help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boney, C. M.
Right arrow Articles by Frackelton, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boney, C. M.
Right arrow Articles by Frackelton, A. R., Jr.
Molecular Endocrinology 14 (6): 805-813
Copyright © 2000 by The Endocrine Society

The Critical Role of Shc in Insulin-Like Growth Factor-I-Mediated Mitogenesis and Differentiation in 3T3-L1 Preadipocytes

Charlotte M. Boney, Philip A. Gruppuso, Ronald A. Faris and A. Raymond Frackelton, Jr.

Department of Pediatrics Rhode Island Hospital (C.M.B., P.A.G., R.A.F.) Providence, Rhode Island 02903
Department of Medicine (A.R.F.) Roger Williams Hospital Providence, Rhode Island 02908
Departments of Pediatrics and Pathology and Laboratory Medicine Brown University Providence, Rhode Island 02906


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factor-I (IGF-I) stimulates mitogenesis in proliferating preadipocytes, but when cells reach confluence and become growth arrested, IGF-I stimulates differentiation into adipocytes. IGF-I induces signaling pathways that involve IGF-I receptor-mediated tyrosine phosphorylation of Shc and insulin receptor substrate 1 (IRS-1). Either of these adaptor proteins can lead to activation of the three-kinase cascade ending in activation of the extracellular signal-regulated kinase 1 and -2 (ERK-1 and -2) mitogen-activated protein kinases (MAPKs). Several lines of evidence suggest that activation of MAPK inhibits 3T3-L1 preadipocyte differentiation. We have shown that IGF-I stimulation of MAPK activity is lost as 3T3-L1 preadipocytes begin to differentiate. This change in MAPK signaling coincides with loss of IGF-I-mediated Shc, but not IRS-1, tyrosine phosphorylation. We hypothesized that down-regulation of MAPK via loss of proximal signaling through Shc is an early component in the IGF-I switch from mitogenesis to differentiation in 3T3-L1 preadipocytes. Treatment of subconfluent cells with the MEK inhibitor PD098059 inhibited both IGF-I-activation of MAPK as well as 3H-thymidine incorporation. PD098059, in the presence of differentiation-inducing media, accelerated differentiation in subconfluent cells as measured by expression of adipocyte protein-2 (aP-2), peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) and lipoprotein lipase (LPL). Transient transfection of subconfluent cells with Shc-Y317F, a dominant-negative mutant, attenuated IGF-I-mediated MAPK activation, inhibited DNA synthesis, and accelerated expression of differentiation markers aP-2, PPAR{gamma}, and LPL. We conclude that signaling through Shc to MAPK plays a critical role in mediating IGF-I-stimulated 3T3-L1 mitogenesis. Our results suggest that loss of the ability of IGF-I to activate Shc signaling to MAPK may be an early component of adipogenesis in 3T3-L1 cells. plays an important role in preadipocyte growth and differentiation. IGF-I stimulates mitogenesis in many cell types in culture, including preadipocytes (1), and IGF-I (or pharmacological doses of insulin) is clearly required for preadipocyte differentiation in vitro (2, 3). This dual role of IGF-I, stimulation of both mitogenesis and differentiation, indicates that these responses are not necessarily mutually exclusive. In vitro, IGF-I stimulates differentiation of preadipocytes once density-induced growth arrest has occurred (4).

The mechanisms of intracellular signaling used by IGF-I to promote mitogenesis or differentiation of preadipocytes are now beginning to be elucidated. The biological effects of IGF-I are mediated through the IGF-I receptor (IGFR), a member of the tyrosine kinase family of growth factor receptors. The activated IGFR tyrosine kinase phosphorylates specific substrates, such as the adaptor proteins Shc and insulin receptor substrate-1 (IRS-1). Tyrosine phosphorylation of these proteins stimulates specific protein-protein interactions via well characterized domains to mediate diverse signaling pathways (5). Shc, a substrate for many growth factor receptor tyrosine kinases, is a key component of signaling complexes that activate several effector pathways, including the small G- protein Ras (6). Ras then activates the three-kinase cascade terminating in the mitogen-activated protein kinases (MAPKs), extracellular signal regulated kinase 1 (ERK1) and ERK2 (7, 8). These MAPK isoforms mediate the mitogenic effects of IGF-I in a number of cell types (9–11). IRS-1, considered to be the major substrate of the IGFR, can activate multiple downstream targets, including Ras and phosphatidylinositol 3- kinase (PI3K) (5, 12).

We have previously shown that IGF-I is a potent stimulator of the MAPKs ERK1 and ERK2 in proliferating 3T3-L1 preadipocytes, and that there is a dramatic decrease in IGF-I-stimulated MAPK activity during early differentiation of 3T3-L1 cells (13). This change in MAPK signaling coincides with the loss of IGF-I-stimulated Shc, but not IRS-1, phosphorylation. This indicates that proximal signaling through Shc to MAPK is down-regulated very early in IGF-I-mediated preadipocyte differentiation. Activation of MAPK in growth-arrested 3T3-L1 cells through transfection of active components of the MAPK cascade (14) or by epidermal growth factor (15, 16) inhibits differentiation. Therefore, down-regulation of MAPK activity may be necessary for preadipocyte differentiation.

We hypothesized that down-regulation of MAPK via loss of proximal signaling by Shc is involved in mediating the IGF-I switch from 3T3-L1 mitogenesis to differentiation. We used a synthetic inhibitor of MAPK activation (PD098059) or a dominant-negative form of Shc to inhibit mitogenesis and promote differentiation in 3T3-L1 cells independently of the usual requirement for density-induced growth arrest. PD098059 inhibits high-dose insulin stimulation of MAPK in 3T3-L1 cells (14). The Shc mutant consists of a tyrosine-to-phenylalanine substitution at position 317, rendering it defective in signaling to Ras (17). Our results demonstrate the critical role of Shc in the switch from IGF-I-mediated mitogenesis to IGF-I-mediated differentiation of 3T3-L1 cells.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Effect of the MAPK Inhibitor PD098059 on IGF-I-Stimulated Mitogenesis in 3T3-L1 Preadipocytes
To test whether MAPK mediates the mitogenic effects of IGF-I in proliferating 3T3-L1 preadipocytes, we asked whether PD098059, a specific noncompetitive inhibitor of the MAPK kinase, MEK-1 (18), would affect IGF-I-stimulated MAPK activation and 3H-thymidine incorporation. We treated subconfluent 3T3-L1 cells with or without 50 µM PD098059 before stimulation with 10 nM IGF-I and then analyzed for active ERK-1 and -2 MAPK by Western blotting with phosphospecific MAPK antibodies. As expected, PD098059 was a potent inhibitor of IGF-I-stimulated MAPK activity in 3T3-L1 preadipocytes (Fig. 1AGo).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Effect of PD098059 on Activation of MAPK and 3H-Thymidine Incorporation in 3T3-L1 Cells

A, 3T3-L1 cells (60–80% confluent) were treated with 10 nM IGF-I for 5 min after preincubation of cells for 2 h with or without 50 µM PD098059. Cell lysates were resolved by SDS-PAGE and then analyzed by Western blotting for phosphorylated MAPK (P-MAPK) and total MAPK. This blot is representative of more than 10 repeats. B, Subconfluent, proliferating cells were serum starved overnight and treated with 10 nM IGF-I for 24 h. During the last 6 h, 3H-thymidine (1 µCi per well) was added to proliferating cells in the absence (P) or presence (P/PD) of 50 µM PD098059 or to growth-arrested cells (GA). Incorporation of 3H-thymidine into DNA is expressed as the mean and SEM (n = 6 wells per condition). Similar results were seen in a second experiment.

 
We then measured 3H-thymidine incorporation in IGF-I-stimulated cells in the presence and absence of 50 µM PD098059 (Fig. 1BGo). Treatment of proliferating cells with the MEK inhibitor substantially reduced 3H-thymidine incorporation in response to IGF-I. DNA synthesis was negligible in postconfluent cells undergoing density-induced growth arrest. To make sure that inhibition of 3H-thymidine incorporation by PD098059 reflected inhibition of proliferation and not an increase in cell death, cell cycle analysis was performed by standard flow cytometry. The percent apoptotic cells in asynchronous, proliferating cells was 1.26 + 1.13 (mean + SD; n = 3), and the percent after overnight treatment with PD098059 was 0.74 + 0.5 (mean + SD; n = 3).

The Effect of PD098059 on IGF-I-Stimulated Differentiation in Subconfluent 3T3-L1 Preadipocytes
To test the hypothesis that loss of MAPK activation is permissive for IGF-I-mediated differentiation, we treated subconfluent 3T3-L1 preadipocytes with differentiation-inducing medium (DMI) in the absence or presence of PD098059. Expression of differentiation-specific genes was determined by Northern analysis and RT-PCR. Northern analysis of total RNA for the lipid-binding protein adipocyte protein-2 (aP-2), a late marker of adipocyte differentiation, revealed detectable expression after treatment with DMI but enhanced expression in the presence of PD098059 (Fig. 2Go). We then examined earlier markers of differentiation, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), and lipoprotein lipase (LPL), using semiquantitative RT-PCR. Subconfluent preadipocytes were treated with DMI or serum-containing medium in the absence or presence of PD098059. PD098059 led to a modest enhancement in the expression of PPAR{gamma} in this and other repeat experiments. However, LPL was only detected in total RNA from cells treated with both PD098059 and DMI (Fig. 3Go). These data suggest that inhibition of MAPK in subconfluent, proliferating 3T3-L1 cells accelerates differentiation.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 2. Northern Analysis of aP-2 Expression in 3T3-L1 Cells Treated with DMI and PD098059

Cells (80% confluent) were treated for 72 h with SCM (lanes 1 and 2), DMI (lanes 3, 4, 7, and 8) or DMI and 50 µM PD098059 (lanes 5 and 6) before analysis of total RNA. Postconfluent, growth-arrested cells treated with SCM for 72 h (lane 9) served as a negative control, and growth-arrested cells treated with DMI for 72 h (lanes 10 and 11) served as a positive control. The upper panel is the Northern blot for aP-2, and the lower panel is a picture of the ethidium bromide-stained gel demonstrating rRNA abundance. Similar results were seen in a second experiment.

 


View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Semiquantitative RT-PCR Analysis of Early Markers of Differentiation in 3T3-L1 Cells Treated with DMI and PD098059

Cells (50% confluent) were treated for 48 h with SCM (C) or DMI (D) alone in the absence (-) or presence of 50 µM PD098059 (+) before isolation of total RNA. Total RNA (2 µg) was reverse transcribed and analyzed by multiplex PCR for expression of PPAR{gamma} and GAPDH or LPL and GAPDH. This represents one of three experiments.

 
Changes in IGF-I-Mitogenic Signaling in 3T3-L1 Preadipocytes Associated with Transfection of a Dominant-Negative Shc Mutant
Although IRS-1 is considered to be of primary importance in IGF-I signaling, both Shc and IRS-1 become phosphorylated when the IGF-I receptor is activated. To test the hypothesis that Shc is necessary for IGF-I mitogenic signaling in proliferating 3T3-L1 cells, we transiently transfected subconfluent cells with a dominant-negative Shc mutant. This mutant is a glutathione-S-transferase (GST) fusion protein with phenylalanine substituted for tyrosine at the 317 position of Shc, rendering it defective in signaling to Ras (17). Expression of the mutant GST-ShcY317F is abundant by 24 h, reaches a maximum at 48 h and remains close to maximum at 72 h (data not shown). Figure 4AGo demonstrates maximal expression 48 h after transfection of the mutant GST-ShcY317F protein in comparison to the three endogenous isoforms of Shc. Western blot analysis of MAPK activation in proliferating cells 48 h after transfection revealed inhibition of IGF-I-stimulated MAPK activity by ShcY317F compared with empty vector (GST alone) or GST-wild-type Shc at transfection efficiencies of 40–50% (Fig. 4BGo).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. Mutant ShcY317F Expression and Inhibition of MAPK Activity

A, Western blot of Shc proteins 48 h after transient transfection of 50% confluent 3T3-L1 cells with empty vector (GST alone), GST-ShcY317F, or no vector (No Tx). The endogenous, wild-type Shc (WT Shc) isoforms are indicated with a bracket, and the GST-Shc mutant is noted with an arrow. B, A representative Western blot of phosphorylated MAPK in IGF-I-treated cells transfected with empty vector (GST alone) or GST-ShcY317F at a transfection efficiency of approximately 40%; 48 h following transfection, cells were stimulated with 10 nM IGF-I for 5 min and analyzed for phosphorylated MAPK and total MAPK. Total MAPK was consistent across all lanes (not shown). Below the Western blot, phospho-MAPK was quantitated by densitometry, normalized for the total amount of MAPK, and expressed as mean + SEM densitometric units. Open bars represent control and closed bars represent stimulation with 10 nM IGF-I for 5 min. Results are compiled from four separate experiments: three comparing empty vector (GST alone) to Shc mutant and one experiment comparing empty vector to GST-wild-type Shc to Shc mutant (n = 3 for this experiment).

 
To test the effect of the dominant-negative Shc mutant on IGF-I-stimulated mitogenesis, we evaluated DNA synthesis by measuring BrdU incorporation in cells transfected with the GST-wild-type Shc or GST-ShcY317F mutant and then treated with IGF-I. Using double fluorescent immunohistochemical staining for BrdU and GST, we counted the number of BrdU-positive nuclei in GST-positive cells. Immunohistochemical staining of BrdU and GST in a representative field of cells transfected with wild type Shc or the Shc mutant is shown in Fig. 5Go. Cells expressing GST-wild-type Shc and exposed to BrdU have yellow nuclei and red cytoplasm (Fig. 5BGo), indicating BrdU incorporation into cells transfected with wild-type Shc. However, staining of GST-ShcY317F-transfected cells revealed red cytoplasm but no nuclear BrdU staining (Fig. 5DGo), indicating inhibition of BrdU uptake in cells expressing the Shc mutant. Also in this field is a nontransfected cell that is BrdU positive. In an experiment with 50–60% transfection efficiency, 100 cells were counted for each condition: 28% of cells transfected with the GST-ShcY317F mutant incorporated BrdU in response to IGF-I compared with 69% in cells transfected with GST-wild-type Shc (significance by Fischer’s exact test gave a two-sided P = 0.0001). These data demonstrate inhibition of IGF-I-stimulated DNA synthesis by the dominant-negative Shc in proliferating 3T3-L1 cells.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Immunohistochemical Analysis of BrdU Incorporation into Transfected 3T3-L1 Cells

Forty eight hours after transfection of GST-wild-type Shc or GST-ShcY317F, cells were incubated with 10 µM BrdU in the presence of 10 nM IGF-I for 4 h and then fixed in 100% cold methanol. Costaining of BrdU (yellow or green nuclei) and GST (red cytoplasm) followed by DAPI staining of nuclei was performed as described in Materials and Methods. Top panels, DAPI staining of nuclei (A) and costaining of BrdU and GST (B) in cells transfected with wild-type Shc. Bottom panels, DAPI staining of nuclei (C) and costaining of BrdU and GST (D) in cells transfected with ShcY317F. This experiment was repeated once with this antibody. However, two other repeat experiments also gave similar results, although specific staining was less dramatic using different primary antibodies for GST.

 
The Effect of the Dominant-Negative Shc Mutant on IGF-I-Stimulated Differentiation in Subconfluent 3T3-L1 Cells
Although mitogenesis and differentiation are considered to be mutually exclusive, IGF-I is known to stimulate both mitogenesis and differentiation in 3T3-L1 preadipocytes. We hypothesized that loss of mitogenic signaling through Shc is a key event in the switch from IGF-I-mediated mitogenesis to differentiation. To test this, we inhibited Shc signaling in subconfluent 3T3-L1 cells via transfection with dominant-negative Shc, and then treated cells 24 h after transfection with DMI and analyzed for early and late markers of adipocyte differentiation. Expression of the late marker aP-2, assessed by Northern analysis of total RNA, was evident after 72 h of DMI treatment in cells transfected with Shc mutant (Fig. 6Go). To examine earlier markers of differentiation, expression of PPAR{gamma} and LPL was evaluated by RT-PCR. After 60 h of treatment with DMI, cells transfected with dominant-negative Shc, but not empty vector (GST alone) or GST-wild type Shc, expressed significant PPAR{gamma} (Fig. 7AGo). By 78 h, both the Shc mutant and empty vector transfectants expressed PPAR{gamma} (data not shown), but only cells transfected with the Shc mutant expressed LPL (Fig. 7BGo). These data suggest that inhibition of Shc signaling is sufficient to permit differentiation in subconfluent 3T3-L1 cells.



View larger version (99K):
[in this window]
[in a new window]
 
Figure 6. Northern Analysis of aP-2 Expression from transfected 3T3-L1 Cells Treated with DMI

Twenty four hours after 50% confluent cells were transfected with the empty vector (GST alone) or ShcY317F, cells were treated with DMI for 72 h before isolation of total RNA. Transfection efficiency was approximately 30%. Control cells, which were not transfected, were treated with SCM and served as a negative control (-). Growth-arrested cells treated with DMI for 72 h served as a positive control (+). The upper panel is the Northern blot for aP-2, and the lower panel is a picture of the ethidium bromide-stained gel indicating rRNA abundance. Similar results were obtained in a replicate experiment.

 


View larger version (51K):
[in this window]
[in a new window]
 
Figure 7. Semiquantitative RT-PCR Analysis of Early Differentiation Markers in Transfected 3T3-L1 Cells Treated with DMI

Twenty four hours after 50% confluent cells were transfected, cells were treated with DMI. Total RNA was isolated at 60 h for PPAR{gamma} analysis and 78 h for LPL analysis. Transfection efficiency was approximately 50%. A, Total RNA (2 µg) was reverse transcribed and analyzed by multiplex PCR for PPAR{gamma} and GAPDH. Two separate experiments are shown. The left panel is the result from cells transfected with empty vector (GST alone) or the GST-ShcY317F mutant. The right panel is the result from cells transfected with empty vector (GST alone), GST-wild-type Shc, or the GST-ShcY317F mutant. B, Total RNA (2 µg) from cells transfected with empty vector (GST alone) or GST-ShcY317F mutant was reverse transcribed and analyzed by multiplex PCR for LPL and GAPDH. Similar results were obtained in several additional experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
It is well established that the MAPK signaling cascade mediates the mitogenic effects of IGF-I in numerous mesenchymal-derived cell systems, including myoblasts (19, 20), rat-1 fibroblasts (21), vascular smooth muscle cells (22), and rat fetal brown adipocytes (23). As expected, we were able to demonstrate that the MEK-1 inhibitor PD098059 completely inhibits MAPK activation by IGF-I in subconfluent 3T3-L1 preadipocytes. By blocking IGF-I-stimulated MAPK activation, DNA synthesis is substantially reduced in subconfluent cells, indicating that the MAPK pathway is important for IGF-I-stimulated mitogenesis in 3T3-L1 preadipocytes.

Inhibition of MAPK by PD098059 promotes differentiation in subconfluent as well as growth-arrested 3T3-L1 cells. Compared with treatment with DMI alone, PD098059 increased expression of PPAR{gamma} and significantly increased expression of the later markers, suggesting that inhibition of MAPK activation is permissive for IGF-I-stimulated differentiation. Similar data were shown by Font de Mora et al. (14) using pharmacological doses of insulin in postconfluent cells. They demonstrated PD098059 inhibition of MAPK activation by insulin in 3T3-L1 cells and a small increase in differentiation markers in PD098059-treated growth-arrested cells. However, we have previously shown that MAPK activation by IGF-I in growth-arrested 3T3-L1 preadipocytes is already decreased (13), so we would predict the effect of PD098059 to be attenuated in growth-arrested compared with subconfluent cells.

Our results show that inhibition of MAPK, even in the absence of density-induced growth arrest, permits differentiation of 3T3-L1 cells. Similar observations have been made in IGF-I-mediated growth and differentiation of rat fetal brown adipocytes (23) and L6A1 myoblasts (24). Those studies demonstrated the role of MAPK activation in mitogenesis and the promotion of differentiation by MAPK inhibition using PD098059, leading us to conclude that these signaling mechanisms may be common to cell systems in which IGF-I stimulates both proliferation and differentiation. In addition, mitogenic hormones such as epidermal growth factor and tumor necrosis factor {alpha} (15, 16), as well as transfection of constitutively active components of the MAPK cascade, inhibit 3T3-L1 differentiation by activation of MAPK (14). We conclude that loss of MAPK activation is both permissive and necessary for 3T3-L1 differentiation.

Several elegant studies by others have investigated the role of upstream mediators of MAPK in 3T3-L1 differentiation, including Raf-1 and Ras (25, 26). Although these data indicate a role for Ras, and to a lesser extent Raf-1, in IGF-I-mediated 3T3-L1 differentiation, these signaling molecules activate MAPK in proliferating, but not differentiating, cells (27, 28). Further upstream, signaling complexes are formed from activated adaptor proteins such as Shc or IRS-1, which can then bind Grb2 and Sos (5). These signaling complexes activate the small G protein Ras, which leads to Raf-1 activation. Raf-1 is the first kinase in the three-kinase cascade ending in MAPK (7, 8).

We have previously shown that loss of MAPK activation by IGF-I in differentiating cells is associated with loss of Shc but not IRS-1 tyrosine phosphorylation (13). We have now presented evidence suggesting that Shc is a critical upstream mediator of MAPK activation in IGF-I-mediated 3T3-L1 mitogenesis. We did so by transiently expressing a dominant-negative Shc that is defective in signaling to Ras. This ShcY317F mutant blocked IGF-I activation of MAPK, inhibited IGF-I-stimulated BrdU incorporation, and promoted differentiation in subconfluent 3T3-L1 cells. We found no inhibition of IRS-1 tyrosine phosphorylation and associated binding of the p85 subunit of PI3K in cells transfected with empty vector (GST alone), wild-type Shc, or ShcY317F (data not shown). Studies by Ishihara et al. (29) found inhibition of IRS-1 signaling in stably transfected Rat1 fibroblasts expressing insulin and not IGF-I receptors, GST-wild-type Shc and GST-ShcY317F. However, unlike our experiments, expression of the GST-Shc proteins (wild-type and Y317F mutant) was in 10-fold excess of endogenous Shc, suggesting to us that inhibition of insulin-stimulated IRS-1 signaling may have been partly a result of the stoichiometry of the transfected proteins. Although we cannot absolutely rule out a role for IRS-1 in IGF-I mitogenic signaling, our results indicate a crucial role for Shc. Shc proteins have been shown to mediate the mitogenic effects of IGF-I in a number of other cell culture systems, including human neuroblastoma cells (30), myeloid progenitor cells (31), and rat-1 fibroblasts (32). On the other hand, IRS-1 (33) and its downstream targets PI3K (34, 35, 36) and protein kinase B (37, 38) appear to have major roles in mediating the differentiating effects of IGF-I in 3T3-L1 cells as well as fetal rat brown adipocytes.

We interpret our present and prior results to suggest that a change in IGF-I signaling from Shc-mediated mitogenesis to IRS-1-mediated differentiation is central to the process of adipogenesis. Our results indicate that inhibiting mitogenesis in subconfluent cells by inhibition of MAPK or transient transfection of the ShcY317F mutant is permissive for differentiation. However, the mechanisms responsible for the switch in Shc signaling, i.e. loss of IGF-I receptor phosphorylation of Shc, but not IRS-1, as 3T3-L1 cells become postconfluent, are unknown. One can speculate on a number of possibilities. For example, a change in IGF-I receptor internalization has been shown to affect Shc but not IRS-1 signaling (39). Binding of regulatory proteins such as Grb10 (40, 41), or protein kinases such as Src (42), protein kinase C (43, 44), or PI3K (44, 45) might directly or indirectly affect IGF-I receptor function. Interaction of the IGF-I receptor with other receptors or integrins (46) has been shown to regulate IGF-I receptor function. There are also many potential mechanisms that could affect Shc phosphorylation independent of a change in IGF-I receptor function, including interactions with IRS-1 (47), Shc phosphatases such as PTEN (48), Src (49), and integrins (50). Relevant to all these potential mechanisms is the conclusion that Shc represents a crucial point of divergence between IGF-I-mediated mitogenesis and IGF-I-stimulated differentiation of 3T3-L1 cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Tissue culture reagents, some RT-PCR reagents, plasmid pGreen lantern, and custom primers were purchased from Life Technologies, Inc. (Gaithersburg, MD). AdvanTaq Plus PCR kit and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control primers were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). Dexamethasone, methylisobutylxanthine, buffer reagents, and X-Omat AR film (Eastman Kodak, Rochester, NY) were purchased from Sigma (St. Louis, MO). 3H-thymidine, 32P-dCTP, enhanced chemiluminescence reagents, Hyperfilm ECL, and Hybond C nitrocellulose were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). Rabbit anti-Shc, rabbit anti-MAPK-1/2 (ERK1/2-CT), and rabbit anti-GST antibodies were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Secondary antibodies for immunocytochemistry were purchased from Pierce Chemical Co. (Rockford, IL). Avidin/Biotin blocking kit, Texas Red Streptavidin, and Vectashield plus 4,6-diamidino-2-phenylindole (DAPI) mounting medium were purchased from Vector Laboratories, Inc. (Burlingame, CA). Human recombinant IGF-I was obtained from GroPep Pty. Ltd. (Adelaide, Australia). PD098059 and anti-dual phosphorylated ERK-1 and -2 MAPK antibodies were purchased from New England Biolabs, Inc. (Beverly, MA). The plasmids containing GST-ShcY317F, GST-Shc, and GST alone were kind gifts from Dr. Kodi S. Ravichandran. The plasmid containing mouse aP-2 was the generous gift of Dr. Jessica Schwartz.

Cell Culture and Transfection
The murine preadipocyte line 3T3-L1 was obtained from American Type Culture Collection (Manassas, VA). Cells were grown in DMEM with l-glutamine, 1 g/liter glucose, 50 µg/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml Amphotericin, (Life Technologies, Inc., Gaithersburg, MD) and 10% FBS. Cultures were maintained in an atmosphere of 5% CO2-95% humidified air at 37 C. Serum-containing medium (SCM) was replaced every 3 days. Differentiation-inducing medium consisted of 0.5 µM dexamethasone, 0.5 mM methylisobutylxanthine, and 7 nM IGF-I (DMI) in SCM.

For transient transfection of 3T3-L1 cells, cells were seeded in six-well plates. The plasmids provided included ShcY317F cloned into pEBG as a GST fusion protein, wild- type Shc cloned into pEBG as a GST fusion protein, and the pEBG vector containing only GST (empty vector). The mutant Shc, wild-type Shc, or the empty vector was transfected into 50% confluent cells with pGreen Lantern at a ratio of 10:1. The plasmid pGreen Lantern expresses green fluorescent protein and was used as a marker of transfection efficiency. Initially the reagent Lipofectin (Life Technologies, Inc.) was used with transfection efficiencies of 20–30%. Improved transfection was subsequently obtained using GenePorter (Gene Therapy Systems, San Diego, CA) with transfection efficiencies of 40–50%. Cells were used for experiments 24–48 h after transfection.

Evaluation of Apoptosis by Flow Cytometry
3T3-L1 cells were grown to 50–60% confluency in 10-cm2 dishes. After overnight incubation in either SCM or SCM containing 50 µM PD098059, cells were detached with 0.05% trypsin and 0.5 mM EDTA, resuspended in SCM, and washed once with PBS. The cells were resuspended in PBS and stained with 0.02% propidium iodide (Sigma) for 5–10 min. DNA content was analyzed on a FACSort (Becton Dickinson and Co. Immunocytometry Systems, San Jose, CA) equipped with an argon-ion laser at 488 nm and Modifit LT software (Verity Software House, Inc., Topsham, ME).

Western Blotting
Preparation of cell lysates for Western blotting was as described previously (13), using lysis buffer with 1% Triton X-100 for anti-Shc Western blots and 0.2% Triton X-100 for anti-phospho-MAPK Western blots. Proteins were resolved by SDS-PAGE on 10% acrylamide gels and transferred to nitrocellulose. Membranes were blocked in 5% BSA in Tris-buffered saline with 0.1% Triton X-100 and probed with primary antibody at 1 µg/ml. Specific binding was visualized using enhanced chemiluminescence and Hyperfilm ECL and then analyzed by digital image analysis using a ScanJet 6100C/T scanner (Hewlett-Packard Co., Palo Alto, CA).

RNA Preparation And Northern Blot Analysis
Total RNA was prepared using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH). Aliquots of total RNA were denatured with dimethylsulfoxide and glyoxal, fractionated by agarose gel electrophoresis and transferred to GeneScreen nylon membranes (NEN Life Science Products, Boston, MA). Membranes were prehybridized in High Efficiency Hybridization solution without formamide (Molecular Research Center, Inc., Cincinnati, OH) and then hybridized with [{alpha}-32P]dCTP-radiolabeled cDNA for aP-2 using a random primed labeling kit (Roche Molecular Biochemicals, Indianapolis, IN). After extensive posthybridization rinses at 60 C, blots were exposed to X-Omat film (Eastman Kodak Co.).

Semiquantitative RT-PCR
Aliquots of 2 µg total RNA were DNAse treated before reverse transcription and primer-dropping PCR as described previously (51). Primer sequences used for detection of murine PPAR{gamma}2 transcripts were taken from Vidal-Puig et al. (52) and resulted in a predicted PCR product of 277 bp. Primer sequences used for detection of murine LPL transcripts were, from 5' to 3', left GCGTAGCAGGAAGTCTGACC, right CTACAACTCAGGCAGAGCCC and resulted in a predicted PCR product of 421 bp. Primers for murine GAPDH were purchased from CLONTECH Laboratories, Inc. and resulted in a predicted PCR product of 980 bp. Optimal PCR cycles required for linear amplification for each primer set were determined. Total amplification in each reaction (GAPDH plus PPAR{gamma}2 or GAPDH plus LPL) was kept below saturation levels to permit the two products to remain within each primer set’s exponential range. GAPDH required 16 to 20 cycles, and its expression was the same in proliferating, postconfluent or differentiating 3T3-L1 cells. PPAR{gamma}2 required 22–26 cycles and LPL required 19–22 cycles, and these cycles were determined from differentiating 3T3-L1 cells. Gels were illuminated with UV light and photographed with Polaroid film.

3H-Thymidine and Bromodeoxyuridine (BrdU) Incorporation
For 3H-thymidine incorporation, cell monolayers were grown to approximately 70% confluence in six-well plates and serum-starved overnight in DMEM with 0.1% BSA before treatment with 10 nM IGF-I for 24 h. Cells were incubated with 50 µM PD098059 (from a stock of 50 mM in DMSO) or an equal volume of DMSO in the presence of 1 µCi/well 3H-thymidine for 6 h before lysis in 0.33 M NaOH. An aliquot was removed for protein assay before DNA precipitation with ice-cold 40% TCA/1.2 M HCl and collection on glass fiber filters for counting. The background level of 3H-thymidine was less than 200 cpm as determined by the addition of 3H-thymidine to a control well just before cell lysis and DNA precipitation.

BrdU incorporation was determined in cell monolayers transfected with wild-type Shc or ShcY317F at 50% confluency in six-well plates. Forty-eight hours after transfection, monolayers were placed in DMEM plus 0.1% BSA or DMEM plus 0.1% BSA and 10 nM IGF-I overnight followed by incubation with 10 µM BrdU (BrdU labeling and detection kit II, Roche Molecular Biochemicals) for 4 h. The cell monolayers were fixed in 100% ice-cold methanol at -20 C for 10 min, allowed to air dry, and then stored at -20 C.

Immunocytochemistry
For immunocytochemical costaining of BrdU incorporation and GST expression, fixed cells were blocked in 1% normal goat serum before incubation with 1:15 dilution of mouse anti-BrdU (BrdU labeling and detection kit II, Roche Molecular Biochemicals) at 37 C for 60 min followed by 10 µg/ml fluorescein isothiocyanate-conjugated goat antimouse IgG at room temperature for 30 min. The monolayers were washed with PBS, blocked in 1% normal donkey serum, and then blocked with avidin and biotin. Cells were incubated in 10 µg/ml rabbit anti-GST in 1% normal donkey serum followed by 10 µg/ml biotin-conjugated donkey anti-rabbit IgG and then Texas red streptavidin at a 1:200 dilution. All incubations were at room temperature for 30 min. Coverslips were mounted with Vectashield plus DAPI. Random fields of view were evaluated using an Eclipse 800 Photomicroscope (Nikon, Melville, NY) equipped with an epi-fluorescence condenser to analyze staining of BrdU in the nucleus and GST in the cytoplasm. Total number of cells was determined from DAPI staining of nuclei. Photomicrographs of monolayers were recorded using a Sensys digital camera connected to a power MacIntosh 8500 running IP Lab Spectrum P imaging software.


    ACKNOWLEDGMENTS
 
The authors thank Hiroko Sekimoto, Xiao Wang, and Rose Marie Smith for technical assistance.


    FOOTNOTES
 
Address requests for reprints to: Charlotte M. Boney, M.D., Department of Pediatrics, Rhode Island Hospital, 593 Eddy Street, MPS-2, Providence, RI 02903.

This work was supported by a Charles H. Hood Foundation Child Health Research Grant and a Knoll Pharmaceutical Co. Weight Risk Investigators Study Council Grant (to C.M.B.), Rhode Island Hospital Department of Pediatrics Research Endowment, and NIH Grants HD-24455 and HD-35831 (to P.A.G.).

Received for publication December 14, 1999. Revision received March 15, 2000. Accepted for publication March 22, 2000.


    REFERENCES
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Benito M, Valverde A, Lorenzo M 1996 IGF-I: a mitogen also involved in differentiation processes in mammalian cells. Int J Biochem Cell Biol 28:499–510[CrossRef][Medline]
  2. Smith P, Wise L, Berkowitz R, Wan C, Rubin C 1988 Insulin-like growth factor-I is an essential regulator of the differentiation of 3T3–L1 adipocytes. J Biol Chem 263:9402–9408[Abstract/Free Full Text]
  3. Schmidt W, Poll-Jordan G, Loffler G 1990 Adipose conversion of 3T3–L1 cells in a serum-free culture system depends on epidermal growth factor, insulin-like growth factor-I, corticosterone, and cyclic AMP. J Biol Chem 265:15489–15495[Abstract/Free Full Text]
  4. Gregoire F, Smas C, Sul H 1998 Understanding adipocyte differentiation. Physiol Rev 78:783–809[Abstract/Free Full Text]
  5. LeRoith D, Werner H, Beitner-Johnson D, Roberts C 1995 Molecular and cellular aspects of the insulin-like growth factor-I receptor. Endocr Rev 16:143–163[Abstract/Free Full Text]
  6. Ravichandran K, Lorenz U, Shoelson S, Burakoff S 1995 Interaction of Shc with Grb2 regulates association of Grb2 with mSos. Mol Cell Biol 15:593–600[Abstract]
  7. Seger R, Krebs E 1995 The MAPK signaling cascade. FASEB J 9:726–735[Abstract]
  8. Cobb M, Goldsmith E 1995 How MAP kinases are regulated. J Biol Chem 270:14843–14846[Free Full Text]
  9. Milasincic D, Calera M, Farmer S, Pilch P 1996 Stimulation of C2C12 myoblast growth by basic fibroblast growth factor and insulin-like growth factor-I can occur via mitogen-activated protein kinase-dependent and -independent pathways. Mol Cell Biol 16:5964–5973[Abstract]
  10. Webster J, Prager D, Melmed S 1994 Insulin-like growth factor-I activation of extracellular signal-related kinase-1 and -2 in growth hormone secreting cells. Mol Endocrinol 8:539–544[Abstract/Free Full Text]
  11. Calleja V, Enriquez P, Filloux C, Peraldi P, Baron V, Van Obberghen E 1999 The effect of cAMP on the mitogen-activated protein kinase pathway depends on both the cell type and the type of tyrosine kinase receptor. Endocrinology 138:1111–1120[Abstract/Free Full Text]
  12. Myers M, Sun X, White M 1994 The IRS-1 signaling system. Trends Biochem Sci 19:289–293[CrossRef][Medline]
  13. Boney C, Smith R, Gruppuso P 1998 Modulation of insulin-like growth factor-I mitogenic signaling in 3T3–L1 preadipocyte differentiation. Endocrinology 139:1638–11644[Abstract/Free Full Text]
  14. Font de Mora J, Porras A, Ahn N, Santos E 1997 Mitogen-activated protein kinase activation is not necessary for, but antagonizes, 3T3–L1 adipocytic differentiation. Mol Cell Biol 17:6068–6075[Abstract]
  15. Hu E, Kim J, Sarraf P, Spiegelman B 1996 Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPAR{gamma}. Science 274:2100–2103[Abstract/Free Full Text]
  16. Camp H, Tafuri S 1997 Regulation of perixisome proliferator-activated receptor {gamma} activity by mitogen-activated protein kinase. J Biol Chem 272:10811–10816[Abstract/Free Full Text]
  17. Stevenson L, Ravichandran K, Frackelton AJ 1999 Shc dominant negative disrupts cell cycle progression in both G0–G1 and G2-M of ErbB2-positive breast cancer cells. Cell Growth Differ 10:61–71[Abstract/Free Full Text]
  18. Alessi D, Cuenda A, Cohen P, Dudley D, Saltiel A 1995 PD098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem 270:27489–27494[Abstract/Free Full Text]
  19. Sarbassov D, Jones L, Peterson C 1997 Extracellular signal-regulated kinase-1 and -2 respond differently to mitogenic and differentiative signaling pathways in myoblasts. Mol Endocrinol 11:2038–2047[Abstract/Free Full Text]
  20. Samual D, Ewton D, Coolican S, Petley T, McWade F, Florini J 1999 Raf-1 activation stimulates proliferation and inhibits IGF-stimulated differentiation in L6A1 myoblasts. Horm Metab Res 31:55–64[Medline]
  21. Lefebvre D, Boney C, Ketelslegers J, Thissen J 1999 Inhibition of IGF-I mitogenic action by zinc chelation is associated with a decreased mitogen-activated protein kinase activation in RAT-1 fibroblasts. FEBS Lett 449:284–288[CrossRef][Medline]
  22. Imai Y, Clemmons D 1999 Roles of phosphatidlyinositol 3-kinase and mitogen-activated protein kinase pathways in stimulation of vascular smooth muscle cell migration and DNA synthesis by IGF-I. Endocrinology 140:4228–4235[Abstract/Free Full Text]
  23. Porras A, Alvarez A, Valladares A, Benito M 1998 p42/p44 mitogen-activated protein kinases activation is required for the IGF-I/insulin induced proliferation, but not differentiation, in rat fetal brown adipocytes. Mol Endocrinol 12:825–834[Abstract/Free Full Text]
  24. Coolican S, Samuel D, Ewton D, McWade F, Florini J 1997 The mitogenic and myogenic actions of insulin-like growth factors utilize distinct signaling pathways. J Biol Chem 272:6653–6662[Abstract/Free Full Text]
  25. Benito M, Porras A, Nebreda A, Santos E 1991 Differentiation of 3T3–L1 fibroblasts to adipocytes induced by transfection of ras oncogenes. Science 253:565–568[Abstract/Free Full Text]
  26. Porras A, Muszynski K, Rapp U, Santos E 1994 Dissociation between activation of raf-1 kinase and the 42-kDa mitogen-activated protein kinase/90 kDa S6 kinase cascade in the insulin-ras pathway of adipocytic differentiation of 3T3–L1 cells. J Biol Chem 269:12741–12748[Abstract/Free Full Text]
  27. Carel K, Kummer J, Schubert C, Leitner W, Heidenreich K, Draznin B 1996 Insulin stimulates mitogen-activated protein kinase by a ras-independent pathway in 3T3–L1 adipocytes. J Biol Chem 271:30625–30630[Abstract/Free Full Text]
  28. Suga J, Yoshimasa Y, Yamada K, Yamamoto Y, Nakao K 1997 Differential activation of mitogen-activated protein kinase by insulin and epidermal growth factor in 3T3–L1 adipocytes. Diabetes 46:735–741[Abstract]
  29. Ishihara H, Sasaoka T, Ishiki M, Takata Y, Imamura T, Usui I, Langlois W, Sawa T, Kobayashi M 1997 Functional importance of Shc tyrosine 317 on insulin signaling in Rat1 fibroblasts expressing insulin receptors. J Biol Chem 272:9581–9586[Abstract/Free Full Text]
  30. Kim B, Cheng H, Margolis B, Feldman E 1998 Insulin receptor substrate-2 and Shc play different roles in insulin-like growth factor-I signaling. J Biol Chem 273:34543–34550[Abstract/Free Full Text]
  31. Soon L, Flechner L, Gutkind J, Wang L, Baserga R, Pierce J, Li W 1999 IGF-I synergizes with interleukin-4 for hematopoietic cell proliferation independent of insulin receptor substrate expression. Mol Cell Biol 19:3816–3828[Abstract/Free Full Text]
  32. Takata Y, Imamura T, Haruta T, Sasaoka T, Kobayashi M 1996 The dominant negative effect of a kinase-defective insulin receptor on IGF-I-stimulated signaling in Rat-1 fibroblasts. Metabolism 45:1474–1482[CrossRef][Medline]
  33. Valverde A, Lorenzo M, Pons S, White M, Benito M 1998 Insulin receptor substrate proteins IRS-1 and IRS-2 differential signaling in the insulin/IGF-I pathways in fetal brown adipocytes. Mol Endocrinol 12:688–697[Abstract/Free Full Text]
  34. Tomiyama K, Nakata H, Watanabe Y 1995 Wortmannin, a specific PI 3-kinase inhibitor, inhibits adipocyte differentiation of 3T3–L1 cells. Biochem Biophys Res Commun 212:263–269[CrossRef][Medline]
  35. Sakaue H, Ogawa W, Matsumoto M 1998 Post-transcriptional control of adipocyte differentiation through activation of phosphoinositide 3-kinase. J Biol Chem 273:28945–28952[Abstract/Free Full Text]
  36. Teruel T, Valverde A, Navarro P, Benito M, Lorenzo M 1998 Inhibition of PI 3-kinase and RAS blocks IGF-I and insulin-induced uncoupling protein 1 gene expression in brown adipocytes. J Cell Physiol 176:99–109[CrossRef][Medline]
  37. Magun R, Burgering B, Soritsky A 1996 Expression of a constitutively activated form of protein kinase B in 3T3–L1 cells causes differentiation. Endocrinology 137:3590–3593[Abstract]
  38. Gagnon A, Chen C, Sorisky A 1999 Activation of protein kinase B and induction of adipogenesis by insulin in 3T3–L1 preadipocytes: contribution of phosphoinositide-3,4,5-triphosphate versus phosphoinositide-3,4-bisphosphate. Diabetes 48:691–698[Abstract]
  39. Chow J, Condorelli G, Smith R 1998 Insulin-like growth factor-I receptor internalization regulates signaling via the Shc/mitogen-activated protein kinase pathway, but not the insulin receptor substrate-1 pathway. J Biol Chem 273:4672–4680[Abstract/Free Full Text]
  40. Morrione A, Valentinis B, Resnicoff M, Xu S, Baserga R 1997 The role of Grb10 in IGF-I-mediated growth. J Biol Chem 272:26382–26387[Abstract/Free Full Text]
  41. Wang J, Dai H, Yousaf N, Moussaif M, Deng Y, Boufelliga A, Swamy O, Leone M, Riedel H 1999 Grb10, a positive stimulatory signaling adapter in platelet-derived growth factor BB-, IGF-I-, and insulin-mediated mitogenesis. Mol Cell Biol 19:6217–6228[Abstract/Free Full Text]
  42. Arbet-Engels C, Tartare-Deckert S, Eckhart W 1999 C-terminal Src kinase associates with ligand-stimulated insulin-like growth factor-I receptor. J Biol Chem 274:5422–5428[Abstract/Free Full Text]
  43. Valverde A, Lorenzo M, Benito M 1996 Involvement of Raf-1 kinase and protein kinase C in IGF-I-induced brown adipocyte mitogenic signaling cascades. Endocrinology 137:3832–3841[Abstract]
  44. Liu Q, Ning W, Danttzer R, Freund G, Kelley K 1998 Activation of protein kinase C and PI 3-kinase and promotion of macrophage differentiation by IGF-I. J Immunol 160:1393–1401[Abstract/Free Full Text]
  45. Seely B, Reichart D, Saltiel A, Olefsky J 1995 Localization of the IGF-I-receptor binding sites for p85, Syp, and GTPase activating protein. J Biol Chem 270:19151–19157[Abstract/Free Full Text]
  46. Shakibaei M, John T, De Souza P, Rahmanzadeh R, Merker H 1999 Signal transduction by ß1 integrin receptors in human chondrocytes in vitro: collaboration with the IGF-I-receptor. Biochem J 342:615–623
  47. Kasus-Jacobi A, Perdereau D, Tartare-Deckert S, Van Obberghen E, Girard J, Burnol A 1997 Evidence for a direct interaction between Insulin receptor substrate-1 and Shc. J Biol Chem 272:17166–17170[Abstract/Free Full Text]
  48. Gu J, Tamura M, Pankov R, Danen E, Takino T, Matsumoto K, Yamada K 1999 Shc and FAK differentially regulate cell motility and directionality modulated by PTEN. J Cell Biol 146:389–403[Abstract/Free Full Text]
  49. Sato K, Otsuki T, Kimoto M, Kakumoto M, Tokmakov A, Watanabe Y, Fukami Y 1998 c-Src and phosphatidylinositol 3-kinase are involved in NGF-dependent tyrosine phosphorylation of Shc in PC12 cells. Biochem Biophys Res Commun 250:223–228[CrossRef][Medline]
  50. Wary K, Mainiero F, Isakoff S, Marcantonio E, Giancotti F 1996 The adaptor protein Shc couples a class of integrins to the control of cell cycle progression. Cell 87:733–743[CrossRef][Medline]
  51. Wong H, Anderson WD, Cheng T, Riabowol KT 1994 Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method. Anal Biochem 223:251–258[CrossRef][Medline]
  52. Vidal-Puig A, Jimenez-Linan M, Lowell BB, Hamann A, Spiegelman B, Flier JS, Moller DE 1996 Regulation of PPAR{gamma} gene expression by nutrition and obesity in rodents. J Clin Invest 97:2553–2561[Medline]



This article has been cited by other articles:


Home page
J ANIM SCIHome page
G. J. Hausman, M. V. Dodson, K. Ajuwon, M. Azain, K. M. Barnes, L. L. Guan, Z. Jiang, S. P. Poulos, R. D. Sainz, S. Smith, et al.
BOARD-INVITED REVIEW: The biology and regulation of preadipocytes and adipocytes in meat animals
J Anim Sci, April 1, 2009; 87(4): 1218 - 1246.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Martin, R. Brenneman, E. Golden, T. Walent, K. G. Becker, V. V. Prabhu, W. Wood III, B. Ladenheim, J.-L. Cadet, and S. Maudsley
Growth Factor Signals in Neural Cells: COHERENT PATTERNS OF INTERACTION CONTROL MULTIPLE LEVELS OF MOLECULAR AND PHENOTYPIC RESPONSES
J. Biol. Chem., January 23, 2009; 284(4): 2493 - 2511.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Xi, X. Shen, and D. R. Clemmons
p66shc Negatively Regulates Insulin-Like Growth Factor I Signal Transduction via Inhibition of p52shc Binding to Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Substrate-1 Leading to Impaired Growth Factor Receptor-Bound Protein-2 Membrane Recruitment
Mol. Endocrinol., September 1, 2008; 22(9): 2162 - 2175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K.-A. Kim, J.-H. Kim, Y. Wang, and H. S. Sul
Pref-1 (Preadipocyte Factor 1) Activates the MEK/Extracellular Signal-Regulated Kinase Pathway To Inhibit Adipocyte Differentiation
Mol. Cell. Biol., March 15, 2007; 27(6): 2294 - 2308.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Lieskovska, Y. Ling, J. Badley-Clarke, and D. R. Clemmons
The Role of Src Kinase in Insulin-like Growth Factor-dependent Mitogenic Signaling in Vascular Smooth Muscle Cells
J. Biol. Chem., September 1, 2006; 281(35): 25041 - 25053.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Laviola, S. Perrini, A. Cignarelli, A. Natalicchio, A. Leonardini, F. De Stefano, M. Cuscito, M. De Fazio, V. Memeo, V. Neri, et al.
Insulin signaling in human visceral and subcutaneous adipose tissue in vivo.
Diabetes, April 1, 2006; 55(4): 952 - 961.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Sekimoto, J. Eipper-Mains, S. Pond-Tor, and C. M. Boney
{alpha}v{beta}3 Integrins and Pyk2 Mediate Insulin-Like Growth Factor I Activation of Src and Mitogen-Activated Protein Kinase in 3T3-L1 Cells
Mol. Endocrinol., July 1, 2005; 19(7): 1859 - 1867.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R J Santen, R X Song, Z Zhang, R Kumar, M-H Jeng, A Masamura, J Lawrence Jr, L Berstein, and W Yue
Long-term estradiol deprivation in breast cancer cells up-regulates growth factor signaling and enhances estrogen sensitivity
Endocr. Relat. Cancer, July 1, 2005; 12(Supplement_1): S61 - S73.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Ling, L. A. Maile, J. Lieskovska, J. Badley-Clarke, and D. R. Clemmons
Role of SHPS-1 in the Regulation of Insulin-like Growth Factor I-stimulated Shc and Mitogen-activated Protein Kinase Activation in Vascular Smooth Muscle Cells
Mol. Biol. Cell, July 1, 2005; 16(7): 3353 - 3364.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. M. El-Shewy, F. L. Kelly, L. Barki-Harrington, and L. M. Luttrell
Ectodomain Shedding-Dependent Transactivation of Epidermal Growth Factor Receptors in Response to Insulin-Like Growth Factor Type I
Mol. Endocrinol., November 1, 2004; 18(11): 2727 - 2739.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. S. Kim, C. Y. Yoon, P. G. Jang, Y. J. Park, C. S. Shin, H. S. Park, J. W. Ryu, Y. K. Pak, J. Y. Park, K. U. Lee, et al.
The Mitogenic and Antiapoptotic Actions of Ghrelin in 3T3-L1 Adipocytes
Mol. Endocrinol., September 1, 2004; 18(9): 2291 - 2301.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xu and K. Liao
Protein Kinase B/AKT 1 Plays a Pivotal Role in Insulin-like Growth Factor-1 Receptor Signaling Induced 3T3-L1 Adipocyte Differentiation
J. Biol. Chem., August 20, 2004; 279(34): 35914 - 35922.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
R. K. Petersen, C. Jorgensen, A. C. Rustan, L. Froyland, K. Muller-Decker, G. Furstenberger, R. K. Berge, K. Kristiansen, and L. Madsen
Arachidonic acid-dependent inhibition of adipocyte differentiation requires PKA activity and is associated with sustained expression of cyclooxygenases
J. Lipid Res., December 1, 2003; 44(12): 2320 - 2330.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. J. Entingh, C. M. Taniguchi, and C. R. Kahn
Bi-directional Regulation of Brown Fat Adipogenesis by the Insulin Receptor
J. Biol. Chem., August 29, 2003; 278(35): 33377 - 33383.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Sekimoto and C. M. Boney
C-Terminal Src Kinase (CSK) Modulates Insulin-Like Growth Factor-I Signaling through Src in 3T3-L1 Differentiation
Endocrinology, June 1, 2003; 144(6): 2546 - 2552.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, J. Nohr, C. H. Jensen, R. K. Petersen, E. Bachmann, B. Teisner, L. K. Larsen, S. Mandrup, and K. Kristiansen
Insulin-like Growth Factor-1/Insulin Bypasses Pref-1/FA1-mediated Inhibition of Adipocyte Differentiation
J. Biol. Chem., May 30, 2003; 278(23): 20906 - 20914.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Prusty, B.-H. Park, K. E. Davis, and S. R. Farmer
Activation of MEK/ERK Signaling Promotes Adipogenesis by Enhancing Peroxisome Proliferator-activated Receptor gamma (PPARgamma ) and C/EBPalpha Gene Expression during the Differentiation of 3T3-L1 Preadipocytes
J. Biol. Chem., November 22, 2002; 277(48): 46226 - 46232.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Lennon, M. Ramauge, A. Dessouroux, and M. Pierre
MAP Kinase Cascades Are Activated in Astrocytes and Preadipocytes by 15-Deoxy-Delta 12-14-prostaglandin J2 and the Thiazolidinedione Ciglitazone through Peroxisome Proliferator Activator Receptor gamma -independent Mechanisms Involving Reactive Oxygenated Species
J. Biol. Chem., August 9, 2002; 277(33): 29681 - 29685.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
F. Machinal-Quelin, M. N. Dieudonne, M. C. Leneveu, R. Pecquery, and Y. Giudicelli
Proadipogenic effect of leptin on rat preadipocytes in vitro: activation of MAPK and STAT3 signaling pathways
Am J Physiol Cell Physiol, April 1, 2002; 282(4): C853 - C863.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M.-C. Beauchamp and G. Renier
Homocysteine Induces Protein Kinase C Activation and Stimulates c-Fos and Lipoprotein Lipase Expression in Macrophages
Diabetes, April 1, 2002; 51(4): 1180 - 1187.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. X.-D. Song, R. A. McPherson, L. Adam, Y. Bao, M. Shupnik, R. Kumar, and R. J. Santen
Linkage of Rapid Estrogen Action to MAPK Activation by ER{alpha}-Shc Association and Shc Pathway Activation
Mol. Endocrinol., January 1, 2002; 16(1): 116 - 127.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
C. M. Boney, H. Sekimoto, P. A. Gruppuso, and A. R. Frackelton Jr.
Src Family Tyrosine Kinases Participate in Insulin-like Growth Factor I Mitogenic Signaling in 3T3-L1 Cells
Cell Growth Differ., July 1, 2001; 12(7): 379 - 386.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. J. Bartosiewicz, D. Jenkins, S. Penn, J. Emery, and A. Buckpitt
Unique Gene Expression Patterns in Liver and Kidney Associated with Exposure to Chemical Toxicants
J. Pharmacol. Exp. Ther., June 1, 2001; 297(3): 895 - 905.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. Fruhbeck, J. Gomez-Ambrosi, F. J. Muruzabal, and M. A. Burrell
The adipocyte: a model for integration of endocrine and metabolic signaling in energy metabolism regulation
Am J Physiol Endocrinol Metab, June 1, 2001; 280(6): E827 - E847.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Qiu, Y. Wei, N. Chen, M. Jiang, J. Wu, and K. Liao
DNA Synthesis and Mitotic Clonal Expansion Is Not a Required Step for 3T3-L1 Preadipocyte Differentiation into Adipocytes
J. Biol. Chem., April 6, 2001; 276(15): 11988 - 11995.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boney, C. M.
Right arrow Articles by Frackelton, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boney, C. M.
Right arrow Articles by Frackelton, A. R., Jr.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals