help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itkin-Ansari, P.
Right arrow Articles by Levine, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itkin-Ansari, P.
Right arrow Articles by Levine, F.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*GLUCAGON
Molecular Endocrinology 14 (6): 814-822
Copyright © 2000 by The Endocrine Society

PDX-1 and Cell-Cell Contact Act in Synergy to Promote {delta}-Cell Development in a Human Pancreatic Endocrine Precursor Cell Line

Pamela Itkin-Ansari, Carla Demeterco, Stuart Bossie, Dominique Dufayet de la Tour, Gillian M. Beattie, Jamileh Movassat, Martin I. Mally, Alberto Hayek and Fred Levine

Center for Molecular Genetics (P. I-A., C.D., S.B., D.D., F.L.) Whittier Institute (P. I-A., C.D., J.M., G.M.B., A.H., F.L.) University of California, San Diego La Jolla, California 92093


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell lines from the fetal and adult pancreas that were developed by retroviral transfer of the SV40T and rasval12 oncogenes lose insulin expression but retain extremely low levels of somatostatin and glucagon mRNA. In contrast to expanded populations of primary human islet cells, none of them express the homeodomain transcription factor PDX-1. When that factor was expressed in the cell lines by retroviral-mediated gene transfer, one of the cell lines, TRM-6, derived from human fetal islets, exhibited a 10- to 100-fold increase in somatostatin gene expression. This is the first report of induction of the endogenous somatostatin gene by PDX-1. Promotion of cell-cell contact by aggregation of TRM-6/PDX-1 into islet-like clusters produced a further 10- to 100-fold increase in somatostatin mRNA, to a level similar to that of freshly isolated islets, which resulted in production of somatostatin protein. Thus, we demonstrate here that signals induced by cell-cell contact act in synergy with PDX-1 to up-regulate the endogenous somatostatin promoter in an immortalized cell line from human fetal islets. This system provides a powerful model for studying human islet cell development and, particularly, the role of cell-cell contact in the differentiation process.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
To approach the problem of providing an unlimited source of cells for transplantation therapies for diabetes, we have been developing immortalized cell lines from endocrine and endocrine precursor cells of the human pancreas using retroviral vectors expressing multiple dominant oncogenes (1, 2, 3). Interestingly, cell lines derived from pancreatic endocrine cells isolated at a variety of developmental stages share many features, particularly a loss of hormone gene expression. Since this dedifferentiated phenotype also occurs in primary cells stimulated to divide in vitro (4), we believe that an inverse relationship between growth and differentiated function is a characteristic of pancreatic endocrine cells. This phenomenon is similar to that found in other cell types such as myoblasts and adipocytes (5, 6).

The balance of growth and differentiation is central to the process by which a precursor develops into a mature, fully differentiated cell. It is clear that specification of this process involves paracrine signals as well as those from solid supports: extracellular matrix and cell-cell contact (7, 8, 9, 10). Furthermore, the sequential activation and repression of a series of transcription factors, interacting with each other, determines the pattern of gene expression characteristic of the different islet cell types. Recently, there has been rapid progress in the identification of the transcription factors involved in pancreatic development and hormone gene regulation (reviewed in Refs. 11, 12). Therefore, we have begun to study the expression and functional status of pancreatic endocrine cell transcription factors in immortalized human pancreatic cell lines.

The first transcription factor of importance in pancreatic development to be targeted in mice was PDX-1 (STF-1, IDX-1, IPF-1), a homeodomain protein that is the earliest known molecular signpost of the developing pancreas. Disruption of the PDX-1 gene in mice and investigation of a spontaneous mutation in humans with pancreatic agenesis led to elucidation of its critical role in formation of the entire organ (13, 14, 15, 16). Conditional knockout of PDX-1 in ß-cells leads to diabetes, demonstrating a further role in maintaining ß-cell function (17). A number of ß-cell-specific genes have been identified as downstream targets of PDX-1, including insulin, islet amyloid polypeptide (IAPP), glucokinase, and the glucose transporter GLUT2 (18, 19, 20).

PDX-1 was originally identified as a somatostatin gene transcription factor, but is detectable by immunohistochemistry in only 15% of adult {delta}-cells (21), although it is not known whether PDX-1 is expressed at a lower level in the remaining {delta}-cells. Because of its apparently limited expression to a subset of {delta}-cells and the fact that selective knockout studies have been limited to ß-cells, there is controversy about the role of PDX-1 in somatostatin gene expression in vivo. Furthermore, studies of the effect of PDX-1 on somatostatin expression in cell culture models have been done primarily by transient transfection assays using truncated or multimerized somatostatin promoter elements (22, 23). Here, we report the effects of stable expression of PDX-1 on pancreatic hormone expression in a series of cell lines from the human fetal and adult pancreas. PDX-1 was found to be a potent transactivator of the endogenous somatostatin gene in one of those cell lines, TRM-6, derived from human fetal islets. Furthermore, we demonstrate that signals from cell-cell contact act in synergy with PDX-1 to induce a level of somatostatin gene expression in TRM-6 cells comparable to that found in freshly isolated human islets.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pancreatic Hormone and PDX-1 Expression in Immortalized Human Pancreatic Cell Lines
A feature common to many oncogene-transformed human pancreatic endocrine cell lines, as well as growth-stimulated primary human pancreatic cells, is an inverse relationship between growth and differentiated function characterized by rapid loss of hormone gene expression (1, 2, 3). As we have previously reported in TRM-1 from 18-week human fetal pancreatic islet-like cell clusters (1) and HAP-5 from adult islets (3), insulin mRNA becomes completely undetectable while low levels of glucagon and somatostatin mRNA frequently persist, upon prolonged passage in culture. Here we report that TRM-6, from 24-week gestation human fetal islets (2), exhibits the same pattern of hormone gene expression (Fig. 1Go). To begin to understand the mechanism by which hormone expression is down-regulated in response to growth signals, we examined expression of the homeodomain transcription factor PDX-1. Although the cell lines differ considerably in the stage of development from which they were isolated, none express PDX-1 (1) (Fig. 2Go, lanes 1, 3, and 5).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR for Hormone Expression in TRM-6 Cells

cDNA samples corresponding to 100 ng RNA from TRM-6 cells and whole pancreas were analyzed for expression of insulin, glucagon, and somatostatin by 40 cycles of PCR. Lower band in TRM-6 insulin PCR represents unincorporated primers. PCR for the housekeeping gene PD served as a control for experimental variation in sample preparation.

 


View larger version (62K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR for PDX-1 Expression

HAP-5, TRM-6, and TRM-1 cell lines were analyzed before (-) and after (+) infection with PDX-1 retroviral vector. RT-PCR for the housekeeping gene PD ensured proper sample preparation. PCR used 300 ng and 100 ng cDNA for PDX-1 and PD, respectively, at 40 cycles.

 
PDX-1 Expression in the TRM-6 Cell Line Induces Somatostatin Gene Expression
To understand the relationship between the pattern of hormone and transcription factor expression in the cell lines, PDX-1 was stably expressed in TRM-1, TRM-6, and HAP-5 monolayer cultures using a PDX-1-expressing retroviral vector designated PDX-hph. Infected cells expressed high levels of PDX-1 mRNA, as demonstrated by RT-PCR (Fig. 2Go, lanes 2, 4, and 6). Immunohistochemical analysis of TRM-6/PDX-1 cells indicated that PDX-1 is also expressed at the level of protein and exhibits nuclear localization, a requirement for function (24) (Fig. 3Go).



View larger version (161K):
[in this window]
[in a new window]
 
Figure 3. Immunostaining for Nuclear Localization of PDX-1

A monolayer culture of TRM-6/PDX-1 cells was grown on glass slides and stained with anti-PDX-1 antibody (green). Cells are identified by cytoplasmic staining of cytokeratins (blue). Bar, 40 µm.

 
Examination of the effects of PDX-1 on hormone expression by an RNase protection assay revealed that TRM-6, but not TRM-1 or HAP-5, exhibited up-regulation of somatostatin in response to PDX-1 (Fig. 4Go). Extending this result, multiple independently infected cultures of TRM-6/PDX-1 also demonstrated consistent up-regulation of somatostatin from the endogenous gene by quantitative RT-PCR when compared with control infected TRM-6 cells. A representative assay is shown in Fig. 5Go (compare Mono. and PDX-1 Mono.) Although PDX-1 routinely elicits a 10- to 100-fold induction of somatostatin expression, the absolute level of somatostatin mRNA remained below that found in primary human islets, and somatostatin protein could not be detected in TRM-6/PDX-1 cells (Fig. 8CGo, mono.).



View larger version (106K):
[in this window]
[in a new window]
 
Figure 4. Somatostatin RNAse Protection Assay in Cell Lines before and after PDX-1 Expression

The effect of PDX-1 on somatostatin expression was determined in HAP-5 (H5), developed from human adult islets, TRM-6 (T6), from human fetal islets, and TRM-1 (T1), from 18-week gestation human fetal pancreatic islet-like cell clusters. Primary adult human islets and Jurkat cells were used as positive and negative controls, respectively. Ten micrograms of all samples except human islets (1 µg) were assayed. Cyclophilin was a control for the integrity of the RNA and for equivalent loading of samples.

 


View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Quantitation of Somatostatin by RT-PCR in the Cell Line TRM-6

A, Agarose gel electrophoresis and linear regression analysis of band intensities from a somatostatin PCR standard curve. The standard curve was generated using known numbers of copies: 3.3 x 105, 1.1 x 105, 3.7 x 104, 1.2 x 104, 4.1 x 103, 1.4 x 103, 4.6 x 102, 1.5 x 102, 5.1 x 101, and 0, from left to right) of a plasmid containing the human somatostatin cDNA amplified for 36 cycles. B, Agarose gel electrophoresis of somatostatin PCR products corresponding to triplicate samples of TRM-6 cells in monolayer culture, TRM-6 cells in aggregate culture, TRM-6/PDX-1 cells in monolayer culture, and TRM-6/PDX-1 cells in aggregate culture. cDNA corresponding to 300 ng RNA was amplified in PCR assays. C, Number of copies of somatostatin mRNA in TRM-6 and TRM-6/PDX cells determined by interpolation of the mean of triplicate sample band intensities onto the standard curve. To control for experimental variation in RNA preparation and PCR, the values were then normalized to quantitative PCR values for the housekeeping gene PD determined by interpolation from a PD standard curve. cDNA was diluted 1:250 before PD assay.

 


View larger version (81K):
[in this window]
[in a new window]
 
Figure 8. Somatostatin mRNA and Protein in TRM-6/PDX-1 Aggregates

A, Somatostatin mRNA levels were compared between TRM-6/PDX-1 aggregates and two freshly isolated human adult islet preparations (HA86 and HA76). The number of copies of somatostatin mRNA was determined by interpolation of RT-PCR sample band intensities onto a standard curve developed from human somatostatin plasmid. cDNA generated from 300 ng of mRNA was assayed by 36 cycles of PCR; each value is the mean of triplicate samples. Normalization to quantitative PCR for the housekeeping gene porphobilinogen deaminase, utilizing cDNA diluted 1:250, confirmed equivalent cDNA production among samples. B, Immunostaining for somatostatin (brown) in i) TRM-6 aggregates, ii) TRM-6/PDX-1 aggregates, iii) human pancreas (somatostatin-positive cell identified by arrowhead) and iv) TRM-6/PDX-1 aggregates, not treated with primary antibody. C, Somatostatin protein was identified by Western blot in whole cell extracts of monolayer (Mono.) and aggregate (Agg.) cultures of TRM-6/PDX-1 cells, compared with 0.5 µg of purified somatostatin peptide (somatostatin-14, 1.6 kDa).

 
PDX-1 Does Not Induce Insulin or Glucagon Gene Expression
Since PDX-1 is reportedly expressed in nearly all ß-cells (14), we investigated the effects of PDX-1 expression on the native insulin gene in TRM-6 cells. Despite the clear up-regulation of somatostatin expression in TRM-6/PDX-1 cells, neither insulin nor glucagon was induced by PDX-1 (data not shown). Furthermore, the glucokinase and GLUT2 genes, which have been reported as targets of PDX-1 regulation, were not induced in TRM-6/PDX-1 cells. To address the possibility that PDX-1 expressed in TRM-6/PDX-1 cells was functionally altered, impairing its ability to bind to cis-elements from the insulin promoter as has been reported in some cell types (25), an electrophoretic mobility shift assay (EMSA) was performed. Nuclear extracts from TRM-6/PDX-1 cells, but not control TRM-6 cultures, shifted the mobility of the PDX-1-binding CT3 element from the human insulin promoter used as probe. Moreover, anti-PDX-1 antiserum was able to supershift the protein-DNA complex (Fig. 6Go). These results indicate that PDX-1 protein in TRM-6/PDX-1 cells is capable of binding to its recognition element in the insulin promoter. Therefore, we conclude that PDX-1 is not sufficient to activate the insulin gene in the TRM-6 cell line.



View larger version (86K):
[in this window]
[in a new window]
 
Figure 6. EMSA for PDX-1 Binding to Its Human Insulin Promoter Element

The binding of protein in nuclear extracts to the probe CT3 (also known as A5) derived from the PDX-1 binding site in the human insulin promoter was compared in TRM-6 and TRM-6/PDX-1 cells to migration of probe alone. PDX-1-shifted insulin probe (arrow) and PDX-1 antibody-induced super-shifted probe (arrowhead) are identified.

 
TRM-6 and TRM-6/PDX-1 Cells Can Be Induced to Form Islet-Like Cell Clusters
Although primary islet cells in monolayer culture rapidly lose hormone expression, differentiated function can be partially restored by culture as three-dimensional islet-like cell clusters in suspension (10). To determine whether TRM-6 cells respond similarly to the physiological cues induced by cell-cell contact in primary pancreatic endocrine cells, we assessed whether TRM-6 cells were amenable to culture as islet-like aggregates. When grown in suspension culture, TRM-6 and TRM-6/PDX-1 cells, but not HeLa cells, formed clusters that appeared as loose aggregates during the first 24 h, becoming more compact, round, and dense by 36–48 h (Fig. 7AGo). The islet-like clusters can be maintained in suspension for 4–12 days with no apparent change in viability. When compared with aggregates of TRM-6 cells, TRM-6/PDX-1 islet-like cell clusters are less compact and exhibit a higher cytoplasm/nucleus ratio, consistent with a more differentiated phenotype (Fig. 7AGo).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 7. Islet-Like Aggregates and Ki-67 Staining of TRM-6 and TRM-6/PDX-1

A, Paraffin sections of islet-like aggregates from TRM-6/MSCV control infected cells, designated MSCV (left, top and bottom), and TRM-6/PDX-1 cells, infected with PDX-1 expressing retrovirus, designated PDX-1 (right, top and bottom) were stained with hematoxylin and eosin. Top and bottom panels are 200x magnification and 800x magnification, respectively. B, Paraffin sections of monolayer and aggregate cultures of TRM-6 (T6) and TRM-6/PDX-1 (T6/PDX) cells were immunostained for the nuclear antigen Ki-67; 170 and 300 cells per sample were analyzed in Exp 1 (dotted bars) and Exp 2 (striped bars), respectively.

 
PDX-1 and Cell-Cell Contact Inhibit Proliferation
To assess whether PDX-1 expression or initiation of cell-cell contact in islet-like aggregates of TRM-6 and TRM-6/PDX-1 cells led to changes in cellular proliferation, immunostaining for the proliferation-associated nuclear antigen Ki-67 (26) in sections of aggregates and monolayer cultures was performed. TRM-6 and TRM-6/PDX-1 monolayer cultures were comprised of 50% and 35% proliferating cells, respectively, indicating that PDX-1 mediates a modest inhibition of growth of TRM-6 cells (Fig. 7BGo). Furthermore, Ki-67 analysis of TRM-6 and TRM-6/PDX-1 aggregate cultures revealed a large decrease in cell division upon aggregation, such that 14–16% of the cells in either aggregate sample were proliferating (Fig. 7BGo). These results were confirmed by BrdU labeling (not shown). Thus, cell-cell contact causes a marked decrease in growth rate despite constitutive expression of two dominant oncogenes in TRM-6 and TRM-6/PDX-1 cells.

Cell-Cell Contact Acts Synergistically with PDX-1 to Promote Somatostatin Expression
To measure the effects of cell-cell contact on differentiated function, expression of islet genes was assayed by quantitative PCR. We found that somatostatin gene expression was further induced 10- to 100-fold in TRM-6/PDX-1 aggregates compared with monolayer cultures. Aggregation of TRM-6 control cells not expressing PDX-1 into islet-like clusters had a negligible effect on somatostatin expression. Thus, PDX-1 and cell-cell contact act synergistically to activate the endogenous somatostatin gene approximately 1000-fold in TRM-6 cells (Fig. 5Go). The high level of somatostatin gene expression in these cells prompted us to compare them to that of freshly isolated islets, with the finding that TRM-6/PDX-1 aggregates have mRNA levels similar to that of two human islet preparations tested (Fig. 8AGo). Immunohistochemical analysis also revealed positive staining for somatostatin protein in TRM-6/PDX-1 islet-like clusters (Fig. 8BGo). Furthermore, somatostatin protein could be detected in cell extracts of TRM-6/PDX-1 aggregates (Fig. 8CGo). Secreted somatostatin protein was also found in the supernatant of TRM-6/PDX-1 islet-like clusters, but as previously described (27, 28), was rapidly converted to degradation products by serum proteases.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have demonstrated that PDX-1 is sufficient to stimulate transcription from the endogenous somatostatin gene in TRM-6, a human cell line with an endocrine precursor phenotype. Furthermore, signals initiated by cell-cell contact enhance PDX-1-induced gene activation to the level of islets. Thus, {delta}-cell development appears to be recapitulated in TRM-6, at least in part, by this combination of factors. The fact that somatostatin expression was induced by PDX-1 in only one of the three human pancreatic cell lines tested, despite similar baseline levels of somatostatin, suggests that additional positive factors in TRM-6 or negative factors in the TRM-1 and HAP-5 cell lines interact with PDX-1 to regulate somatostatin transcription. The finding that PDX-1 is not sufficient to activate the native insulin promoter in TRM-6 cells is consistent with our previously reported results in which purified primary ß-cells induced to proliferate with hepatocyte growth factor/scatter factor (HGF/SF) and extracellular matrix lose insulin gene expression while retaining PDX-1 expression (4).

Cell-cell contact, acting in synergy with PDX-1 to activate somatostatin expression in TRM-6 cells, reveals a direct signaling pathway between the cell surface and nuclear factors in pancreatic endocrine cells. TRM-6, as an unlimited, homogeneous source of human pancreatic endocrine precursor cells, provides a malleable tool for unraveling the components of this signaling pathway, beginning with identification of the cell surface molecule responsible for initiating contact. Candidate cell adhesion molecules (CAMs) belonging to the immunoglobulin superfamily and the calcium-dependent cadherin family are being examined, since roles for both types of proteins in pancreatic development are well documented (8, 29). Cadherin formation of adherens junctions is required for islet function as loss of N- and E-cadherins lead to abrogation of islet integrity (8). It was recently reported that the MIN-6 rodent insulinoma cell line can be induced to aggregate by a mechanism involving E-cadherin. In comparison to monolayer cultures, MIN-6 islet-like clusters were capable of an increased response to nutrient and nonnutrient secretagogues (30).

In addition to identifying the cell adhesion molecule initiating synergy with PDX-1, the identity of the downstream transcriptional effector acting on the somatostatin promoter also remains to be determined. Although not completely ruled out, PDX-1 itself is unlikely to be the direct target of this signal transduction pathway. It is constitutively expressed at high levels and able to partially activate somatostatin transcription even in monolayer cultures. Furthermore, all of the PDX-1 in monolayer cultures appears to be localized to the nucleus, as has been reported for functional protein (24). The role of other candidate factors involved in somatostatin gene regulation, including PBX-1 (31) and PAX-6 (32), as potential mediators of cell-cell contact-induced signaling, is being investigated.

PDX-1 and cell-cell contact may act through the same pathway to reduce the rate of cell division in TRM-6, as their effects are not additive or synergistic with each other. Interestingly, since the growth rate reduction occurs in the presence of SV40 T antigen and H-rasval12 expression, the pathway being acted upon by PDX-1 and cell-cell contact must be independent or downstream of pathways, such as mitogen-activated protein kinase (MAPK), stimulated by the oncogenes.

We believe that the potent induction of hormone gene expression by synergistic interactions of a transcription factor and cell-cell contact that occurs in TRM-6 is likely to be similar to interactions that take place during the process of normal endocrine cell development. Thus, the TRM-6 cell line provides a powerful model system for studying human pancreatic endocrine cell development and should enable us to determine the molecular mechanisms by which morphoregulatory cell adhesion molecules influence hormone expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Growth and Aggregation
Cells were grown in low glucose DMEM with 10% FBS. TRM-6/MSCV control cells and TRM-6/PDX-1 cells were induced to form islet-like aggregates by removal from monolayer culture with Cell Dissociation Media (Sigma, Saint Louis, MO), pelleting, and shaking in a cryovial at 70 cycles/min for 1 h. Contents of the cryovial were removed without resuspension and released dropwise into media-filled wells of ultra-low adhesion tissue culture plates (Corning SPD, Acton, MA) prepared according to manufacturer’s instructions. After growth for 4–12 days, with media changes every 48 h, cell aggregates and monolayer cultures were harvested.

Histochemistry
TRM6/MSCV and TRM-6/PDX-1 monolayers, detached from the culture plates with cell dissociation solution (Sigma), and aggregates were fixed in 4% paraformaldehyde and embedded in paraffin. After deparaffining and hydrating, the slides (8-µm sections) were stained for hematoxylin and eosin or further treated. For Ki67 immunohistochemistry, slides were permeabilized in 0.3% Triton X-100 in PBS for 15 min, and then placed in Coplin jars filled with 0.01 mol/liter citrate buffer before incubating three times for 4 min at the maximum power (750 W) in a microwave oven (Amana-Radarange, M84TMA, Amana, IA). The sections were allowed to cool to room temperature and washed with PBS. Slides were then blocked for 1 h with 10% goat serum, washed, and incubated with the proliferation marker Ki-67 (1:50 dilution, DAKO Corp., Carpinteria, CA). After a 1-h incubation, the slides were washed and incubated with biotinylated goat antirabbit at 1:20 dilution (BioGenex Laboratories, Inc. San Ramon, CA) for 20 min. After washing, slides were incubated with streptavidin horseradish peroxidase at 1:20 dilution (BioGenex Laboratories, Inc.) for 20 min (33). The Peroxidase Substrate Kit (Vector Laboratories, Inc., Burlingame, CA) was used for color development. Control slides were incubated with isotype-matched control immunoglobulin. Somatostatin immunostaining was performed with rabbit antisomatostatin antibody (DAKO Corp.) diluted 1:200. Secondary antibody and visualization steps were as described for Ki-67. PDX-1 and pan-cytokeratin immunostaining and confocal microscopy were performed as previously described (4). Briefly, cells were fixed and permeabilized as described above. Primary antibodies were anti-PDX-1 (IDX-1, a kind gift from Dr. Joel Habener) and KL1 (antihuman pan-cytokeratin). Secondary antibodies were fluorescein-isothiocyanate-conjugated donkey antirabbit, and indo dicarbocyanine-conjugated donkey antimouse (Jackson ImmunoResearch Laboratories, Inc. West Grove, PA), respectively. Slides were analyzed using a confocal microscope by scanning planes of 0.3 µm thickness. Fluorescent images for each marker were collected, and color composite images were generated using Adobe Photoshop 4.0 (Adobe Systems, Inc., San Jose, CA).

Analysis and Quantitation of mRNA
RT-PCR was performed as described (4). PCR primers were designed for human somatostatin (forward, CGTCAGTTTCTGCAGAAGTCC; reverse, CCATAGCCGGGTTTGAGTTA) and cross an intron, amplifying a 196-bp cDNA fragment. PCR primers for human glucagon (forward, GAATTCATTGCTTGGCTGGT; reverse,CATTTCAAACATCCCACGTG) amplify a 255-bp cDNA fragment. PCR primers for PDX-1 (4), porphobilinogen deaminase (PD) (34), and insulin (35) were described previously.

PCR amplification conditions were 5 min at 94 C followed by cycles of 94 C for 45 sec, 60 C for 45 sec, 72 C for 45 sec. Cycle number and amount of cDNA were as described in the figure legends. PCR samples were electrophoresed on a 1.5% agarose gel, and DNA was visualized by ethidium bromide staining.

Conditions for quantitative PCR were chosen as previously described (4) in accordance with recommended practices (36, 37, 38). Standard curves for quantitative PCR of somatostatin and the housekeeping gene PD were developed using somatostatin plasmid and cDNA from the 293 cell line, respectively. The band intensities were determined by digital scanning of the photograph, followed by quantitation using Scion Image analysis software (Scion Corp., Frederick, MD). The number of copies of mRNA was determined by interpolation of the sample band intensities onto the standard curve. The mean of triplicates was tabulated. The somatostatin values were then normalized to quantitative PCR values for PD to control for experimental variation in RNA preparation and PCR.

RNase protection assay was also performed as previously described (35).

Plasmids and Virus Production
The retroviral vector encoding PDX-1 (PDX-hph) was created by cloning the human PDX-1 cDNA, a kind gift of Dr. Roland Stein (39), into the BglII/XhoI sites of the MSCV/hph retroviral vector (40). MSCV/hph virus (designated MSCV in figures) was used for control infections. Virus preparation was as previously described (41).

EMSA
Nuclear Extracts
PBS-washed cells were centrifuged for 10 sec in a microcentrifuge, resuspended in 400 µl of buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethanesulfonyl fluoride, 10 mM NaF, 10 mM sodium molybdate, 10 mM glycerophosphate, 10 mM sodium vanadate, 10 mM p-nitrophenyl phosphate). Cells were allowed to swell on ice for 15 min. 25 µl of 10% Nonidet P40 was added and the cells were incubated for 30 min on ice. After 30 sec of microcentrifugation, the pellet was resuspended in 50 µl of (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethanesulfonyl fluoride, 10 µg/ml leupeptin, 1 µg/ml pepstatin A, 0.1 mM p-aminobenzoic acid, 10 µg/ml aprotinin, 5% (vol/vol) glycerol, 10 mM NaF, 10 mM sodium molybdate, 10 mM glycerophosphate, 10 mM sodium vanadate, 10 mM p-nitrophenyl phosphate) for 30 min. After 2 min of centrifugation at 4 C, supernatant containing nuclear extracts was collected and stored at -70 C.

Mobility Shift Assay
Biotinylated probes (Genset, La Jolla, CA) corresponded to the double-stranded human insulin promoter element CT3 or A5 (42):

5'-TCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGC-3' A mixture of 4 µl nuclease-free water, 2 µl of 5x DNA-protein buffer (20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM dithiothreitol, 0.25 M Tris HCl 7.4, 0.25 mg/ml Poly dl:dC) and 2 µl of nuclear extracts were incubated for 10 min at room temperature. Labeled probes (1 µl) were added and incubated for 20 min at room temperature. Loading buffer (1 µl) was added, and the sample was electrophoresed for 1 h in 0.5x TBE at 100 V. Samples were transferred overnight by capillary action onto a positively charged nitrocellulose membrane, (Amersham Pharmacia Biotech, Arlington Heights, IL). The membrane was cross-linked for 5 min under UV lights, blocked in Blocking Agent (Roche Molecular Biochemicals, Indianapolis, IN) for 1 h at room temperature, and incubated with streptavidin-peroxidase in PBS-Tween 0.1% buffer for 1 h. After washing steps (once in 3xSSC-0.1% SDS for 15 min, twice in 0.2x SSC for 20 min, and once in 2xSSC for 5 min), detection was performed by enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech) and exposed on XOMAT film (Eastman Kodak Co., Rochester, NY) for 5 sec.

Western Blot
Whole-cell extracts were prepared by incubation in lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 5 mM EDTA, 100 µg/ml PMSF, 1 µg/ml aprotinin, 1% Triton X-100) for 30 min on ice, followed by 15 min of centrifugation at 12,000 x g, 4 C. Extracts were mixed with loading buffer and electrophoresed on 4–15% acrylamide gel (ReadyGel Bio-Rad Laboratories, Inc. Hercules, CA) in Tris/glycine/SDS buffer. Proteins, including pure somatostatin (Sigma), were transferred onto double nitrocellulose membranes (Immobilon-Psq, Millipore, Bedford, MA) in Tris/glycine/methanol buffer for 1 h at 100 V. After overnight blocking in PBS-Tween (PBST) with 3% milk, membrane was incubated for 2 h at room temperature with rabbit antisomatostatin antibody (DAKO Corp.) diluted 1:50. After long washing in PBST, membrane was incubated with secondary goat antirabbit antibody conjugated to horseradish peroxidase diluted 1:2000 (Amersham Pharmacia Biotech), washed in PBST, and revealed by ECL (Amersham Pharmacia Biotech).


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Joel Habener for IDX-1 (PDX-1) antibody and Dr. Mehboob Hussain and Joel Habener for their efforts to assay somatostatin protein in monolayer cultures. We thank Dr. L. Goldstein for use of the confocal microscope facility.


    FOOTNOTES
 
Address requests for reprints to: Dr. Fred Levine, Center for Molecular Genetics, University of California San Diego School of Medicine, La Jolla, California 92093-0634.

This work was supported in part by a graduate education grant from the Whittier Institute (P.I-A.), by Grants DK-55065 and DK-55283 from the NIH (F.L.), Grants 197035 (F.L.) and 198225 (A.H.) from the Juvenile Diabetes Foundation, and the Herbert O Perry fund (A.H.). F.L. is a member of the University of California San Diego Cancer Center and the Department of Pediatrics.

Received for publication December 10, 1999. Revision received February 25, 2000. Accepted for publication March 14, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Wang S, Beattie G, Mally M, Cirrulli V, Itkin-Ansari P, Lopez AD, Hayek A, Levine F 1997 Isolation and characterization of a cell line from the epithelial cells of the human fetal pancreas. Cell Transplant 6:59–67[CrossRef][Medline]
  2. Wang S, Beattie GM, Mally MI, Lopez AD, Hayek A, Levine F 1997 Analysis of a human fetal pancreatic islet cell line. Transplant Proc 29:2219[CrossRef][Medline]
  3. Beattie G, Hayek A, Levine F Growth and genetic modification of human ß-cells, ß-cell precursors. In: Genetic Engineering, Principles and Methods, Plenum Press, New York, in press
  4. Beattie GM, Itkin-Ansari P, Cirulli V, Leibowitz G, Lopez AD, Bossie S, Mally MI, Levine F, Hayek A 1999 Sustained proliferation of PDX-1+ cells derived from human islets. Diabetes 48:1013–1019[Abstract]
  5. Alema S, Tato F 1994 Oncogenes and muscle differentiation: multiple mechanisms of interference. Semin Cancer Biol 5:147–156[Medline]
  6. Hu E, Kin JB, Sarraf P, Spiegelman BM 1996 Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPAR{gamma}. Science 274:2100–2103[Abstract/Free Full Text]
  7. Jiang FX, Cram DS, DeAizpurua HJ, Harrison LC 1999 Laminin-1 promotes differentiation of fetal mouse pancreatic ß-cells. Diabetes 48:722–30[Abstract]
  8. Dahl U, Sjødin A, Semb H 1996 Cadherins regulate aggregation of pancreatic ß-cells in vivo. Development 122:2895–902[Abstract]
  9. Kim SK, Hebrok M, Melton DA 1997 Notochord to endoderm signaling is required for pancreas development. Development 124:4243–52[Abstract]
  10. Beattie GM, Rubin JS, Mally MI, Otonkoski T, Hayek A 1996 Regulation of proliferation and differentiation of human fetal pancreatic islet cells by extracellular matrix, hepatocyte growth factor, and cell-cell contact. Diabetes 45:1223–1228[Abstract]
  11. Sander M, German MS 1997 The beta cell transcription factors and development of the pancreas. J Mol Med 75:327–340[CrossRef][Medline]
  12. Edlund H 1998 Transcribing pancreas. Diabetes 47:1817–23[Abstract]
  13. Jonsson J, Carlsson L, Edlund T, Edlund H 1994 Insulin-promoter factor 1 is required for pancreas development in mice. Nature 371:606–609[CrossRef][Medline]
  14. Ohlsson H, Karlsson K, Edlund T 1993 IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  15. Peers B, Leonard J, Sharma S, Teitelman G, Montminy MR 1994 Insulin expression in pancreatic islet cells relies on cooperative interactions between the helix loop helix factor E47 and the homeobox factor STF-1. Mol Endocrinol 8:1798–1806[Abstract/Free Full Text]
  16. Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF 1997 Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 15:106–10[CrossRef][Medline]
  17. Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H 1998 ß-Cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the ß-cell phenotype and maturity onset diabetes. Genes Dev 12:1763–8[Abstract/Free Full Text]
  18. Carty MD, Lillquist JS, Peshavaria M, Stein R, Soeller WC 1997 Identification of cis- and trans-active factors regulating human islet amyloid polypeptide gene expression in pancreatic beta-cells. J Biol Chem 272:11986–11993[Abstract/Free Full Text]
  19. Waeber G, Thompson N, Nicod P, Bonny C 1996 Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol 10:1327–34[Abstract/Free Full Text]
  20. Watada H, Kajimoto Y, Miyagawa J, Hanafusa T, Hamaguchi K, Matsuoka T, Yamamoto K, Matsuzawa Y, Kawamori R, Yamasaki Y 1996 PDX-1 induces insulin and glucokinase gene expressions in {alpha}TC1 clone 6 cells in the presence of betacellulin. Diabetes 45:1826–31[Abstract]
  21. Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R 1994 X1Hbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806–816[Abstract/Free Full Text]
  22. Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR 1993 Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275–1283[Abstract/Free Full Text]
  23. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145–1156[Medline]
  24. Macfarlane WM, McKinnon CM, Felton-Edkins ZA, Cragg H, James RF, Docherty K 1999 Glucose stimulates translocation of the homeodomain transcription factor PDX1 from the cytoplasm to the nucleus in pancreatic ß-cells. J Biol Chem 274:1011–6[Abstract/Free Full Text]
  25. Macfarlane WM, Smith SB, James RF, Clifton AD, Doza YN, Cohen P, Docherty K 1997 The p38/reactivating kinase mitogen-activated protein kinase cascade mediates the activation of the transcription factor insulin upstream factor 1 and insulin gene transcription by high glucose in pancreatic ß-cells. J Biol Chem 272:20936–20944[Abstract/Free Full Text]
  26. Cattoretti G, Becker MH, Key G, Duchrow M, Schlüter C, Galle J, Gerdes J 1992 Monoclonal antibodies against recombinant parts of the Ki-67 antigen (MIB 1 and MIB 3) detect proliferating cells in microwave-processed formalin-fixed paraffin sections. J Pathol 168:357–363[CrossRef][Medline]
  27. Benuck M, Marks N 1976 Differences in the degradation of hypothalamic releasing factors by rat and human serum. Life Sci 19:1271–1276[CrossRef][Medline]
  28. Brazeau P, Epelbaum J, Tannenbaum GS, Rorstad O, Martin JB 1978 Somatostatin: isolation, characterization, distribution, and blood determination. Metabolism 27:1133–1137[CrossRef][Medline]
  29. Cirulli V, Crisa L, Beattie GM, Mally MI, Lopez AD, Fannon A, Ptasznik A, Inverardi L, Ricordi C, Deerinck T, Ellisman M, Reisfeld RA, Hayek A 1998 KSA antigen Ep-CAM mediates cell-cell adhesion of pancreatic epithelial cells: morphoregulatory roles in pancreatic islet development. J Cell Biol 140:1519–1534[Abstract/Free Full Text]
  30. Hauge-Evans AC, Squires PE, Persaud SJ, Jones PM 1999 Pancreatic ß-cell-to-ß-cell interactions are required for integrated responses to nutrient stimuli: enhanced Ca2+ and insulin secretory responses of MIN6 pseudoislets. Diabetes 48:1402–1408[Abstract]
  31. Goudet G, Delhalle S, Biemar F, Martial JA, Peers B 1999 Functional and cooperative interactions between the homeodomain PDX1, Pbx, and Prep1 factors on the somatostatin promoter. J Biol Chem 274:4067–4073[Abstract/Free Full Text]
  32. Andersen FG, Jensen J, Heller RS, Petersen HV, Larsson LI, Madsen OD, Serup P 1999 Pax6 and Pdx1 form a functional complex on the rat somatostatin gene upstream enhancer. FEBS Lett 445:315–320[CrossRef][Medline]
  33. Sternberger LA, Hardy Jr PH, Cuculis JJ, Meyer HG 1970 The unlabeled antibody enzyme method of immunohistochemistry: preparation and properties of soluble antigen-antibody complex (horseradish peroxidase-antihorseradish peroxidase) and its use in identification of spirochetes. J Histochem Cytochem 18:315–333[Abstract]
  34. Shimizu H, Shimizu C, Burns JC 1994 Detection of novel RNA viruses: morbilliviruses as a model system. Mol Cell Probes 8:209–14[CrossRef][Medline]
  35. Mally MI, Otonkoski T, Lopez AD, Hayek A 1994 Developmental gene expression in the human fetal pancreas. Pediatr Res 36:537–544[Medline]
  36. Halford WP, Falco VC, Gebhardt BM, Carr DJ 1999 The inherent quantitative capacity of the reverse transcription-polymerase chain reaction. Anal Biochem 266:181–91[CrossRef][Medline]
  37. Haberhausen G, Pinsl J, Kuhn CC, Markert-Hahn C 1998 Comparative study of different standardization concepts in quantitative competitive reverse transcription-PCR assays. J Clin Microbiol 36:628–633[Abstract/Free Full Text]
  38. Zhang C, Peters LE, Linnane AW, Nagley P 1996 Comparison of different quantitative PCR procedures in the analysis of the 4977-bp deletion in human mitochondrial DNA. Biochem Biophys Res Commun 223:450–455[CrossRef][Medline]
  39. Stoffel M, Stein R, Wright CV, Espinosa III R, Le Beau MM, Bell GI 1995 Localization of human homeodomain transcription factor insulin promoter factor 1 (IPF1) to chromosome band 13q12.1. Genomics 28:125–126[CrossRef][Medline]
  40. Hawley RG, Lieu FHL, Fong AZC, Hawley TS 1994 Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1:136–138[Medline]
  41. Yee J-K, Mihanohara A, LaPorte P, Bouic K, Burns JC, Friedmann T 1994 Generation of high titer, pantropic retroviral vectors: efficient gene transfer into hepatocytes. Proc Natl Acad Sci USA 91:9564–9568[Abstract/Free Full Text]
  42. German M, Ashcroft S, Docherty K, Edlund H, Edlund T, Goodison S, Imura H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K, Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R, Steiner D, Tsai M-J, Walker MD 1995 The insulin gene promoter; a simplified nomenclature. Diabetes 44:1002–1004[Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
J. Movassat, G. M. Beattie, A. D. Lopez, and A. Hayek
Exendin 4 Up-Regulates Expression of PDX 1 and Hastens Differentiation and Maturation of Human Fetal Pancreatic Cells
J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4775 - 4781.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Demeterco, P. Itkin-Ansari, B. Tyrberg, L. P. Ford, R. A. Jarvis, and F. Levine
c-Myc Controls Proliferation Versus Differentiation in Human Pancreatic Endocrine Cells
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3475 - 3485.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H. Kojima, T. Nakamura, Y. Fujita, A. Kishi, M. Fujimiya, S. Yamada, M. Kudo, Y. Nishio, H. Maegawa, M. Haneda, et al.
Combined Expression of Pancreatic Duodenal Homeobox 1 and Islet Factor 1 Induces Immature Enterocytes to Produce Insulin
Diabetes, May 1, 2002; 51(5): 1398 - 1408.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Dufayet de la Tour, T. Halvorsen, C. Demeterco, B. Tyrberg, P. Itkin-Ansari, M. Loy, S.-J. Yoo, E. Hao, S. Bossie, and F. Levine
{beta}-Cell Differentiation from a Human Pancreatic Cell Line in Vitro and in Vivo
Mol. Endocrinol., March 1, 2001; 15(3): 476 - 483.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itkin-Ansari, P.
Right arrow Articles by Levine, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itkin-Ansari, P.
Right arrow Articles by Levine, F.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*GLUCAGON


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals