| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pediatrics Rhode Island Hospital (C.M.B., P.A.G.,
R.A.F.) Providence, Rhode Island 02903
Department of
Medicine (A.R.F.) Roger Williams Hospital Providence, Rhode
Island 02908
Departments of Pediatrics and Pathology and
Laboratory Medicine Brown University Providence, Rhode Island
02906
| ABSTRACT |
|---|
|
|
|---|
(PPAR
) and lipoprotein
lipase (LPL). Transient transfection of subconfluent cells with
Shc-Y317F, a dominant-negative mutant, attenuated IGF-I-mediated MAPK
activation, inhibited DNA synthesis, and accelerated expression of
differentiation markers aP-2, PPAR
, and LPL. We conclude that
signaling through Shc to MAPK plays a critical role in mediating
IGF-I-stimulated 3T3-L1 mitogenesis. Our results suggest that loss of
the ability of IGF-I to activate Shc signaling to MAPK may be an early
component of adipogenesis in 3T3-L1 cells.
plays an important role in preadipocyte growth and differentiation.
IGF-I stimulates mitogenesis in many cell types in culture, including
preadipocytes (1), and IGF-I (or pharmacological doses of insulin) is
clearly required for preadipocyte differentiation in vitro
(2, 3). This dual role of IGF-I, stimulation of both mitogenesis and
differentiation, indicates that these responses are not necessarily
mutually exclusive. In vitro, IGF-I stimulates
differentiation of preadipocytes once density-induced growth arrest has
occurred (4). The mechanisms of intracellular signaling used by IGF-I to promote mitogenesis or differentiation of preadipocytes are now beginning to be elucidated. The biological effects of IGF-I are mediated through the IGF-I receptor (IGFR), a member of the tyrosine kinase family of growth factor receptors. The activated IGFR tyrosine kinase phosphorylates specific substrates, such as the adaptor proteins Shc and insulin receptor substrate-1 (IRS-1). Tyrosine phosphorylation of these proteins stimulates specific protein-protein interactions via well characterized domains to mediate diverse signaling pathways (5). Shc, a substrate for many growth factor receptor tyrosine kinases, is a key component of signaling complexes that activate several effector pathways, including the small G- protein Ras (6). Ras then activates the three-kinase cascade terminating in the mitogen-activated protein kinases (MAPKs), extracellular signal regulated kinase 1 (ERK1) and ERK2 (7, 8). These MAPK isoforms mediate the mitogenic effects of IGF-I in a number of cell types (911). IRS-1, considered to be the major substrate of the IGFR, can activate multiple downstream targets, including Ras and phosphatidylinositol 3- kinase (PI3K) (5, 12).
We have previously shown that IGF-I is a potent stimulator of the MAPKs ERK1 and ERK2 in proliferating 3T3-L1 preadipocytes, and that there is a dramatic decrease in IGF-I-stimulated MAPK activity during early differentiation of 3T3-L1 cells (13). This change in MAPK signaling coincides with the loss of IGF-I-stimulated Shc, but not IRS-1, phosphorylation. This indicates that proximal signaling through Shc to MAPK is down-regulated very early in IGF-I-mediated preadipocyte differentiation. Activation of MAPK in growth-arrested 3T3-L1 cells through transfection of active components of the MAPK cascade (14) or by epidermal growth factor (15, 16) inhibits differentiation. Therefore, down-regulation of MAPK activity may be necessary for preadipocyte differentiation.
We hypothesized that down-regulation of MAPK via loss of proximal signaling by Shc is involved in mediating the IGF-I switch from 3T3-L1 mitogenesis to differentiation. We used a synthetic inhibitor of MAPK activation (PD098059) or a dominant-negative form of Shc to inhibit mitogenesis and promote differentiation in 3T3-L1 cells independently of the usual requirement for density-induced growth arrest. PD098059 inhibits high-dose insulin stimulation of MAPK in 3T3-L1 cells (14). The Shc mutant consists of a tyrosine-to-phenylalanine substitution at position 317, rendering it defective in signaling to Ras (17). Our results demonstrate the critical role of Shc in the switch from IGF-I-mediated mitogenesis to IGF-I-mediated differentiation of 3T3-L1 cells.
| RESULTS |
|---|
|
|
|---|
|
The Effect of PD098059 on IGF-I-Stimulated Differentiation in
Subconfluent 3T3-L1 Preadipocytes
To test the hypothesis that loss of MAPK activation is
permissive for IGF-I-mediated differentiation, we treated
subconfluent 3T3-L1 preadipocytes with differentiation-inducing medium
(DMI) in the absence or presence of PD098059. Expression of
differentiation-specific genes was determined by Northern analysis and
RT-PCR. Northern analysis of total RNA for the lipid-binding protein
adipocyte protein-2 (aP-2), a late marker of adipocyte differentiation,
revealed detectable expression after treatment with DMI but enhanced
expression in the presence of PD098059 (Fig. 2
). We then examined earlier markers of
differentiation, peroxisome proliferator-activated receptor
(PPAR
), and lipoprotein lipase (LPL), using semiquantitative RT-PCR.
Subconfluent preadipocytes were treated with DMI or serum-containing
medium in the absence or presence of PD098059. PD098059 led to a modest
enhancement in the expression of PPAR
in this and other repeat
experiments. However, LPL was only detected in total RNA from cells
treated with both PD098059 and DMI (Fig. 3
). These data suggest that inhibition of
MAPK in subconfluent, proliferating 3T3-L1 cells accelerates
differentiation.
|
|
|
|
and LPL was evaluated by RT-PCR.
After 60 h of treatment with DMI, cells transfected with
dominant-negative Shc, but not empty vector (GST alone) or GST-wild
type Shc, expressed significant PPAR
(Fig. 7A
(data not shown), but
only cells transfected with the Shc mutant expressed LPL (Fig. 7B
|
|
| DISCUSSION |
|---|
|
|
|---|
Inhibition of MAPK by PD098059 promotes differentiation in subconfluent
as well as growth-arrested 3T3-L1 cells. Compared with treatment with
DMI alone, PD098059 increased expression of PPAR
and significantly
increased expression of the later markers, suggesting that inhibition
of MAPK activation is permissive for IGF-I-stimulated differentiation.
Similar data were shown by Font de Mora et al. (14) using
pharmacological doses of insulin in postconfluent cells. They
demonstrated PD098059 inhibition of MAPK activation by insulin in
3T3-L1 cells and a small increase in differentiation markers in
PD098059-treated growth-arrested cells. However, we have previously
shown that MAPK activation by IGF-I in growth-arrested 3T3-L1
preadipocytes is already decreased (13), so we would predict the effect
of PD098059 to be attenuated in growth-arrested compared with
subconfluent cells.
Our results show that inhibition of MAPK, even in the absence of
density-induced growth arrest, permits differentiation of 3T3-L1 cells.
Similar observations have been made in IGF-I-mediated growth and
differentiation of rat fetal brown adipocytes (23) and L6A1 myoblasts
(24). Those studies demonstrated the role of MAPK activation in
mitogenesis and the promotion of differentiation by MAPK inhibition
using PD098059, leading us to conclude that these signaling mechanisms
may be common to cell systems in which IGF-I stimulates both
proliferation and differentiation. In addition, mitogenic hormones such
as epidermal growth factor and tumor necrosis factor
(15, 16), as
well as transfection of constitutively active components of the MAPK
cascade, inhibit 3T3-L1 differentiation by activation of MAPK (14). We
conclude that loss of MAPK activation is both permissive and necessary
for 3T3-L1 differentiation.
Several elegant studies by others have investigated the role of upstream mediators of MAPK in 3T3-L1 differentiation, including Raf-1 and Ras (25, 26). Although these data indicate a role for Ras, and to a lesser extent Raf-1, in IGF-I-mediated 3T3-L1 differentiation, these signaling molecules activate MAPK in proliferating, but not differentiating, cells (27, 28). Further upstream, signaling complexes are formed from activated adaptor proteins such as Shc or IRS-1, which can then bind Grb2 and Sos (5). These signaling complexes activate the small G protein Ras, which leads to Raf-1 activation. Raf-1 is the first kinase in the three-kinase cascade ending in MAPK (7, 8).
We have previously shown that loss of MAPK activation by IGF-I in differentiating cells is associated with loss of Shc but not IRS-1 tyrosine phosphorylation (13). We have now presented evidence suggesting that Shc is a critical upstream mediator of MAPK activation in IGF-I-mediated 3T3-L1 mitogenesis. We did so by transiently expressing a dominant-negative Shc that is defective in signaling to Ras. This ShcY317F mutant blocked IGF-I activation of MAPK, inhibited IGF-I-stimulated BrdU incorporation, and promoted differentiation in subconfluent 3T3-L1 cells. We found no inhibition of IRS-1 tyrosine phosphorylation and associated binding of the p85 subunit of PI3K in cells transfected with empty vector (GST alone), wild-type Shc, or ShcY317F (data not shown). Studies by Ishihara et al. (29) found inhibition of IRS-1 signaling in stably transfected Rat1 fibroblasts expressing insulin and not IGF-I receptors, GST-wild-type Shc and GST-ShcY317F. However, unlike our experiments, expression of the GST-Shc proteins (wild-type and Y317F mutant) was in 10-fold excess of endogenous Shc, suggesting to us that inhibition of insulin-stimulated IRS-1 signaling may have been partly a result of the stoichiometry of the transfected proteins. Although we cannot absolutely rule out a role for IRS-1 in IGF-I mitogenic signaling, our results indicate a crucial role for Shc. Shc proteins have been shown to mediate the mitogenic effects of IGF-I in a number of other cell culture systems, including human neuroblastoma cells (30), myeloid progenitor cells (31), and rat-1 fibroblasts (32). On the other hand, IRS-1 (33) and its downstream targets PI3K (34, 35, 36) and protein kinase B (37, 38) appear to have major roles in mediating the differentiating effects of IGF-I in 3T3-L1 cells as well as fetal rat brown adipocytes.
We interpret our present and prior results to suggest that a change in IGF-I signaling from Shc-mediated mitogenesis to IRS-1-mediated differentiation is central to the process of adipogenesis. Our results indicate that inhibiting mitogenesis in subconfluent cells by inhibition of MAPK or transient transfection of the ShcY317F mutant is permissive for differentiation. However, the mechanisms responsible for the switch in Shc signaling, i.e. loss of IGF-I receptor phosphorylation of Shc, but not IRS-1, as 3T3-L1 cells become postconfluent, are unknown. One can speculate on a number of possibilities. For example, a change in IGF-I receptor internalization has been shown to affect Shc but not IRS-1 signaling (39). Binding of regulatory proteins such as Grb10 (40, 41), or protein kinases such as Src (42), protein kinase C (43, 44), or PI3K (44, 45) might directly or indirectly affect IGF-I receptor function. Interaction of the IGF-I receptor with other receptors or integrins (46) has been shown to regulate IGF-I receptor function. There are also many potential mechanisms that could affect Shc phosphorylation independent of a change in IGF-I receptor function, including interactions with IRS-1 (47), Shc phosphatases such as PTEN (48), Src (49), and integrins (50). Relevant to all these potential mechanisms is the conclusion that Shc represents a crucial point of divergence between IGF-I-mediated mitogenesis and IGF-I-stimulated differentiation of 3T3-L1 cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture and Transfection
The murine preadipocyte line 3T3-L1 was obtained from
American Type Culture Collection (Manassas, VA). Cells
were grown in DMEM with l-glutamine, 1 g/liter glucose, 50 µg/ml
penicillin, 100 µg/ml streptomycin, 0.25 µg/ml
Amphotericin, (Life Technologies, Inc.,
Gaithersburg, MD) and 10% FBS. Cultures were maintained in an
atmosphere of 5% CO2-95% humidified air at 37
C. Serum-containing medium (SCM) was replaced every 3 days.
Differentiation-inducing medium consisted of 0.5 µM
dexamethasone, 0.5 mM methylisobutylxanthine, and 7
nM IGF-I (DMI) in SCM.
For transient transfection of 3T3-L1 cells, cells were seeded in six-well plates. The plasmids provided included ShcY317F cloned into pEBG as a GST fusion protein, wild- type Shc cloned into pEBG as a GST fusion protein, and the pEBG vector containing only GST (empty vector). The mutant Shc, wild-type Shc, or the empty vector was transfected into 50% confluent cells with pGreen Lantern at a ratio of 10:1. The plasmid pGreen Lantern expresses green fluorescent protein and was used as a marker of transfection efficiency. Initially the reagent Lipofectin (Life Technologies, Inc.) was used with transfection efficiencies of 2030%. Improved transfection was subsequently obtained using GenePorter (Gene Therapy Systems, San Diego, CA) with transfection efficiencies of 4050%. Cells were used for experiments 2448 h after transfection.
Evaluation of Apoptosis by Flow Cytometry
3T3-L1 cells were grown to 5060% confluency in
10-cm2 dishes. After overnight incubation in
either SCM or SCM containing 50 µM PD098059, cells were
detached with 0.05% trypsin and 0.5 mM EDTA, resuspended
in SCM, and washed once with PBS. The cells were resuspended in PBS and
stained with 0.02% propidium iodide (Sigma) for 510
min. DNA content was analyzed on a FACSort (Becton Dickinson and Co. Immunocytometry Systems, San Jose, CA) equipped with an
argon-ion laser at 488 nm and Modifit LT software (Verity Software
House, Inc., Topsham, ME).
Western Blotting
Preparation of cell lysates for Western blotting was as
described previously (13), using lysis buffer with 1% Triton X-100 for
anti-Shc Western blots and 0.2% Triton X-100 for anti-phospho-MAPK
Western blots. Proteins were resolved by SDS-PAGE on 10% acrylamide
gels and transferred to nitrocellulose. Membranes were blocked in 5%
BSA in Tris-buffered saline with 0.1% Triton X-100 and probed with
primary antibody at 1 µg/ml. Specific binding was visualized using
enhanced chemiluminescence and Hyperfilm ECL and then analyzed by
digital image analysis using a ScanJet 6100C/T scanner
(Hewlett-Packard Co., Palo Alto, CA).
RNA Preparation And Northern Blot Analysis
Total RNA was prepared using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH). Aliquots of total RNA
were denatured with dimethylsulfoxide and glyoxal, fractionated by
agarose gel electrophoresis and transferred to GeneScreen nylon
membranes (NEN Life Science Products, Boston, MA). Membranes were
prehybridized in High Efficiency Hybridization solution without
formamide (Molecular Research Center, Inc., Cincinnati,
OH) and then hybridized with
[
-32P]dCTP-radiolabeled cDNA for aP-2 using
a random primed labeling kit (Roche Molecular Biochemicals, Indianapolis, IN). After extensive
posthybridization rinses at 60 C, blots were exposed to X-Omat film
(Eastman Kodak Co.).
Semiquantitative RT-PCR
Aliquots of 2 µg total RNA were DNAse treated before reverse
transcription and primer-dropping PCR as described previously (51).
Primer sequences used for detection of murine PPAR
2 transcripts were
taken from Vidal-Puig et al. (52) and resulted in a
predicted PCR product of 277 bp. Primer sequences used for detection of
murine LPL transcripts were, from 5' to 3', left GCGTAGCAGGAAGTCTGACC,
right CTACAACTCAGGCAGAGCCC and resulted in a predicted PCR product of
421 bp. Primers for murine GAPDH were purchased from CLONTECH Laboratories, Inc. and resulted in a predicted PCR product of
980 bp. Optimal PCR cycles required for linear amplification for each
primer set were determined. Total amplification in each reaction (GAPDH
plus PPAR
2 or GAPDH plus LPL) was kept below saturation levels to
permit the two products to remain within each primer sets exponential
range. GAPDH required 16 to 20 cycles, and its expression was the same
in proliferating, postconfluent or differentiating 3T3-L1 cells.
PPAR
2 required 2226 cycles and LPL required 1922 cycles, and
these cycles were determined from differentiating 3T3-L1 cells. Gels
were illuminated with UV light and photographed with Polaroid film.
3H-Thymidine and Bromodeoxyuridine (BrdU)
Incorporation
For 3H-thymidine incorporation, cell
monolayers were grown to approximately 70% confluence in six-well
plates and serum-starved overnight in DMEM with 0.1% BSA before
treatment with 10 nM IGF-I for 24 h. Cells were
incubated with 50 µM PD098059 (from a stock of 50
mM in DMSO) or an equal volume of DMSO in the presence of 1
µCi/well 3H-thymidine for 6 h before lysis
in 0.33 M NaOH. An aliquot was removed for protein assay
before DNA precipitation with ice-cold 40% TCA/1.2 M HCl
and collection on glass fiber filters for counting. The background
level of 3H-thymidine was less than 200 cpm as
determined by the addition of 3H-thymidine to a
control well just before cell lysis and DNA precipitation.
BrdU incorporation was determined in cell monolayers transfected with wild-type Shc or ShcY317F at 50% confluency in six-well plates. Forty-eight hours after transfection, monolayers were placed in DMEM plus 0.1% BSA or DMEM plus 0.1% BSA and 10 nM IGF-I overnight followed by incubation with 10 µM BrdU (BrdU labeling and detection kit II, Roche Molecular Biochemicals) for 4 h. The cell monolayers were fixed in 100% ice-cold methanol at -20 C for 10 min, allowed to air dry, and then stored at -20 C.
Immunocytochemistry
For immunocytochemical costaining of BrdU incorporation and GST
expression, fixed cells were blocked in 1% normal goat serum before
incubation with 1:15 dilution of mouse anti-BrdU (BrdU labeling and
detection kit II, Roche Molecular Biochemicals) at 37 C
for 60 min followed by 10 µg/ml fluorescein
isothiocyanate-conjugated goat antimouse IgG at room temperature
for 30 min. The monolayers were washed with PBS, blocked in 1% normal
donkey serum, and then blocked with avidin and biotin. Cells were
incubated in 10 µg/ml rabbit anti-GST in 1% normal donkey serum
followed by 10 µg/ml biotin-conjugated donkey anti-rabbit IgG and
then Texas red streptavidin at a 1:200 dilution. All incubations were
at room temperature for 30 min. Coverslips were mounted with
Vectashield plus DAPI. Random fields of view were evaluated using an
Eclipse 800 Photomicroscope (Nikon, Melville, NY) equipped
with an epi-fluorescence condenser to analyze staining of BrdU in the
nucleus and GST in the cytoplasm. Total number of cells was determined
from DAPI staining of nuclei. Photomicrographs of monolayers were
recorded using a Sensys digital camera connected to a power MacIntosh
8500 running IP Lab Spectrum P imaging software.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by a Charles H. Hood Foundation Child Health Research Grant and a Knoll Pharmaceutical Co. Weight Risk Investigators Study Council Grant (to C.M.B.), Rhode Island Hospital Department of Pediatrics Research Endowment, and NIH Grants HD-24455 and HD-35831 (to P.A.G.).
Received for publication December 14, 1999. Revision received March 15, 2000. Accepted for publication March 22, 2000.
| REFERENCES |
|---|
|
|
|---|
.
Science 274:21002103
activity by mitogen-activated
protein kinase. J Biol Chem 272:1081110816
gene expression
by nutrition and obesity in rodents. J Clin Invest 97:25532561[Medline]
This article has been cited by other articles:
![]() |
G. J. Hausman, M. V. Dodson, K. Ajuwon, M. Azain, K. M. Barnes, L. L. Guan, Z. Jiang, S. P. Poulos, R. D. Sainz, S. Smith, et al. BOARD-INVITED REVIEW: The biology and regulation of preadipocytes and adipocytes in meat animals J Anim Sci, April 1, 2009; 87(4): 1218 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Martin, R. Brenneman, E. Golden, T. Walent, K. G. Becker, V. V. Prabhu, W. Wood III, B. Ladenheim, J.-L. Cadet, and S. Maudsley Growth Factor Signals in Neural Cells: COHERENT PATTERNS OF INTERACTION CONTROL MULTIPLE LEVELS OF MOLECULAR AND PHENOTYPIC RESPONSES J. Biol. Chem., January 23, 2009; 284(4): 2493 - 2511. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xi, X. Shen, and D. R. Clemmons p66shc Negatively Regulates Insulin-Like Growth Factor I Signal Transduction via Inhibition of p52shc Binding to Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Substrate-1 Leading to Impaired Growth Factor Receptor-Bound Protein-2 Membrane Recruitment Mol. Endocrinol., September 1, 2008; 22(9): 2162 - 2175. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-A. Kim, J.-H. Kim, Y. Wang, and H. S. Sul Pref-1 (Preadipocyte Factor 1) Activates the MEK/Extracellular Signal-Regulated Kinase Pathway To Inhibit Adipocyte Differentiation Mol. Cell. Biol., March 15, 2007; 27(6): 2294 - 2308. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lieskovska, Y. Ling, J. Badley-Clarke, and D. R. Clemmons The Role of Src Kinase in Insulin-like Growth Factor-dependent Mitogenic Signaling in Vascular Smooth Muscle Cells J. Biol. Chem., September 1, 2006; 281(35): 25041 - 25053. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Laviola, S. Perrini, A. Cignarelli, A. Natalicchio, A. Leonardini, F. De Stefano, M. Cuscito, M. De Fazio, V. Memeo, V. Neri, et al. Insulin signaling in human visceral and subcutaneous adipose tissue in vivo. Diabetes, April 1, 2006; 55(4): 952 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sekimoto, J. Eipper-Mains, S. Pond-Tor, and C. M. Boney {alpha}v{beta}3 Integrins and Pyk2 Mediate Insulin-Like Growth Factor I Activation of Src and Mitogen-Activated Protein Kinase in 3T3-L1 Cells Mol. Endocrinol., July 1, 2005; 19(7): 1859 - 1867. [Abstract] [Full Text] [PDF] |
||||
![]() |
R J Santen, R X Song, Z Zhang, R Kumar, M-H Jeng, A Masamura, J Lawrence Jr, L Berstein, and W Yue Long-term estradiol deprivation in breast cancer cells up-regulates growth factor signaling and enhances estrogen sensitivity Endocr. Relat. Cancer, July 1, 2005; 12(Supplement_1): S61 - S73. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ling, L. A. Maile, J. Lieskovska, J. Badley-Clarke, and D. R. Clemmons Role of SHPS-1 in the Regulation of Insulin-like Growth Factor I-stimulated Shc and Mitogen-activated Protein Kinase Activation in Vascular Smooth Muscle Cells Mol. Biol. Cell, July 1, 2005; 16(7): 3353 - 3364. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. El-Shewy, F. L. Kelly, L. Barki-Harrington, and L. M. Luttrell Ectodomain Shedding-Dependent Transactivation of Epidermal Growth Factor Receptors in Response to Insulin-Like Growth Factor Type I Mol. Endocrinol., November 1, 2004; 18(11): 2727 - 2739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kim, C. Y. Yoon, P. G. Jang, Y. J. Park, C. S. Shin, H. S. Park, J. W. Ryu, Y. K. Pak, J. Y. Park, K. U. Lee, et al. The Mitogenic and Antiapoptotic Actions of Ghrelin in 3T3-L1 Adipocytes Mol. Endocrinol., September 1, 2004; 18(9): 2291 - 2301. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu and K. Liao Protein Kinase B/AKT 1 Plays a Pivotal Role in Insulin-like Growth Factor-1 Receptor Signaling Induced 3T3-L1 Adipocyte Differentiation J. Biol. Chem., August 20, 2004; 279(34): 35914 - 35922. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Petersen, C. Jorgensen, A. C. Rustan, L. Froyland, K. Muller-Decker, G. Furstenberger, R. K. Berge, K. Kristiansen, and L. Madsen Arachidonic acid-dependent inhibition of adipocyte differentiation requires PKA activity and is associated with sustained expression of cyclooxygenases J. Lipid Res., December 1, 2003; 44(12): 2320 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Entingh, C. M. Taniguchi, and C. R. Kahn Bi-directional Regulation of Brown Fat Adipogenesis by the Insulin Receptor J. Biol. Chem., August 29, 2003; 278(35): 33377 - 33383. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sekimoto and C. M. Boney C-Terminal Src Kinase (CSK) Modulates Insulin-Like Growth Factor-I Signaling through Src in 3T3-L1 Differentiation Endocrinology, June 1, 2003; 144(6): 2546 - 2552. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, J. Nohr, C. H. Jensen, R. K. Petersen, E. Bachmann, B. Teisner, L. K. Larsen, S. Mandrup, and K. Kristiansen Insulin-like Growth Factor-1/Insulin Bypasses Pref-1/FA1-mediated Inhibition of Adipocyte Differentiation J. Biol. Chem., May 30, 2003; 278(23): 20906 - 20914. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Prusty, B.-H. Park, K. E. Davis, and S. R. Farmer Activation of MEK/ERK Signaling Promotes Adipogenesis by Enhancing Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) and C/EBPalpha Gene Expression during the Differentiation of 3T3-L1 Preadipocytes J. Biol. Chem., November 22, 2002; 277(48): 46226 - 46232. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Lennon, M. Ramauge, A. Dessouroux, and M. Pierre MAP Kinase Cascades Are Activated in Astrocytes and Preadipocytes by 15-Deoxy-Delta 12-14-prostaglandin J2 and the Thiazolidinedione Ciglitazone through Peroxisome Proliferator Activator Receptor gamma -independent Mechanisms Involving Reactive Oxygenated Species J. Biol. Chem., August 9, 2002; 277(33): 29681 - 29685. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Machinal-Quelin, M. N. Dieudonne, M. C. Leneveu, R. Pecquery, and Y. Giudicelli Proadipogenic effect of leptin on rat preadipocytes in vitro: activation of MAPK and STAT3 signaling pathways Am J Physiol Cell Physiol, April 1, 2002; 282(4): C853 - C863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Beauchamp and G. Renier Homocysteine Induces Protein Kinase C Activation and Stimulates c-Fos and Lipoprotein Lipase Expression in Macrophages Diabetes, April 1, 2002; 51(4): 1180 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. X.-D. Song, R. A. McPherson, L. Adam, Y. Bao, M. Shupnik, R. Kumar, and R. J. Santen Linkage of Rapid Estrogen Action to MAPK Activation by ER{alpha}-Shc Association and Shc Pathway Activation Mol. Endocrinol., January 1, 2002; 16(1): 116 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Boney, H. Sekimoto, P. A. Gruppuso, and A. R. Frackelton Jr. Src Family Tyrosine Kinases Participate in Insulin-like Growth Factor I Mitogenic Signaling in 3T3-L1 Cells Cell Growth Differ., July 1, 2001; 12(7): 379 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Bartosiewicz, D. Jenkins, S. Penn, J. Emery, and A. Buckpitt Unique Gene Expression Patterns in Liver and Kidney Associated with Exposure to Chemical Toxicants J. Pharmacol. Exp. Ther., June 1, 2001; 297(3): 895 - 905. [Abstract] [Full Text] |
||||
![]() |
G. Fruhbeck, J. Gomez-Ambrosi, F. J. Muruzabal, and M. A. Burrell The adipocyte: a model for integration of endocrine and metabolic signaling in energy metabolism regulation Am J Physiol Endocrinol Metab, June 1, 2001; 280(6): E827 - E847. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qiu, Y. Wei, N. Chen, M. Jiang, J. Wu, and K. Liao DNA Synthesis and Mitotic Clonal Expansion Is Not a Required Step for 3T3-L1 Preadipocyte Differentiation into Adipocytes J. Biol. Chem., April 6, 2001; 276(15): 11988 - 11995. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |