help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Northrop, J. P.
Right arrow Articles by Schatz, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Northrop, J. P.
Right arrow Articles by Schatz, P. J.
Molecular Endocrinology 14 (5): 605-622
Copyright © 2000 by The Endocrine Society

Selection of Estrogen Receptor ß- and Thyroid Hormone Receptor ß-Specific Coactivator-Mimetic Peptides Using Recombinant Peptide Libraries

Jeffrey P. Northrop, Dee Nguyen, Sunila Piplani, Susan E. Olivan, Stephen T-S. Kwan, Ning Fei Go, Charles P. Hart and Peter J. Schatz

Affymax Research Institute Santa Clara, California 95051


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroid and thyroid hormone receptors are members of the superfamily of nuclear receptors (NR) that participate in developmental and homeostatic mechanisms by changes in the transcription of specific genes. These activities are governed by the receptors’ cognate ligands and through interaction with the components of the transcriptional machinery. A number of coactivator molecules of the steroid receptor coactivator (SRC)/nuclear receptor coactivator (NCoA) family interact with activation functions within NRs through a conserved region containing helical domains of a core LXXLL sequence and, thereby, participate in transcriptional regulation. Using a mammalian-two-hybrid assay, we show that the thyroid hormone receptor ß (TRß) and estrogen receptor ß (ERß) have different LXXLL motif preferences for interactions with SRC-1. Using large random and focused (centered on the LXXLL motif) recombinant peptide diversity libraries, we have obtained novel peptide sequences that interact specifically with ERß or with TRß in a ligand-dependent manner. Random sequence libraries yielded LXXLL-containing peptides, and sequence analysis of selected clones revealed that the preferred residues within and around the LXXLL motif vary significantly between these two receptors. We compared the receptor binding of library-selected peptides to that of peptides derived from natural coactivators. The affinities of selected peptides for the ligand binding domains of ERß and TRß were similar to the best natural LXXLL motifs tested, but showed a higher degree of receptor selectivity. These selected peptides also display receptor-selective dominant inhibitory activities when introduced into mammalian cells. Finally, by directed mutations in specific residues, we were able to alter the receptor binding preference of these peptides.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Nuclear receptors (NRs) comprise a family of approximately 70 transcription factors that include the steroid, thyroid hormone, retinoid, and vitamin D3 receptors. These proteins are found broadly in vertebrates and in other nonvertebrate eukaryotes such as nematodes and insects, and function to regulate cellular homeostatic mechanisms, proliferation, differentiation, and death. Generally, these proteins are known to be receptors for extracellularly derived ligands that regulate their activity as transcription factors at specific DNA response elements within promoters. Most NRs bind their cognate DNA elements either as homodimers or as heterodimers with the retinoid X receptor (RXR) (see Refs. 1, 2, 3 and references therein). A large subset of the NRs, while sharing a common set of structural features with the rest of the superfamily, do not have known natural or synthetic ligands and are thus termed orphan receptors. With only limited exceptions, the NRs each contain an amino-terminal A/B domain, a central zinc finger-containing DNA-binding domain, C, a so-called hinge region, D, and a carboxy-terminal ligand binding domain (LBD), E. Early studies with steroid receptors indicated the presence of at least two transcriptional transactivation (AF) domains, one each in the A/B and E regions. While the AF-1 domain, located within the amino-terminal portion of NRs, can function independently of ligand binding, the AF-2 functionality is generally ligand dependent (4, 5, 6). Crystal structures of several NR LBDs (7, 8, 9, 10, 11) have revealed a well conserved structure of 12 {alpha}-helices forming a 3-layered structure containing a ligand- binding cavity that is almost entirely buried within the helices. While several minor structural changes occur upon ligand binding, the highly conserved carboxy-terminal helix 12, which has been shown to be associated with the ligand-dependent AF-2 function (12, 13, 14, 15), appears to occupy quite different positions in apo-, holo-, and antagonist-bound receptors (10, 11). In agonist-bound receptors, helix 12 appears to cap off the ligand-binding pocket, thus stabilizing the holostructure and forming a new potential protein interaction face (7).

Several studies have indicated that the activity of individual NRs can both modulate, and be modulated by, other transcription factors, including other NRs, AP-1, and NF{kappa}B (16, 17, 18, 19, 20, 21, 22), and that stimulation of the protein kinase A pathway can affect NR signaling (23, 24, 25). These findings and others have led to the search for transcriptional coactivator and corepressor molecules which, by forming large, multicomponent complexes with NRs, would be able to integrate and transmit diverse cellular signals to the basal transcriptional machinery. Several classes of NR cofactors have been identified to date (reviewed in Ref. 26). One class of coactivator molecules consists of the CREB-binding protein (CBP) and the related factor p300 (27, 28, 29) which, in addition to functioning in the transcription of both CREB- and AP-1-responsive genes (30), have been shown to function in NR-mediated transcription, and thus have been classified as integrators of multiple signal transduction pathways (31, 32). A second class of proteins of 160 kDa, termed steroid receptor coactivators (SRC) or nuclear receptor coactivators (NCoA), include SRC-1/NCoA-1, TIF2/GRIP/NCoA-2, and RAC3/p/CIP/ACTR/AIB1/TRAM-1 (see Ref. 33 and references therein). These proteins have been shown to interact with NR LBDs and with CBP and p300, and to be directly involved in ligand-dependent transactivation by NRs (31, 34, 35, 36, 37, 38, 39). The SRC family members, as well as CBP and p300, contain highly conserved amino acid sequences of the form LXXLL (where L is leucine and X is any amino acid), which likely form amphipathic {alpha}-helices (37, 40). Three copies of this motif, also called leucine-charged/helical domains or NR boxes, are located in a region of the SRC members capable of hormone-regulated interaction with NRs (nuclear receptor interaction domain, NRID), and additional motifs may allow the assembly of larger multicomponent coactivator complexes. The presence of multiple copies of these NR boxes within coactivators suggests a mechanism whereby signal input and cellular context are varied to allow multiple combinatorial coactivator complexes to be assembled to facilitate flexible but precise transcriptional control (41). Multiple NR-boxes within the NRID of SRC family members could reflect the ability of these proteins to interact with many different NRs or reflect a requirement for multiple cooperative interactions (perhaps with receptor dimers) for efficient association. Inactivation of the SRC-1 gene by gene targeting (42) has shown that there may be at least partial functional redundancy between the SRC family members. The molecular nature of this NR/coactivator interaction mediated by these LXXLL motifs has been a topic of recent intense investigation. Studies thus far have focused mainly on the functional requirements of the three NR boxes within the NRID of the SRC family members. Several studies have shown that different SRC family members may have receptor preferences (43, 44) and that different receptors have differing requirements for one or more intact LXXLL motifs (37, 44, 45, 46, 47). Thus, the stoichiometry of coactivator-receptor interactions may vary significantly for different receptors. In addition, several studies have attempted to determine the residues in and around the LXXLL motifs that are required for receptor interaction. Mutational analysis has shown that the leucine residues are critical for interaction, while residues upstream and downstream of the core motif have more variable contributions (37, 45, 46, 47, 48). In addition, recent studies (47, 49) have suggested that different ligands for the same NR may change the coactivator binding specificity, thus potentially adding a further refinement to transcriptional control through a given receptor.

The use of large random and focused peptide libraries displayed either on phage (reviewed in Refs. 50, 51) or by the peptides-on-plasmids method (52, 53), have allowed the selection of peptides that interact specifically with a variety of molecules including antibodies (54), cytokine and other cell surface receptors (55, 56, 57), SH2 and SH3 domains (58, 59, 60, 61), and proteases and other enzymes (62, 63, 64). In the work presented here, we have chosen to take a different approach to studying the requirements of NR-coactivator interactions by isolating novel peptides that interact with NR LBDs in a receptor and ligand-dependent manner. We show, by mammalian-two-hybrid (M2H) assay, that the estrogen receptor-ß (ERß) and thyroid hormone receptor-ß (TRß) have significantly different NR box preferences when analyzed with fragments of SRC-1. Screening random and focused LacI-fused peptide libraries with ERß, and a focused headpiece dimer (HpD) library (65) with ERß and TRß, allowed the isolation of peptides with both receptor-selective and ligand-dependent properties, as well as peptides that interact well with both receptors. Sequence analysis of these peptides revealed several interesting differences between the peptides preferred by ERß and those preferred by TRß. With a coactivator-dependent scintillation proximity assay (SPA), we determined that the affinities of selected peptides for these two receptors are as high, and in some cases higher, than natural NR box peptides. Expression of selected peptides in mammalian cells resulted in receptor-selective dominant inhibitory activity toward wild-type receptors. Finally, based on observed sequence preferences, we made directed mutations in these peptides to alter their receptor specificity.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
NR Box Motif Preferences for ERß and TRß
Previous studies have demonstrated that SRC-1 is capable of both interaction with, and potentiation of transcription by, the estrogen and thyroid hormone receptors (48, 71, 72, 73). The central NRID contains three copies of a motif variably called leucine charged/helical domain/motif, or NR box, possessing a characteristic {alpha}-helical LXXLL structure where L is leucine and X is any amino acid (37, 40). The aim of our initial studies was to determine whether one or more than one of these NR boxes is necessary for efficient interaction with ligand-activated NRs. Second, we sought to determine whether there are receptor-specific preferences for NR box interactions. As a model system, we chose ERß and TRß because they represent both those NRs that typically homodimerize and bind to palindromic response elements (REs,) and also those that are capable of heterodimerization with the retinoid X receptor and bind to direct repeat REs.

In a cell-based M2H assay, we analyzed various combinations of NR boxes within the central SRC-1 NRID and the first NR-box of CBP (Fig. 1AGo) for interaction with ERß and TRß. Recent observations (37, 47, 48) have indicated that NR box 2 is sufficient for the interaction of SRC-1 with ER{alpha} and that NR box 3 does not interact with ER{alpha} significantly. In contrast to these observations, we found that ERß prefers the presence of at least two motifs (1+2 > 2+3) for interaction comparable to that observed when all three motifs are present (Fig. 1BGo). NR box 2, however, does appear most important for this interaction. TRß requires both the NR boxes 2 and 3 for efficient interaction while 1+2 interacts very poorly (Fig. 1CGo). Thus, the NR box preference for TRß is substantially different from that of ERß. The interaction of the amino terminus of CBP with these receptors was minimal as compared with the interaction with the SRC-1 NRID (Fig. 1Go, B and C). We conclude that ERß and TRß interact minimally or not at all with the amino terminus of CBP.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. M2H Analysis of SRC-1 and CBP Interactions with ERß and TRß

A, Diagram of the structure of full-length human SRC-1 showing the basic helix-loop-helix/PAS domain, the NRID, and the CBP/p300 interaction domain (top). Transcriptional activation domains (AD1 and AD2) are shown. Fusions of the SRC-1 NRID (1+2+3) or parts thereof (middle) or the amino terminus of mouse CBP (bottom) to either the yeast Gal4 DNA binding domain or to MBP. Numbers indicate the amino acid boundaries of the various fragments. The heavy black boxed numbers, 1–3, indicate the positions of the various NR boxes. B and C, Luciferase reporter activity in CHO cells transfected (see Materials and Methods) with a reporter construct, expression vectors for the various SRC-1 or CBP Gal4 fusions shown in panel A, and VP16 fusions to the receptor LBDs from ERß, and TRß, respectively. NS, Nonstimulated; E2, stimulated with estradiol (50 nM); T3, stimulated with T3 (800 nM). Data are expressed as luciferase units normalized to the ß-galactosidase internal control expression. Error bars represent the SD of three individually transfected wells. Mock, No Gal4 construct included.

 
Peptide Libraries Can Be Used To Select NR-Interacting Motifs
Because some receptors appear to require more than one NR box for efficient interaction with a SRC family member, the natural motifs may not be optimal for a given receptor. The number of known natural NR boxes is a somewhat limited subset of reagents to determine optimal receptor binding preferences. To overcome this limitation, we screened large numbers of peptides with the LBDs of ERß and TRß. We chose these two receptors to work with because of their obvious differences in NR box motif preference observed in the M2H studies. We expressed glutathione-S-transferase (GST) fusions of the LBDs in Escherichia coli and purified these proteins (see Materials and Methods). Radioligand binding assays in vitro demonstrated that the fusions were capable of binding estradiol (E2) and T3, respectively (data not shown). As a control, we fused the SRC-1 NRID (residues 597–781, Fig. 1AGo) to maltose binding protein (MBP), purified this protein, and demonstrated ligand-enhanced interaction with ERß (Fig. 2CGo) and TRß (data not shown) in an enzyme-linked immunosorbent assay (ELISA) format.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. ELISA Analysis with Either GST or ER beta LBD Fused to GST (ERß), of Peptides Obtained by Panning LacI Fused Libraries with ERß LBD

A, Anti-LacI ELISA with peptide clones derived from the focused 19 mer (X7LXXLLX7, clone numbers 1–24) or the random 15 mer (clone numbers 25–48) libraries. B, Anti-MBP ELISA with peptides derived from the fourth round output of the above panning transferred to an MBP vector (see Materials and Methods). Control (SRC1+2+3) is the MBPSRC-1 NRID fusion containing three NR boxes shown in Fig. 1AGo. Clones 1–24, focused 19 mer-derived; clones 25–47, random 15 mer-derived. ELISAs in panels A and B are performed in the presence of 1 µM estradiol. C, MBP ELISA with selected peptides tested in panel B above. NS, Non-stimulated; +E2, stimulated with 1 µM estradiol. LacI and MBP fused peptides are assayed as crude bacterial lysates. Data expressed as the mean and SD of two independent wells. D, Sequence (single letter codes) of LacI-fused peptides derived from either the focused 19 mer (X7LXXLLX7), top, or the random 15 mer, bottom. Clone numbers correspond to the clones analyzed in panel A and are ranked according to the observed ELISA signal. Large gray boxes show the position of the conserved Leu residues (with one Met exception in clone number 31). Not all of the peptides from the focused library are 19 mers due to the presence of stop codons.

 
Two LacI-fused peptide libraries (52) were used, a random 15-mer containing 1.3 x 1010 members and a focused library of structure X7LXXLLX7, containing 3.5 x 109 members, where L is leucine and X is any amino acid. We started with LacI-based libraries because they produce a multivalent reagent capable of interacting with target proteins even when there is relatively low affinity. Four rounds of affinity enrichment using immobilized ERß were performed (see Materials and Methods). Twenty-four random isolates from each library were then assayed individually by ELISA using either GST-ERß or GST alone, each in the presence of E2. Many of these LacI-peptide fusions interacted specifically with ERß and not with the control GST (Fig. 2AGo). Sequences of clones derived from the focused library (Fig. 2DGo) revealed patterns quite similar to natural NR box peptides. Charged residues occurred in many positions but notably at +2 and +3 between the Leu residues as in NR box 2 and 3 of the SRC family members. In addition, clones frequently contained Lys, Ile, and Leu at the -1 position as found in SRC NR boxes. More importantly, sequencing of only a few of the random 15 mer-derived peptides revealed that almost all contained LXXLL motifs containing appropriately positioned charged and hydrophobic residues. These results indicated that this method could be used to select appropriate interacting peptides and that the sequence motif most easily selected from a random library closely resembles the natural sequence.

To attempt to rank order peptides more effectively, we transferred the fourth round LacI panning output peptides, in bulk, to an MBP fusion vector and assayed individual clones for their interaction with ERß in the presence of E2 by ELISA. Display of the peptides on MBP should make a monovalent rather than multivalent reagent, leading to a better correlation between affinity of the peptide for the receptor and the observed ELISA signal (53, 65). Many of these clones interacted specifically with ERß, although they gave lower apparent signals compared with MBP SRC-1 NRID, which contains three NR boxes (Fig. 2BGo). Rare clones (M-23 for instance) interacted with GST alone. To determine the ligand dependence of these interactions, we assayed several clones with and without E2. In each case tested, the ERß-specific binding was almost entirely dependent on E2, mimicking the interaction with natural coactivator molecules (Fig. 2CGo). These results indicate that peptide libraries can be used as a rich source of diversity for identifying NR interacting motifs and may have utility in identifying either receptor and/or ligand-selective reagents.

Selection of Receptor-Selective Peptides from HpD Libraries
To improve the affinity of selected peptides and to attempt to differentiate selectivities between receptor types, we constructed a focused X7LXXLLX7 HpD (65) peptide library containing 1.8 x 109 members. The use of HpD-based libraries can result in the isolation of peptides with higher affinity than those derived from intact LacI-based libraries. We panned this focused library on immobilized GST-ERß and GST-TRß fusion proteins. After four rounds of enrichment, we transferred the pooled population of selected peptides to an MBP fusion vector for ELISA analysis. Random peptide clones showed specific binding in the presence of appropriate ligand, to the receptor on which they were selected (Fig. 3Go, A and B). Again, a few clones showed specificity to GST (M-169, M-654, M-682). To determine whether these peptides display receptor selectivity, we tested several clones against both receptors by ELISA (Fig. 3CGo). Four ERß-selected peptides, tested as MBP fusions, displayed remarkable selectivity for ERß with little or no TRß cross-reactivity. Similarly, three (M-607, M-683, and M-693) of four tested TRß-selected peptides displayed a high degree of selectivity for TRß. One peptide, M-655, appeared to bind both TRß and ERß with roughly equal efficacy. Thus, the selection of receptor-selective NR-box mimetics is possible using the peptide library approach.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 3. ELISA Analysis of Clones Derived from a Focused 19 mer (X7LXXLLX7) HpD Library Panned with the ERß LBD or the TRß LBD

A, Anti-MBP ELISA of ERß-derived clones in the presence of 1 µM estradiol, with either GST or GST ERß (ER beta) coated onto plates. B, Anti-MBP ELISA of TRß-derived clones in the presence of 1 µM T3, with either GST or GST TRß (TR beta) coated onto plates. C, Anti-MBP ELISA on selected clones with either GST, ER ß, or TRß coated onto plates in the absence of hormone (-E2, -T3) or in the presence of 1 µM hormone (+E2, +T3). "100" series clones, ERß-derived; "600" series clones, TRß-derived. MBP-fused peptides are assayed as crude bacterial lysates. Data expressed as the mean and SD of two independent wells. D, Sequence of MBP-fused peptides derived from panning the focused 19 mer (X7LXXLLX7) library with ERß (top) or TRß (bottom). Most of these clones are depicted in the ELISA analysis (panels A and B above). Each group of clones is ranked, top to bottom, by ELISA signal. Central gray boxes show position of the three conserved Leu residues. Gray boxes on the left indicate peptides used for purification and further analysis.

 
The sequence of several of these clones revealed some interesting patterns (Fig. 3DGo). As with the peptides isolated with the LacI-based libraries, these peptides, isolated in association with ERß, contain charged residues in the +2 and/or +3 positions. Peptides with the highest ELISA signal and affinity (see below and Table 1Go) for ERß contain a basic residue (R or K) at the +3 position mimicking the natural SRC-1 NR box 2 peptide (Fig. 4CGo). In contrast, the peptides isolated in association with TRß frequently contain Arg in the +2 position, but never at the +3 position, similar to the natural SRC-1 NR box 3 peptide. The M2H results above are consistent with these peptide results in that adding NR box 3 to NR box 2 (SRC2+3) results in a synergistic effect upon apparent association with VP16-TRß while the addition of NR box 1 to NR box 2 (SRC1+2) results in no synergism (Fig. 1cGo). This suggests that while NR box 3 alone is ineffective, it contributes significantly to the interaction of TRß with SRC-1. A second striking feature of the TRß-selected peptides is the heavy bias toward the presence of Pro at the -2 position with hydrophobic residues (L, I, M) at the -1 position. While proline is not in general found at this position in natural NR boxes, it does not preclude binding to ERß as some ERß-selected peptides contain Pro in this position and at least one TRß-selected peptide binds effectively to ERß as well (see below). The bias for hydrophobic residues at the -1 position by ERß is not as strong, allowing basic residues (K, R) to be selected as well. This may reflect the M2H results indicating a relative preference for NR-box 1 (over NR box 3) by ERß and NR box 3 (over NR box 1) by TRß (Fig. 1Go, B and C). The selection of specific residues outside the -2 to +5 positions are more difficult to define for either receptor. Both ERß and TRß select for both positively and negatively charged residues as well as a number of Ser residues in the +6 to +12 region; however, it is also apparent that peptides extending only to the +6 or +7 position can be efficiently selected by these receptors. No apparent consensus appears defined in the -7 to -3 region of the selected peptides.


View this table:
[in this window]
[in a new window]
 
Table 1. Competition Scintillation Proximity Assay for Natural and Library-Selected Coactivator Fragments and Peptides

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Analysis of peptides by SPA

A, Sequences of natural coactivator-derived 19 mer peptides from the three SRC family members and from CBP and p300. B, Control SPA using either ERß (top) or TRß (bottom) and 125I SRC1+2+3 (125I MBP SRC) as the tracer in the presence (+) or absence (-) of 1 µM E2 or T3, respectively. Competition is with cold SRC1+2+3 (MBP SRC). Concentrations of MBP SRC that inhibit 50% of the total tracer binding (IC50) are shown. Inset at top is a magnified scale of ERß in the absence of E2.

 
Determination of Receptor/Coactivator-Mimetic Peptide Interaction Affinities by Radiocompetition Assay
To more accurately characterize the peptides selected from libraries, we chose eight of each population of ERß and TRß selected peptide fusions (gray boxed in Fig. 3DGo) for further analysis. In addition, MBP fusions to several of the SRC-1 fragments used in the initial M2H studies (Fig. 1AGo) were constructed. Finally, for comparison to natural NR boxes, we made MBP fusions to eleven 19 mer peptides derived from the three SRC-1 family members (SRC-1, TIF-2, and RAC-3), and from CBP and p300 (Fig. 4AGo). These MBP-peptide fusions were constructed to mimic the format of the focused X7LXXLLX7 HpD-derived peptides and were purified by affinity chromatography.

We set up a homogeneous binding assay based on SPA using immobilized receptor LBDs and iodinated SRC-1 NRID (SRC1+2+3) as the tracer. Control experiments using unlabeled tracer as the competitor are shown in Fig. 4BGo. Even in the absence of E2, ERß interacts specifically and saturably with the NRID (Fig. 4BGo, top inset). The IC50 for SRC1+2+3 is 21 nM without ligand but decreases ~5 fold to 4.3 nM upon the addition of E2. In addition, as expected from the ELISA experiments (see Fig. 2CGo), the amount of tracer bound to the immobilized receptor increases dramatically with ligand addition. TRß does not interact measurably with the NRID in the absence of ligand (Fig. 4BGo, bottom), consistent with our observation of much lower basal ELISA signals with TRß as compared with ERß (Fig. 3CGo). Addition of ligand to the TRß SPA results in the expected association of the 125I NRID and an IC50 of 5.1 nM for unlabeled SRC1+2+3.

We next used the various MBP fusions described above as competitors in both the ERß/NRID and TRß/NRID SPAs in the presence of E2 and T3, respectively (Exp. 1, Table 1Go). To ensure that affinity and selectivity trends we observed were not artifacts of any one protein preparation, we reisolated a second batch of several of the MBP fusions and repeated all measurements (Exp. 2, Table 1Go). Although there are some quantitative differences between the two protein preparations, the results lead to the same conclusions in each case. As expected, the IC50 values for SRC1+2+3 and SRC2+3 are nearly identical (3–11 nM) for the TRß assay, and these protein fragments are more potent than any natural or synthetic, single NR box-containing peptide, assayed on this receptor. SRC1+2 and SRC2, either as a peptide (19 mer) or fragment (~56 mer), are less potent, consistent with the M2H assays above. Homologous peptides derived from the three SRC-1 family members behave in a similar fashion with TRß. The order of affinity of the three NR boxes in each case is 2 > 3 > 1 suggesting that, at the level of NRID-AF2 interactions, TRß displays no preference for any one of the three SRC-1 family members. Consistent with M2H experiments, the amino-terminal NR box of CBP has relatively poor affinity for TRß (as does the similar sequence from p300). While many of the TRß-selected peptides (M-668, M-673, M-675, and M-683 for instance) have IC50 values similar to the best natural peptides, e.g. SRC2, the ERß-selected peptides have low affinity for TRß. The fold selectivity of the TRß-selected peptides for the TR is always >2, except for M-655, which, by ELISA (Fig. 3CGo), binds to both TRß and ERß. In contrast, most of the natural coactivator-derived peptides have receptor selectivities of only 1- to 2-fold. The observed >1- to 2-fold selectivity of SRC3 for TRß is consistent with the M2H results (Fig. 1CGo).

The interactions of the natural coactivator-derived peptides or SRC-1 fragments with ERß are slightly different than with TRß, as expected. While SRC1+2+3 still has the lowest IC50, there is little difference between the values obtained for SRC1+2 and SRC2+3 on ERß, in contrast to those obtained for TRß. SRC2, in fragment or peptide form, has lower affinity than the fusion proteins containing more than one NR box as predicted by M2H assay (Fig. 1BGo). In addition, the order of affinity of the three NR boxes in each SRC-1 family member for ERß is 2 > 3 = 1. From the data presented in Table 1Go, it is tempting to predict that TIF-2 and RAC-3 would be more effective coactivators of ERß-dependent transcription than SRC-1, as the affinities of the 1 and 3 NR boxes of these proteins are significantly higher than those of the corresponding NR boxes of SRC-1. While previous studies using yeast-two-hybrid systems have shown that an ER LBD is able to interact with the amino terminus of CBP (31) or with the amino-terminal CBP NR-box [albeit poorly compared with the SRC NR boxes (40)], our data suggest that these interactions are of quite low affinity (Fig. 1BGo and Table 1Go). We speculate that the type of assay used to determine NR-coactivator interactions has a significant effect on the interpretation of the results.

Peptides we selected using ERß as the panning reagent show a relatively high degree of selectivity for ERß over TRß (Table 1Go). As with the TRß-selected peptides and TRß, the affinity of the ERß-selected peptides for ERß is similar if not slightly higher than the best natural NR boxes (compare M-180 and M-193 with TIF2, Table 1Go). In addition, similar to the TRß-selected peptides, these individual peptides do not have affinities for ERß that are as high as any of the SRC-1 fragments containing more than one LXXLL motif. The experiments above demonstrate that screening peptide libraries with individual receptors is a successful method for obtaining receptor-selective peptides with affinities equal to or greater than the relatively nonselective natural NR box-derived sequences.

Dominant Negative Activities of Receptor-Selective Peptides
We next asked the question whether peptides that showed receptor-selective binding in vitro would also show selective binding, and therefore competition for natural coactivators, in mammalian cells. Expression of a Gal4-NRID fusion protein, but not Gal4 alone, in CHO cells in the presence of wild-type ERß and an ERE reporter construct dramatically inhibited estradiol-induced transcription, reflecting a potent dominant inhibitory activity (Fig. 5AGo). We tested three Gal4-peptide fusions in this system: The relatively nonselective peptide, SRC2; the ERß-selective peptide, M-193; and the TRß-selective peptide, M-668 (Fig. 6AGo). Using 4 ng/well of expression plasmid, both SRC2 and M-193 peptides inhibited estradiol-induced transcriptional activity as well as the SRC123 (NRID) protein, while M-668 was less effective (Fig. 5BGo, top). Reducing the amount of protein expressed (using 2 ng/well, Fig. 5BGo, bottom) showed that M-193 peptide is more potent than either SRC2 or M-668 as a dominant inhibitor of ERß-directed transcription. These data are consistent with the observed in vitro affinities of the peptides for ERß (Table 1Go). High level expression (2–4 ng/well plasmid) of Gal4 vector alone inhibited transcription by TRß on a TRE-dependent reporter (data not shown). We therefore used low level expression of the peptide fusions to show that M-668 is as potent as SRC2 and that M-193 is the least potent dominant negative inhibitor of TRß, as expected from the binding affinities (Fig. 5CGo and Table 1Go). Therefore, receptor-selective binding results in receptor-selective transcriptional inhibition by these peptides.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. Dominant Negative Effects of the SRC-1 NRID and Selected Peptides

A, Luciferase activity from E2-stimulated CHO cells transfected with ERELuc reporter alone (ERE), with ERE and wild-type ERß (ERE/ERb), with ERE/ERb and either Gal4 vector (Vector) or Gal4SRC-1 NRID (SRC123) described in Fig. 1Go. Four nanograms of vector or SRC123 expression plasmid were used per microtiter well. Luciferase expressed as counts per second normalized to the ß-galactosidase internal control as in Fig. 1Go. B, CHO cells treated as in panel A above but only one E2 concentration of 100 nM (E2) shown or nonstimulated (NS). Control (ERE/ERb alone), or plus 4 ng/well (top) or 2 ng/well (bottom) of the indicated Gal4 construct. Luciferase expressed as percentage of the maximal E2-induced signal of the control. C, Same as in panel B above except that a TRELuc reporter and wild-type TRß was used in each transfection and only 0.33 ng/well of Gal4 construct was used (see Materials and Methods). T3, 800 nM T3. Luciferase expressed as in panel A above. Note the Y-axis does not start at zero.

 


View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. Analysis of Mutations in Natural or Library-Selected Peptides by M2H Assay

A, Sequence of peptides (14 mers or 19 mers) used as Gal4 fusions. To the right of each sequence is its abbreviated name showing one significant residue amino terminal to the first Leu (+1), the two residues at positions +2 and +3, and either one or two significant residues carboxy terminal the the Leu at +5. wt, Wild-type sequence. Mutated residues are shown in bold type, and conserved Leu residues are underlined. B, C, and D, Luciferase activities from CHO cells transiently transfected (see Materials and Methods) with UASTKLuc, the indicated Gal4-peptide fusions (depicted in panel A above), and either VP16ERß (ERb) or VP16TRß (TRb). NS, Nonstimulated; E2 or T3, cells stimulated with 100 nM E2 or 800 nM T3, respectively. Luciferase signals were corrected for ß-galactosidase internal control and expressed as percentages of the signal obtained with the wild-type SRC2 peptide in the presence of hormone (horizontal dashed line indicates 100%). Data are mean and SD of values from two to four independent transfections for each construct.

 
Peptide Mutation Analysis by Mammalian Two-Hybrid Assay
Based on the sequence of peptides selected with the ERß and TRß LBDs, we attempted to switch the receptor specificity of an ERß-selective peptide (M-193) to TRß, a TRß-selective peptide (M-668) to ERß, and a dual specificity peptide (SRC2) toward TRß. The coactivator-derived peptide, SRC2, is relatively nonselective for either receptor (Table 1Go), yet contains several features quite similar to the M-193 ERß-selective peptide such as lack of a proline at the -2 position, presence of a basic residue at the +3 position, and more than one acidic residue carboxy-terminal to the core LXXLL motif. We therefore introduced changes (Fig. 6AGo) directed at specifically enhancing the interaction of this peptide with TRß. Changing the +2 and +3 residues from His-Arg to Arg-Ser (K RS ED), found in several TRß-selected clones (Fig. 3DGo), resulted in an increase in activity with TRß but a moderate drop in activity with ERß (Fig. 6BGo). Substitution of the Lys at -2 with Pro (P HR ED) resulted in increased activity with TRß, as expected, but also an increase in activity with ERß, especially in the absence of hormone. This is consistent with the finding of Pro in this position of some ERß-selected peptides (Fig. 3DGo) and with dual specificity peptides such as M-655 (Fig. 3Go, C and D). Subsequent removal of the carboxy-terminal acidic residues from P HR ED and substitution with Arg and Ser (P HR RS) further increased activity with TRß but decreased activity with ERß as compared with P HR ED (Fig. 6BGo).

Peptide M-668, the most TRß-selective peptide we identified, contains features that, either alone or in combination, could bias its binding away from ERß including a lack of a basic residue at the +3 position, and a lack of an acidic residue at the +7 position. M-668 also contains a Pro at the -2 position, rarely found in ERß-selected peptides, but apparently not detrimental to ERß binding (see above). Substituting this Pro for Ser (S TM G), found in several ERß-selected peptides (Fig. 3DGo), resulted in loss of more than 80% of the interaction with TRß while causing little change in the interaction with ERß (Fig. 6CGo). Subsequently placing a basic residue, Arg, in the +3 position and an acidic residue, Glu, in the +7 position (S TR E) resulted in little further change in binding to either receptor, suggesting that additional features of the peptide preclude a more effective interaction with ERß.

The ERß-selective peptide, M-193, contains features that are common in the ERß-selected peptides but uncommon in the TRß-selected peptides. These include lack of a proline at the -2 position, presence of Arg at the +3 position, and the presence of acidic residues at the +7 or +8, and +12 positions. Changing the two Glu residues at positions +8 and +12 to Arg (S WR RR) dramatically reduced both basal and estradiol-induced interactions with ERß (Fig. 6DGo). As expected, introduction of a Pro residue at the -2 position (P WR EE) slightly increased interaction with TRß but had relatively little effect on interaction with ERß (Fig. 6DGo). Combining these changes with a shift in the position of the basic residue from +3 to +2 (P RS RR) resulted in loss of most of the interaction with ERß but some increased interaction with TRß relative to the wild-type 193 peptide (Fig. 6DGo). The results above suggest that directed mutations can alter the receptor specificity of natural or selected interacting peptides.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Many NRs bind DNA response elements as either homo- or heterodimers; therefore, studies aimed toward defining the function of multiple LXXLL motifs within coactivators, with regard to signal transduction specificity and integration of multiple signal inputs, have been complicated by issues of potential cooperativity and stoichiometry of coactivator binding to NRs. For instance, cocrystalization studies have shown that one coactivator fragment containing two linked LXXLL motifs can bridge across a receptor dimer, binding to both AF2 domains simultaneously (10). However, while some studies with DNA-bound heterodimers, such as TR{alpha}/RXR, suggest that each partner binds to one coactivator molecule (46), other similar studies with RAR/RXR (74) support a model where, again, two LXXLL motifs within one coactivator molecule bridge across the heterodimer. In addition, the potential for more than one site of coactivator interaction within full-length receptors exists, e.g. with both the AF1 and AF2 domains (34, 72). Therefore, while the exact reasons for multiple LXXLL motifs within coactivator molecules are still not well understood, this feature presumably allows for a limited set of coactivators to interact with multiple NRs and/or allows for cooperative interactions between several coactivators and receptor monomers or dimers to form transcriptionally active complexes.

In the study presented here, we have focused on the NR box sequence preferences for hormone-dependent coactivator interactions with ERß and TRß. Using a M2H assay, we analyzed interactions with fragments of the previously defined minimal NR interaction domain containing three NR boxes (37, 40) and found that these two receptors display different preferences for optimal interaction. While the second NR box from SRC-1 (SRC2) alone interacts somewhat with both receptors, the first and third NR boxes are needed but contribute to optimal binding differently for these two receptors. Interestingly, while our results (not shown) and those of others (37, 47, 48) indicate that ER{alpha} requires only the SRC2 NR box for optimal interaction, it appears that ERß requires the addition of a second NR box (preferably SRC1) for efficient interaction with the coactivator. While the M2H data for ERß are consistent with some sort of cooperative interaction when two NR boxes are present, it is difficult at this time to propose that this represents a fundamental difference in the way ER{alpha} and ERß interact with this class of coactivator. The data do, however, support the notion that the two receptors have differing sequence preferences for interacting NR boxes. In further support of this, Chang et al. (75) have recently identified a set of LXXLL peptides containing a Pro in the -2 position, similar to our TRß-selected peptides, that bind well to both TRß and ERß (like peptide M-655) but that bind poorly to ER{alpha}. Like ERß, TRß interacts most strongly with the second NR box on its own but also requires two NR boxes, SRC2+3 in particular, for strong interaction. These observations are consistent with recent findings of others using GRIP, which show that mutation of NR box 3 reduces coactivator function in mammalian cells (44, 45).

We used both random and focused libraries to select novel ERß-interacting peptides. Sequence analysis of peptides derived from a random 15 mer library revealed the presence of LXXLL motifs. This finding is, perhaps, not surprising given that previous studies have demonstrated the importance of the Leu residues for coactivator binding (37, 40). It does, however, demonstrate that, at least in the presence of an agonist ligand, the LXXLL binding site on the receptor is dominant over other possible binding sites in its ability to enrich peptide ligands. Consistent with this notion, in a recent study using E2-bound ER{alpha} as the target and random peptide libraries presented by phage display, LXXLL motifs were also isolated (76).

The position of the LXXLL motif within the random 15 mer clones varies. It is not, however, found in a position that would allow the peptide to be shorter than extending to the +8 or -2 positions. This is consistent with recent peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) and TRß cocrystallization studies with NR box peptides showing that the conserved Glu in helix 12 and Lys in helix 3 form specific hydrogen bonds with residues contained within this peptide length (10, 45). Using a focused, LXXLL-containing library, we found strongly ERß interacting peptides with higher frequency (Fig. 2AGo). When all of the selected LacI-coupled peptides were transferred to an MBP expression vector, the frequency of strongly interacting, receptor-specific clones dropped, consistent with the notion that weakly interacting peptides may not be detected unless they are displayed as a multivalent reagent.

We show by both ELISA and SPA that the SRC-1 NRID can interact with ERß in the absence of hormone but that E2 increases its affinity for ERß by 5-fold. Similarly, many of the ERß-selected peptides also interact with ERß in the absence of estradiol, especially those selected from HpD libraries (Figs. 2cGo and 3cGo). Interestingly, neither the SRC-1 NRID nor the TRß-selected peptides interact with TRß in the absence of T3. This likely represents a fundamental difference in the conformation these two receptors assume in the nonliganded form and is consistent with the ability of the nonliganded TRs to bind corepressor molecules and repress transcription in intact cells (77) while ERs appear to bind corepressors tightly only in the presence of antagonists (78). Importantly, peptides we selected using ERß and LacI fused libraries were, in addition to having some constitutive interaction, also responsive to E2, demonstrating that they have properties very similar to natural coactivators.

Analysis of natural NR box peptides by competition SPA is consistent with the M2H studies and supports the view that NR box 2 interacts most strongly followed by NR box 3>1 for TRß, and NR box 1= 3 for ERß. Some differences between the NR-boxes of the three SRC family members are evident. Ding et al. (44) have suggested that TIF2/GRIP1 may interact with ER{alpha} more strongly than SRC-1. Our SPA data are not inconsistent with this but suggest that RAC-3, in addition, might interact more strongly with ERß (Table 1Go).

We selected peptides that bound preferentially to ERß or TRß in a ligand-dependent manner. The affinities of selected peptides for TRß and ERß were, in general, similar to the best natural coactivator-derived peptides, yet showed a much more consistent degree of selectivity toward the receptor used to isolate them. Although peptides with much higher affinity were not isolated in the current work, the use of specific experimental methods such as more stringent wash conditions or inclusion of low-affinity peptides, could increase the selection or identification of higher affinity peptides. In addition, most selected peptides that interacted well with ERß also interacted with ER{alpha}, and those that interacted well with TRß also interacted with TR{alpha} (data not shown). Thus, it appears that it may be more difficult to find receptor subtype-specific LXXLL-containing peptides. However, one recent study has identified non-LXXLL-containing peptides with binding preference for either ER{alpha} or ERß (76), and another study has identified a single LXXLL-containing peptide with specificity for ERß (75).

An important aspect of these studies is the ability to demonstrate that peptides specifically selected to bind to one receptor LBD over another in vitro should show selective activities on wild-type receptors in cell-based assays. Our dominant negative results suggest that this is indeed true. Interestingly, Norris et al. (79) have demonstrated hormone-specific dominant negative activity of phage-selected peptides using ER{alpha}. The ability to derive reagents that specifically inhibit the transcriptional activity of one type of NR, as demonstrated here, one subtype of NR (75), or the transcriptional activity of one type of ligand on a specific NR (79) may be useful in elucidating complex hormonal responses in cell-based systems or even whole animals.

Recent studies have begun to address the questions of 1) which residues within and around the conserved leucines within NR boxes are important for receptor binding, and 2) which residues impart binding specificity for one receptor over another. Using ER{alpha}, McInerney et al. (47) found that residues N-terminal to the core LXXLL motif of SRC-1/NCoA-1 NR box 2 were not important for receptor interaction while C-terminal residues, especially positions +12 and +13, were very important. Conversely, Mak et al. (80) found that a NR box 2 peptide extending only to residue +7 but containing important N-terminal residues at positions -2 to -4 bound efficiently to ER{alpha}. Although the assay methods were different, it is not immediately clear what is the source of this discrepancy. Darimont et al. (45) found that sequences flanking the core NR box 2 of GRIP (although the hydrophobic core was also necessary) determined binding affinity for TRß, while the core motif itself determined binding affinity for the glucocorticoid receptor. We demonstrate that peptides selected from a focused (LXXLL) library by TRß contain several characteristics that differentiate them from those selected by ERß. These include Pro at the -2 position with Leu, Ile, and Met at the -1 position, basic residues at the +2 position but not +3 position, and a somewhat higher proportion of basic residues in the +7 to +12 positions. ERß-selected peptides may contain these features but also permit basic residues in the -1 and +3 positions, tend to have a higher proportion of acidic residues in the +7 to +12 positions, and have a high frequency of Ser, Thr, and Gly rather than Pro at the -2 position.

It is unclear what the roles of residues +2 and +3 are for either affinity or selectivity of NR box interactions with NRs. Cocrystal structure analysis (10) indicates that the side chains of these residues are solvent exposed, and Darimont et al. (45) have shown that peptide interactions are unaffected by mutation of these residues. Our data show that charged residues are selected frequently here and suggest that different receptors may have preferences for the location of the charge at the +2 and +3 positions. Altering the position of the basic residue from +3 to +2 in certain peptides (SRC2 for instance) can decrease interaction with ERß and increase interaction with TRß. Further specific mutations and perhaps cocrystallization studies will be necessary to resolve these issues. Studies with ER{alpha} and RAR{alpha} (47) suggest that mutation of residues C-terminal to the core LXXLL motif can differentially affect interactions with these two receptors, implying that specific interactions with the receptor occur in this area. Cocrystal structure analysis with PPAR{gamma} (10, 47) and TRß (45) show that several interactions are present, most notably between conserved residues in the C terminus of receptor helix 3 and residues +4 to +7 of either SRC-1 or GRIP NR box 2. These interactions form one half of what has been termed a "charge clamp" (10), which may serve to orient the helix on the hydrophobic face and to limit the length of the {alpha}-helix. Our results support a view that charged residues C-terminal to the core motif can affect receptor affinity and selectivity. Switching two negatively charged residues in the +7 and +12 positions with one basic residue and a serine in peptide SRC-1 NR box 2 decreases interaction with ERß while increasing interaction with TRß. It will be interesting to determine whether these changes alter receptor specificity by changing specific side chain interactions or rather by a more global change in the motif structure.

Using ER{alpha} with SRC-1 NR boxes and TRß with GRIP NR boxes, Mak et al. (80) and Darimont et al. (45), respectively, have shown that residues N-terminal to the core LXXLL motif, especially three basic residues -4 to -2 in the case of ER{alpha}, are involved in the observed high-affinity interactions. We noted that ERß- and TRß-selected peptides usually contained at least one basic residue in either the -4 or -3 position but that no consensus is evident beyond that. The strong selection for proline in the -2 position by TRß suggests that residues N-terminal to the core motif [aside from the -1 position, which appears to be involved in the charge clamp (10)] may actually interfere with high-affinity interactions with this receptor if forced to be in proximity to the receptor by a rigid, extended {alpha}-helix. While it is clear that certain combinations of residues are permissible, as evidenced by the ability of SRC-1 NR box 2 to interact with TRß, proline in this position may allow potentially interfering residues to bend away from the surface of the receptor. ERß appears to be much less sensitive to negative effects of N-terminal residues as proline is not strongly selected in the -2 position; however, we show that substitution for proline here can enhance interactions with both TRß and ERß. Recently, Paige et al. (76) have presented several sequences obtained from panning phage libraries with ER{alpha} in the presence of estradiol. Although these peptides are presented to the receptor as N-terminal rather than C-terminal fusions as in our study, their sequences show several characteristics in common with our ERß-selected peptides. These include Ser, Gly, and Pro in the -2 position, a mix of basic and hydrophobic residues in the -1 position, acidic residues in the +7 and +8 position, and charged residues in both the +2 and +3 positions. As these peptides were selected using phage display, their relative affinities for the receptor compared with natural motifs or our HpD-selected sequences are not known.

Starting with the NR box 2 from SRC-1, we were able to make directed mutations that moderately decreased interaction with ERß and substantially increased interaction with TRß. Since the direction for these changes was based on sequences of newly isolated peptides, it is apparent that the methodology predicts real differences in individual receptor preferences. Attempts to alter a TRß-selective peptide to ERß selectivity have not been successful so far, perhaps due to the short length of the particular peptide tested. We did, however, achieve modest success in switching an ERß-selective peptide to TRß selectivity. Experimentation with specific changes on several more starting peptides will, no doubt, further our interpretation of these results.

In summary, these studies demonstrate that receptor-selective and ligand-dependent peptides can likely be selected for any given NR. The information gained can potentially be used to predict what sequences, and therefore presumably what coactivator molecules, might best interact with a given NR. The results thus suggest a general method for the development of reagents for studying orphan receptors and for characterizing ligand-dependent receptor conformations using peptide libraries.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
M2H and Dominant Negative Assays
Expression constructs for fusions between the acidic activation domain of HSV1 VP16 (402–479) and the LBDs of human ERß (215–530) and TRß (175–461) were constructed in the vector pSG5 (Stratagene, La Jolla, CA) (numbers in parentheses are amino acid numbers). Fusions between yeast Gal4 DNA-binding domain (1–147) and various fragments of human SRC-1, containing one, two, or three NR boxes, and mouse CBP were similarly constructed in pSG5. These constructs also contain the translation initiation sequence and amino acids 1–76 of the glucocorticoid receptor fused to Gal4 (66). The SRC-1 fragments contain the following amino acids: NRID (SRC1+2+3), 597–781; SRC1+2, 597–721; SRC2+3, 646–781; SRC1+3, 597–646 and 701–781; SRC1, 597–646; SRC2, 646–701; SRC3, 721–781. The CBP fusion contains amino acids 1–115. Mammalian expression vectors for peptide fusions to the Gal4 DNA-binding domain were constructed using complementary oligonucleotides encoding either 14 mers or 19 mers, preceded by three Gly residues and followed by two stop codons in the vector pSG5. A construct, UASTKluc, containing five copies of the Gal4 upstream activation sequence (UAS) upstream of a herpes thymidine kinase (TK) minimal promoter and luciferase, was used as the reporter. An expression construct for human TRß was made by inserting a cDNA fragment containing the complete coding region ((67), ATCC no. 67244, ATCC, Manassas, VA) into pSG5. The expression vector for human ERß in pSG5 was a gift from John Moore (Glaxo Wellcome Inc., Research Triangle Park, NC). Luciferase reporter constructs ERELuc and TRELuc were made by inserting either five copies of a palindromic estrogen response element (AAAGTCAGGTCACAGTGACCTGATCAAAG) or four copies of a direct repeat TR response element (ATCCAGGTCACAGGAGGTCA), respectively, into the vector pGL3-promoter vector (Promega Corp., Madison, WI). Transient transfections into CHO-K1 cells were performed essentially as described previously (68), using either (3 ng of VP16-LBD construct, 3 ng of Gal4-fusion construct, and 8 ng of UASTKluc), or (2 ng of ERß or TRß expression construct, 8 ng of ERELuc or TRELuc, and from 0.33–4 ng of Gal4-fusion construct), and 25 ng of ß-galactosidase internal control plasmid, pCH110, plus pBluescript KS (Stratagene) to a total of 80 ng of plasmid per well. After one 15-h transfection, cells were washed once and then treated for 24 h with the indicated concentrations of either E2 or T3 (Sigma, St. Louis, MO) diluted in phenol red-free Optimem medium (Life Technologies, Inc., Gaithersburg, MD) containing 10% charcoal stripped delipidated bovine calf serum (Sigma). Luciferase and ß-galactosidase activities were measured as previously described (68).

Protein Expression and Purification
Fusions to GST were constructed in expression vectors derived from pGEX-3X (Amersham Pharmacia Biotech, Piscataway, NJ). Receptor LBDs of ERß and TRß fused to GST contain the identical amino acids as described in the above section. In addition, a GST-fused full-length TRß construct was made and the resulting fusion protein used for peptide library screening (see below). Coactivator fragments and peptides were fused to MBP in derivatives of the vector pMALc2 (New England Biolabs, Inc., Beverly, MA) as described (53). SRC-1 fragments contain the following amino acids: SRC1+2+3, 597–781; SRC1+2, 597–721; SRC2+3, 646–781; and SRC2, 646–701. In addition, a SRC1+2+3 construct containing the additional amino acids CLEPYTACD [antibody 179 epitope, (69)] at the carboxy terminus was constructed and used for radiolabeling (see below). Peptides derived from the NR-boxes of the coactivators SRC-1, TIF-2, RAC-3, CBP, and p300 were constructed as 19 mers in the form X7LXXLLX7 (sequences depicted in Fig. 4CGo) and fused to MBP in the vector pELM3 (53). Fusion proteins were expressed in E. coli strain ARI814 (65) using 400 µM isopropylthiogalactoside added at OD600 ~ 0.5, followed by growth at 37 C for 3 h. For GST fusions, sonication buffer was PBS, 1 mM EDTA, 0.1 mM phenylmethylsulfonylfluoride (PMSF), protease inhibitors 10 µg/ml leupeptin and 5 µg/ml aprotinin, and 5 mM dithiothreitol (DTT). For MBP fusions, sonication buffer was 10 mM Tris, pH 7.4, 1 mM EDTA, 200 mM NaCl, 0.1 mM PMSF, protease inhibitors as above, and 5 mM DTT. Harvested bacteria were frozen and thawed, incubated with 200 µg/ml lysozyme in sonication buffer (15 min, 4 C), sonicated, and a cleared lysate produced by centrifugation (Beckman Coulter, Inc. JA20 rotor, 14,000 rpm, 15 min, 4 C). GST fusions were purified on glutathione sepharose resin (Amersham Pharmacia Biotech), and MBP fusions on amylose resin (New England Biolabs, Inc.). GST fusion proteins were eluted with 50 mM Tris-HCl, pH 8.0, 10 mM glutathione, and MBP fusions with sonication buffer containing 10 mM maltose. Purified proteins were characterized by PAGE.

Library Construction, Panning, and Analysis of Individual Clones by ELISA
Detailed procedures for construction, panning, and analysis of LacI (peptides-on-plasmids) and HpD libraries have been described previously (52, 53, 65). The three libraries used in the current work consist of a random 15 mer (X15), X = (NNK) where N = A, C, G, T and K = G, T, and a focused 19 mer (X7LXXLLX7), both fused to LacI, and a focused 19 mer (X7LXXLLX7) fused to the HpD. Panning was performed by coating 24 (first round) or 6 (subsequent rounds) microtiter wells each with 2 µg of either GST ERß-LBD or GST TRß-full length, followed by appropriate BSA blocking. Four rounds of panning were performed essentially as described (53) except that 2–5 µg/ml of purified soluble GST were added to each lysate to reduce the probability of enriching for peptides specific for GST. ERß was panned using all three libraries in the presence of 1 µM E2 and TRß panned with only the focused, HpD library, in the presence of 1 µM T3. Sequencing of LacI and MBP fusions was by the dideoxy chain termination technique using double stranded plasmid DNA and appropriate primers. Analysis of clones by ELISA, using crude lysates, was performed with ERß-LBD and both TRß-LBD and TRß-full length fusions without significant differences observed between these latter two (data not shown). Briefly, ELISA plates were coated with 10 µg/ml, 100 µl/well of GST ERß-LBD, GST TRß-LBD, or GST TRß-full length receptor in PBS, 1 mM DTT (shaking for 1 h at room temperature). Plates were washed three times (200 µl PBS, 0.05% Tween 20, 1 mM DTT, 4 C), and blocked in assay buffer (200 µl PBS, 0.1% BSA, 0.05%Tween 20, 1 mM DTT, 4 C) for 1 h with shaking. After removal of the blocking buffer, 100 µl/well of MBP or LacI fusion protein-containing bacterial lysates diluted 1:50 or 1:20, respectively (53), in assay buffer were added to the plates and incubated with or without 1 µM hormone (shaking at 4 C for 1 h). Plates were washed as above, and 100 µl/well of polyclonal rabbit anti-MBP antiserum (New England Biolabs, Inc.) diluted 1:10,000 or anti-LacI antiserum diluted 1:15,000 plus alkaline phosphatase-conjugated goat antirabbit IgG (Tago) diluted 1:2000 in assay buffer (minus DTT) were added concurrently to plates (shaking at 4 C for 45 min). After washing as above (but without DTT), colorimetric development (p-nitrophenyl phosphate, Bio-Rad Laboratories, Inc.) was performed and measured at OD405nm.

Iodination of MBPSRC1+2+3 Protein
Purified MBPSRC1+2+3 protein containing a carboxy-terminal antibody 179 epitope (see above) was iodinated using IODO-BEADS reagent (Pierce Chemical Co., Rockford, IL) according to the manufacture’s instructions. Briefly, 100 µg of protein in 100 µl volume were mixed with 100 µl BupH phosphate buffer (Pierce Chemical Co.), one IODO-BEAD, and 5 µl carrier-free iodine-125 (3.7GBq/ml, 100 mCi/ml, (Amersham Pharmacia Biotech) . The labeling reaction proceeded at room temperature for 5 min and was then terminated by removing the reaction mix from the IODO-BEAD. The labeled protein was purified on a Sephadex G-50 column immediately. Aliquots taken from the unpurified reaction and each of the fractions collected from the G-50 column were counted with scintillation fluid. Protein recovery was estimated by ELISA with unlabeled protein as a control. Typical specific activity of the iodinated MBPSRC1+2+3 was between 166–246 Ci/mmol protein. Autoradiography of the protein analyzed by PAGE showed a major labeled band at approximately 55 kDa.

Competition SPA
Yttrium silicate SPA beads (60 µg/well) coated with the polycationic polymer, polylysine (Amersham Pharmacia Biotech) were batch bound with 250 ng/well of either purified GST ERß-LBD or TRß-LBD in coating buffer [Tris-buffered saline (TBS) pH 7.4, 1 mM DTT, room temperature, 15 min with shaking]. Receptor-bound beads were pelleted and then resuspended in assay buffer (TBS, 0.1% BSA, 1 mM DTT) to remove unbound receptor. Purified MBP fusion proteins or fusion peptides were added at varying concentrations to wells and a fixed amount (20,000 cpm) of iodinated MBPSRC1+2+3 was subsequently added in assay buffer with or without either 1 µM E2 or 1 µM T3 final as appropriate for a total assay volume of 100 µl/well. Assays were incubated for 1 h at 4 C in 96-well OptiPlates (Packard) with shaking and subsequently read on a TopCount (Packard). The IC50 values were determined with a nonlinear least squares regression to a four-parameter logistic equation (70).


    ACKNOWLEDGMENTS
 
We thank Jennie Woo for oligonucleotide synthesis and DNA sequencing, Margaret Reed for plasmid construction, and Ted Baer, Mike Needels, and Marc Navre for critical reading of the manuscript.


    FOOTNOTES
 
Address requests for reprints to: Dr. Jeffrey Northrop, Affymax Research Institute, 3410 Central Expressway, Santa Clara, California 95051.

Received for publication December 1, 1999. Revision received February 9, 2000. Accepted for publication February 14, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  2. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  3. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  4. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  5. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  6. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941–951[CrossRef][Medline]
  7. Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-{gamma} ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  8. Bourguet W, Ruff M, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-{alpha}. Nature 375:377–382[CrossRef][Medline]
  9. Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD, Fletterick RJ 1995 A structural role for hormone in the thyroid hormone receptor. Nature 378:690–697[CrossRef][Medline]
  10. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–143[CrossRef][Medline]
  11. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  12. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  13. Barettino D, Vivanco Ruiz MM, Stunnenberg HG 1994 Characterization of the ligand-dependent transactivation domain of thyroid hormone receptor. EMBO J 13:3039–3049[Medline]
  14. Durand B, Saunders M, Gaudon C, Roy B, Losson R, Chambon P 1994 Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoic acid receptor: nature of the response element on AF-2 activity. EMBO J 13:5370–5382[Medline]
  15. Tone Y, Collingwood TN, Adams M, Chatterjee VK 1994 Functional analysis of a transactivation domain in the thyroid hormone ß receptor. J Biol Chem 269:31157–31161[Abstract/Free Full Text]
  16. Jonat C, Rahmsdorf HJ, Park KK, Cato AC, Gebel S, Ponta H, Herrlich P 1990 Antitumor promotion and antiinflammation: down-modulation of AP-1(Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189–1204[CrossRef][Medline]
  17. Yang-Yen H-F, Chambard JC, Sun YL, Smeal T, Schmidt TJ, Drouin J, Karin M 1990 Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62:1205–1215[CrossRef][Medline]
  18. Schule R, Rangarajan P, Kliewer S, Ransone LJ, Bolado J, Yang N, Verma IM, Evans RM 1990 Functional antagonism between oncoprotein c-Jun and the glucocorticoid receptor. Cell 62:1217–1226[CrossRef][Medline]
  19. Salbert G, Fanjul A, Piedrafita FJ, Lu XP, Kim SJ, Tran P, Pfahl M 1993 Retinoic acid receptors and retinoid X receptor-{alpha} down-regulate the transforming growth factor-ß 1 promoter by antagonizing AP-1 activity. Mol Endocrinol 7:47–56[Abstract/Free Full Text]
  20. Ray A, Prefontaine KE 1994 Physical association and functional antagonism between the p65 subunit of transcription factor NF-{kappa} B and the glucocorticoid receptor. Proc Natl Acad Sci USA 91:752–756[Abstract/Free Full Text]
  21. van de Stolpe A, Caldenhoven E, Stade BG, Koenderman L, Raaijmakers JA, Johnson JP, van der Saag PT 1994 12-O-tetradecanoylphorbol-13-acetate- and tumor necrosis factor {alpha}-mediated induction of intercellular adhesion molecule-1 is inhibited by dexamethasone. Functional analysis of the human intercellular adhesion molecular-1 promoter. J Biol Chem 269:6185–6192[Abstract/Free Full Text]
  22. Ohtsuka T, Kubota A, Hirano T, Watanabe K, Yoshida H, Tsurufuji M, Iizuka Y, Konishi K, Tsurufuji S 1996 Glucocorticoid-mediated gene suppression of rat cytokine-induced neutrophil chemoattractant CINC/gro, a member of the interleukin-8 family, through impairment of NF-{kappa} B activation. J Biol Chem 271:1651–1659[Abstract/Free Full Text]
  23. Rangarajan PN, Umesono K, Evans RM 1992 Modulation of glucocorticoid receptor function by protein kinase A. Mol Endocrinol 6:1451–1457[Abstract/Free Full Text]
  24. Huggenvik JI, Collard MW, Kim YW, Sharma RP 1993 Modification of the retinoic acid signaling pathway by the catalytic subunit of protein kinase-A. Mol Endocrinol 7:543–550[Abstract/Free Full Text]
  25. Beck CA, Weigel N, Moyer ML, Nordeen SK, Edwards DP 1993 The progesterone antagonist RU486 acquires agonist activity upon stimulation of cAMP signaling pathways. Proc Natl Acad Sci U S A 90:4441–4445[Abstract/Free Full Text]
  26. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor coactivators. Curr Opin Cell Biol 9:222–232[CrossRef][Medline]
  27. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855–859[CrossRef][Medline]
  28. Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH 1994 Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223–226[CrossRef][Medline]
  29. Eckner R, Ewen ME, Newsome D, Gerdes M, DeCaprio JA, Lawrence JB, Livingston DM 1994 Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev 8:869–884[Abstract/Free Full Text]
  30. Arias J, Alberts AS, Brindle P, Claret FX, Smeal T, Karin M, Feramisco J, Montminy M 1994 Activation of cAMP and mitogen responsive genes relies on a common nuclear factor. Nature 370:226–229[CrossRef][Medline]
  31. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  32. Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H, Montminy M, Evans RM 1996 Role of CBP/P300 in nuclear receptor signalling. Nature 383:99–103[CrossRef][Medline]
  33. Torchia J, Glass C, Rosenfeld MG 1998 Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 10:373–383[CrossRef][Medline]
  34. Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ, Edwards DP, O’Malley BW 1998 The steroid receptor coactivator-1 contains multiple receptor interacting and activation domains that cooperatively enhance the activation function 1 (AF1) and AF2 domains of steroid receptors. J Biol Chem 273:12101–12108[Abstract/Free Full Text]
  35. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  36. Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J 17:507–519[CrossRef][Medline]
  37. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  38. Yao TP, Ku G, NZ, Scully, R, Livingston DM 1996 The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc Natl Acad Sci USA 93:10626–10631[Abstract/Free Full Text]
  39. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  40. Heery DM, Kalkhoven E, Horare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  41. Yamamoto KR, Pearce D, Thomas J, Miner JN 1992 Combinatorial regulation at a mammalian composite response element. In: McKnight SL, Yamamoto KR (eds)Transcriptional Regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 1169–1192
  42. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925[Abstract/Free Full Text]
  43. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frai DE 1998 A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273:27645–27653[Abstract/Free Full Text]
  44. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1(SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313[Abstract/Free Full Text]
  45. Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev 12:3343–3356[Abstract/Free Full Text]
  46. Leers J, Treuter E, Gustafsson JA 1998 Mechanistic principles in NR box-dependent interaction between nuclear hormone receptors and the coactivator TIF2. Mol Cell Biol 18:6001–6013[Abstract/Free Full Text]
  47. McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J, Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK, Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 12:3357–3368[Abstract/Free Full Text]
  48. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  49. Takeyama K, Masuhiro Y, Fuse H, Endoh H, Murayama A, Kitanaka S, Suzawa M, Yanagisawa J, Kato S 1999 Selective interaction of vitamin D receptor with transcriptional coactivators by a vitamin D analog. Mol Cell Biol 19:1049–1055[Abstract/Free Full Text]
  50. Winter J 1994 Bacteriophage display: peptide libraries and drug discovery. Drug Dev Res 33:71–89[CrossRef]
  51. Rodi DJ, Makowski L 1999 Phage-display technology–finding a needle in a vast molecular haystack. Curr Opin Biotechnol 10:87–93[CrossRef][Medline]
  52. Cull MG, Miller JF, Schatz PJ 1992 Screening for receptor ligands using large libraries of peptides linked to the C terminus of the lac repressor. Proc Natl Acad Sci USA 89:1865–1869[Abstract/Free Full Text]
  53. Schatz PJ, Cull MG, Martin EL, Gates CM 1996 Screening of peptide libraries linked to lac repressor. Methods Enzymol 267:171–191[Medline]
  54. Cwirla S, Peters EA, Barrett RW, Dower WJ 1990 Peptides on phage: a vast library of peptides for identifying ligands. Proc Natl Acad Sci USA 87:6378–6382[Abstract/Free Full Text]
  55. Yanofsky SD, Baldwin DN, Butler JH, Holden FR, Jacobs JW, Balasubramanian P, Chinn JP, Cwirla SE, Peters-Bhatt E, Whitehorn EA, Tate EH, Akeson A, Bowlin TL, Dower WJ, Barrett RW 1996 High affinity type I interleukin 1 receptor antagonists discovered by screening recombinant peptide libraries. Proc Natl Acad Sci USA 93:7381–7386[Abstract/Free Full Text]
  56. Martin EL, Rens-Domiano S, Schatz PJ, Hamm HE 1996 Potent peptide analogues of a G protein receptor-binding region obtained with a combinatorial library. J Biol Chem 271:361–366[Abstract/Free Full Text]
  57. Cwirla SE, Balasubramanian P, Duffin DJ, Wagstrom CR, Gates CM, Singer SC, Davis AM, Tansik RL, Mattheakis LC, Boytos CM, Schatz PJ, Baccanari DP, Wrighton NC, Barrett RW, Dower WJ 1997 Peptide agonist of the thrombopoietin receptor as potent as the natural cytokine. Science 276:1696–1699[Abstract/Free Full Text]
  58. Cheadle C, Ivashchenko Y, South V, Searfoss GH, French S, Howk R, Ricca GA, Jaye M 1994 Identification of a Src SH3 domain binding motif by screening a random phage display library. J Biol Chem 269:24034–24039[Abstract/Free Full Text]
  59. Oligino L, Lung F-DT, Sastry L, Bigelow J, Cao T, Curran M, Burke TR, Wang S, Krag D, Roller PP, King CR 1997 Nonphosphorylated peptide ligands for the Grb2 Src homology 2 domain. J Biol Chem 272:29046–29052[Abstract/Free Full Text]
  60. Hart CP, Martin JE, Reed MA, Keval AA, Pustelnik MJ, Northrop JP, Patel DV, Grove JR 1999 Potent inhibitory ligands of the GRB2 SH2 domain form recombinant peptide libraries. Cell Signal 11:453–464[CrossRef][Medline]
  61. Sparks AB, Quilliam LA, Thorn JM, Der CJ, Kay BK 1994 Identification and characterization of Src SH3 ligands from phage-displayed random peptide libraries. J Biol Chem 269:23853–23856[Abstract/Free Full Text]
  62. Smith MM, Shi L, Navre M 1995 Rapid identification of highly active and selective substrates for stromelysin and matrilysin using bacteriophage peptide display libraries. J Biol Chem 270:6440–6449[Abstract/Free Full Text]
  63. Stricker NL, Christopherson KS, Byungdoo AY, Schatz PJ, Raab RW, Dawes G, Bassett DEJ, Bredt DS, Li M 1997 PZD domain of neuronal nitric oxide synthase recognizes novel C-terminal peptide sequences. Nat Biotechnol 15:336–342[CrossRef][Medline]
  64. Schatz PJ 1993 Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: A 13 residue consensus peptide specifies biotinylation in Escherichia coli. Biotechnology 11:1138–1143[Medline]
  65. Gates CM, Stemmer WPC, Kaptein R, Schatz PJ 1996 Affinity selective isolation of ligands from peptide libraries through display on a lac repressor "Headpiece Dimer". J Mol Biol 255:373–386[CrossRef][Medline]
  66. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver B, Su J-L, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM 1997 Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 272:3137–3140[Abstract/Free Full Text]
  67. Weinberger C, Thompson CC, Ong ES, Lebo R, Gruol DJ, Evans RM 1986 the c-erb-A gene encodes a thyroid hormone receptor. Nature 324:641–646[CrossRef][Medline]
  68. Dias JM, Go NF, Hart CP, Mattheakis LC 1998 Genetic recombination as a reporter for screening steroid receptor agonists and antagonists. Anal Biochem 258:96–102[CrossRef][Medline]
  69. Whitehorn EA, Tate E, Yanofsky SD, Kochersperger L, Davis A, Mortensen RB, Yonkovich S, Bell K, Dower WJ, Barrett RW 1995 A generic method for expression and use of "tagged" soluble versions of cell surface receptors. Biotechnology 13:1215–1219[CrossRef][Medline]
  70. DeLean A, Munson PJ, Rodbard D 1978 Simultaneous analysis of families of sigmoidal curves: application to bioassay, radioligand assay, and physiological dose-response curves. Am J Physiol 235:97–102
  71. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  72. McInerney EM, Tsai MJ, O’Malley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc Natl Acad Sci USA 93:10069–10073[Abstract/Free Full Text]
  73. Smith CL, Onate SA, Tsai MJ, O’Malley BW 1996 CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptor-dependent transcription. Proc Natl Acad Sci USA 93:8884–8888[Abstract/Free Full Text]
  74. Westin S, Kurokawa R, Nolte RT, Wisely GB, McInerney EM, Rose DW, Milburn MV, Rosenfeld MG, Glass CK 1998 Interactions controlling the assembly of nuclear-receptor heterodimers and co-activators. Nature 395:199–202[CrossRef][Medline]
  75. Chang C-Y, Norris JD, Grn H, Paige LA, Hamilton PT, Kenan DJ, Fowlkes D, McDonnell DP 1999 Dissection of the LXXLL nuclear receptor-coactivator interaction motif using combinatorial peptide libraries: discovery of peptide antagonists of estrogen recepors {alpha} and ß. Mol Cell Biol 19:8226–8239[Abstract/Free Full Text]
  76. Paige LA, Christensen DJ, Gron H, Norris JD, Gottlin EB, Padilla KM, Chang CY, Ballas LM, Hamilton PT, McDonnell DP, Fowlkes DM 1999 Estrogen receptor (ER) modulators each induce distinct conformational changes in ER{alpha} and ERß. Proc Natl Acad Sci USA 96:3999–4004[Abstract/Free Full Text]
  77. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  78. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T, Schiff R, Del-Rio A, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  79. Norris JD, Paige LA, Christensen DJ, Chang C-Y, Huacani MR, Fan D, Hamilton PT, Fowlkes DM, McDonnell DP 1999 Peptide antagonists of the human estrogen receptor. Science 285:744–746[Abstract/Free Full Text]
  80. Mak HY, Hoare S, Henttu PMA, Parker MG 1999 Molecular determinants of the estrogen receptor-coactivator interface. Mol Cell Biol 19:3895–3903[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
H. Wang, H. Li, L. B. Moore, M. D. L. Johnson, J. M. Maglich, B. Goodwin, O. R. R. Ittoop, B. Wisely, K. Creech, D. J. Parks, et al.
The Phytoestrogen Coumestrol Is a Naturally Occurring Antagonist of the Human Pregnane X Receptor
Mol. Endocrinol., April 1, 2008; 22(4): 838 - 857.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Lodrini, T. Munz, N. Coudevylle, C. Griesinger, S. Becker, and E. Pfitzner
p160/SRC/NCoA coactivators form complexes via specific interaction of their PAS-B domain with the CID/AD1 domain
Nucleic Acids Res., April 1, 2008; 36(6): 1847 - 1860.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P.-J. Tai, Y.-H. Huang, C.-H. Shih, R.-N. Chen, C.-D. Chen, W.-J. Chen, C.-S. Wang, and K.-H. Lin
Direct Regulation of Androgen Receptor-Associated Protein 70 by Thyroid Hormone and Its Receptors
Endocrinology, July 1, 2007; 148(7): 3485 - 3495.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Folkertsma, P. I. van Noort, A. de Heer, P. Carati, R. Brandt, A. Visser, G. Vriend, and J. de Vlieg
The Use of in Vitro Peptide Binding Profiles and in Silico Ligand-Receptor Interaction Profiles to Describe Ligand-Induced Conformations of the Retinoid X Receptor {alpha} Ligand-Binding Domain
Mol. Endocrinol., January 1, 2007; 21(1): 30 - 48.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. N. Duong, S. Elliott, D. E. Frigo, L. I. Melnik, L. Vanhoy, S. Tomchuck, H. P. Lebeau, O. David, B. S. Beckman, J. Alam, et al.
AKT Regulation of Estrogen Receptor {beta} Transcriptional Activity in Breast Cancer.
Cancer Res., September 1, 2006; 66(17): 8373 - 8381.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. J. Dubbink, R. Hersmus, A. C. W. Pike, M. Molier, A. O. Brinkmann, G. Jenster, and J. Trapman
Androgen Receptor Ligand-Binding Domain Interaction and Nuclear Receptor Specificity of FXXLF and LXXLL Motifs as Determined by L/F Swapping
Mol. Endocrinol., August 1, 2006; 20(8): 1742 - 1755.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
J. M. R. Moore and R. K. Guy
Coregulator Interactions with the Thyroid Hormone Receptor
Mol. Cell. Proteomics, April 1, 2005; 4(4): 475 - 482.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C M Klinge, S C Jernigan, K A Mattingly, K E Risinger, and J Zhang
Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors {alpha} and {beta} by coactivators and corepressors
J. Mol. Endocrinol., October 1, 2004; 33(2): 387 - 410.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. R. Moore, S. J. Galicia, A. C. McReynolds, N.-H. Nguyen, T. S. Scanlan, and R. K. Guy
Quantitative Proteomics of the Thyroid Hormone Receptor-Coregulator Interactions
J. Biol. Chem., June 25, 2004; 279(26): 27584 - 27590.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. A. Iannone, C. A. Simmons, S. H. Kadwell, D. L. Svoboda, D. E. Vanderwall, S.-J. Deng, T. G. Consler, J. Shearin, J. G. Gray, and K. H. Pearce
Correlation between in Vitro Peptide Binding Profiles and Cellular Activities for Estrogen Receptor-Modulating Compounds
Mol. Endocrinol., May 1, 2004; 18(5): 1064 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A.-M. Leduc, J. O. Trent, J. L. Wittliff, K. S. Bramlett, S. L. Briggs, N. Y. Chirgadze, Y. Wang, T. P. Burris, and A. F. Spatola
Helix-stabilized cyclic peptides as selective inhibitors of steroid receptor-coactivator interactions
PNAS, September 30, 2003; 100(20): 11273 - 11278.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Liu, K. S. Knappenberger, H. Kack, G. Andersson, E. Nilsson, C. Dartsch, and C. W. Scott
A Homogeneous in Vitro Functional Assay for Estrogen Receptors: Coactivator Recruitment
Mol. Endocrinol., March 1, 2003; 17(3): 346 - 355.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wu, W. W. Chin, Y. Wang, and T. P. Burris
Ligand and Coactivator Identity Determines the Requirement of the Charge Clamp for Coactivation of the Peroxisome Proliferator-activated Receptor gamma
J. Biol. Chem., February 28, 2003; 278(10): 8637 - 8644.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. Ko, G. R. Cardona, T. Iwasaki, K. S. Bramlett, T. P. Burris, and W. W. Chin
Ser-884 Adjacent to the LXXLL Motif of Coactivator TRBP Defines Selectivity for ERs and TRs
Mol. Endocrinol., January 1, 2002; 16(1): 128 - 140.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. S. Bramlett, Y. Wu, and T. P. Burris
Ligands Specify Coactivator Nuclear Receptor (NR) Box Affinity for Estrogen Receptor Subtypes
Mol. Endocrinol., June 1, 2001; 15(6): 909 - 922.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Hall, C.-y. Chang, and D. P. McDonnell
Development of Peptide Antagonists That Target Estrogen Receptor {beta}-Coactivator Interactions
Mol. Endocrinol., December 1, 2000; 14(12): 2010 - 2023.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Warnmark, T. Almlof, J. Leers, J.-A. Gustafsson, and E. Treuter
Differential Recruitment of the Mammalian Mediator Subunit TRAP220 by Estrogen Receptors ERalpha and ERbeta
J. Biol. Chem., June 22, 2001; 276(26): 23397 - 23404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Northrop, J. P.
Right arrow Articles by Schatz, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Northrop, J. P.
Right arrow Articles by Schatz, P. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals