Molecular Endocrinology 14 (6): 805-813
Copyright © 2000 by The Endocrine Society
The Critical Role of Shc in Insulin-Like Growth Factor-I-Mediated Mitogenesis and Differentiation in 3T3-L1 Preadipocytes
Charlotte M. Boney,
Philip A. Gruppuso,
Ronald A. Faris and
A. Raymond Frackelton, Jr.
Department of Pediatrics Rhode Island Hospital (C.M.B., P.A.G.,
R.A.F.) Providence, Rhode Island 02903
Department of
Medicine (A.R.F.) Roger Williams Hospital Providence, Rhode
Island 02908
Departments of Pediatrics and Pathology and
Laboratory Medicine Brown University Providence, Rhode Island
02906
 |
ABSTRACT
|
|---|
Insulin-like growth factor-I (IGF-I) stimulates
mitogenesis in proliferating preadipocytes, but when cells reach
confluence and become growth arrested, IGF-I stimulates differentiation
into adipocytes. IGF-I induces signaling pathways that involve
IGF-I receptor-mediated tyrosine phosphorylation of Shc and insulin
receptor substrate 1 (IRS-1). Either of these adaptor proteins can lead
to activation of the three-kinase cascade ending in activation of the
extracellular signal-regulated kinase 1 and -2 (ERK-1 and -2)
mitogen-activated protein kinases (MAPKs). Several lines of evidence
suggest that activation of MAPK inhibits 3T3-L1 preadipocyte
differentiation. We have shown that IGF-I stimulation of MAPK activity
is lost as 3T3-L1 preadipocytes begin to differentiate. This change in
MAPK signaling coincides with loss of IGF-I-mediated Shc, but not
IRS-1, tyrosine phosphorylation. We hypothesized that down-regulation
of MAPK via loss of proximal signaling through Shc is an early
component in the IGF-I switch from mitogenesis to differentiation in
3T3-L1 preadipocytes. Treatment of subconfluent cells with the
MEK inhibitor PD098059 inhibited both IGF-I-activation of
MAPK as well as 3H-thymidine incorporation.
PD098059, in the presence of differentiation-inducing media,
accelerated differentiation in subconfluent cells as measured by
expression of adipocyte protein-2 (aP-2), peroxisome
proliferator-activated receptor
(PPAR
) and lipoprotein
lipase (LPL). Transient transfection of subconfluent cells with
Shc-Y317F, a dominant-negative mutant, attenuated IGF-I-mediated MAPK
activation, inhibited DNA synthesis, and accelerated expression of
differentiation markers aP-2, PPAR
, and LPL. We conclude that
signaling through Shc to MAPK plays a critical role in mediating
IGF-I-stimulated 3T3-L1 mitogenesis. Our results suggest that loss of
the ability of IGF-I to activate Shc signaling to MAPK may be an early
component of adipogenesis in 3T3-L1 cells.
plays an important role in preadipocyte growth and differentiation.
IGF-I stimulates mitogenesis in many cell types in culture, including
preadipocytes (1), and IGF-I (or pharmacological doses of insulin) is
clearly required for preadipocyte differentiation in vitro
(2, 3). This dual role of IGF-I, stimulation of both mitogenesis and
differentiation, indicates that these responses are not necessarily
mutually exclusive. In vitro, IGF-I stimulates
differentiation of preadipocytes once density-induced growth arrest has
occurred (4).
The mechanisms of intracellular signaling used by IGF-I to promote
mitogenesis or differentiation of preadipocytes are now beginning to be
elucidated. The biological effects of IGF-I are mediated through the
IGF-I receptor (IGFR), a member of the tyrosine kinase family of growth
factor receptors. The activated IGFR tyrosine kinase phosphorylates
specific substrates, such as the adaptor proteins Shc and insulin
receptor substrate-1 (IRS-1). Tyrosine phosphorylation of these
proteins stimulates specific protein-protein interactions via well
characterized domains to mediate diverse signaling pathways (5). Shc, a
substrate for many growth factor receptor tyrosine kinases, is a key
component of signaling complexes that activate several effector
pathways, including the small G- protein Ras (6). Ras then
activates the three-kinase cascade terminating in the mitogen-activated
protein kinases (MAPKs), extracellular signal regulated kinase 1 (ERK1)
and ERK2 (7, 8). These MAPK isoforms mediate the mitogenic effects of
IGF-I in a number of cell types (911). IRS-1, considered to be the
major substrate of the IGFR, can activate multiple downstream targets,
including Ras and phosphatidylinositol 3- kinase (PI3K) (5,
12).
We have previously shown that IGF-I is a potent stimulator of the MAPKs
ERK1 and ERK2 in proliferating 3T3-L1 preadipocytes, and that there is
a dramatic decrease in IGF-I-stimulated MAPK activity during early
differentiation of 3T3-L1 cells (13). This change in MAPK signaling
coincides with the loss of IGF-I-stimulated Shc, but not IRS-1,
phosphorylation. This indicates that proximal signaling through Shc to
MAPK is down-regulated very early in IGF-I-mediated preadipocyte
differentiation. Activation of MAPK in growth-arrested 3T3-L1 cells
through transfection of active components of the MAPK cascade (14) or
by epidermal growth factor (15, 16) inhibits differentiation.
Therefore, down-regulation of MAPK activity may be necessary for
preadipocyte differentiation.
We hypothesized that down-regulation of MAPK via loss of proximal
signaling by Shc is involved in mediating the IGF-I switch from 3T3-L1
mitogenesis to differentiation. We used a synthetic inhibitor of MAPK
activation (PD098059) or a dominant-negative form of Shc to inhibit
mitogenesis and promote differentiation in 3T3-L1 cells independently
of the usual requirement for density-induced growth arrest.
PD098059 inhibits high-dose insulin stimulation of MAPK in 3T3-L1 cells
(14). The Shc mutant consists of a tyrosine-to-phenylalanine
substitution at position 317, rendering it defective in signaling to
Ras (17). Our results demonstrate the critical role of Shc in the
switch from IGF-I-mediated mitogenesis to IGF-I-mediated
differentiation of 3T3-L1 cells.
 |
RESULTS
|
|---|
The Effect of the MAPK Inhibitor PD098059 on IGF-I-Stimulated
Mitogenesis in 3T3-L1 Preadipocytes
To test whether MAPK mediates the mitogenic effects of IGF-I
in proliferating 3T3-L1 preadipocytes, we asked whether PD098059, a
specific noncompetitive inhibitor of the MAPK kinase, MEK-1 (18), would
affect IGF-I-stimulated MAPK activation and
3H-thymidine incorporation. We treated
subconfluent 3T3-L1 cells with or without 50 µM PD098059
before stimulation with 10 nM IGF-I and then analyzed for
active ERK-1 and -2 MAPK by Western blotting with phosphospecific MAPK
antibodies. As expected, PD098059 was a potent inhibitor of
IGF-I-stimulated MAPK activity in 3T3-L1 preadipocytes (Fig. 1A
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1. Effect of PD098059 on Activation of MAPK and
3H-Thymidine Incorporation in 3T3-L1 Cells
A, 3T3-L1 cells (6080% confluent) were treated with 10
nM IGF-I for 5 min after preincubation of cells for 2
h with or without 50 µM PD098059. Cell lysates were
resolved by SDS-PAGE and then analyzed by Western blotting for
phosphorylated MAPK (P-MAPK) and total MAPK. This blot is
representative of more than 10 repeats. B, Subconfluent, proliferating
cells were serum starved overnight and treated with 10 nM
IGF-I for 24 h. During the last 6 h, 3H-thymidine
(1 µCi per well) was added to proliferating cells in the absence (P)
or presence (P/PD) of 50 µM PD098059 or to
growth-arrested cells (GA). Incorporation of 3H-thymidine
into DNA is expressed as the mean and SEM (n = 6 wells
per condition). Similar results were seen in a second experiment.
|
|
We then measured 3H-thymidine incorporation
in IGF-I-stimulated cells in the presence and absence of 50
µM PD098059 (Fig. 1B
). Treatment of proliferating cells
with the MEK inhibitor substantially reduced
3H-thymidine incorporation in response to IGF-I.
DNA synthesis was negligible in postconfluent cells undergoing
density-induced growth arrest. To make sure that inhibition of
3H-thymidine incorporation by PD098059 reflected
inhibition of proliferation and not an increase in cell death, cell
cycle analysis was performed by standard flow cytometry. The percent
apoptotic cells in asynchronous, proliferating cells was 1.26 +
1.13 (mean + SD; n = 3), and the percent after
overnight treatment with PD098059 was 0.74 + 0.5 (mean +
SD; n = 3).
The Effect of PD098059 on IGF-I-Stimulated Differentiation in
Subconfluent 3T3-L1 Preadipocytes
To test the hypothesis that loss of MAPK activation is
permissive for IGF-I-mediated differentiation, we treated
subconfluent 3T3-L1 preadipocytes with differentiation-inducing medium
(DMI) in the absence or presence of PD098059. Expression of
differentiation-specific genes was determined by Northern analysis and
RT-PCR. Northern analysis of total RNA for the lipid-binding protein
adipocyte protein-2 (aP-2), a late marker of adipocyte differentiation,
revealed detectable expression after treatment with DMI but enhanced
expression in the presence of PD098059 (Fig. 2
). We then examined earlier markers of
differentiation, peroxisome proliferator-activated receptor
(PPAR
), and lipoprotein lipase (LPL), using semiquantitative RT-PCR.
Subconfluent preadipocytes were treated with DMI or serum-containing
medium in the absence or presence of PD098059. PD098059 led to a modest
enhancement in the expression of PPAR
in this and other repeat
experiments. However, LPL was only detected in total RNA from cells
treated with both PD098059 and DMI (Fig. 3
). These data suggest that inhibition of
MAPK in subconfluent, proliferating 3T3-L1 cells accelerates
differentiation.

View larger version (93K):
[in this window]
[in a new window]
|
Figure 2. Northern Analysis of aP-2 Expression in 3T3-L1
Cells Treated with DMI and PD098059
Cells (80% confluent) were treated for 72 h with SCM (lanes 1 and
2), DMI (lanes 3, 4, 7, and 8) or DMI and 50 µM PD098059
(lanes 5 and 6) before analysis of total RNA. Postconfluent,
growth-arrested cells treated with SCM for 72 h (lane 9) served as
a negative control, and growth-arrested cells treated with DMI for
72 h (lanes 10 and 11) served as a positive control. The
upper panel is the Northern blot for aP-2, and the
lower panel is a picture of the ethidium bromide-stained
gel demonstrating rRNA abundance. Similar results were seen in a second
experiment.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
Figure 3. Semiquantitative RT-PCR Analysis of Early Markers
of Differentiation in 3T3-L1 Cells Treated with DMI and PD098059
Cells (50% confluent) were treated for 48 h with SCM (C) or DMI
(D) alone in the absence (-) or presence of 50 µM
PD098059 (+) before isolation of total RNA. Total RNA (2 µg) was
reverse transcribed and analyzed by multiplex PCR for expression of
PPAR and GAPDH or LPL and GAPDH. This represents one of three
experiments.
|
|
Changes in IGF-I-Mitogenic Signaling in 3T3-L1 Preadipocytes
Associated with Transfection of a Dominant-Negative Shc Mutant
Although IRS-1 is considered to be of primary importance in IGF-I
signaling, both Shc and IRS-1 become phosphorylated when the IGF-I
receptor is activated. To test the hypothesis that Shc is necessary for
IGF-I mitogenic signaling in proliferating 3T3-L1 cells, we transiently
transfected subconfluent cells with a dominant-negative Shc mutant.
This mutant is a glutathione-S-transferase (GST) fusion
protein with phenylalanine substituted for tyrosine at the 317 position
of Shc, rendering it defective in signaling to Ras (17). Expression of
the mutant GST-ShcY317F is abundant by 24 h, reaches a maximum at
48 h and remains close to maximum at 72 h (data not shown).
Figure 4A
demonstrates maximal expression
48 h after transfection of the mutant GST-ShcY317F protein in
comparison to the three endogenous isoforms of Shc. Western blot
analysis of MAPK activation in proliferating cells 48 h after
transfection revealed inhibition of IGF-I-stimulated MAPK activity by
ShcY317F compared with empty vector (GST alone) or GST-wild-type Shc at
transfection efficiencies of 4050% (Fig. 4B
).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 4. Mutant ShcY317F Expression and Inhibition of MAPK
Activity
A, Western blot of Shc proteins 48 h after transient transfection
of 50% confluent 3T3-L1 cells with empty vector (GST alone),
GST-ShcY317F, or no vector (No Tx). The endogenous, wild-type Shc (WT
Shc) isoforms are indicated with a bracket, and the
GST-Shc mutant is noted with an arrow. B, A
representative Western blot of phosphorylated MAPK in IGF-I-treated
cells transfected with empty vector (GST alone) or GST-ShcY317F at a
transfection efficiency of approximately 40%; 48 h following
transfection, cells were stimulated with 10 nM IGF-I for 5
min and analyzed for phosphorylated MAPK and total MAPK. Total MAPK was
consistent across all lanes (not shown). Below the Western blot,
phospho-MAPK was quantitated by densitometry, normalized for the total
amount of MAPK, and expressed as mean + SEM densitometric
units. Open bars represent control and closed
bars represent stimulation with 10 nM IGF-I for 5
min. Results are compiled from four separate experiments: three
comparing empty vector (GST alone) to Shc mutant and one experiment
comparing empty vector to GST-wild-type Shc to Shc mutant (n = 3
for this experiment).
|
|
To test the effect of the dominant-negative Shc mutant on
IGF-I-stimulated mitogenesis, we evaluated DNA synthesis by measuring
BrdU incorporation in cells transfected with the GST-wild-type Shc or
GST-ShcY317F mutant and then treated with IGF-I. Using double
fluorescent immunohistochemical staining for BrdU and GST, we counted
the number of BrdU-positive nuclei in GST-positive cells.
Immunohistochemical staining of BrdU and GST in a representative field
of cells transfected with wild type Shc or the Shc mutant is shown in
Fig. 5
. Cells expressing GST-wild-type
Shc and exposed to BrdU have yellow nuclei and red cytoplasm (Fig. 5B
),
indicating BrdU incorporation into cells transfected with wild-type
Shc. However, staining of GST-ShcY317F-transfected cells revealed red
cytoplasm but no nuclear BrdU staining (Fig. 5D
), indicating inhibition
of BrdU uptake in cells expressing the Shc mutant. Also in this field
is a nontransfected cell that is BrdU positive. In an experiment with
5060% transfection efficiency, 100 cells were counted for each
condition: 28% of cells transfected with the GST-ShcY317F mutant
incorporated BrdU in response to IGF-I compared with 69% in cells
transfected with GST-wild-type Shc (significance by Fischers exact
test gave a two-sided P = 0.0001). These data
demonstrate inhibition of IGF-I-stimulated DNA synthesis by the
dominant-negative Shc in proliferating 3T3-L1 cells.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 5. Immunohistochemical Analysis of BrdU Incorporation
into Transfected 3T3-L1 Cells
Forty eight hours after transfection of GST-wild-type Shc or
GST-ShcY317F, cells were incubated with 10 µM BrdU in the
presence of 10 nM IGF-I for 4 h and then fixed in
100% cold methanol. Costaining of BrdU (yellow or green
nuclei) and GST (red cytoplasm) followed by DAPI
staining of nuclei was performed as described in Materials and
Methods. Top panels, DAPI staining of nuclei (A)
and costaining of BrdU and GST (B) in cells transfected with wild-type
Shc. Bottom panels, DAPI staining of nuclei (C) and
costaining of BrdU and GST (D) in cells transfected with ShcY317F. This
experiment was repeated once with this antibody. However, two other
repeat experiments also gave similar results, although specific
staining was less dramatic using different primary antibodies for GST.
|
|
The Effect of the Dominant-Negative Shc Mutant on IGF-I-Stimulated
Differentiation in Subconfluent 3T3-L1 Cells
Although mitogenesis and differentiation are considered to be
mutually exclusive, IGF-I is known to stimulate both mitogenesis and
differentiation in 3T3-L1 preadipocytes. We hypothesized that loss of
mitogenic signaling through Shc is a key event in the switch from
IGF-I-mediated mitogenesis to differentiation. To test this, we
inhibited Shc signaling in subconfluent 3T3-L1 cells via transfection
with dominant-negative Shc, and then treated cells 24 h after
transfection with DMI and analyzed for early and late markers of
adipocyte differentiation. Expression of the late marker aP-2, assessed
by Northern analysis of total RNA, was evident after 72 h of DMI
treatment in cells transfected with Shc mutant (Fig. 6
). To examine earlier markers of
differentiation, expression of PPAR
and LPL was evaluated by RT-PCR.
After 60 h of treatment with DMI, cells transfected with
dominant-negative Shc, but not empty vector (GST alone) or GST-wild
type Shc, expressed significant PPAR
(Fig. 7A
). By 78 h, both the Shc mutant
and empty vector transfectants expressed PPAR
(data not shown), but
only cells transfected with the Shc mutant expressed LPL (Fig. 7B
).
These data suggest that inhibition of Shc signaling is sufficient to
permit differentiation in subconfluent 3T3-L1 cells.

View larger version (99K):
[in this window]
[in a new window]
|
Figure 6. Northern Analysis of aP-2 Expression from
transfected 3T3-L1 Cells Treated with DMI
Twenty four hours after 50% confluent cells were transfected with the
empty vector (GST alone) or ShcY317F, cells were treated with DMI for
72 h before isolation of total RNA. Transfection efficiency was
approximately 30%. Control cells, which were not transfected, were
treated with SCM and served as a negative control (-). Growth-arrested
cells treated with DMI for 72 h served as a positive control (+).
The upper panel is the Northern blot for aP-2, and the
lower panel is a picture of the ethidium bromide-stained
gel indicating rRNA abundance. Similar results were obtained in a
replicate experiment.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Figure 7. Semiquantitative RT-PCR Analysis of Early
Differentiation Markers in Transfected 3T3-L1 Cells Treated with DMI
Twenty four hours after 50% confluent cells were transfected, cells
were treated with DMI. Total RNA was isolated at 60 h for PPAR
analysis and 78 h for LPL analysis. Transfection efficiency was
approximately 50%. A, Total RNA (2 µg) was reverse transcribed and
analyzed by multiplex PCR for PPAR and GAPDH. Two separate
experiments are shown. The left panel is the result from
cells transfected with empty vector (GST alone) or the GST-ShcY317F
mutant. The right panel is the result from cells
transfected with empty vector (GST alone), GST-wild-type Shc, or the
GST-ShcY317F mutant. B, Total RNA (2 µg) from cells transfected with
empty vector (GST alone) or GST-ShcY317F mutant was reverse transcribed
and analyzed by multiplex PCR for LPL and GAPDH. Similar results were
obtained in several additional experiments.
|
|
 |
DISCUSSION
|
|---|
It is well established that the MAPK signaling cascade mediates
the mitogenic effects of IGF-I in numerous mesenchymal-derived cell
systems, including myoblasts (19, 20), rat-1 fibroblasts (21), vascular
smooth muscle cells (22), and rat fetal brown adipocytes (23). As
expected, we were able to demonstrate that the MEK-1 inhibitor PD098059
completely inhibits MAPK activation by IGF-I in subconfluent 3T3-L1
preadipocytes. By blocking IGF-I-stimulated MAPK activation, DNA
synthesis is substantially reduced in subconfluent cells, indicating
that the MAPK pathway is important for IGF-I-stimulated mitogenesis in
3T3-L1 preadipocytes.
Inhibition of MAPK by PD098059 promotes differentiation in subconfluent
as well as growth-arrested 3T3-L1 cells. Compared with treatment with
DMI alone, PD098059 increased expression of PPAR
and significantly
increased expression of the later markers, suggesting that inhibition
of MAPK activation is permissive for IGF-I-stimulated differentiation.
Similar data were shown by Font de Mora et al. (14) using
pharmacological doses of insulin in postconfluent cells. They
demonstrated PD098059 inhibition of MAPK activation by insulin in
3T3-L1 cells and a small increase in differentiation markers in
PD098059-treated growth-arrested cells. However, we have previously
shown that MAPK activation by IGF-I in growth-arrested 3T3-L1
preadipocytes is already decreased (13), so we would predict the effect
of PD098059 to be attenuated in growth-arrested compared with
subconfluent cells.
Our results show that inhibition of MAPK, even in the absence of
density-induced growth arrest, permits differentiation of 3T3-L1 cells.
Similar observations have been made in IGF-I-mediated growth and
differentiation of rat fetal brown adipocytes (23) and L6A1 myoblasts
(24). Those studies demonstrated the role of MAPK activation in
mitogenesis and the promotion of differentiation by MAPK inhibition
using PD098059, leading us to conclude that these signaling mechanisms
may be common to cell systems in which IGF-I stimulates both
proliferation and differentiation. In addition, mitogenic hormones such
as epidermal growth factor and tumor necrosis factor
(15, 16), as
well as transfection of constitutively active components of the MAPK
cascade, inhibit 3T3-L1 differentiation by activation of MAPK (14). We
conclude that loss of MAPK activation is both permissive and necessary
for 3T3-L1 differentiation.
Several elegant studies by others have investigated the role of
upstream mediators of MAPK in 3T3-L1 differentiation, including Raf-1
and Ras (25, 26). Although these data indicate a role for Ras, and to a
lesser extent Raf-1, in IGF-I-mediated 3T3-L1 differentiation, these
signaling molecules activate MAPK in proliferating, but not
differentiating, cells (27, 28). Further upstream, signaling complexes
are formed from activated adaptor proteins such as Shc or IRS-1, which
can then bind Grb2 and Sos (5). These signaling complexes activate the
small G protein Ras, which leads to Raf-1 activation. Raf-1 is the
first kinase in the three-kinase cascade ending in MAPK (7, 8).
We have previously shown that loss of MAPK activation by IGF-I in
differentiating cells is associated with loss of Shc but not IRS-1
tyrosine phosphorylation (13). We have now presented evidence
suggesting that Shc is a critical upstream mediator of MAPK activation
in IGF-I-mediated 3T3-L1 mitogenesis. We did so by transiently
expressing a dominant-negative Shc that is defective in signaling to
Ras. This ShcY317F mutant blocked IGF-I activation of MAPK, inhibited
IGF-I-stimulated BrdU incorporation, and promoted differentiation in
subconfluent 3T3-L1 cells. We found no inhibition of IRS-1 tyrosine
phosphorylation and associated binding of the p85 subunit of PI3K in
cells transfected with empty vector (GST alone), wild-type Shc, or
ShcY317F (data not shown). Studies by Ishihara et al. (29)
found inhibition of IRS-1 signaling in stably transfected Rat1
fibroblasts expressing insulin and not IGF-I receptors, GST-wild-type
Shc and GST-ShcY317F. However, unlike our experiments, expression of
the GST-Shc proteins (wild-type and Y317F mutant) was in 10-fold excess
of endogenous Shc, suggesting to us that inhibition of
insulin-stimulated IRS-1 signaling may have been partly a result of the
stoichiometry of the transfected proteins. Although we cannot
absolutely rule out a role for IRS-1 in IGF-I mitogenic signaling, our
results indicate a crucial role for Shc. Shc proteins have been shown
to mediate the mitogenic effects of IGF-I in a number of other cell
culture systems, including human neuroblastoma cells (30), myeloid
progenitor cells (31), and rat-1 fibroblasts (32). On the other hand,
IRS-1 (33) and its downstream targets PI3K (34, 35, 36) and protein kinase
B (37, 38) appear to have major roles in mediating the differentiating
effects of IGF-I in 3T3-L1 cells as well as fetal rat brown
adipocytes.
We interpret our present and prior results to suggest that a change in
IGF-I signaling from Shc-mediated mitogenesis to IRS-1-mediated
differentiation is central to the process of adipogenesis. Our results
indicate that inhibiting mitogenesis in subconfluent cells by
inhibition of MAPK or transient transfection of the ShcY317F mutant is
permissive for differentiation. However, the mechanisms responsible for
the switch in Shc signaling, i.e. loss of IGF-I receptor
phosphorylation of Shc, but not IRS-1, as 3T3-L1 cells become
postconfluent, are unknown. One can speculate on a number of
possibilities. For example, a change in IGF-I receptor internalization
has been shown to affect Shc but not IRS-1 signaling (39). Binding of
regulatory proteins such as Grb10 (40, 41), or protein kinases such as
Src (42), protein kinase C (43, 44), or PI3K (44, 45) might directly or
indirectly affect IGF-I receptor function. Interaction of the IGF-I
receptor with other receptors or integrins (46) has been shown to
regulate IGF-I receptor function. There are also many potential
mechanisms that could affect Shc phosphorylation independent of a
change in IGF-I receptor function, including interactions with IRS-1
(47), Shc phosphatases such as PTEN (48), Src (49), and integrins (50).
Relevant to all these potential mechanisms is the conclusion that Shc
represents a crucial point of divergence between IGF-I-mediated
mitogenesis and IGF-I-stimulated differentiation of 3T3-L1 cells.
 |
MATERIALS AND METHODS
|
|---|
Materials
Tissue culture reagents, some RT-PCR reagents, plasmid pGreen
lantern, and custom primers were purchased from Life Technologies, Inc. (Gaithersburg, MD). AdvanTaq Plus PCR kit and
mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control primers
were purchased from CLONTECH Laboratories, Inc. (Palo
Alto, CA). Dexamethasone, methylisobutylxanthine, buffer reagents, and
X-Omat AR film (Eastman Kodak, Rochester, NY) were purchased from
Sigma (St. Louis, MO). 3H-thymidine,
32P-dCTP, enhanced chemiluminescence reagents,
Hyperfilm ECL, and Hybond C nitrocellulose were purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL). Rabbit
anti-Shc, rabbit anti-MAPK-1/2 (ERK1/2-CT), and rabbit anti-GST
antibodies were purchased from Upstate Biotechnology, Inc.
(Lake Placid, NY). Secondary antibodies for immunocytochemistry were
purchased from Pierce Chemical Co. (Rockford, IL).
Avidin/Biotin blocking kit, Texas Red Streptavidin, and Vectashield
plus 4,6-diamidino-2-phenylindole (DAPI) mounting medium were purchased
from Vector Laboratories, Inc. (Burlingame, CA). Human
recombinant IGF-I was obtained from GroPep Pty. Ltd.
(Adelaide, Australia). PD098059 and anti-dual phosphorylated
ERK-1 and -2 MAPK antibodies were purchased from New England Biolabs, Inc. (Beverly, MA). The plasmids containing
GST-ShcY317F, GST-Shc, and GST alone were kind gifts from Dr. Kodi S.
Ravichandran. The plasmid containing mouse aP-2 was the generous gift
of Dr. Jessica Schwartz.
Cell Culture and Transfection
The murine preadipocyte line 3T3-L1 was obtained from
American Type Culture Collection (Manassas, VA). Cells
were grown in DMEM with l-glutamine, 1 g/liter glucose, 50 µg/ml
penicillin, 100 µg/ml streptomycin, 0.25 µg/ml
Amphotericin, (Life Technologies, Inc.,
Gaithersburg, MD) and 10% FBS. Cultures were maintained in an
atmosphere of 5% CO2-95% humidified air at 37
C. Serum-containing medium (SCM) was replaced every 3 days.
Differentiation-inducing medium consisted of 0.5 µM
dexamethasone, 0.5 mM methylisobutylxanthine, and 7
nM IGF-I (DMI) in SCM.
For transient transfection of 3T3-L1 cells, cells were seeded in
six-well plates. The plasmids provided included ShcY317F cloned into
pEBG as a GST fusion protein, wild- type Shc cloned into pEBG as a GST
fusion protein, and the pEBG vector containing only GST (empty vector).
The mutant Shc, wild-type Shc, or the empty vector was transfected into
50% confluent cells with pGreen Lantern at a ratio of 10:1. The
plasmid pGreen Lantern expresses green fluorescent protein and was used
as a marker of transfection efficiency. Initially the reagent
Lipofectin (Life Technologies, Inc.) was used with
transfection efficiencies of 2030%. Improved transfection was
subsequently obtained using GenePorter (Gene Therapy Systems, San
Diego, CA) with transfection efficiencies of 4050%. Cells were used
for experiments 2448 h after transfection.
Evaluation of Apoptosis by Flow Cytometry
3T3-L1 cells were grown to 5060% confluency in
10-cm2 dishes. After overnight incubation in
either SCM or SCM containing 50 µM PD098059, cells were
detached with 0.05% trypsin and 0.5 mM EDTA, resuspended
in SCM, and washed once with PBS. The cells were resuspended in PBS and
stained with 0.02% propidium iodide (Sigma) for 510
min. DNA content was analyzed on a FACSort (Becton Dickinson and Co. Immunocytometry Systems, San Jose, CA) equipped with an
argon-ion laser at 488 nm and Modifit LT software (Verity Software
House, Inc., Topsham, ME).
Western Blotting
Preparation of cell lysates for Western blotting was as
described previously (13), using lysis buffer with 1% Triton X-100 for
anti-Shc Western blots and 0.2% Triton X-100 for anti-phospho-MAPK
Western blots. Proteins were resolved by SDS-PAGE on 10% acrylamide
gels and transferred to nitrocellulose. Membranes were blocked in 5%
BSA in Tris-buffered saline with 0.1% Triton X-100 and probed with
primary antibody at 1 µg/ml. Specific binding was visualized using
enhanced chemiluminescence and Hyperfilm ECL and then analyzed by
digital image analysis using a ScanJet 6100C/T scanner
(Hewlett-Packard Co., Palo Alto, CA).
RNA Preparation And Northern Blot Analysis
Total RNA was prepared using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH). Aliquots of total RNA
were denatured with dimethylsulfoxide and glyoxal, fractionated by
agarose gel electrophoresis and transferred to GeneScreen nylon
membranes (NEN Life Science Products, Boston, MA). Membranes were
prehybridized in High Efficiency Hybridization solution without
formamide (Molecular Research Center, Inc., Cincinnati,
OH) and then hybridized with
[
-32P]dCTP-radiolabeled cDNA for aP-2 using
a random primed labeling kit (Roche Molecular Biochemicals, Indianapolis, IN). After extensive
posthybridization rinses at 60 C, blots were exposed to X-Omat film
(Eastman Kodak Co.).
Semiquantitative RT-PCR
Aliquots of 2 µg total RNA were DNAse treated before reverse
transcription and primer-dropping PCR as described previously (51).
Primer sequences used for detection of murine PPAR
2 transcripts were
taken from Vidal-Puig et al. (52) and resulted in a
predicted PCR product of 277 bp. Primer sequences used for detection of
murine LPL transcripts were, from 5' to 3', left GCGTAGCAGGAAGTCTGACC,
right CTACAACTCAGGCAGAGCCC and resulted in a predicted PCR product of
421 bp. Primers for murine GAPDH were purchased from CLONTECH Laboratories, Inc. and resulted in a predicted PCR product of
980 bp. Optimal PCR cycles required for linear amplification for each
primer set were determined. Total amplification in each reaction (GAPDH
plus PPAR
2 or GAPDH plus LPL) was kept below saturation levels to
permit the two products to remain within each primer sets exponential
range. GAPDH required 16 to 20 cycles, and its expression was the same
in proliferating, postconfluent or differentiating 3T3-L1 cells.
PPAR
2 required 2226 cycles and LPL required 1922 cycles, and
these cycles were determined from differentiating 3T3-L1 cells. Gels
were illuminated with UV light and photographed with Polaroid film.
3H-Thymidine and Bromodeoxyuridine (BrdU)
Incorporation
For 3H-thymidine incorporation, cell
monolayers were grown to approximately 70% confluence in six-well
plates and serum-starved overnight in DMEM with 0.1% BSA before
treatment with 10 nM IGF-I for 24 h. Cells were
incubated with 50 µM PD098059 (from a stock of 50
mM in DMSO) or an equal volume of DMSO in the presence of 1
µCi/well 3H-thymidine for 6 h before lysis
in 0.33 M NaOH. An aliquot was removed for protein assay
before DNA precipitation with ice-cold 40% TCA/1.2 M HCl
and collection on glass fiber filters for counting. The background
level of 3H-thymidine was less than 200 cpm as
determined by the addition of 3H-thymidine to a
control well just before cell lysis and DNA precipitation.
BrdU incorporation was determined in cell monolayers transfected with
wild-type Shc or ShcY317F at 50% confluency in six-well plates.
Forty-eight hours after transfection, monolayers were placed in DMEM
plus 0.1% BSA or DMEM plus 0.1% BSA and 10 nM IGF-I
overnight followed by incubation with 10 µM BrdU (BrdU
labeling and detection kit II, Roche Molecular Biochemicals) for 4 h. The cell monolayers were fixed in
100% ice-cold methanol at -20 C for 10 min, allowed to air dry, and
then stored at -20 C.
Immunocytochemistry
For immunocytochemical costaining of BrdU incorporation and GST
expression, fixed cells were blocked in 1% normal goat serum before
incubation with 1:15 dilution of mouse anti-BrdU (BrdU labeling and
detection kit II, Roche Molecular Biochemicals) at 37 C
for 60 min followed by 10 µg/ml fluorescein
isothiocyanate-conjugated goat antimouse IgG at room temperature
for 30 min. The monolayers were washed with PBS, blocked in 1% normal
donkey serum, and then blocked with avidin and biotin. Cells were
incubated in 10 µg/ml rabbit anti-GST in 1% normal donkey serum
followed by 10 µg/ml biotin-conjugated donkey anti-rabbit IgG and
then Texas red streptavidin at a 1:200 dilution. All incubations were
at room temperature for 30 min. Coverslips were mounted with
Vectashield plus DAPI. Random fields of view were evaluated using an
Eclipse 800 Photomicroscope (Nikon, Melville, NY) equipped
with an epi-fluorescence condenser to analyze staining of BrdU in the
nucleus and GST in the cytoplasm. Total number of cells was determined
from DAPI staining of nuclei. Photomicrographs of monolayers were
recorded using a Sensys digital camera connected to a power MacIntosh
8500 running IP Lab Spectrum P imaging software.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Hiroko Sekimoto, Xiao Wang, and Rose Marie
Smith for technical assistance.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Charlotte M. Boney, M.D., Department of Pediatrics, Rhode Island Hospital, 593 Eddy Street, MPS-2, Providence, RI 02903.
This work was supported by a Charles H. Hood Foundation Child Health
Research Grant and a Knoll Pharmaceutical Co. Weight Risk
Investigators Study Council Grant (to C.M.B.), Rhode Island Hospital
Department of Pediatrics Research Endowment, and NIH Grants HD-24455
and HD-35831 (to P.A.G.).
Received for publication December 14, 1999.
Revision received March 15, 2000.
Accepted for publication March 22, 2000.
 |
REFERENCES
|
|---|
-
Benito M, Valverde A, Lorenzo M 1996 IGF-I: a mitogen
also involved in differentiation processes in mammalian cells. Int
J Biochem Cell Biol 28:499510[CrossRef][Medline]
-
Smith P, Wise L, Berkowitz R, Wan C, Rubin C 1988 Insulin-like growth factor-I is an essential regulator of the
differentiation of 3T3L1 adipocytes. J Biol Chem 263:94029408[Abstract/Free Full Text]
-
Schmidt W, Poll-Jordan G, Loffler G 1990 Adipose conversion
of 3T3L1 cells in a serum-free culture system depends on epidermal
growth factor, insulin-like growth factor-I, corticosterone, and cyclic
AMP. J Biol Chem 265:1548915495[Abstract/Free Full Text]
-
Gregoire F, Smas C, Sul H 1998 Understanding adipocyte
differentiation. Physiol Rev 78:783809[Abstract/Free Full Text]
-
LeRoith D, Werner H, Beitner-Johnson D, Roberts C 1995 Molecular and cellular aspects of the insulin-like growth factor-I
receptor. Endocr Rev 16:143163[CrossRef][Medline]
-
Ravichandran K, Lorenz U, Shoelson S, Burakoff S 1995 Interaction of Shc with Grb2 regulates association of Grb2 with mSos.
Mol Cell Biol 15:593600[Abstract]
-
Seger R, Krebs E 1995 The MAPK signaling cascade. FASEB J 9:726735[Abstract]
-
Cobb M, Goldsmith E 1995 How MAP kinases are regulated.
J Biol Chem 270:1484314846[Free Full Text]
-
Milasincic D, Calera M, Farmer S, Pilch P 1996 Stimulation of
C2C12 myoblast growth by basic fibroblast growth factor and
insulin-like growth factor-I can occur via mitogen-activated protein
kinase-dependent and -independent pathways. Mol Cell Biol 16:59645973[Abstract]
-
Webster J, Prager D, Melmed S 1994 Insulin-like growth
factor-I activation of extracellular signal-related kinase-1 and -2 in
growth hormone secreting cells. Mol Endocrinol 8:539544[Abstract]
-
Calleja V, Enriquez P, Filloux C, Peraldi P, Baron V, Van
Obberghen E 1999 The effect of cAMP on the mitogen-activated protein
kinase pathway depends on both the cell type and the type of tyrosine
kinase receptor. Endocrinology 138:11111120[Abstract/Free Full Text]
-
Myers M, Sun X, White M 1994 The IRS-1 signaling system.
Trends Biochem Sci 19:289293[CrossRef][Medline]
-
Boney C, Smith R, Gruppuso P 1998 Modulation of
insulin-like growth factor-I mitogenic signaling in 3T3L1
preadipocyte differentiation. Endocrinology 139:163811644[Abstract/Free Full Text]
-
Font de Mora J, Porras A, Ahn N, Santos E 1997 Mitogen-activated protein kinase activation is not necessary for, but
antagonizes, 3T3L1 adipocytic differentiation. Mol Cell Biol 17:60686075[Abstract]
-
Hu E, Kim J, Sarraf P, Spiegelman B 1996 Inhibition of
adipogenesis through MAP kinase-mediated phosphorylation of PPAR
.
Science 274:21002103[Abstract/Free Full Text]
-
Camp H, Tafuri S 1997 Regulation of perixisome
proliferator-activated receptor
activity by mitogen-activated
protein kinase. J Biol Chem 272:1081110816[Abstract/Free Full Text]
-
Stevenson L, Ravichandran K, Frackelton AJ 1999 Shc dominant
negative disrupts cell cycle progression in both G0G1 and G2-M of
ErbB2-positive breast cancer cells. Cell Growth Differ 10:6171[Abstract/Free Full Text]
-
Alessi D, Cuenda A, Cohen P, Dudley D, Saltiel A 1995 PD098059
is a specific inhibitor of the activation of mitogen-activated protein
kinase kinase in vitro and in vivo. J Biol
Chem 270:2748927494[Abstract/Free Full Text]
-
Sarbassov D, Jones L, Peterson C 1997 Extracellular
signal-regulated kinase-1 and -2 respond differently to mitogenic and
differentiative signaling pathways in myoblasts. Mol Endocrinol 11:20382047[Abstract/Free Full Text]
-
Samual D, Ewton D, Coolican S, Petley T, McWade F, Florini J 1999 Raf-1 activation stimulates proliferation and inhibits
IGF-stimulated differentiation in L6A1 myoblasts. Horm Metab Res 31:5564[Medline]
-
Lefebvre D, Boney C, Ketelslegers J, Thissen J 1999 Inhibition
of IGF-I mitogenic action by zinc chelation is associated with a
decreased mitogen-activated protein kinase activation in RAT-1
fibroblasts. FEBS Lett 449:284288[CrossRef][Medline]
-
Imai Y, Clemmons D 1999 Roles of phosphatidlyinositol 3-kinase
and mitogen-activated protein kinase pathways in stimulation of
vascular smooth muscle cell migration and DNA synthesis by IGF-I.
Endocrinology 140:42284235[Abstract/Free Full Text]
-
Porras A, Alvarez A, Valladares A, Benito M 1998 p42/p44
mitogen-activated protein kinases activation is required for the
IGF-I/insulin induced proliferation, but not differentiation, in rat
fetal brown adipocytes. Mol Endocrinol 12:825834[Abstract/Free Full Text]
-
Coolican S, Samuel D, Ewton D, McWade F, Florini J 1997 The
mitogenic and myogenic actions of insulin-like growth factors utilize
distinct signaling pathways. J Biol Chem 272:66536662[Abstract/Free Full Text]
-
Benito M, Porras A, Nebreda A, Santos E 1991 Differentiation
of 3T3L1 fibroblasts to adipocytes induced by transfection of ras
oncogenes. Science 253:565568[Abstract/Free Full Text]
-
Porras A, Muszynski K, Rapp U, Santos E 1994 Dissociation
between activation of raf-1 kinase and the 42-kDa mitogen-activated
protein kinase/90 kDa S6 kinase cascade in the insulin-ras pathway of
adipocytic differentiation of 3T3L1 cells. J Biol Chem 269:1274112748[Abstract/Free Full Text]
-
Carel K, Kummer J, Schubert C, Leitner W, Heidenreich K,
Draznin B 1996 Insulin stimulates mitogen-activated protein kinase by a
ras-independent pathway in 3T3L1 adipocytes. J Biol Chem 271:3062530630[Abstract/Free Full Text]
-
Suga J, Yoshimasa Y, Yamada K, Yamamoto Y, Nakao K 1997 Differential activation of mitogen-activated protein kinase by insulin
and epidermal growth factor in 3T3L1 adipocytes. Diabetes 46:735741[Abstract]
-
Ishihara H, Sasaoka T, Ishiki M, Takata Y, Imamura T, Usui I,
Langlois W, Sawa T, Kobayashi M 1997 Functional importance of Shc
tyrosine 317 on insulin signaling in Rat1 fibroblasts expressing
insulin receptors. J Biol Chem 272:95819586[Abstract/Free Full Text]
-
Kim B, Cheng H, Margolis B, Feldman E 1998 Insulin receptor
substrate-2 and Shc play different roles in insulin-like growth
factor-I signaling. J Biol Chem 273:3454334550[Abstract/Free Full Text]
-
Soon L, Flechner L, Gutkind J, Wang L, Baserga R, Pierce J, Li
W 1999 IGF-I synergizes with interleukin-4 for hematopoietic cell
proliferation independent of insulin receptor substrate expression. Mol
Cell Biol 19:38163828[Abstract/Free Full Text]
-
Takata Y, Imamura T, Haruta T, Sasaoka T, Kobayashi M 1996 The
dominant negative effect of a kinase-defective insulin receptor on
IGF-I-stimulated signaling in Rat-1 fibroblasts. Metabolism 45:14741482[CrossRef][Medline]
-
Valverde A, Lorenzo M, Pons S, White M, Benito M 1998 Insulin
receptor substrate proteins IRS-1 and IRS-2 differential signaling in
the insulin/IGF-I pathways in fetal brown adipocytes. Mol Endocrinol 12:688697[Abstract/Free Full Text]
-
Tomiyama K, Nakata H, Watanabe Y 1995 Wortmannin, a specific
PI 3-kinase inhibitor, inhibits adipocyte differentiation of 3T3L1
cells. Biochem Biophys Res Commun 212:263269[CrossRef][Medline]
-
Sakaue H, Ogawa W, Matsumoto M 1998 Post-transcriptional
control of adipocyte differentiation through activation of
phosphoinositide 3-kinase. J Biol Chem 273:2894528952[Abstract/Free Full Text]
-
Teruel T, Valverde A, Navarro P, Benito M, Lorenzo M 1998 Inhibition of PI 3-kinase and RAS blocks IGF-I and insulin-induced
uncoupling protein 1 gene expression in brown adipocytes. J Cell
Physiol 176:99109[CrossRef][Medline]
-
Magun R, Burgering B, Soritsky A 1996 Expression of a
constitutively activated form of protein kinase B in 3T3L1 cells
causes differentiation. Endocrinology 137:35903593[Abstract]
-
Gagnon A, Chen C, Sorisky A 1999 Activation of protein
kinase B and induction of adipogenesis by insulin in 3T3L1
preadipocytes: contribution of
phosphoinositide-3,4,5-triphosphate versus
phosphoinositide-3,4-bisphosphate. Diabetes 48:691698[Abstract]
-
Chow J, Condorelli G, Smith R 1998 Insulin-like growth
factor-I receptor internalization regulates signaling via the
Shc/mitogen-activated protein kinase pathway, but not the insulin
receptor substrate-1 pathway. J Biol Chem 273:46724680[Abstract/Free Full Text]
-
Morrione A, Valentinis B, Resnicoff M, Xu S, Baserga R 1997 The role of Grb10 in IGF-I-mediated growth. J Biol Chem 272:2638226387[Abstract/Free Full Text]
-
Wang J, Dai H, Yousaf N, Moussaif M, Deng Y, Boufelliga A,
Swamy O, Leone M, Riedel H 1999 Grb10, a positive stimulatory signaling
adapter in platelet-derived growth factor BB-, IGF-I-, and
insulin-mediated mitogenesis. Mol Cell Biol 19:62176228[Abstract/Free Full Text]
-
Arbet-Engels C, Tartare-Deckert S, Eckhart W 1999 C-terminal
Src kinase associates with ligand-stimulated insulin-like growth
factor-I receptor. J Biol Chem 274:54225428[Abstract/Free Full Text]
-
Valverde A, Lorenzo M, Benito M 1996 Involvement of Raf-1
kinase and protein kinase C in IGF-I-induced brown adipocyte mitogenic
signaling cascades. Endocrinology 137:38323841[Abstract]
-
Liu Q, Ning W, Danttzer R, Freund G, Kelley K 1998 Activation
of protein kinase C and PI 3-kinase and promotion of macrophage
differentiation by IGF-I. J Immunol 160:13931401[Abstract/Free Full Text]
-
Seely B, Reichart D, Saltiel A, Olefsky J 1995 Localization
of the IGF-I-receptor binding sites for p85, Syp, and GTPase
activating protein. J Biol Chem 270:1915119157[Abstract/Free Full Text]
-
Shakibaei M, John T, De Souza P, Rahmanzadeh R, Merker H 1999 Signal transduction by ß1 integrin receptors in human chondrocytes
in vitro: collaboration with the IGF-I-receptor. Biochem J 342:615623
-
Kasus-Jacobi A, Perdereau D, Tartare-Deckert S, Van Obberghen
E, Girard J, Burnol A 1997 Evidence for a direct interaction between
Insulin receptor substrate-1 and Shc. J Biol Chem 272:1716617170[Abstract/Free Full Text]
-
Gu J, Tamura M, Pankov R, Danen E, Takino T, Matsumoto K,
Yamada K 1999 Shc and FAK differentially regulate cell motility and
directionality modulated by PTEN. J Cell Biol 146:389403[Abstract/Free Full Text]
-
Sato K, Otsuki T, Kimoto M, Kakumoto M, Tokmakov A, Watanabe
Y, Fukami Y 1998 c-Src and phosphatidylinositol 3-kinase are involved
in NGF-dependent tyrosine phosphorylation of Shc in PC12 cells. Biochem
Biophys Res Commun 250:223228[CrossRef][Medline]
-
Wary K, Mainiero F, Isakoff S, Marcantonio E, Giancotti F 1996 The adaptor protein Shc couples a class of integrins to the control of
cell cycle progression. Cell 87:733743[CrossRef][Medline]
-
Wong H, Anderson WD, Cheng T, Riabowol KT 1994 Monitoring mRNA
expression by polymerase chain reaction: the "primer-dropping"
method. Anal Biochem 223:251258[CrossRef][Medline]
-
Vidal-Puig A, Jimenez-Linan M, Lowell BB, Hamann A, Spiegelman
B, Flier JS, Moller DE 1996 Regulation of PPAR
gene expression
by nutrition and obesity in rodents. J Clin Invest 97:25532561[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
K.-A. Kim, J.-H. Kim, Y. Wang, and H. S. Sul
Pref-1 (Preadipocyte Factor 1) Activates the MEK/Extracellular Signal-Regulated Kinase Pathway To Inhibit Adipocyte Differentiation
Mol. Cell. Biol.,
March 15, 2007;
27(6):
2294 - 2308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lieskovska, Y. Ling, J. Badley-Clarke, and D. R. Clemmons
The Role of Src Kinase in Insulin-like Growth Factor-dependent Mitogenic Signaling in Vascular Smooth Muscle Cells
J. Biol. Chem.,
September 1, 2006;
281(35):
25041 - 25053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Laviola, S. Perrini, A. Cignarelli, A. Natalicchio, A. Leonardini, F. De Stefano, M. Cuscito, M. De Fazio, V. Memeo, V. Neri, et al.
Insulin signaling in human visceral and subcutaneous adipose tissue in vivo.
Diabetes,
April 1, 2006;
55(4):
952 - 961.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sekimoto, J. Eipper-Mains, S. Pond-Tor, and C. M. Boney
{alpha}v{beta}3 Integrins and Pyk2 Mediate Insulin-Like Growth Factor I Activation of Src and Mitogen-Activated Protein Kinase in 3T3-L1 Cells
Mol. Endocrinol.,
July 1, 2005;
19(7):
1859 - 1867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R J Santen, R X Song, Z Zhang, R Kumar, M-H Jeng, A Masamura, J Lawrence Jr, L Berstein, and W Yue
Long-term estradiol deprivation in breast cancer cells up-regulates growth factor signaling and enhances estrogen sensitivity
Endocr. Relat. Cancer,
July 1, 2005;
12(Supplement_1):
S61 - S73.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ling, L. A. Maile, J. Lieskovska, J. Badley-Clarke, and D. R. Clemmons
Role of SHPS-1 in the Regulation of Insulin-like Growth Factor I-stimulated Shc and Mitogen-activated Protein Kinase Activation in Vascular Smooth Muscle Cells
Mol. Biol. Cell,
July 1, 2005;
16(7):
3353 - 3364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. M. El-Shewy, F. L. Kelly, L. Barki-Harrington, and L. M. Luttrell
Ectodomain Shedding-Dependent Transactivation of Epidermal Growth Factor Receptors in Response to Insulin-Like Growth Factor Type I
Mol. Endocrinol.,
November 1, 2004;
18(11):
2727 - 2739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Kim, C. Y. Yoon, P. G. Jang, Y. J. Park, C. S. Shin, H. S. Park, J. W. Ryu, Y. K. Pak, J. Y. Park, K. U. Lee, et al.
The Mitogenic and Antiapoptotic Actions of Ghrelin in 3T3-L1 Adipocytes
Mol. Endocrinol.,
September 1, 2004;
18(9):
2291 - 2301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xu and K. Liao
Protein Kinase B/AKT 1 Plays a Pivotal Role in Insulin-like Growth Factor-1 Receptor Signaling Induced 3T3-L1 Adipocyte Differentiation
J. Biol. Chem.,
August 20, 2004;
279(34):
35914 - 35922.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Petersen, C. Jorgensen, A. C. Rustan, L. Froyland, K. Muller-Decker, G. Furstenberger, R. K. Berge, K. Kristiansen, and L. Madsen
Arachidonic acid-dependent inhibition of adipocyte differentiation requires PKA activity and is associated with sustained expression of cyclooxygenases
J. Lipid Res.,
December 1, 2003;
44(12):
2320 - 2330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Entingh, C. M. Taniguchi, and C. R. Kahn
Bi-directional Regulation of Brown Fat Adipogenesis by the Insulin Receptor
J. Biol. Chem.,
August 29, 2003;
278(35):
33377 - 33383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sekimoto and C. M. Boney
C-Terminal Src Kinase (CSK) Modulates Insulin-Like Growth Factor-I Signaling through Src in 3T3-L1 Differentiation
Endocrinology,
June 1, 2003;
144(6):
2546 - 2552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhang, J. Nohr, C. H. Jensen, R. K. Petersen, E. Bachmann, B. Teisner, L. K. Larsen, S. Mandrup, and K. Kristiansen
Insulin-like Growth Factor-1/Insulin Bypasses Pref-1/FA1-mediated Inhibition of Adipocyte Differentiation
J. Biol. Chem.,
May 30, 2003;
278(23):
20906 - 20914.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Prusty, B.-H. Park, K. E. Davis, and S. R. Farmer
Activation of MEK/ERK Signaling Promotes Adipogenesis by Enhancing Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) and C/EBPalpha Gene Expression during the Differentiation of 3T3-L1 Preadipocytes
J. Biol. Chem.,
November 22, 2002;
277(48):
46226 - 46232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Lennon, M. Ramauge, A. Dessouroux, and M. Pierre
MAP Kinase Cascades Are Activated in Astrocytes and Preadipocytes by 15-Deoxy-Delta 12-14-prostaglandin J2 and the Thiazolidinedione Ciglitazone through Peroxisome Proliferator Activator Receptor gamma -independent Mechanisms Involving Reactive Oxygenated Species
J. Biol. Chem.,
August 9, 2002;
277(33):
29681 - 29685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Machinal-Quelin, M. N. Dieudonne, M. C. Leneveu, R. Pecquery, and Y. Giudicelli
Proadipogenic effect of leptin on rat preadipocytes in vitro: activation of MAPK and STAT3 signaling pathways
Am J Physiol Cell Physiol,
April 1, 2002;
282(4):
C853 - C863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-C. Beauchamp and G. Renier
Homocysteine Induces Protein Kinase C Activation and Stimulates c-Fos and Lipoprotein Lipase Expression in Macrophages
Diabetes,
April 1, 2002;
51(4):
1180 - 1187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. X.-D. Song, R. A. McPherson, L. Adam, Y. Bao, M. Shupnik, R. Kumar, and R. J. Santen
Linkage of Rapid Estrogen Action to MAPK Activation by ER{alpha}-Shc Association and Shc Pathway Activation
Mol. Endocrinol.,
January 1, 2002;
16(1):
116 - 127.
[Abstract]
[Full Text]
[PDF]
|
 |
|