Fig. 6F
), however, most ER foci did not coincide with splicing
speckles. These results indicate that most of the ER
pool is not
directly involved in transcription. A recent colocalization study using
a variety of other transcription factors has also shown that most
transactivators do not overlap with sites of transcription (53).
|
and SRC-1
in HeLa cells. The
SRC-1 construct used in Figs. 7
construct was generated and used in
cotransfection studies with GFP-SRC-1. Although the emission spectrum
for CFP (emission max at 475 nm with a minor peak at 501 nm) partially
overlaps with the emission spectrum of GFP (emission max = 507
nm), use of a higher wavelength fluorescein isothiocyanate (FITC)
emission filter set minimized bleed through of the CFP signal. In cells
expressing low levels of CFP-ER
(Fig. 7A
and SRC-1 was
examined in live cells using CFP-ER
- and GFP-SRC-1-transfected HeLa
cells. Before hormone addition, both CFP-ER
(Fig. 7E
(Fig. 7G
|
|

and GFP-SRC-1 was analyzed by
performing CSK extractions on cells in real time as in Fig. 5
(left two columns) and GFP-SRC-1
(right two columns) in the same cells before (whole) and
after (CSK) extraction with CSK buffer containing 0.5% Triton
X-100. In the absence of ligand (Fig. 8A
and GFP-SRC-1 fluorescence was removed after detergent
extraction. In E2- treated
cells (10 nM, 1 h, Fig. 8A
and GFP-SRC-1 remained after extraction. With
4HT (10 nM, 1 h, Fig. 8A
remained after detergent;
however, most of the GFP-SRC-1 fluorescence was removed, suggesting
ER
and SRC-1 interactions are much weaker in the presence of these
antagonists. The relative amounts of CFP-ER
and GFP-SRC-1 remaining
after detergent extraction were quantified and are shown in Fig. 8B
in the nucleus (70.4 ± 5.7%,
70.4 ± 4.5%, and 82.3 ± 4.2%, respectively; n = 4),
only E2 led to substantial retention of GFP-SRC-1
(42.1 ± 8.2%; n = 4) after detergent extraction. Full
matrix extractions (not shown) on E2-treated
cells cotransfected with CFP-ER
and GFP-SRC-1 showed that much of
the GFP-SRC-1 (34.8 ± 5.4; n = 2) remained associated with
the NM.
Colocalization and Tethering of SRC-1 Depends upon the Presence of
LXXLL Motifs
Two major isoforms of SRC-1 are widely expressed in a variety of
cell lines and tissues (9, 17). The SRC-1a isoform used above consists
of 1441 amino acids. The SRC-1e isoform is identical to SRC-1a up to
amino acid 1385 but lacks 56 amino acids found in SRC-1a and contains
14 unique amino acids at the C terminus (Fig. 9A
). SRC-1e has been reported to be a
more potent coactivator for ER
and binds more efficiently to ER
using in vitro binding assays (17). We therefore tested
whether these two isoforms showed differences in their ability to
colocalize with ER
and tether to the NM in an agonist-dependent
manner. Shown in Fig. 9B
are E2-treated nuclei
cotransfected with CFP-ER
and GFP-SRC-1a (top row) or
GFP-SRC-1e (second row). The intranuclear distribution of
both isoforms is very similar in terms of their ability to colocalize
with CFP-ER
. When cells are extracted before fixation, both
GFP-SRC-1a (Fig. 9C
, top row) and GFP-SRC-1e remain
associated with CFP-ER
(Fig. 9C
, second row) in the
presence of added E2 (10
nM, 1 h).
|
, we generated C-terminal deletion
constructs of SRC-1 as fusion proteins with yellow fluorescent protein
(YFP). The YFP proteins behave similarly to their GFP counterparts but
since the YFP excitation and emission spectra are shifted away from the
CFP spectra, this further minimizes bleedthrough potential. A YFP
construct containing the first 780 amino acids of SRC-1 colocalizes
with CFP-ER
(Fig. 9B
interactions in a cellular context. The resulting YFP-SRC570780
protein is predominantly cytoplasmic in the absence of cotransfected
CFP-ER
or in the absence of added E2 (data not
shown). When cells were treated with E2 (10
nM, 2 h), YFP-SRC570780 was able to
accumulate in the nucleus at sites containing CFP-ER
(Fig. 9B
(Fig. 9C
within the nucleus and in
the context of nuclear architecture. | DISCUSSION |
|---|
|
|
|---|
,
which is predominantly nuclear regardless of its liganded state
(43, 44, 45), other mechanisms must exist to prevent activation of specific
target genes by unliganded receptor. By combining approaches to examine
transfected and endogenous receptors, we show that ligand-induced
changes in ER
localization and partitioning are early events
involved in receptor activation. We demonstrate that while both agonist
and antagonists lead to formation of NM-bound foci of ER
, only
agonist recruits SRC-1 to these sites, suggesting that both NM
association and coactivator recruitment are necessary for ER
function.
In confirmation of results reported previously by Htun et
al. (45), we show that GFP-tagged ER
(GFP-ER
) is active in
terms of its ability to activate an ERE reporter gene and undergo
changes in its intranuclear distribution (Fig. 2
). The use of
GFP-tagged receptors and high-resolution microscopy allows GFP-ER
localization to be examined in live cells. This provides certain
advantages in that it circumvents potential artifacts caused by
fixation or antibody labeling. In the absence of ligand, GFP-ER
is
diffusely distributed throughout the nucleoplasm being excluded from
nucleolar regions. Htun et al. and we find that GFP-ER
develops a punctate distribution after the addition of E2
and 4HT, and to a lesser extent, ICI 182,780. By following the
distribution of GFP-ER
in individual cells during ligand addition,
we demonstrate that reorganization occurs on a rapid timescale of
1020 min (Fig. 3
).
ER
has long been known to associate with the NM (41), and addition
of estrogen results in the transformation of ER
from a loosely bound
nuclear form to a tightly bound or NM-associated form of ER
(60, 61). We chose to examine the effects of ligand on this transition first
in MCF-7 cells expressing endogenous receptor. In the absence of added
ligand, the majority of endogenous ER
is extracted after brief
exposure to CSK buffer containing 0.5% Triton X-100, indicating that
it is loosely bound or soluble. Addition of agonist or antagonists
results in NM association of ER
(Fig. 4A
). With both
E2 and 4HT, but not with either of the ICI
compounds tested, we find that some of the ER
is eluted during
digestion with DNase I. This fraction could correspond to a DNA binding
form of ER
; however, this does not appear to be the case as we
observe no differences when cells are treated with DNase I or with
digestion buffer alone (Fig. 4B
). It is more likely that the ER
found in the DNase I fraction represents a less tightly NM bound form
that is eluted during prolonged exposure to buffer containing detergent
as reported previously for the Pit-1 transcription factor (52).
Early attempts using immunocytochemistry to characterize the
biochemically defined loose and NM-bound forms of ER
failed to
identify differences in their intranuclear distribution (61, 62, 63). We
have directly examined this issue by performing real-time detergent
extractions and NM preparations on unfixed cells transfected with
GFP-ER
. We find when working with transfected receptors,
overexpression in a subpopulation of cells can lead to a
misrepresentation of the soluble and NM-bound forms of ER
analyzed
on Western blots (data not shown). By selecting cells that express
relatively low levels of GFP-tagged molecules, we are able to bypass
potential problems caused by overexpression. When individual cells
expressing similar levels of GFP-ER
are treated with or without
E2 (Fig. 5
), differences in the extractability of
receptor are readily observed. These results are very reproducible when
care is taken to select cells with comparable expression levels.
However, when cells that express very high levels of protein are used,
substantial GFP fluorescence can remain even in the absence of hormone
(Fig. 5A
). Thus, differences in expression levels may explain the lack
of estrogen-dependent change in NM association reported previously
(45). Using this procedure to analyze NM association of GFP-ER
demonstrates that transfected GFP-labeled receptor behaves similarly to
endogenous receptor in terms of its ability to interact with the NM in
a ligand-dependent manner. Furthermore, this method demonstrates that
ligand-induced foci are NM associated and links receptor reorganization
with the NM. Agonist-induced foci of the mineralocorticoid receptor
have also been reported to associate with the NM (59).
While NM association of steroid receptors has long been recognized
(41), the functional significance of this interaction has remained
unclear. There have been numerous reports that have linked
transcription to nuclear architecture. Both mRNA and proteins involved
in transcription, including RNA polymerase II, associate with the NM
(23, 24, 25, 26, 27, 35, 36, 37, 38, 39, 40). Early reports have also shown actively transcribed
genes to be NM associated (33, 34). Cumulatively, these studies
indicate that the NM may play a role in the organization of
transcription components. In the work presented here, we demonstrate a
clear dependence upon ligand for NM association of ER
and show that
addition of E2 and 4HT results in ER
redistribution in live cells and yields comparable partitioning
patterns during NM preparations. We observe that
E2- and 4HT-induced ER
foci remain after
detergent extraction and NM preparations, suggesting that the NM is
involved in the organization of receptor complexes. As both
E2 and 4HT [in some cellular contexts (5, 6, 7)]
can act as ER
agonists, it is not surprising that they have similar
effects on ER
partitioning. The NM association of ER
induced by
the pure antagonists ICI 164,384 and ICI 182,780 suggests that this
association alone is not sufficient for transcription to occur. These
compounds do not activate the receptor and exert different effects on
the localization and solubility partitioning of ER
than observed
above for E2 and 4HT. With ICI 164,384 we do not
see a significant change in GFP-ER
localization; with ICI 182,780,
the effects on GFP-ER
are much less dramatic than with agonist. In
partitioning studies, however, we find that these two antagonists
result in the rapid association of ER
with the NM. Interestingly, we
do not see ER
in the differentially soluble "DNase I" fraction
(see Fig. 4B
), suggesting that these ligands drive ER
directly to a
tightly bound NM fraction.
With the ability to identify sites of RNA synthesis using Br-UTP and/or
antibodies to the hyperphosphorylated large subunit of RNA polymerase
II [pol IIo (23, 24, 25, 26, 53)], it is possible to visualize where nuclear
regulators are relative to sites of new message synthesis. With
increasing capability to detect brief (
1 min) pulses in Br-UTP, the
estimate of the number of transcription sites per nucleus has risen
over the years from several hundred to several thousand (23).
Regardless of this wide range in the number of sites, there is
agreement that most of the nuclear volume is transcriptionally silent.
The number and appearance of pol IIo immunoreactive foci are similar to
the endogenous and exogenous ER
foci in low expressing cells.
However, high-resolution microscopic analysis reveals that most ER
foci do not overlap with transcription sites (Fig. 6
). Although only a
few transcription factors have been examined, it is clear that there is
much less colocalization between RNA synthesis foci and transcription
factors than expected. A quantitative, high-resolution
immunofluorescence study of several transcription factors revealed
that, in whole cells, labeled foci generally did not overlap with sites
of transcription (53). This could mean that complexes containing
transcription factors are in a dynamic state of assembly/disassembly
and that the time they spend actively transcribing genes is minimal.
Moreover, as agonists/antagonists (E2, 4HT, ICIs)
each drive ER
to the matrix and greatly alter receptor half -lives
[e.g., E2 and ICIs lead to receptor
turnover while 4HT stabilizes (64)], it is possible that
nontranscription site receptor targeting may reflect, in part, sites of
receptor turnover/stabilization.
Adding complexity to this issue is that NRs, including ER
, interact
with a growing list of coregulator molecules that include corepressors
and coactivators (reviewed in Ref. 65). As ER
has been reported to
associate with steroid receptor coactivators in an agonist-dependent
manner, we used biologically active, GFP and YFP SRC-1 chimeras to
study live cell dynamics in relation to bioluminescent (cyan) ER
. In
the absence of hormone, both proteins are nuclear and relatively
diffuse. Addition of E2 results in a substantial
overlap between the two complementary bioluminescent signals,
suggesting that a significant portion of the SRC-1 is associated with
ER
. In the cells examined, E2 causes GFP-SRC-1
to become punctate and overlap with the distribution of CFP-ER
.
Also, E2, but not antagonists, leads to NM
association of GFP-SRC-1, indicating agonist leads to increased
affinities to protein or RNA components of nuclear architecture. In
HeLa cells singly transfected with GFP-SRC-1, we see no effects of
adding E2 on GFP-SRC-1 localization or NM
attachment (data not shown), suggesting that these events are mediated
through CFP-ER
. These experiments also reveal that less interaction
between CFP-ER
and GFP-SRC-1 occurs in the presence of 4HT and ICI
182,780, complementing biochemical studies (17, 66).
Structural studies demonstrate that ligand binding
results in conformational changes in ER
that may affect interactions
with coactivators (67, 68). Coactivators interact with the
agonist-bound LBD via an LXXLL motif known as the NR box (16) using an
AF-2 interaction surface (18). Here, using fluorescent protein chimeras
of ER
and SRC-1a/e, we show that the presence of the LXXLL motifs is
required for agonist-dependent ER
colocalization in vivo
(Fig. 9
). Recently, the structure of ER
bound to agonist and a NR
box peptide from the coactivator GRIP1 was determined and the NR box
peptide was found in a hydrophobic groove formed by helices 3, 4, 5,
and 12 of the LBD (68). In this same study, the structure bound to
tamoxifen was also determined and showed that helix 12 was in a
position to occlude coactivator binding by mimicking interactions
between the NR box and the LBD. These structural studies show that
agonist and antagonist binding to ER
result in structural changes
that affect interactions with steroid receptor coactivators.
Conformational changes induced by agonists and antagonists may also
expose molecular domains that enable ER
to interact with the NM and
undergo intranuclear rearrangement. Early changes in receptor
solubility and localization appear to be necessary for, but do not
guarantee, transactivation, as antagonists have similar effects as
agonists. While all ligands tested result in NM association, only
E2 causes detectable interactions between ER
and SRC-1 in situ. These results suggest that ER
transcription function requires early intranuclear dynamics that
include receptor relocalization, NM association, and coactivator
interactions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
construct, PCR primers were designed
to add a KpnI site at the 5'-end and the entire human ER
sequence was amplified from pRST7-ER (5). The PCR product was cut with
KpnI and BamHI and inserted in the correct
reading frame into pEGFP-C1 (CLONTECH Laboratories, Inc.)
cut with the same two enzymes. The major portion of hER
generated by
PCR was replaced with a SmaI-BamHI fragment from
the original hER
plasmid. Sequence analysis was performed on the
remaining hER
sequence generated by PCR to ensure that no errors had
occurred. To compare GFP vs. non-GFP proteins, the GFP
coding sequence was removed by digesting with AgeI and
BspEI and religating the parent vector (pEGFP-C1-hER-GFP).
To generate CFP-ER, the region encoding CFP was cut out of the pECFP-C1
vector (CLONTECH Laboratories, Inc.) using AgeI
and KpnI and placed into our original GFP-ER vector.
GFP-ER282 was generated by PCR to create a stop codon after amino acid
282 followed by a BamHI site for subcloning into pEGFP-C1.
GFP-SRC-1 was generated by PCR amplification of the GFP sequence from
pEGFP-C1 using the primers 5'-EGFP (CATGGTACCATGGTGAGCAAGGGCGAGGA) and
3'-EGFP (CTGCAGAACCACCA CACTGGACTTGTACAGCTCG TCCATGC) to create a
GFP fragment with a 5'-KpnI site and a 3'-BstXI
site used for subcloning into pCR3.1-hSCR-1a vector (15) resulting in a
plasmid called pCR3.1-GFP-hSRC-1a. To generate GFP-SRC-1e,
pCR3.1-hSRC-1e (gift of Martin Dutertre) was digested with
ApaI and BamHI and placed into the
pCR3.1-GFP-hSRC-1a vector cut with the same two enzymes. YFP-SRC780 was
generated by performing a partial digest with BsrG1 and a
full digest with BamHI of pCR3.1-GFP-hSRC-1a and ligation of
this fragment into pEYFP-C1 (CLONTECH Laboratories, Inc.)
cut with the same two enzymes. YFP-SRC630 was generated by PCR to
create a stop codon after amino acid 630 followed by an XbaI
site used for subcloning into pEYFP-C1. YFP-SRC570780 was generated
by digesting pCR3.1-hSRC-1a with EcoRI and BamHI
and ligating this fragment into pEYFP-C1 cut with the same two
enzymes.
Cell Culture and Labeling
HeLa cells were maintained in Opti-MEM I media (Life Technologies, Inc., Gaithersburg, MD) containing 4% FBS
(Life Technologies, Inc.). MCF-7 cells (gift from Dr.
Richard Santen, University of Virginia, Charlottesville, VA) were
maintained in Improved MEM Zinc Option media (Life Technologies, Inc.) supplemented with 10% FBS. MCF-7 cells were transferred
to DMEM containing 5% dextran charcoal-stripped FBS, PS, 25
mM HEPES, and 110 mg/liter sodium pyruvate referred to as
stripped media and grown for 48 h before use. HepG2 cells were
maintained in DMEM high glucose (Life Technologies, Inc.)
containing 10% FBS, 1% nonessential amino acids, and 1.6%
L-glutamine. Twenty four hours before transfection, cells
were plated onto poly-D-lysine-coated coverslips in 35-mm
wells at a concentration of 105 cells per well in stripped media.
Transient expression of ER
, GFP-ER
, CFP-ER
, and GFP-SRC-1
vectors was accomplished using a calcium phosphate transfection kit
(5'
3', Inc., Boulder, CO). Twelve hours after transfection, cells
were shocked with 10% dimethylsulfoxide and allowed to recover 6
h in stripped media before addition of hormone. For the transcription
assays shown in Fig. 2A
, HeLa cells were cotransfected with 1 µg
ERE-E1b-Luc (48) and either 100 ng of pEGFP-C1-hER or pEGFP-C1-hER-GFP
using Lipofectin (Life Technologies, Inc.).For fixed cell
experiments, vehicle (EtOH), 10 nM 17ß-estradiol
(E2, Sigma, St. Louis, MO), 10
nM 4-HT (gift from D. Salin-Drouin, Laboratoires Besins
Iscovesco, Paris, France), 10 nM ICI 164,384 or 10
nM ICI 182,780 (both gifts from Alan Wakeling, Zeneca Pharmaceuticals, Macclesfield, UK) were added for the
appropriate time before fixation in 4% formaldehyde in PEM (80
mM K-piperazine-N,N'-bis(2-ethanesulfonic acid),
5 mM EGTA, 2 mM
MgCl2, pH 6.8) for 30 min at 4 C. Cells were
quenched in 1 mg/ml NaBH4 in PEM and
permeabilized for 30 min in 0.5% Triton X-100 in PEM. Coverslips were
blocked for 1 h at room temperature in 5% dry milk in TBST (20
mM Tris-HCl, 150 mM NaCl,
0.1% Tween 20, pH 7.4) and incubated for 2 h at room temperature
with primary mouse monoclonal anti-ERnt diluted 1:2000 in blocking
buffer. Splicing domains were labeled with the SRm160 antibody
[diluted 1:10; Blencowe et al. (36)]. Transcription
sites were labeled with antiphosphorylated RNA pol II (RNA pol IIo;
diluted 1:4). Primary antibodies were detected using the appropriate
Texas Red or FITC-conjugated secondary antibodies (1:600;
Southern Biotechnology Associates) recognizing
mouse or rabbit primary antibodies. Cells were counterstained for 1 min
in 4,6-diamidino-2-phenylindole (1 µg/ml) in TBST and mounted
in Slow Fade reagent (Molecular Probes, Inc., Eugene,
OR).
Immunoblotting
After hormone addition, cells were lysed in 1x Laemmli
sample buffer and samples (
2 x 105 cells
per well) were electrophoresed on a 10% SDS-PAGE gel and transferred
to Immobilon (Millipore Corp., Bedford, MA) using a liquid
transfer apparatus (Bio-Rad Laboratories, Inc., Hercules,
CA). The membrane was blocked for 1 h in 5% dry milk in TBST,
incubated with anti-ERnt mouse monoclonal antibody (0.1 µg/ml) for
2 h, washed in TBST, incubated with horse radish
peroxidase-conjugated secondary antibody (1:2000; Pierce Chemical Co., Rockford, IL) for 1 h, and washed in TBST. Signal was
detected using the enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Arlington Heights, IL).
Preparation of Core NM
HeLa and MCF-7 cells were extracted using established protocols
(22, 52, 69) while attached to poly-D-lysine-coated
substrates. Cells were washed in PBS and sequentially treated in the
following manner. Soluble proteins were extracted by treatment for 3
min with ice-cold CSK buffer (10 mM
piperazine-N,N'-bis(2-ethanesulfonic acid), 300
mM sucrose, 100 mM NaCl, 3
mM MgCl2, 0.5% Triton
X-100, pH 6.80) containing protease inhibitors (aprotinin, leupeptin,
pepstatin A, antipain, phenylmethylsulfonyl fluoride) and
vanadyl ribonucleoside complex (VRC). Chromatin was removed by
digesting with RNAse-free DNase I (400 U/ml; Roche Molecular Biochemicals, Indianapolis, IN) in digestion buffer (same as CSK
but with 50 mM NaCl) containing protease
inhibitors and VRC for 50 min at 32 C. The DNase I digestion buffer was
removed and replaced with 187.5 µl of fresh digestion buffer and 1
M ammonium sulfate was added slowly, drop-wise,
to a final concentration of 0.25 M and cells were
incubated for 5 min at room temperature. The ammonium sulfate was
removed and replaced with 125 µl of digestion buffer, 4
M NaCl in digestion buffer was added to a final
concentration of 2 M NaCl and cells were
incubated 5 min at room temperature. Cells were washed twice in
digestion buffer and either fixed in 4% formaldehyde in digestion
buffer or lysed in SDS-PAGE sample buffer for Western blot analysis.
For CSK-fixed cells, cells were extracted for 3 min in CSK buffer
followed by fixation in 4% formaldehyde in CSK buffer. For the Western
blot analysis shown in Fig. 4
, equivalent samples of unextracted cells
(whole), CSK supernatant (CSK), DNase I supernatant, ammonium sulfate
supernatant, NaCl supernatant, and NM-extracted cells were loaded.
Fluorescent and Deconvolution Microscopy
Conventional immunofluorescence microscopy and differential
interference contrast microscopy were performed using a
Carl Zeiss (Thornwood, NY) AxioPhot microscope.
Deconvolution microscopy was performed on a Carl Zeiss
AxioVert S100 TV microscope and a DeltaVision Restoration Microscopy
System (Applied Precision, Inc., Issaquah, WA). A Z-series of
focal planes were digitally imaged and deconvolved with the DeltaVision
constrained iterative algorithm (46, 47) to generate high resolution
images. All image files were digitally processed for presentation using
Adobe Photoshop and printed at 300 dots per inch using a Codonics NP
1600 dye diffusion printer (Codonics, Inc., Middleburg Heights,
OH).
Live Microscopy
Live microscopy was performed on cells transfected with
GFP-ER
(Figs. 2
, 3
, and 5
) or CFP-ER
and fluorescent SRC-1
plasmids (
Figs. 79![]()
![]()
). Cells were grown on 40- mm coverslips in 60-mm
plates and transfected with 2.5 mg of each test plasmid using the
calcium phosphate transfection procedure. After the dimethylsulfoxide
shock, cells were allowed to recover for 48 h and were transferred to
a live cell, closed chamber (Bioptechs, Inc., Butler, PA) and
maintained in DMEM with 5% stripped FBS at 37 C. This medium was
recirculated using a peristaltic pump to which ligand was added after
the 0 time point exposure. To minimize photo damage, cells were imaged
using neutral density filters to allow only 30% of the total light and
1 sec exposure times. Focal planes were limited to approximately 5 per
cell and used to create three-dimensional reconstructions. Images were
taken at 5-min intervals in Fig. 3
, and every other time point (10-min
interval) is shown. To perform real time detergent extractions shown in
Figs. 5
and 8
, CSK buffer with 0.5% Triton X-100 was circulated into
the cell chamber for 3 min at room temperature. To perform full-scale
NM preps, cells were extracted with CSK buffer as above before buffer
containing DNase I was circulated into the chamber and remained for 50
min at 32 C. Digested chromatin was removed by sequentially circulating
buffer containing 0.25 M ammonium sulfate and 2.0
M NaCl. All extraction buffers were replaced with CSK
buffer without detergent before imaging as Triton X-100 partially
quenched GFP fluorescence.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by NIH Grant RO1 DK-55622 and a National American Heart Association Scientist Development Award (9630033N) to M.A.M., an NIH postdoctoral fellowship to D.L.S. (1F32DK09787), NIH RO1 DK-53002 to C.L.S., and funds from the Department of Cell Biology, Baylor College of Medicine.
Received for publication July 26, 1999. Revision received December 21, 1999. Accepted for publication December 28, 1999.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. J. Lee, C. Chae, and M. M. Wang p150/Glued Modifies Nuclear Estrogen Receptor Function Mol. Endocrinol., May 1, 2009; 23(5): 620 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Picard, C. Charbonneau, M. Sanchez, A. Licznar, M. Busson, G. Lazennec, and A. Tremblay Phosphorylation of Activation Function-1 Regulates Proteasome-Dependent Nuclear Mobility and E6-Associated Protein Ubiquitin Ligase Recruitment to the Estrogen Receptor {beta} Mol. Endocrinol., February 1, 2008; 22(2): 317 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Damdimopoulos, G. Spyrou, and J.-A. Gustafsson Ligands Differentially Modify the Nuclear Mobility of Estrogen Receptors {alpha} and Endocrinology, January 1, 2008; 149(1): 339 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Wittmann, A. Sherk, and D. P. McDonnell Definition of Functionally Important Mechanistic Differences among Selective Estrogen Receptor Down-regulators Cancer Res., October 1, 2007; 67(19): 9549 - 9560. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Amazit, L. Pasini, A. T. Szafran, V. Berno, R.-C. Wu, M. Mielke, E. D. Jones, M. G. Mancini, C. A. Hinojos, B. W. O'Malley, et al. Regulation of SRC-3 Intercompartmental Dynamics by Estrogen Receptor and Phosphorylation Mol. Cell. Biol., October 1, 2007; 27(19): 6913 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Penttinen, J. Jaehrling, A. E. Damdimopoulos, J. Inzunza, J. G. Lemmen, P. van der Saag, K. Pettersson, G. Gauglitz, S. Makela, and I. Pongratz Diet-Derived Polyphenol Metabolite Enterolactone Is a Tissue-Specific Estrogen Receptor Activator Endocrinology, October 1, 2007; 148(10): 4875 - 4886. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qiu, Y. Huang, G. Chen, Z. Chen, D. J. Tweardy, and S. Dong Aberrant Chromatin Remodeling by Retinoic Acid Receptor {alpha} Fusion Proteins Assessed at the Single-Cell Level Mol. Biol. Cell, October 1, 2007; 18(10): 3941 - 3951. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nonclercq, F. Journe, I. Laios, C. Chaboteaux, R.-A. Toillon, G. Leclercq, and G. Laurent Effect of nuclear export inhibition on estrogen receptor regulation in breast cancer cells J. Mol. Endocrinol., August 1, 2007; 39(2): 105 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez, K. Sauve, N. Picard, and A. Tremblay The Hormonal Response of Estrogen Receptor beta Is Decreased by the Phosphatidylinositol 3-Kinase/Akt Pathway via a Phosphorylation-dependent Release of CREB-binding Protein J. Biol. Chem., February 16, 2007; 282(7): 4830 - 4840. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, R.-C. Wu, L. Amazit, S. Y. Tsai, M.-J. Tsai, and B. W. O'Malley Specific Amino Acid Residues in the Basic Helix-Loop-Helix Domain of SRC-3 Are Essential for Its Nuclear Localization and Proteasome-Dependent Turnover Mol. Cell. Biol., February 15, 2007; 27(4): 1296 - 1308. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Padron, L. Li, E. M. Kofoed, and F. Schaufele Ligand-Selective Interdomain Conformations of Estrogen Receptor-{alpha} Mol. Endocrinol., January 1, 2007; 21(1): 49 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Arnett-Mansfield, J. D. Graham, A. R. Hanson, P. A. Mote, A. Gompel, L. L. Scurr, N. Gava, A. de Fazio, and C. L. Clarke Focal Subnuclear Distribution of Progesterone Receptor Is Ligand Dependent and Associated with Transcriptional Activity Mol. Endocrinol., January 1, 2007; 21(1): 14 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. D. Sharp, M. G. Mancini, C. A. Hinojos, F. Dai, V. Berno, A. T. Szafran, K. P. Smith, T. T. Lele, D. E. Ingber, and M. A. Mancini Estrogen-receptor-{alpha} exchange and chromatin dynamics are ligand- and domain-dependent J. Cell Sci., October 1, 2006; 119(19): 4101 - 4116. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, H. Kawate, K. Ohnaka, H. Nawata, and R. Takayanagi Nuclear Compartmentalization of N-CoR and Its Interactions with Steroid Receptors. Mol. Cell. Biol., September 1, 2006; 26(17): 6633 - 6655. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. M. Schaaf, L. Willetts, B. P. Hayes, B. Maschera, E. Stylianou, and S. N. Farrow The Relationship between Intranuclear Mobility of the NF-{kappa}B Subunit p65 and Its DNA Binding Affinity J. Biol. Chem., August 4, 2006; 281(31): 22409 - 22420. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Grenier, A. Trousson, A. Chauchereau, J. Cartaud, M. Schumacher, and C. Massaad Differential Recruitment of p160 Coactivators by Glucocorticoid Receptor between Schwann Cells and Astrocytes Mol. Endocrinol., February 1, 2006; 20(2): 254 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M-B Debril, L Dubuquoy, J-N Feige, W Wahli, B Desvergne, J Auwerx, and L Gelman Scaffold attachment factor B1 directly interacts with nuclear receptors in living cells and represses transcriptional activity J. Mol. Endocrinol., December 1, 2005; 35(3): 503 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Chen, L.-J. Juan, and B.-c. Chung SF-1 (Nuclear Receptor 5A1) Activity Is Activated by Cyclic AMP via p300-Mediated Recruitment to Active Foci, Acetylation, and Increased DNA Binding Mol. Cell. Biol., December 1, 2005; 25(23): 10442 - 10453. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fan, A. Park, and K. P. Nephew CHIP (Carboxyl Terminus of Hsc70-Interacting Protein) Promotes Basal and Geldanamycin-Induced Degradation of Estrogen Receptor-{alpha} Mol. Endocrinol., December 1, 2005; 19(12): 2901 - 2914. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawate, Y. Wu, K. Ohnaka, R.-H. Tao, K.-i. Nakamura, T. Okabe, T. Yanase, H. Nawata, and R. Takayanagi Impaired Nuclear Translocation, Nuclear Matrix Targeting, and Intranuclear Mobility of Mutant Androgen Receptors Carrying Amino Acid Substitutions in the Deoxyribonucleic Acid-Binding Domain Derived from Androgen Insensitivity Syndrome Patients J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6162 - 6169. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Zheng, R.-C. Wu, C. L. Smith, and B. W. O'Malley Rapid Estrogen-Induced Phosphorylation of the SRC-3 Coactivator Occurs in an Extranuclear Complex Containing Estrogen Receptor Mol. Cell. Biol., September 15, 2005; 25(18): 8273 - 8284. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller Antiandrogens prevent stable DNA-binding of the androgen receptor J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takahashi, M. Ohmichi, J. Kawagoe, C. Ohshima, M. Doshida, T. Ohta, M. Saitoh, A. Mori-Abe, B. Du, H. Igarashi, et al. Growth Factors Change Nuclear Distribution of Estrogen Receptor-{alpha} via Mitogen-Activated Protein Kinase or Phosphatidylinositol 3-Kinase Cascade in a Human Breast Cancer Cell Line Endocrinology, September 1, 2005; 146(9): 4082 - 4089. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, J.-M. Sun, L. Li, and J. R. Davie Differential Intranuclear Organization of Transcription Factors Sp1 and Sp3 Mol. Biol. Cell, September 1, 2005; 16(9): 4073 - 4083. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Valley, R. Metivier, N. M. Solodin, A. M. Fowler, M. T. Mashek, L. Hill, and E. T. Alarid Differential Regulation of Estrogen-Inducible Proteolysis and Transcription by the Estrogen Receptor {alpha} N Terminus Mol. Cell. Biol., July 1, 2005; 25(13): 5417 - 5428. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Day and F. Schaufele Imaging Molecular Interactions in Living Cells Mol. Endocrinol., July 1, 2005; 19(7): 1675 - 1686. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. M. Schaaf, L. J. Lewis-Tuffin, and J. A. Cidlowski Ligand-Selective Targeting of the Glucocorticoid Receptor to Nuclear Subdomains Is Associated with Decreased Receptor Mobility Mol. Endocrinol., June 1, 2005; 19(6): 1501 - 1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Feige, L. Gelman, C. Tudor, Y. Engelborghs, W. Wahli, and B. Desvergne Fluorescence Imaging Reveals the Nuclear Behavior of Peroxisome Proliferator-activated Receptor/Retinoid X Receptor Heterodimers in the Absence and Presence of Ligand J. Biol. Chem., May 6, 2005; 280(18): 17880 - 17890. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Singh, C. Song, Z. Yang, and R. Kumar Nuclear Localization and Chromatin Targets of p21-activated Kinase 1 J. Biol. Chem., May 6, 2005; 280(18): 18130 - 18137. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Narayanan, D. P. Edwards, and N. L. Weigel Human Progesterone Receptor Displays Cell Cycle-Dependent Changes in Transcriptional Activity Mol. Cell. Biol., April 15, 2005; 25(8): 2885 - 2898. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, R. Barhoumi, R. Burghardt, and S. Safe Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer Mol. Endocrinol., April 1, 2005; 19(4): 843 - 854. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Ruas, L. Poellinger, and T. Pereira Role of CBP in regulating HIF-1-mediated activation of transcription J. Cell Sci., January 15, 2005; 118(2): 301 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wu, R. Burghardt, and S. Safe Vitamin D-interacting Protein 205 (DRIP205) Coactivation of Estrogen Receptor {alpha} (ER{alpha}) Involves Multiple Domains of Both Proteins J. Biol. Chem., December 17, 2004; 279(51): 53602 - 53612. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cui, M. Zhang, R. Pestell, E. M. Curran, W. V. Welshons, and S. A. W. Fuqua Phosphorylation of Estrogen Receptor {alpha} Blocks Its Acetylation and Regulates Estrogen Sensitivity Cancer Res., December 15, 2004; 64(24): 9199 - 9208. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Narayanan, V. A. T. Sepulveda, M. Falzon, and N. L. Weigel The Functional Consequences of Cross-talk between the Vitamin D Receptor and ERK Signaling Pathways Are Cell-specific J. Biol. Chem., November 5, 2004; 279(45): 47298 - 47310. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Nair, S. K. Mishra, Z. Yang, S. Balasenthil, R. Kumar, and R. K. Vadlamudi Potential Role of a Novel Transcriptional Coactivator PELP1 in Histone H1 Displacement in Cancer Cells Cancer Res., September 15, 2004; 64(18): 6416 - 6423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Damdimopoulos, A. Miranda-Vizuete, E. Treuter, J.-A. Gustafsson, and G. Spyrou An Alternative Splicing Variant of the Selenoprotein Thioredoxin Reductase Is a Modulator of Estrogen Signaling J. Biol. Chem., September 10, 2004; 279(37): 38721 - 38729. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dong, D. L. Stenoien, J. Qiu, M. A. Mancini, and D. J. Tweardy Reduced Intranuclear Mobility of APL Fusion Proteins Accompanies Their Mislocalization and Results in Sequestration and Decreased Mobility of Retinoid X Receptor {alpha} Mol. Cell. Biol., May 15, 2004; 24(10): 4465 - 4475. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Botos, W. Xian, D. F. Smith, and C. L. Smith Progesterone Receptor Deficient in Chromatin Binding Has an Altered Cellular State J. Biol. Chem., April 9, 2004; 279(15): 15231 - 15239. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Elbi, D. A. Walker, G. Romero, W. P. Sullivan, D. O. Toft, G. L. Hager, and D. B. DeFranco Molecular chaperones function as steroid receptor nuclear mobility factors PNAS, March 2, 2004; 101(9): 2876 - 2881. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Arnett-Mansfield, A. deFazio, P. A. Mote, and C. L. Clarke Subnuclear Distribution of Progesterone Receptors A and B in Normal and Malignant Endometrium J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1429 - 1442. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Smith and B. W. O'Malley Coregulator Function: A Key to Understanding Tissue Specificity of Selective Receptor Modulators Endocr. Rev., February 1, 2004; 25(1): 45 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Lonard, S. Y. Tsai, and B. W. O'Malley Selective Estrogen Receptor Modulators 4-Hydroxytamoxifen and Raloxifene Impact the Stability and Function of SRC-1 and SRC-3 Coactivator Proteins Mol. Cell. Biol., January 1, 2004; 24(1): 14 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ochiai, K.-i. Matsuda, M. Nishi, H. Ozawa, and M. Kawata Imaging Analysis of Subcellular Correlation of Androgen Receptor and Estrogen Receptor {alpha} in Single Living Cells Using Green Fluorescent Protein Color Variants Mol. Endocrinol., January 1, 2004; 18(1): 26 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Marsaud, A. Gougelet, S. Maillard, and J.-M. Renoir Various Phosphorylation Pathways, Depending on Agonist and Antagonist Binding to Endogenous Estrogen Receptor {alpha} (ER{alpha}), Differentially Affect ER{alpha} Extractability, Proteasome-Mediated Stability, and Transcriptional Activity in Human Breast Cancer Cells Mol. Endocrinol., October 1, 2003; 17(10): 2013 - 2027. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Pilipuk, M. D. Galigniana, and J. Schwartz Subnuclear Localization of C/EBP{beta} Is Regulated by Growth Hormone and Dependent on MAPK J. Biol. Chem., September 12, 2003; 278(37): 35668 - 35677. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ben-Yehoyada, I. Ben-Dor, and Y. Shaul c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association J. Biol. Chem., September 5, 2003; 278(36): 34475 - 34482. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Amazit, Y. Alj, R. K. Tyagi, A. Chauchereau, H. Loosfelt, C. Pichon, J. Pantel, E. Foulon-Guinchard, P. Leclerc, E. Milgrom, et al. Subcellular Localization and Mechanisms of Nucleocytoplasmic Trafficking of Steroid Receptor Coactivator-1 J. Biol. Chem., August 22, 2003; 278(34): 32195 - 32203. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. De Bosscher, W. Vanden Berghe, and G. Haegeman The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression Endocr. Rev., August 1, 2003; 24(4): 488 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Alarid, M. T. Preisler-Mashek, and N. M. Solodin Thyroid Hormone Is an Inhibitor of Estrogen-Induced Degradation of Estrogen Receptor-{alpha} Protein: Estrogen-Dependent Proteolysis Is Not Essential for Receptor Transactivation Function in the Pituitary Endocrinology, August 1, 2003; 144(8): 3469 - 3476. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, L. Liao, S.-Q. Kuang, and J. Xu Spatial Distribution of the Messenger Ribonucleic Acid and Protein of the Nuclear Receptor Coactivator, Amplified in Breast Cancer-3, in Mice Endocrinology, April 1, 2003; 144(4): 1435 - 1443. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dan, J. C. Y. Cheung, D. R. L. Scriven, and E. D. W. Moore Epitope-dependent localization of estrogen receptoralpha , but not -beta , in en face arterial endothelium Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1295 - H1306. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. M. Schaaf and J. A. Cidlowski Molecular Determinants of Glucocorticoid Receptor Mobility in Living Cells: the Importance of Ligand Affinity Mol. Cell. Biol., March 15, 2003; 23(6): 1922 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Day, T. C. Voss, J. F. Enwright III, C. F. Booker, A. Periasamy, and F. Schaufele Imaging the Localized Protein Interactions Between Pit-1 and the CCAAT/Enhancer Binding Protein {alpha} in the Living Pituitary Cell Nucleus Mol. Endocrinol., March 1, 2003; 17(3): 333 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kino and G. P. Chrousos Tumor Necrosis Factor alpha Receptor- and Fas-associated FLASH Inhibit Transcriptional Activity of the Glucocorticoid Receptor by Binding to and Interfering with Its Interaction with p160 Type Nuclear Receptor Coactivators J. Biol. Chem., January 24, 2003; 278(5): 3023 - 3029. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Figtree, D. McDonald, H. Watkins, and K. M. Channon Truncated Estrogen Receptor {alpha} 46-kDa Isoform in Human Endothelial Cells: Relationship to Acute Activation of Nitric Oxide Synthase Circulation, January 7, 2003; 107(1): 120 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J. Rivera, C. S. Song, V. E. Centonze, J. D. Lechleiter, B. Chatterjee, and A. K. Roy Role of the Promyelocytic Leukemia Body in the Dynamic Interaction between the Androgen Receptor and Steroid Receptor Coactivator-1 in Living Cells Mol. Endocrinol., January 1, 2003; 17(1): 128 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Ruas, L. Poellinger, and T. Pereira Functional Analysis of Hypoxia-inducible Factor-1alpha -mediated Transactivation. IDENTIFICATION OF AMINO ACID RESIDUES CRITICAL FOR TRANSCRIPTIONAL ACTIVATION AND/OR INTERACTION WITH CREB-BINDING PROTEIN J. Biol. Chem., October 4, 2002; 277(41): 38723 - 38730. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Matsuda, I. Ochiai, M. Nishi, and M. Kawata Colocalization and Ligand-Dependent Discrete Distribution of the Estrogen Receptor (ER){alpha} and ER{beta} Mol. Endocrinol., October 1, 2002; 16(10): 2215 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-B. Lazaro, P. J. Bailey, and A. B. Lassar Cyclin D-cdk4 activity modulates the subnuclear localization and interaction of MEF2 with SRC-family coactivators during skeletal muscle differentiation Genes & Dev., July 15, 2002; 16(14): 1792 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. DeFranco Navigating Steroid Hormone Receptors through the Nuclear Compartment Mol. Endocrinol., July 1, 2002; 16(7): 1449 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vottero, T. Kino, H. Combe, P. Lecomte, and G. P. Chrousos A Novel, C-Terminal Dominant Negative Mutation of the GR Causes Familial Glucocorticoid Resistance through Abnormal Interactions with p160 Steroid Receptor Coactivators J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2658 - 2667. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Nye, R. R. Rajendran, D. L. Stenoien, M. A. Mancini, B. S. Katzenellenbogen, and A. S. Belmont Alteration of Large-Scale Chromatin Structure by Estrogen Receptor Mol. Cell. Biol., May 15, 2002; 22(10): 3437 - 3449. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Mulholland, H. Cheng, K. Reid, P. S. Rennie, and C. C. Nelson The Androgen Receptor Can Promote beta -Catenin Nuclear Translocation Independently of Adenomatous Polyposis Coli J. Biol. Chem., May 10, 2002; 277(20): 17933 - 17943. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lloyd, R. C. Trembath, and S. Shackleton A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies Hum. Mol. Genet., April 1, 2002; 11(7): 769 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Saitoh, R. Takayanagi, K. Goto, A. Fukamizu, A. Tomura, T. Yanase, and H. Nawata The Presence of Both the Amino- and Carboxyl-Terminal Domains in the AR Is Essential for the Completion of a Transcriptionally Active Form with Coactivators and Intranuclear Compartmentalization Common to the Steroid Hormone Receptors: A Three-Dimensional Imaging Study Mol. Endocrinol., April 1, 2002; 16(4): 694 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Akiyama, C. T. Baumann, S. Sakai, G. L. Hager, and F. J. Gonzalez Selective Intranuclear Redistribution of PPAR Isoforms by RXR{alpha} Mol. Endocrinol., April 1, 2002; 16(4): 707 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Weatherman, C.-Y. Chang, N. J. Clegg, D. C. Carroll, R. N. Day, J. D. Baxter, D. P. McDonnell, T. S. Scanlan, and F. Schaufele Ligand-Selective Interactions of ER Detected in Living Cells by Fluorescence Resonance Energy Transfer Mol. Endocrinol., March 1, 2002; 16(3): 487 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. AEsoy, G. Mellgren, K.-I. Morohashi, and J. Lund Activation of cAMP-Dependent Protein Kinase Increases the Protein Level of Steroidogenic Factor-1 Endocrinology, January 1, 2002; 143(1): 295 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Schaufele, J. F. Enwright III, X. Wang, C. Teoh, R. Srihari, R. Erickson, O. A. MacDougald, and R. N. Day CCAAT/Enhancer Binding Protein {alpha} Assembles Essential Cooperating Factors in Common Subnuclear Domains Mol. Endocrinol., October 1, 2001; 15(10): 1665 - 1676. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Sunn, T.-A. Cock, L. A. Crofts, J. A. Eisman, and E. M. Gardiner Novel N-Terminal Variant of Human VDR Mol. Endocrinol., September 1, 2001; 15(9): 1599 - 1609. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Stenoien, A. C. Nye, M. G. Mancini, K. Patel, M. Dutertre, B. W. O'Malley, C. L. Smith, A. S. Belmont, and M. A. Mancini Ligand-Mediated Assembly and Real-Time Cellular Dynamics of Estrogen Receptor {alpha}-Coactivator Complexes in Living Cells Mol. Cell. Biol., July 1, 2001; 21(13): 4404 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Yen Physiological and Molecular Basis of Thyroid Hormone Action Physiol Rev, July 1, 2001; 81(3): 1097 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Choi, J. Pratap, A. Javed, S. K. Zaidi, L. Xing, E. Balint, S. Dalamangas, B. Boyce, A. J. van Wijnen, J. B. Lian, et al. Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development PNAS, June 28, 2001; (2001) 151236498. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pasqualini, D. Guivarc'h, J.-V. Barnier, B. Guibert, J.-D. Vincent, and P. Vernier Differential Subcellular Distribution and Transcriptional Activity of {{Sigma}}E3, {{Sigma}}E4, and {{Sigma}}E3-4 Isoforms of the Rat Estrogen Receptor-{{alpha}} Mol. Endocrinol., June 1, 2001; 15(6): 894 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Price Jr., C. A. Butler, P. Webb, R. Uht, P. Kushner, and R. J. Handa A Splice Variant of Estrogen Receptor {beta} Missing Exon 3 Displays Altered Subnuclear Localization and Capacity for Transcriptional Activation Endocrinology, May 1, 2001; 142(5): 2039 - 2049. [Abstract] [Full Text] |
||||
![]() |
C. Herrmann and M. Mancini The Cdk9 and cyclin T subunits of TAK/P-TEFb localize to splicing factor-rich nuclear speckle regions J. Cell Sci., January 4, 2001; 114(8): 1491 - 1503. [Abstract] [PDF] |
||||
![]() |
J Nickerson Experimental observations of a nuclear matrix J. Cell Sci., January 2, 2001; 114(3): 463 - 474. [Abstract] [PDF] |
||||
![]() |
F. Schaufele, C.-y. Chang, W. Liu, J. D. Baxter, S. K. Nordeen, Y. Wan, R. N. Day, and D. P. McDonnell Temporally Distinct and Ligand-Specific Recruitment of Nuclear Receptor-Interacting Peptides and Cofactors to Subnuclear Domains Containing the Estrogen Receptor Mol. Endocrinol., December 1, 2000; 14(12): 2024 - 2039. [Abstract] [Full Text] |
||||
![]() |
R. K. Tyagi, Y. Lavrovsky, S. C. Ahn, C. S. Song, B. Chatterjee, and A. K. Roy Dynamics of Intracellular Movement and Nucleocytoplasmic Recycling of the Ligand-Activated Androgen Receptor in Living Cells Mol. Endocrinol., August 1, 2000; 14(8): 1162 - 1174. [Abstract] [Full Text] |
||||
![]() |
K. Prufer, A. Racz, G. C. Lin, and J. Barsony Dimerization with Retinoid X Receptors Promotes Nuclear Localization and Subnuclear Targeting of Vitamin D Receptors J. Biol. Chem., December 22, 2000; 275(52): 41114 - 41123. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Baumann, P. Maruvada, G. L. Hager, and P. M. Yen Nuclear Cytoplasmic Shuttling by Thyroid Hormone Receptors. MULTIPLE PROTEIN INTERACTIONS ARE REQUIRED FOR NUCLEAR RETENTION J. Biol. Chem., March 30, 2001; 276(14): 11237 - 11245. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tomura, K. Goto, H. Morinaga, M. Nomura, T. Okabe, T. Yanase, R. Takayanagi, and H. Nawata The Subnuclear Three-dimensional Image Analysis of Androgen Receptor Fused to Green Fluorescence Protein J. Biol. Chem., July 20, 2001; 276(30): 28395 - 28401. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Sun, H. Y. Chen, and J. R. Davie Effect of Estradiol on Histone Acetylation Dynamics in Human Breast Cancer Cells J. Biol. Chem., December 21, 2001; 276(52): 49435 - 49442. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Choi, J. Pratap, A. Javed, S. K. Zaidi, L. Xing, E. Balint, S. Dalamangas, B. Boyce, A. J. van Wijnen, J. B. Lian, et al. Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development PNAS, July 17, 2001; 98(15): 8650 - 8655. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Preisler-Mashek, N. Solodin, B. L. Stark, M. K. Tyriver, and E. T. Alarid Ligand-specific regulation of proteasome-mediated proteolysis of estrogen receptor-alpha Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E891 - E898. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |