help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takada, I.
Right arrow Articles by Umesono, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takada, I.
Right arrow Articles by Umesono, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*Structure*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*(L)-METHIONINE
Molecular Endocrinology 14 (5): 733-740
Copyright © 2000 by The Endocrine Society

Alteration of a Single Amino Acid in Peroxisome Proliferator-Activated Receptor-{alpha} (PPAR{alpha}) Generates a PPAR{delta} Phenotype

Ichiro Takada, Ruth T. Yu, H. Eric Xu, Millard H. Lambert, Valerie G. Montana, Steven A. Kliewer, Ronald M. Evans and Kazuhiko Umesono1

Graduate School for Biostudies Kyoto University (I.T., R.T.Y., K.U.) Kyoto 606-8507, Japan
Glaxo Wellcome Inc. Research and Development (H.E.X., M.H.L., V.G.M., S.A.K.) Research Triangle Park, North Carolina 27709
Howard Hughes Medical Institute (R.M.E.) The Salk Institute for Biological Studies La Jolla, California 92037


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Three pharmacologically important nuclear receptors, the peroxisome proliferator-activated receptors (PPARs {alpha}, {gamma}, and {delta}), mediate key transcriptional responses involved in lipid homeostasis. The PPAR{alpha} and {gamma} subtypes are well conserved from Xenopus to man, but the ß/{delta} subtypes display substantial species variations in both structure and ligand activation profiles. Characterization of the avian cognates revealed a close relationship between chick (c) {alpha} and {gamma} subtypes to their mammalian counterparts, whereas the third chicken subtype was intermediate to Xenopus (x) ß and mammalian {delta}, establishing that ß and {delta} are orthologs. Like xPPARß, cPPARß responded efficiently to hypolipidemic compounds that fail to activate the human counterpart. This provided the opportunity to address the pharmacological problem as to how drug selectivity is achieved and the more global evolutionary question as to the minimal changes needed to generate a new class of receptor. X-ray crystallography and chimeric analyses combined with site-directed mutagenesis of avian and mammalian cognates revealed that a Met to Val change at residue 417 was sufficient to switch the human and chick phenotype. These results establish that the genetic drive to evolve a novel and functionally selectable receptor can be modulated by a single amino acid change and suggest how nuclear receptors can accommodate natural variation in species physiology.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Lipid and glucose homeostasis involves the coordination of signaling pathways mediated by transcription factors, among which the peroxisome proliferator-activated receptors (PPARs) have been shown to play a major role. The PPARs are members of the nuclear receptor superfamily of ligand-activated transcription factors. Several PPAR subtypes have been described and named PPAR{alpha}, PPARß, PPAR{gamma}, and PPAR{delta}. The different forms are expressed in tissue-specific patterns: PPAR{alpha} is abundantly found in liver, kidney, heart, and muscle; PPAR{gamma} is localized in fat, large intestine, and macrophages; and PPARs ß and {delta} are widely expressed. The PPARs form a subclass of fatty acid and eicosanoid sensors that are characterized by their distinct pharmacological profiles, a property that has allowed the identification of subtype-selective ligands including the widely used fibrate and thiazolidinedione classes of drugs (for review, see Refs. 1, 2, 3, 4 and references therein).

The PPARß and -{delta} forms posed a dilemma as to whether they constituted a single group or represented distinct subtypes. Since Xenopus PPARß (xPPARß) shares only approximately 75% amino acid identity in the ligand-binding domain with mouse and human (h) PPAR{delta}, it was not clear whether these receptors are orthologs or paralogs. This lack of clarity was further exacerbated by the finding that human and mouse PPAR{delta}s are functionally distinct from xPPARß in their response to ligands (5, 6). To better understand the evolutionary relationship between the PPARs, we have isolated the chick counterparts as a means for providing insight into the ancestral form of these genes after divergence from amphibians. Our results demonstrate that chick and Xenopus PPARß and mammalian PPAR{delta} are orthologs. Moreover, we have exploited cross-species differences in the PPARß/{delta} subtype to understand the molecular basis for important pharmacological differences in the ligand binding properties of the PPARs.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chick PPAR (cPPAR)-related gene products were obtained from cDNA libraries prepared from 2.5-day-old embryos and adult adipose tissue (see Materials and Methods). Isolation and characterization of multiple overlapping clones allowed the compilation of full-length cDNA sequences for all three cPPARs2 (Fig. 1AGo, GenBank accession nos. AF163809, AF163810, and AF163811), and an evolutionary tree comparing the ligand-binding domains (LBDs) was constructed using the ClustalW program (Ref. 7 and Fig. 1BGo). The phylogenetic relationships reveal that PPAR{alpha} and -{gamma} are highly conserved from Xenopus to human but greater divergence exists among the ß/{delta} subtypes, with the chick counterpart forming an intermediary link between Xenopus PPARß and mouse/human PPAR{delta}. This alignment indicates clearly that the ß and {delta} forms constitute a single subtype as the conservation within individual subtypes is much higher than the similarity between that of a given species.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Comparison of Chick PPARs with Human, Mouse, and Xenopus Counterparts

A, Schematic of the DBDs and LBDs of cPPARs compared with the corresponding regions of the human, mouse, and Xenopus receptors. Numbers indicate percent identity to the corresponding cPPAR. B, Tree plot comparison of human (H), mouse (M), chick (C), and Xenopus (X) PPAR LBDs. Human RXR{alpha} was used as the root for this tree. 0.05 indicates the frequency of amino acid change (maximum is 1). The Clustal W program (7 ) was used for alignment.

 
To characterize the ligand response profiles of the cPPARs, we used GAL4 fusions of the LBDs to avoid background activation from endogenous PPARs. Serum-free conditions were chosen as some nuclear receptors are modulated by the addition of FBS. The chick subtypes were found to exhibit distinct ligand response profiles (Fig. 2AGo; structures of compounds are shown in Table 1Go). Wy-14,643 and eicosatetroenoic acid (ETYA) are selective PPAR{alpha} activators; in chick, ETYA activates PPAR{alpha} to a greater extent than Wy-14,643, as is the case in humans and Xenopus, but not in mouse (8, 9). Carbaprostacyclin is active on both PPAR{alpha} and -ß (but {alpha} >> ß) and thiazolidinediones (BRL 49653, Glaxo Wellcome, Inc., Research Triangle Park, NC) are selective for PPAR{gamma} as previously reported (5, 10). Among the fibrate derivatives, bezafibrate and GW2331 (11) were capable of activating PPARß; other fibrates (fenofibrate and gemfibrozil) were active only on PPAR{alpha}.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Transcriptional Activity of GAL-cPPAR Fusion Receptors

CV-1 cells were cotransfected with a reporter gene containing four copies of a GAL4 binding site (MH-100x4-tk-Luc) in the presence or absence of a chimeric receptor (GAL4-cPPAR{alpha},ß,{gamma}). Activation of the luciferase reporter gene was measured in relative light units with ß-galactosidase activity as a control for transfection efficiency and presented as fold activation. Ligand response data are derived from triplicate points from two independent experiments and represented as the mean ± SE; n = 6. A, Comparison of the fold activities of cPPAR{alpha}, -ß, and -{gamma} by the indicated compounds. Numbers within brackets represent the ligand concentration in micromoles. cPGI, carbaprostacyclin, Wy; Wy-14,643, BF; bezafibrate, FF; fenofibrate, GF; gemfibrozil, GW; GW2331, BRL; BRL 49653. B, Chick and human GAL4-PPARß/{delta}s were analyzed in cotransfection assays with bezafibrate, GW2331, and carbaprostacyclin. Bezafibrate and GW2331 appear specific for cPPARß. C, 35S-human and chick PPAR{delta}/ß were preincubated for 30 min at 37 C with either 100 µM bezafibrate, 1 µM GW2331, or 100 µM carbaprostacyclin before addition of trypsin (final concentrations of 20 and 40 µg/ml, respectively). Proteolytic digestions were carried out at 37 C for 10 min, and then samples were denatured and electrophoresed on a 12.5% SDS-polyacrylamide gel. In the presence of bezafibrate and GW2331, only cPPARß shows protected fragments (arrows). Addition of carbaprostacyclin results in protected fragments for hPPAR{delta} and cPPARß (arrows).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Chemical Structures of the Compounds Used in This Study

 
This ability of some of the fibrates to activate cPPARß prompted us to compare the effect of bezafibrate, GW2331, and carbaprostacyclin in the mammalian and chick PPARß/{delta}s. As shown in Fig. 2BGo, the responses elicited by bezafibrate and GW2331 were distinct between chick (c) and human (h). The potency of bezafibrate on cPPARß was similar to that seen with xPPARß (6). Carbaprostacyclin activated hPPAR{delta} and cPPARß with equal efficiency.

To determine whether these compounds could directly bind to PPAR{delta}/ß, we used protease digestion assays. Addition of increasing concentrations of trypsin in the presence of 100 µM bezafibrate or 1 µM GW2331 to 35S-labeled cPPARß resulted in the appearance of protease-resistant fragments of approximately 32 kDa, 29 kDa, and 27 kDa (Fig. 2CGo, arrows), but no protected bands were observed with hPPARß. With carbaprostacyclin, protease-resistant fragments of similar sizes were observed with both human and chick PPAR{delta}/ß. It is thus apparent that PPARß/{delta} ligands can be classified into those with species-selective activity (bezafibrate, GW2331) and those without (carbaprostacyclin).

To determine the region essential for ligand-selective recognition by PPARß/{delta}, we examined the structures of the chick, Xenopus, mouse, and human homologs (12, 13, 14). Although cPPARß LBD and xPPARß LBD share only 71% amino acid identity (216/303) vs. 90% (272/303) between chick and human, the ligand activation properties of the cPPARß LBD more closely resemble those of Xenopus (6, 11). Detailed comparison of the LBD sequences of cPPARß with those of human, mouse, and Xenopus revealed that 200 amino acids (a.a.) are conserved with the remaining 103 a.a. varying between species.

Taking into consideration the similarity in ligand response between chick and Xenopus, we focused on 9 a.a. that are conserved between chick and Xenopus, but not between chick and human/mouse. A series of chimeric human and chick PPAR{delta}/ß expression constructs were made in an attempt to further localize the key residues involved in the ligand specification (Fig. 3AGo). Examination of the response of these receptors to bezafibrate, GW2331 and carbaprostacyclin indicated that the domain spanning from the hinge region to helix 9 is not critical for recognition of either bezafibrate or GW2331 by the cPPARß, but that helix 10, containing a net change of 3 a.a., was essential for recognition of both compounds (Fig. 3BGo).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. The C-Terminal Region of cPPAR Is Required for Fibrate-Dependent Activity

A, Schematic representations of chimeric GAL4-hPPAR{delta}/cPPARß fusion proteins (numbers indicate the a.a. position from the first methionine). Chimera 1 (open triangle) is a fusion of hPPAR{delta} (137–261) and cPPARß (264–443), chimera 2 (open circle) encodes a fusion of hPPAR{delta} (137–261), cPPARß (264–383), and hPPAR{delta} (382–441), and chimera 3 (solid circle) is a fusion of hPPAR{delta} (137–381) and cPPARß (384–443). B, Cotransfection experiments were performed as described in Fig. 2Go with the addition of bezafibrate, GW2331, and carbaprostacyclin as indicated. Chimeras 1 and 3 showed response to bezafibrate and GW2331, and all constructs were responsive to carbaprostacyclin. Vertical axis represents fold activation.

 
During the course of this work, we solved the crystal structure of the fibrate GW2331 bound to hPPAR{delta} (Fig. 4Go). As in the case of other PPAR ligands, the carboxylic acid of GW2331 (see Table 1Go) was found to form an intricate series of hydrogen bonds with histidine residues in helices 5 and 10 and a tyrosine in the AF-2 helix (15, 16). We postulate that this network of interactions effectively locks the receptor into a conformation permissive for coactivator interactions. Notably, M417 in helix 10 is bent into an unfavorable conformation for accommodation of the gem-dialkyl constituent of the GW2331 fibrate headgroup. The steric interference between M417 and the fibrate may explain the relatively low-affinity binding of GW2331 to hPPAR{delta}.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 4. The hPPAR{delta}-GW2331 Cocrystal Structure

Left panel, The hPPAR{delta} polypeptide backbone is shown as a yellow ribbon. The carbon atoms of GW2331 are shown in green. The oxygen and fluorine atoms of GW2331 are shown in red and orange, respectively. Right panel, Close-up view of the fibrate headgroup of GW2331 bound to the hPPAR{delta} LBD. The carbon and oxygen atoms of GW2331 are shown in green and red, respectively. The side chains of M416 and M417 are shown with the carbon and sulfur atoms depicted in blue and orange, respectively. The side chain of M417 is bent into a high-energy configuration by the gem-dialkyl of GW2331.

 
Sequence comparison revealed that both the chick and Xenopus PPARß subtypes have a valine residue at the position analogous to M417. The shorter side chain of valine would be expected to better accommodate the gem-dialkyl substituent of the fibrate headgroup. These data suggested that this single residue might be a key determinant in the binding of fibrates to PPARs. To test this hypothesis, we constructed the following mutants (depicted in Fig. 5AGo); one in which M417 of hPPAR{delta} was changed to valine (hPPAR{delta}417V) and the reverse where the corresponding valines of cPPARß and hPPAR{alpha} were altered to methionine (cPPARß419M, hPPAR{alpha}444M). Reporter assays confirmed that the substitution of a valine confers the ability for a fibrate response to hPPAR{delta}417V and, reciprocally, replacement of the more compact valine with methionine results in loss of response to the fibrates (Fig. 5BGo). This alteration in ligand responsiveness was found to correlate with changes in ligand binding as inferred from protease digestion assays using functionally equivalent constructs (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. A Single Amino Acid Residue Confers Subtype-Specific Ligand Recognition

Data are represented as the mean ± SE; n = 6. A, A schematic representation of GAL4-fusion point mutants; hPPAR{delta}417V (Met to Val change at position 417) and cPPARß419M, hPPAR{alpha}444M (Val to Met change at positions 419 and 444, respectively). B The above constructs were analyzed in cotransfection experiments with 10 µM bezafibrate, 10 nM GW2331, and 10 µM carbaprostacyclin.

 
In summary, the isolation and characterization of the cPPAR homologs have provided an opportunity to study how this class of receptors may have evolved. The chimeric analyses together with x-ray crystallographic studies of the fibrate GW2331 bound to hPPAR{delta} allowed us to localize a difference in ligand responsiveness to M417 in helix 10 of the human receptor. This work illustrates that a single amino acid change may be sufficient to acquire a new ligand binding specificity as well as to suppress recognition of a previous ligand. Our data agree with and extend the observations of others who showed that changes in one or several amino acids can result in marked alterations in the ligand selectivity of nuclear receptors (9, 17). Alteration of a single amino acid would be the minimum change necessary to generate a functionally distinct receptor. In combination with a preexisting gene duplication, this represents the simplest conceptual mechanism for the formation of a new receptor gene family.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of cPPAR cDNAs
cDNA clones encoding the cPPARs were obtained from 7-week-old male broiler adipose tissue (Stratagene) and stage 17–18 chick embryonic {lambda}ZAP cDNA libraries (18) with mouse PPAR{gamma} (13) and mouse retinoid X receptor-ß (RXRß) (19) cDNAs as probes using standard low-stringency hybridization procedures. Insert cDNA fragments were recovered from purified positive clones into pBluescript vectors for restriction enzyme mapping and DNA sequencing. Full-length cDNA sequences for each of three PPAR subtypes were assembled and analyzed by DNA sequencing using ALFexpress (Pharmacia Biotech, Piscataway, NJ).

Plasmid Construction
Full length coding sequences for cPPAR{alpha}, PPARß, and PPAR{gamma} were inserted into a pCMX expression vector (20), giving rise to pCMX-cPPAR{alpha}, pCMX-cPPARß/{delta}, and pCMX-cPPAR{gamma}, respectively. GAL4 fusions of the PPAR LBDs were prepared by PCR amplification of the DNA fragments encoding the respective LBDs from corresponding pCMX plasmid templates. Sequences of primers used are TTGGGTTTGTCGACGGAATGT CACATAATGCAATACGT (forward) and TTTGGGTTTGGA-TCCAAAAATCCTTAATACATG TCCCT (reverse) for PPAR{alpha}, TTGGTTGAATTCGGCATGTCACATAACGCAAT (forward) and TTTGGGTTTGTCGACAAGAGGTCCTTAGTACATGTCCTTGTA (reverse) for PPARß/{delta}, and TTTGGGTTTGAATTCGGAATGTCACATAATGCCATC (forward) and TGGGGTTTGGATC CGA-ACTACTATCGCCATTAATATAAGTC (reverse) for PPAR{gamma}. The amplified DNA fragments were digested with SalI and BamHI for PPAR{alpha}, EcoRI and SalI for PPARß and PPAR{gamma}, and inserted at the respective sites in the pCMX-GAL4 derivatives to prepare pCMX-GAL4-cPPAR{alpha}, pCMX-GAL4-cPPARß, and pCMX-GAL4-cPPAR{gamma}. GAL4 fusion constructs for the hPPARs were previously described (11).

Transactivation Assays
Monkey kidney CV-1 cells were used for transfection assays in 24-well cluster tissue culture plates by calcium phosphate precipitation (21). Transfection mixtures contained 50 ng of receptor expression plasmid, 150 ng of MH100x4-tk-luc reporter plasmid, 350 ng of pCMX-ßGAL as control for transfection efficiency, and 200 ng of pGEM4 carrier plasmid. Cells were transfected for 7 h, washed, and incubated for approximately 36 h in serum-free media containing 5 µg/ml insulin, 5 µg/ml transferrin, 0.01% fatty acid free BSA, plus ligand compounds where indicated, before harvesting and assaying for luciferase and ß-galactosidase activity. All points were performed in triplicate and repeated at least twice in independent experiments with variations of less than 10%.

Mutagenesis
GAL4 fusions of chimeric constructs encoding hPPAR{delta} and cPPARß LBDs were prepared as follows. Chimera 1 was prepared by digestion of cPPARß/{delta} with SacI/BglII and ligation into respective sites of pCMX-GAL4 hPPAR{delta}. Chimera 2 was prepared by PCR amplification of chimera 1 and ligation to the C-terminal region of hPPAR{delta}. Sequences of primers used are TTTGTCGACGGCATGTCACACAACGCTATCCG (forward) and GGACTGCAGGTGGAATTCCAGTG (reverse). Amplified DNA fragments were digested with SalI/EcoRI and ligation into respective sites of pCMX-GAL4-hPPAR{delta}. Chimera 3 was prepared by PCR amplification from pCMX-cPPARß and ligation to pCMX-hPPAR{delta}. Primer sequences used are CACTGGAATTCCACCTGCAGTCC (forward) and TTTGGGTTTGTCGACAAGAGG TCCTTAGTACATGTCCTTGTA (reverse). The amplified DNA fragments were digested with EcoRI and BglII and inserted at the respective sites in pCMX-GAL4-hPPAR{delta}.

GAL4 fusions of the mutant hPPAR{alpha} and -{delta} and cPPARß LBD were prepared by PCR amplification first on N-terminal and mutated sites and subsequently on mutated sites and C termini. N-terminal and C-terminal primers were used to obtain the full-length construct. Primer sequences used for hPPAR{delta}417V, TTTGTCGACGGCATGTCACACAACGCTATCCG (forward) and CCGCTGAACCATCTGGGCGTGCTCG (reverse), were for N-terminal fragment; CGAGCACGCCCAGATGGTTCAGCGG (forward) and TTTGGATCCTTAGTACATGTCCT TGTAGATCTCCTGGAGC (reverse) were for C-terminal fragment. In cPPAR-ß419M, TGGGTTTGAATTCGGCATGTCACATAACGCAATCC (forward) and CTGCATCAGCTGGG CGTGC (reverse) were for N-terminal fragment; GCACGCCCAGCTGATGCAG (forward) and TTTGGGTTTGTCGACAAGAGGTCCTTAGTACATGTCCT-TGTA (reverse) were for C-terminal fragment. In hPPAR{alpha}444M, TTTGGGGGTCGACTCACACAACGCGATTCGTTT TGG (forward) and CTGCATCAGCTGCGCATGCT (reverse) are for N-terminal fragment; AGCATGCGCAGCTGATGCAG (forward) and TTTGGGGATCCTCAGTACATGTCCCTG TAGATCT (reverse) are for C-terminal fragment. All constructs were confirmed by DNA sequencing using ALFexpress (Pharmacia Biotech).

Protease Digestion Assay
35S-radiolabeled proteins were synthesized from 1 µg of pCMX-PPARs by the reticulocyte lysate system (Promega Corp.). Of the total 40 µl of labeled in vitro translated PPAR proteins, 15 µl were preincubated for 30 min at 37 C in 40 µl of binding buffer [final 10 mM Tris-HCl, pH 8.0, 80 mM KCl, 0.1% NP40, 7% glycerol, 1 mM dithiothreitol (DTT)] with activators (bezafibrate, carbaprostacyclin, GW2331) that were dissolved in 1x binding buffer. Protease digestion assays were initiated by the addition of 2 µl of 5x stock solution of trypsin to 8 µl of translation products and carried out for 10 min at 37 C. Reactions were stopped by addition of 10 µl of 2x loading buffer (62.5 mM Tris HCl, pH 6.8, 2% SDS, 10% glycerol, 50 mM DTT, 5 µg/ml bromophenol blue). Samples were loaded and electrophoresed on a 12% acrylamide-SDS gel, and the gel was dried under vacuum for 2 h and analyzed using BAS Imager (FUJIX, Tokyo, Japan).

Crystallography
The procedures for determining the cocrystal structure of GW2331 bound to the hPPAR{delta} LBD, including the protein purification, crystal growth, and structure refinement, were performed as previously described (16). The structure was determined at 2.5 A resolution and was refined with an R factor of 28.3% (31.4% for the free R), which revealed clear electron density for GW2331 and the LBD pocket residues surrounding the compound.


    ACKNOWLEDGMENTS
 
We thank K. Yasuda for his support during the early part of this project, T. Willson, H. Oizumi, and members of the Umesono laboratory for valuable advice and discussion, and E. Stevens for administrative assistance.


    FOOTNOTES
 
Address requests for reprints to: Ruth T. Yu, Institute for Virus Research, Kyoto University, 53 Kawaharacho, Shogoin, Sakyoku, Kyoto 606-8507, Japan.

This work was supported in part by grants from Japan Society for Promotion of Science and Human Frontiers Science Program. This paper is dedicated to K. Umesono.

1 Deceased April 12, 1999. Back

2 The sequences reported in this paper have been deposited in the GenBank database [accession nos. AF163809 (cPPAR{alpha}), AF163810 (cPPARß/{delta}), and AF163811 (cPPAR{gamma})]. Back

Received for publication December 10, 1999. Revision received January 25, 2000. Accepted for publication January 27, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sorensen HN, Treuter E, Gustafsson JA 1998 Regulation of peroxisome proliferator-activated receptors. Vitam Horm 54:121–166[Medline]
  2. Kliewer SA, Lehmann JM, Willson TM 1999 Orphan nuclear receptors: shifting endocrinology into reverse. Science 284:757–760[Abstract/Free Full Text]
  3. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R, Santini C, Sahoo SP, Tolman RL, Smith RG, Moller DE 1999 Novel peroxisome proliferator-activated receptor (PPAR){gamma} and PPAR{delta} ligands produce distinct biological effects. J Biol Chem 274:6718–6725[Abstract/Free Full Text]
  4. Brown PJ, Smith-Oliver TA, Charifson PS, Tomkinson NC, Fivush AM, Sternbach DD, Wade LE, Orband-Miller L, Parks DJ, Blanchard SG, Kliewer SA 1997 Identification of peroxisome proliferator-activated receptor ligands from a biased chemical library. Chem Biol 4:909–18[CrossRef][Medline]
  5. Forman BM, Chen J, Evans RM 1997 Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors {alpha} and {delta} Proc Natl Acad Sci USA 94:4312–4317[Abstract/Free Full Text]
  6. Krey G, Braissant O, L’Horset F, Kalkhoven E, Perroud M, Parker MG, Wahli W 1997 Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator- activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol 11:779–791[Abstract/Free Full Text]
  7. Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680[Abstract/Free Full Text]
  8. Mukherjee R, Jow L, Noonan D, McDonnell DP 1994 Human and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activators. J Steroid Biochem Mol Biol 51:157–166[CrossRef][Medline]
  9. Keller H, Devchand PR, Perroud M, Wahli W 1997 PPAR{alpha} structure-function relationships derived from species-specific differences in responsiveness to hypolipidemic agents. J Biol Chem 378:651–655
  10. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} ( PPAR {gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  11. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM, Lehmann JM 1997 Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors {alpha} and {gamma}. Proc Natl Acad Sci USA 94:4318–4323[Abstract/Free Full Text]
  12. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W 1992 Control of the peroxisomal ß-oxidation pathway by a novel family of nuclear hormone receptors. Cell 68:879–887[CrossRef][Medline]
  13. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borg-meyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 91:7355–7359[Abstract/Free Full Text]
  14. Schmidt A, Endo N, Rutledge SJ, Vogel R, Shinar D, Rodan GA 1992 Identification of a new member of the steroid hormone receptor superfamily that is activated by a peroxisome proliferator and fatty acids. Mol Endocrinol 6:1634–1641[Abstract/Free Full Text]
  15. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–43[CrossRef][Medline]
  16. Xu HE, Lambert MH, Montana VG, Parks DJ, Blanchard SG, Brown PJ, Sternbach DD, Lehmann JM, Wisely GB, Willson TM, Kliewer SA, Milburn MV 1999 Molecular recognition of fatty acids by peroxisome proliferator-activated receptor. Mol Cell 3:397–403[CrossRef][Medline]
  17. Peet DJ, Doyle DF, Corey DR, Mangelsdorf DJ 1998 Engineering novel specificities for ligand-activated transcription in the nuclear hormone receptor RXR. Chem Biol 5:13–21[CrossRef][Medline]
  18. Yu RT, McKeown M, Evans RM, Umesono K 1994 Relationship between Drosophila gap gene tailless and a vertebrate nuclear receptor Tlx. Nature 370:375–379[CrossRef][Medline]
  19. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  20. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  21. Umesono K, Evans RM 1989 Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:1139–1146[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Pochetti, C. Godio, N. Mitro, D. Caruso, A. Galmozzi, S. Scurati, F. Loiodice, G. Fracchiolla, P. Tortorella, A. Laghezza, et al.
Insights into the Mechanism of Partial Agonism: CRYSTAL STRUCTURES OF THE PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR {gamma} LIGAND-BINDING DOMAIN IN THE COMPLEX WITH TWO ENANTIOMERIC LIGANDS
J. Biol. Chem., June 8, 2007; 282(23): 17314 - 17324.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Yin, R. G. Russell, L. E. Dettin, R. Bai, Z.-L. Wei, A. P. Kozikowski, L. Kopleovich, and R. I. Glazer
Peroxisome Proliferator-Activated Receptor {delta} and {gamma} Agonists Differentially Alter Tumor Differentiation and Progression during Mammary Carcinogenesis
Cancer Res., May 1, 2005; 65(9): 3950 - 3957.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. Adachi, A. I. Shulman, K. Yamamoto, I. Shimomura, S. Yamada, D. J. Mangelsdorf, and M. Makishima
Structural Determinants for Vitamin D Receptor Response to Endocrine and Xenobiotic Signals
Mol. Endocrinol., January 1, 2004; 18(1): 43 - 52.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Kamei, H. Ohizumi, Y. Fujitani, T. Nemoto, T. Tanaka, N. Takahashi, T. Kawada, M. Miyoshi, O. Ezaki, and A. Kakizuka
PPAR{gamma} coactivator 1{beta}/ERR ligand 1 is an ERR protein ligand, whose expression induces a high-energy expenditure and antagonizes obesity
PNAS, October 14, 2003; 100(21): 12378 - 12383.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. E. Xu, M. H. Lambert, V. G. Montana, K. D. Plunket, L. B. Moore, J. L. Collins, J. A. Oplinger, S. A. Kliewer, R. T. Gampe Jr., D. D. McKee, et al.
Structural determinants of ligand binding selectivity between the peroxisome proliferator-activated receptors
PNAS, October 31, 2001; (2001) 241410198.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Hornung, L. L. Waite, E. A. Ricke, F. Bentzien, D. Wallwiener, and R. N. Taylor
Nuclear Peroxisome Proliferator-Activated Receptors {{alpha}} and {{gamma}} Have Opposing Effects on Monocyte Chemotaxis in Endometriosis
J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3108 - 3114.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
R. T. Miller and T. M. Willson
Regulation of Xenobiotic Metabolism by Orphan Nuclear Receptors
Toxicol Pathol, January 1, 2001; 29(1): 3 - 5.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. E. Xu, M. H. Lambert, V. G. Montana, K. D. Plunket, L. B. Moore, J. L. Collins, J. A. Oplinger, S. A. Kliewer, R. T. Gampe Jr., D. D. McKee, et al.
Structural determinants of ligand binding selectivity between the peroxisome proliferator-activated receptors
PNAS, November 20, 2001; 98(24): 13919 - 13924.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takada, I.
Right arrow Articles by Umesono, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takada, I.
Right arrow Articles by Umesono, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*Structure*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*(L)-METHIONINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals