help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, J.
Right arrow Articles by Yong, E. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, J.
Right arrow Articles by Yong, E. L.
Molecular Endocrinology 14 (8): 1187-1197
Copyright © 2000 by The Endocrine Society

Human Androgen Receptor Mutation Disrupts Ternary Interactions between Ligand, Receptor Domains, and the Coactivator TIF2 (Transcription Intermediary Factor 2)

Joyce Lim1, Farid J. Ghadessy1,2, Abdullah A. R. Abdullah, Leonard Pinsky, Mark Trifiro and E. L. Yong

Department of Obstetrics and Gynecology (J.L., F.J.G., E.L.Y.) National University of Singapore Republic of Singapore 119074
Department of Genetics (A.A.R.A., L.P., M.T.) Lady Davis Institute of Medical Research McGill University Montréal, Québec, Canada H3T 1E2


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The androgen receptor (AR) is a ligand-dependent X-linked nuclear transcription factor regulating male sexual development and spermatogenesis. The receptor is activated when androgen binds to the C-terminal ligand-binding domain (LBD), triggering a cascade of molecular events, including interactions between the LBD and the N-terminal transactivation domain (TAD), and the recruitment of transcriptional coactivators. A nonconservative asparagine to lysine substitution in AR residue 727 was encountered in a phenotypically normal man with subfertility and depressed spermatogenesis. This N727K mutation, although located in the LBD, did not alter any ligand-binding characteristic of the AR in the patient’s fibroblasts or when expressed in heterologous cells. Nonetheless, the mutant AR displayed only half of wild-type transactivation capacity when exposed to physiological or synthetic androgens. This transactivation defect was consistently present when examined with two different reporter systems in three cell lines, using three androgen-driven promoters (including the complex human prostate-specific antigen promoter), confirming the pathogenicity of the mutation. In mammalian two-hybrid assays, N727K disrupted LBD interactions with the AR TAD and with the coactivator, transcription intermediary factor 2 (TIF2). Strikingly, the transactivation defect of the mutant AR can be rectified in vitro with mesterolone, consistent with the ability of this androgen analog to restore sperm production in vivo. Mesterolone, but not the physiological androgen dihydrotestosterone, restored mutant LBD interactions with the TAD and with TIF2, when expressed as fusion proteins in the two-hybrid assay. Our data support an emerging paradigm with respect to AR mutations in the LBD and male infertility: pathogenicity is transmitted through reduced interdomain and coactivator interactions, and androgen analogs that are corrective in vitro may indicate hormonal therapy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Physiological androgens are essential for development and maintenance of the male phenotype. Spermatogenesis is exquisitely dependent on androgens, yet normal androgen levels commonly prevail in males with idiopathic infertility. This has led us to the hypothesis that androgen receptor (AR) deficiency or dysfunction could be the cause of reduced sperm formation in some patients with male infertility. Consistent with this is the discovery of transactivation-defective AR mutations in several patients with depressed spermatogenesis (1, 2, 3). All actions of androgens are mediated by the AR, a member of the steroid/nuclear receptor superfamily of ligand-activated transcription factors (4). Constituent members share a modular structure comprising an N-terminal transactivation domain (TAD) of variable length, a central DNA-binding domain (DBD) that enables interaction with cognate response elements usually upstream of target genes, and a C-terminal ligand-binding domain (LBD). Much of our knowledge of the mechanism of action of the androgen receptor derives from studies on LBDs of the retinoid X (RXR), thyroid hormone (THR), and estrogen (ER) receptors. Like other steroid receptors, the AR LBD binds specifically to its physiological ligands, testosterone (T) and dihydrotestosterone (DHT), triggering a series of molecular events culminating in the activation of androgen-responsive gene(s). Mutations that disturb androgen binding to the AR LBD result in abrogation of receptor function and androgen insensitivity syndromes in affected males (4). The AR has a large TAD, which forms more than half of the receptor protein (Fig. 1Go). Unlike RXR, THR, and ER, deletion of the LBD results in a TAD fragment that is constitutively active. In many reporter gene assays, the activation function of AR TAD, minus the LBD, is almost equivalent to the activity of the liganded full-length AR (5, 6). In contrast AR LBD fragments, in which the TAD is deleted, demonstrate very little intrinsic transactivation function in various cell lines. Another unusual feature is that functional interaction between the TAD and LBD is essential for optimal AR activity. Mutants that selectively interfere with the cooperation between TAD and LBD dramatically impair receptor activity (7).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Location of the N727K Mutation in of the AR-LBD and Alignment of Sequences Corresponding to Helices 3 and 4

The principal domains of the AR are schematically depicted (top panel), and the portion forming predicted helices H3 and H4 of the LBD is aligned with corresponding sequences from the human progesterone (PR), glucocorticoid (GR), mineralocorticoid (MR), and PPAR{gamma} receptors. A mutation in AR residue 727 (*), changing asparagine to lysine in a patient (TBL) with male infertility and severely depressed sperm production, is in a highly conserved coactivator-interacting signature sequence (underlined) in the H3-H4 interhelical region. Conserved residues are in bold. TAD, Transactivation domain; DNA-binding domain (shaded box); LBD, ligand-binding domain.

 
Recently, it was demonstrated that activation functions of steroid receptor LBDs are dependent on recruitment of coactivator molecules that act as bridging factors linking these receptors to preinitiation complexes and RNA polymerase II, thereby initiating transcription. In a preliminary report, we have described a nonconservative mutation (N727K) in the AR LBD of a man with severely depressed spermatogenesis causing infertility (1). The mutation occurs within a highly conserved 20 amino-acid region that constitutes a signature sequence for the nuclear receptor superfamily (Fig. 1Go) (8). Mutational studies in the ER, PR, RAR, and THR demonstrate this region to be integral to the function of a family of closely related p160 coactivator proteins comprising NcoA1/SRC1, TIF2/GRIP1/NcoA2/SRC2, and pCIP/RAC3/ACTR/AIB1/SRC3 (9). These steroid receptor coactivators associate in a ligand-dependent manner with nuclear receptors to enhance transactivation. All have conserved LXXLL (L is leucine, X is any amino acid) motifs in their nuclear receptor-interacting domains that are critical for receptor-coactivator interactions. The tertiary structures of all steroid receptor LBDs solved to date are very similar, consisting essentially of a wedge-shaped helical sandwich made up of 11 to 12 {alpha}-helices disposed in three layers (10). Crystallographic data from the ER (11) and peroxisome proliferator-associated receptor (PPAR-{gamma}) (12) indicate the LXXLL motif forms a short {alpha}-helix that binds in a hydrophobic groove on the holoreceptor surface formed by helices 3 and 4 on one side, and helix 12 on the other. Two highly conserved residues, a glutamate in helix 12 and lysine in helix 3, serve to orient the LXXLL helix, and mutations of these charged residues do not affect ligand binding, yet abrogate ligand-dependent transactivation activity almost totally in the vitamin D receptor (13), ER (14), and THR (15).

We have recently reported mutations in residue 886, 11 residues upstream of the conserved glutamate in predicted helix 12 of the AR, which by disrupting interdomain and receptor-coactivator interactions, lead to minimal androgen insensitivity, depressed sperm production, and male infertility (3). Here, we present evidence that another transactivation-defective mutant, located at the opposite end of the coactivator binding groove in helix 3/4, disrupts not only interaction with the coactivator TIF2 (transcription intermediary factor 2), but also interdomain interactions with the TAD. In vitro studies were performed to illuminate the mechanism whereby pharmacological therapy with the androgen analog, mesterolone, resulted in improved sperm production and fertility in our patient.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Oligospermic Patient with Amino Acid Substitution in the AR LBD
A patient with severe oligospermia and male infertility was found to have a single C-to-G transversion in his AR gene causing an asparagine-to-lysine substitution in codon 727 (Fig. 1Go). Single-strand conformation polymorphism analyses did not reveal any other AR mutation. The N727K mutation involves a residue highly conserved among members of the steroid receptor family that is predicted to lie between helices 3 and 4 of the AR LBD. Treatment with the androgen analog, mesterolone (1{alpha}-methyl-DHT, 1{alpha}-methyl-17ß-hydroxy-5{alpha}-androstan-3-one), restored normal sperm production and resulted in a healthy pregnancy (1). Withdrawal of mesterolone therapy was associated with reversion to poor sperm production, suggesting that mesterolone had a corrective effect on mutant AR function in vivo.

Ligand Binding Characteristics of Mutant Receptor
The androgen-binding properties of the mutant receptor were examined in fibroblast monolayers derived from subjects’ genital skin. Binding to the natural androgen DHT was within normal limits, with a dissociation constant (Kd) of 0.5 (normal, 0.29–0.54) nM and Bmax of 43 (normal, 26–43) fmol DHT/mg protein at 37C (Fig. 2AGo). In contrast, fibroblasts from another subject with complete androgen insensitivity due to a splice-site mutation causing a truncated AR LBD, had no DHT binding. Binding to the synthetic androgen MB was also normal with Kd of 0.29 (N: 0.1–0.3) nM, Bmax: 28.5 (15–50) (data not shown). Dissociation kinetics for DHT in fibroblasts were within normal limits, with dissociation rate constant, k, of 9.2 (N: 8.8–9.9) (10-3/min) at 42 C (Fig. 2BGo). To test for subtle perturbations of androgen-binding kinetics in a more homogenous intracellular milieu, the androgen-binding properties of AR expressed in COS-7 cells were examined. The affinity constants (Kd) of N727K for the synthetic androgens methyltrienolone (MT, R1881) or mibolerone (MB) (Fig. 2CGo) were 0.90 and 0.87 nM, respectively, no different from the wild type (WT). Since mild abnormalities of AR ligand binding can manifest solely as disordered dissociation kinetics, chase studies were performed. The dissociation rates of T, DHT, and MB (Fig. 2DGo) for N727K at 42 C were similar to the WT. The mutation also did not manifest any thermolability in ligand binding (data not shown). Competitive binding assays indicate that the ability of unlabeled mesterolone to inhibit binding of [3H]-T (Fig. 3AGo) or [3H]-DHT (Fig. 3BGo) to AR was similar to that observed for cold T and DHT. Radiolabeled-androgen binding to AR was largely replaced by unlabeled mesterolone at 5 nM, and near total displacement occurred at doses above 50 nM. In contrast, the nonandrogen, cortisol, did not inhibit [3H]-androgen binding. There were no significant differences in the relative binding affinity of mesterolone to WT or mutant AR. Thus, comprehensive examination indicates N727K mutation did not affect the binding kinetics of any androgen, including mesterolone, to the AR.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Androgen Binding Properties of N727K AR

A, Primary fibroblast cultures were established from genital skin biopsies of the infertile subject TBL, two normal controls (C1, C2), and a patient with complete androgen insensitivity syndrome (CAIS) due to a truncated LBD (38 ). Monolayers were exposed to 3[H]-DHT for 2 h at 37 C, and radiolabeled androgen specifically bound (fmol 3[H]-DHT bound/mg total protein) was measured to obtain the Scatchard plot. B, The dissociation kinetics of 3[H]-DHT bound to fibroblasts from patient TBL was compared with that from two normal controls (C1, C2). The percentage (log scale) of 3[H]-DHT specifically bound after exposure to 200-fold excess unlabeled DHT at 42 C was measured at the indicated intervals. C, WT or mutant AR, transiently expressed in COS cells, was exposed to increasing concentrations of 3[H]-MB at 37 C, and the amount specifically bound (fmol 3[H]-MB bound/mg total protein) was measured to obtain the Scatchard plot. D, WT or mutant AR, transiently expressed in COS cells, was exposed to 3 nM 3[H]-MB and chased with 200-fold excess unlabeled hormone at 42 C. The percentage of radiolabeled hormone remaining was measured at the indicated intervals.

 


View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Competitive Binding of Androgens to AR

WT or N727K AR, transiently expressed in COS cells, was exposed to 3 nM [3H]-T (panel A) or [3H]-DHT (panel B) alone or with increasing concentrations of unlabeled mesterolone (MES), T, DHT, or cortisol (CORT) as indicated. The amount of [3H]-androgen specifically bound after 3 h incubation at 32 C was measured and expressed as a percentage relative to controls not exposed to cold hormone. Each data point is the mean of triplicate determinations.

 
Effect of N727K Mutation on Transactivation
Full-length WT or N727K AR was expressed in COS-7, CV1, and HeLa cells, together with one of three androgen-driven reporter genes: the mouse mammary tumor virus promoter attached to either GH (MMTV-GH) or luciferase (MMTV-Luc) reporter genes, and the human prostate-specific antigen promoter (16) driving the luciferase reporter (PSA-Luc). With the MMTV-Luc reporter, the mutant receptor consistently displayed only 25–50% of the transactivation capacity of the WT receptor when exposed to increasing doses of T in COS-7 cells (Fig. 4Go). The N727K mutant was partially transactivation-defective with all doses (0.1 nM to 300 nM) of the physiological androgens, T and DHT, in Hela cells (Fig. 5Go, A and B). Interestingly, near-normal activity of mutant AR was observed with 0.1 nM DHT, accounting for normal male sexual development in the subject. Mutant AR was also transactivation defective (~50% lower) with the MMTV-GH reporter system, both for DHT and MB in COS-7 and CV-1 cells; and with the human androgen-regulated promoter, PSA-Luc in Hela cells (data not shown). Different levels of WT and mutant receptor expression were not the cause of reduced transactivation, since GH reporter activity was normalized to unit ligand-AR complex, and equivalent amounts of immunoactive WT and mutant AR were present in transfected cells (Fig. 4Go, inset). Thus, the N727K mutation consistently disrupts ligand-dependent transactivational function of the AR, in the contexts of simple, tumor viral, and complex human androgen-responsive promoters, in all cell lines tested.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Transcriptional Activity of Full-Length AR

Full-length WT (open bars) or N727K (closed bars) AR was expressed in COS-7 cells and transcriptional function, measured with MMTV-Luc, is luciferase activity (relative light units) in the presence, and absence, of T. Cells from representative wells, exposed to 30, 100, and 300 nM T, respectively, were lysed; and 10 µg of cellular protein were loaded onto a SDS-PAGE gel and AR labeled with specific antibody, PG-21 (inset).

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Comparative Effect of T, DHT, and Mesterolone on AR Activity

Hela cells were transfected with WT or N727K expression vectors and the reporter MMTV-Luc and exposed to T (panel A), DHT (panel B), and mesterolone (panel C), at the indicated doses (nM) for 42 h. Androgen-induced AR activity was expressed as fold increase in luciferase activity relative to cells not exposed to androgen. Data points are mean ± SE of four replicates.

 
Differential Effect of Mesterolone, Compared with T and DHT
Interestingly the synthetic androgen analog, mesterolone, induced mutant AR activity to levels higher than that of the WT (Fig. 5CGo). This consistent restorative effect of mesterolone, at doses between 0.1–300 nM, on mutant AR activity was in contrast to defective transactivation observed with DHT and T (Fig. 5Go, A and B). Similar results were independently replicated using a different assay system (MMTV-GH), wherein mesterolone increased the transactivation capacity of the mutant receptor to levels exceeding that of WT (Fig. 6AGo). With the multimeric reporter, ARE-TATA-Luc, N727K was about half as transcriptionally active as the WT when activated by DHT. In contrast, mesterolone was able to augment mutant receptor function to levels comparable to, or even greater than, that of WT (Fig. 6BGo). Mesterolone also increased N727K activity to levels observed with WT, with the complex human PSA promoter (Fig. 6CGo). These experiments suggest that mesterolone can restore transactivation function of the N727K mutation in vitro.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Differential Effect of DHT and Mesterolone on AR Activity

A, COS-1 cells were cotransfected with AR expression vectors and the MMTV-GH reporter and exposed to increasing doses of mesterolone (nM). Transactivation activity was expressed as GH secreted per unit MB-AR complex. B, Hela cells were transfected with WT or N727K expression vectors and the reporter ARE-TATA-Luc and exposed to vehicle (-) or either DHT or mesterolone (MES) at 0.1 or 1.0 nM doses. Luciferase activity was measured in relative light units (RLU). C, AR activity with the PSA-Luc promoter with either vehicle (-) or 1 nM each of DHT or MES in Hela cells.

 
Effect of Mutation on AR Interdomain Interactions
As the debilitating effects of the N727K mutation on receptor function were not due to aberrant ligand binding, we next investigated its effect on the TAD-LBD interdomain interactions in the mammalian two-hybrid system, wherein the AR LBD is fused to the GAL-4 DNA-binding domain (GAL4DBD) and AR TAD, to the VP-16 activation domain (VP16AD) (5, 17) and protein-protein interactions measured with pGAL4-TATA-Luc (Fig. 7AGo). A DHT-dependent functional interaction could be discerned between WT LBD and TAD, and this interaction was reduced by up to a third for the mutant LBD fusion protein. Reduced interaction of mutant LBD with TAD was even more evident when increasing doses of the LBD fusion construct were expressed (Fig. 7BGo). Expression levels of mutant and WT LBD fusion proteins were equivalent as judged by immunoblot analysis (Fig. 7BGo, lower panel) and by measurement of specific DHT-binding (1082 ± 3 vs. 1094 ± 12 fmol DHT bound/mg protein for WT and mutant fusion constructs, respectively). Strikingly, mesterolone can, dose-dependently, reverse defective mutant TAD/LBD interactions (Fig. 7CGo) to levels observed with WT LBD (Fig. 7AGo), suggesting that restoration of TAD-LBD interactions contributes to its effects on the full-length receptor (Figs. 5CGo and 6Go). In contrast, the presence of the N727K mutation did not affect LBD-LBD interactions when the LBD fragments fused to GAL4DBD and VP16AD were coexpressed together with the GAL4-TATA-Luc reporter gene. Although a 4-fold increase in WT LBD-LBD interactions was observed with physiological doses of DHT, mutant LBD-LBD interactions were no different from the WT when exposed to DHT, mesterolone, and mibolerone (Fig. 7DGo). Recent studies suggest that p160 coactivators, such as TIF2, can augment TAD-LBD interactions (18, 19, 20). To examine the role of TIF2 in TAD-LBD interactions, increasing doses of TIF2 were coexpressed with TAD and LBD fusion proteins (Fig. 7EGo). TIF2 did not fully restore mutant TAD-LBD interactions, suggesting that the coactivator was unable to compensate for defective TAD-LBD interactions. Overall the experiments indicate that N727K mutation disrupted the strong TAD-LBD, but not the weak LBD-LBD, interdomain interactions of the AR. Defective TAD-LBD interactions can be reversed by mesterolone, but not by DHT.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 7. Interaction between AR Domains in the Mammalian Two-Hybrid Assay

Hela cells were transfected with Gal4DBD- or VP16AD-AR chimeric proteins and protein-protein interactions were measured with GAL4-Tata-Luc reporter gene. A, Chimeric proteins VP16AD-ARTAD and WT, or mutant, Gal4DBD-ARLBD were coexpressed and treated with increasing doses of DHT (nM). AR TAD-LBD domain interactions induced Gal4-Tata-Luc reporter activity and were expressed as fold increase in androgen-induced luciferase activity. B, AR TAD-LBD protein-protein interactions with increasing doses (ng) of WT or N727K pGal4DBD-ARLBD vector. Cells were treated with DHT (0.5 nM) or vehicle, and activity of the mutant LBD was expressed as a percentage of that observed with the WT. Representative wild-type (W) or mutant (M) cells from each treatment were lysed, and 10 µg of cellular protein were loaded onto an SDS-PAGE gel and chimeric Gal4DBD-ARLBD protein was identified with a specific antibody, SC510. C, Effect of mesterolone on AR TAD-LBD interactions. Experiment as in panel A, but with addition of indicated doses of mesterolone (nM). D, AR LBD-LBD interactions with WT or mutant VP16AD-ARLBDs coexpressed with their Gal4DBD-ARLBD counterparts. After transfection, cells were treated with 10 nM of either DHT, MES, MB, or with vehicle. E, Effect of TIF2 on AR TAD-LBD interactions. Experiments was performed as in panel A, with or without 0.5 nM DHT, in the presence of the indicated amounts (ng) of coexpressed full-length TIF2. Data are fold increase in androgen-induced reporter gene activity (mean ± SE of at least 3 replicates), except where indicated.

 
Effect of Mutation on Interactions with TIF2
Residue 727 lies in a subdomain of the AR LBD, homologous to the signature sequence on the PR, RXR, and ER, thought to mediate interactions with coactivator molecules (10) (Fig. 1Go). The effects of the N727K on AR interaction with the coactivator TIF2 were studied. Cotransfection of TIF2 and full-length WT or mutant AR resulted in a small hormone-dependent increase in reporter gene activity with the PSA-promoter construct (Fig. 8AGo). In this assay, the N727K AR was only half as transcriptionally active as the full-length WT receptor when exposed to DHT. On the other hand, mesterolone restored mutant AR function both in the presence and absence of TIF2. Recent reports indicate that TIF2 fragments lacking functional LXXLL motifs can interact in a hormone-independent manner with the AR TAD (7, 21, 22). High intrinsic activity of TAD, perhaps augmented by endogenous TIF2, may mask the activity of cotransfected TIF2, resulting in only a small synergistic effect (Fig. 8AGo). The coactivator function of TIF2 was more evident with a DBD LBD fragment, minus the strong intrinsic activity of the TAD, wherein activity of the WT LBD fragment was increased in a dose-dependent manner by about 800% (Fig. 8BGo). In comparison, although coactivator augmentation of transactivation activity was observed, mutant AR DBD LBD fragment reduced coactivator function by up to 50% compared with the WT, in the presence of nanomolar quantities of DHT. The mammalian two-hybrid approach was next used to investigate the interaction of TIF2 with the AR LBD. A TIF2 fragment comprising amino acids 581-1464 fused to the VP16AD was coexpressed with WT or N727K LBD fusion protein, and TIF2-AR LBD interactions were measured with the GAL4-TATA-Luc reporter gene. In the absence of the TIF2 fusion protein, neither DHT nor mesterolone caused any increase in reporter gene activity (Fig. 9AGo). Coexpression of TIF2 and AR LBD fusion proteins gave a hormone-dependent increase in luciferase activity. Interactions of mutant AR LBD with TIF2 were reduced, being half as much as the WT when exposed to DHT. In the presence of mesterolone, mutant AR was also defective at low doses of TIF2, but higher doses of TIF2 restored mutant LBD-TIF2 interactions. Mesterolone was more effective than DHT in activating mutant LBD-TIF2 interactions for all doses of androgen examined (Fig. 9Go, B and C) suggesting that the corrective effect of mesterolone on N727K function was mediated partly through the coactivator.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 8. Effect of TIF2 on AR Activity in Hela Cells

A, Full-length WT or N727K AR was coexpressed with or without 30 ng TIF2, and AR activity was measured with PSA-Luc reporter in the presence or absence of 1 nM each of DHT or MES. B, WT or mutant N-truncated AR fragment, AR(DBDLBD), comprising residues 507–919 was coexpressed with increasing amounts of TIF2, and fold increase in AR activity with or without 1 nM DHT was measured with PSA-Luc reporter gene.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 9. Interaction between AR LBD and TIF2 Fragments in the Mammalian Two-Hybrid Assay

The fusion proteins VP16AD-TIF2 and WT or mutant Gal4DBD-ARLBD were coexpressed, and protein-protein interactions were measured with the Gal4-Tata-Luc reporter. Vertical lines in TIF2 fragment denote the relative positions of nuclear receptor interacting (LXXLL) motifs. A, Effect of increasing doses of TIF2 (0/2.5/5/25 ng) with and without 1 nM of either DHT or MES. B and C, Effects of the indicated doses (nM) of DHT (panel B) and MES (panel C) on LBD-TIF2 interactions.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In a preliminary report, we described a nonconservative N727K mutation in the AR LBD of a subfertile male with severely depressed sperm production (1). Since the mutation lies in the AR LBD, its effect on ligand binding was comprehensively examined. Surprisingly the mutant AR, whether expressed endogenously in the patient’s fibroblasts or transiently in heterologous cells, did not exhibit any abnormal androgen-binding characteristic. However, the transactivation ability of N727K AR was partially deficient in all transfected cell lines, in the presence of the physiological ligands, T and DHT, and the synthetic androgen MB. This was true with all three androgen-regulated promoters examined, including the complex human PSA promoter, validating the pathogenicity of the mutation. Although pathogenic, the defect was subtle, congruent with the observed minimal androgen insensitivity phenotype, where external male sexual development was normal and the sole abnormality was depressed spermatogenesis.

Natural (2, 15, 23) and engineered (14, 24, 25, 26) mutations in the LBDs of various nuclear receptors have been described to abrogate receptor function without an effect on ligand binding. Although the crystal structure of the AR LBD has not been determined, it is very likely to retain the canonical nuclear receptor structure. If so, one can predict that residue 727 would lie in the interhelical region between H3 and H4 (Fig. 1Go). The residues homologous to AR 727 in the ER (27) and PR (28) do not form contacts with bound ligand and are not situated in the immediate vicinity of the ligand-binding pocket (10). This is consistent with our observations that the N727K mutation does not affect ligand binding. The structure of cocrystallized PPAR{gamma}/SRC-1 (12) and ER{alpha}/GRIP1 (11) fragments indicate that the H3-H4 interhelical regions and helix 12 form opposite boundaries of a highly complementary recognition site for the LXXLL motifs of coactivators. The position of the N727K mutant in predicted H3-H4 interhelical region, together with defective TIF2 interactions observed with both the full-length receptor and with the LBD fragment in two-hybrid assays, suggest that the pathogenicity of the mutation is due, partly, to impairment of AR LBD coactivator interactions. Interestingly, 9 of 10 amino acid substitutions in the H3-H4 interhelical region (residues 720–730) result in partial androgen insensitivity or are associated with prostate cancer (29), indicating that this region modulates receptor activity, in contrast to mutations occurring in residues flanking this region that totally disrupt AR activity causing complete androgen insensitivity. Furthermore, homozygous SRC-1 knockout mice, although fertile, display partial hormone resistance and decreased growth and development of the testes in response to steroid hormones (30). We have previously described another AR mutation (M886V) in predicted helix 12 that causes defective TIF2 interactions and is associated with oligospermic infertility (3). These two naturally occurring coactivator-defective AR mutants, each positioned on opposite sides of the predicted TIF2 binding groove, suggest that defective coactivator action contributes to minimal androgen insensitivity and impaired spermatogenesis.

In addition to defective interactions with TIF2, the N727K mutation also disrupts TAD-LBD interactions in two-hybrid assays. In contrast, no effect on LBD-LBD interactions was detected. Unlike other steroid receptors, the AR TAD fragment has a stronger intrinsic transactivation activity than liganded LBD fragment (5, 6, 7, 21, 22). The molecular mechanisms whereby the TAD stimulates transcription is still largely unknown, but interactions between TAD and LBD are essential for AR activity. The N727K mutation, by disrupting TAD-LBD interaction, indicates the importance of residue 727 for interaction(s) with the TAD. Thus several molecular mechanisms most likely contribute to the pathogenesis of androgen insensitivity by N727K. First, the mutation reduces direct interactions of the LBD with TIF2. This was most clearly observed in the two-hybrid system, when mutant AR, liganded to DHT, had only half the ability of WT to interact with TIF2. Second, by reducing TAD-LBD interactions, the function of the full-length receptor is impaired, perhaps by disrupting the efficient recruitment of coactivators that normally bind to the TAD in a hormone-independent manner (7, 21, 22). The third possibility is that TIF2 mediates the linking of AR LBD to the TAD, resulting in a more stable ternary complex with improved transactivation activity. Coactivators are able to mediate the interaction between the TAD and LBD of PR (19, 31), enabling cooperativity between the N-terminal AF1 activation domain with AF2 in the C-terminal end of the LBD. However, the synergistic effect of TIF2 on AR TAD-LBD interaction has yet to be proven (22), and further experiments are required to resolve the issue.

Empirical treatment with mesterolone in our subject was associated with marked improvement in sperm parameters, impregnation and delivery of a healthy child (1). Cessation of mesterolone therapy was temporally followed by reversion to defective sperm production, suggesting that the androgen analog was instrumental in restoring normal spermatogenesis. The relative binding affinity of mesterolone to WT and mutant AR is similar to that of DHT and T. However, in contrast to DHT and T, mesterolone was able to restore mutant AR function to levels observed for the WT. This differential effect of mesterolone was evident with full-length AR in various cell lines, in different promoters and with a wide range of hormone doses. Mesterolone restored mutant LBD interactions with the TAD, and with TIF2 in two-hybrid assays. Compared with DHT, mesterolone has an additional methyl residue on carbon 1 of the phenolic A ring. The phenolic A ring of progesterone, like estradiol, is nestled between residues in two pincers formed by H3 and H4/H5 of their respective receptors (10). It is plausible that when the bulkier mesterolone is liganded to mutant AR, it can expose different TAD- and coactivator-interacting residues in H3-H4 interhelical region, thereby diminishing the negative effect of the N727K mutation. Indeed, structural analysis has shown that the binding of estradiol or raloxifene induces different conformation states in the ER, affecting binding of coactivator peptides (11). Furthermore, crystallographic data show that when troglitazone (Glaxco Wellcome Inc., Research Triangle Park, NC) is bound to PPAR{gamma}, the SRC-1 LXXLL flanking residues interacting with the H3-H4 interhelical region are different from those employed when the receptor is bound to another ligand, BRL 49653 (Glaxco Wellcome, Inc.) (20). Another possibility, suggested by the differential affinities of TIF2 LXXLL motifs for NR LBDs (32), is that mesterolone induces a topography of the mutant LBD that favors stronger interaction with an alternative LXXLL motif of TIF2. Provocatively, an AR germline mutation (R726L) in the amino acid preceding residue 727, found in a prostate cancer patient, did not cause any ligand-binding defect, but was abnormally activated by the noncognate ligand, estradiol (33). Thus, it seems likely that AR residue 727 defines a functional subdomain that, although not directly contributing to the ligand-binding pocket, can be indirectly affected by the presence of different ligands. Overall, our findings are consistent with the hypothesis that the protein-protein interacting surfaces of mutant AR is in an abnormal conformation with DHT, but can be correctly positioned when mesterolone is the ligand.

AR mutations in males present a unique opportunity for fine structure-function correlations as they represent a natural knock-out system for the single copy X-linked AR gene. The N727K substitution disrupts interdomain and TIF2 interactions, resulting in the mildest form of androgen insensitivity, which is manifested solely as depressed spermatogenesis. The restorative effect of mesterolone in vitro and in vivo suggests the value of screening for this mutation in those with depressed spermatogenesis and raises the possibility of directed hormonal therapy.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Subjects
Our patient, TBL, was referred for the problem of subfertility associated with sperm counts that were persistently <5 (normal, >20) x 106/ml. Secondary sexual characteristics were normal. Screening of his AR gene was performed with single strand conformation polymorphism (SSCP) analyses, and alleles with differential mobilities were sequenced. Genital skin was biopsied from the patient and primary fibroblast cultures were established (3). Fibroblasts containing a nonfunctional AR from a subject with complete AIS (34) served as a negative control, while those derived from healthy males undergoing circumcision were used as normal controls. Written consents were obtained from subjects and approval from the Hospital Ethical Committee.

Androgen-Binding Characteristics of AR
The androgen-binding properties of the AR were determined according to standard techniques (3). In brief, cells were exposed to increasing doses of tritiated androgens, and the amount of radiolabeled androgen specifically bound was determined to calculate the Kd and Bmax.

Thermolability
Thermolability was examined by comparing the binding properties at 37 C and 42 C. A reduction of Bmax of more than 40% defined thermolability.

Chase Experiments
To determine k, the rate constant of dissociation, cell monolayers were preincubated with the radiolabeled androgens, and the proportion of labeled hormone still specifically bound after exposure to excess unlabeled hormone was determined at predetermined time intervals.

Competitive Androgen Binding Assays
These were performed by coincubating 3 nM of [3H]-androgen with increasing doses of unlabeled ligands at testicular temperature of 32 C and measuring the amount of radiolabeled androgen specifically bound after a 3-h incubation.

Plasmids
N727K AR
The mutation in our subjects was recreated in a cDNA fragment by site-directed mutagenesis (35) and then substituted into the homologous section of an AR expression vector, pSVhARo.

AR DBDLBD Fragment
The TAD fragment, bounded by the unique restriction sites NheI/KpnI, was excised from full-length N727K and WT plasmids, the remaining fragment was blunt ended and religated so as to form the DBD coupled to the LBD fragment translated from the first ATG at position 507.

Mammalian Two-Hybrid (CLONTECH Laboratories, Inc., Palo Alto, CA)
The pGAL4DBD-LBD was prepared by amplifying cDNA encoding the AR LBD (exons 4–8) using pSVhARo as template with (5'-agcccggaagctgaagaaactt-3') and (5'-gtttccaaagcttcactgggtgtggaa-3') as forward and reverse primers. This PCR product, including the stop codon in exon 8, was partially digested with HindIII (site underlined) and ligated in-frame into the SmaI/HindIII site of pM containing GAL4DBD. The pVP16AD-ARTAD was made by restricting pSVhARo with EagI and HindIII to release the fragment encoding amino acids 14–565 of the AR. The 5'-end of this fragment was then ligated to a synthetic linker encoding the first 13 amino acids of ARTAD, and the resultant fragment encoding the entire ARTAD was cloned in frame with the VP16 activation domain using pVP16 vector that had been cut with EcoRI, blunt ended, and digested with HindIII. Plasmid pVP16AD-TIF2 was constructed by a double digest of pSG5-TIF2 with HindIII/XbaI followed by ligating to pVP16 with a similar site excised. The fusion protein consisted of amino acids 581 to 1464 of TIF2 fused in frame to the VP16 activation domain. The GAL4-TATA-Luc reporter vector was obtained by amplifying the five GAL4 binding sites and the adenovirus E1b minimal promoter of pG5CAT using (5'-gattacgcggctagctaattcccgggatcc-3') and (5'-tctcgccaagcttatgaattcgagctggcg-3') as forward and reverse primers, respectively. The PCR product was double digested with NheI/HindIII (sites underlined) and ligated upstream of the luciferase gene in similarly prepared pGL-basic (Promega Corp., Madison, WI) vector. The plasmids pMMTV-Luc and pMMTV-GH contain the MMTV promoter with its multiple androgen response elements cloned upstream of the luciferase and GH genes, respectively. The promoter region of the PSA gene was cloned from genomic DNA of a healthy man using published sense (acggtccatatggatcaagtcagctactctgg) and antisense (agccgtcagctgaagcttggggctggggagcc) primers (16). This PCR product was double digested with NdeI and SalI (sites underlined) and cloned into a corresponding site in the pGL-basic vector. The resultant PSA-Luc reporter gene comprises nucleotides -1600 to +12 bp of the transcription start site of the PSA gene promoter cloned upstream of the luciferase gene. All constructs were sequenced to confirm the fidelity of the enzymatic manipulations.

Mammalian Cell Culture and Transient Transfection
Mutant and WT plasmids were transfected into COS-7, CV-1, or HeLa cells using lipofection technique (36). pCMV-ßGal was used to normalize transfection efficiency. In some replicates, radiolabeled MB or MT was added to the culture medium and specific androgen-binding activity was determined. Transactivation activity was measured in relative light units (RLU) and normalized to protein content and transfection efficiency. In some experiments, COS-1 cells were transfected with 1 µg of AR plasmid, 2 µg of pCMV-ßGal, and 10 µg of the reporter construct pMMTV-GH (37). Seventy-two hours after androgen addition, secreted hGH (50 µl/sample) was measured by an immunoassay kit (Nichols Institute Diagnostics, San Juan Capistrano, CA), and the androgen-binding activity of the cells was determined with [3H]MB.

Immunoblot Analyses
Immunoblot analyses were used to study the effect of the mutation on AR protein production. The rabbit polyclonal antibody, PG-21, which recognizes the first 21 N-terminal amino acids of the human AR, was used to detect AR protein (35). A mouse monoclonal antibody SC510 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was used to locate GAL4DBD fusion proteins. Protein-antibody complexes were subsequently visualized by enhanced chemiluminescence (38).


    ACKNOWLEDGMENTS
 
We wish to thank Dr. G. Jenster (MD Anderson Cancer Center, Houston, TX) for his kind gift of ARE-TATA-Luc; Dr. G. Prins (University of Illinois, Chicago, IL) for the AR antibody, PG-21; Dr. P. Chambon, IGBMC (Strasbourg, France) for pSG5-TIF2; and Dr. S. Hsu (National University of Singapore, Republic of Singapore) for SC510 monoclonal antibody.


    FOOTNOTES
 
Address requests for reprints to: E. L. Yong, M.D., Ph.D., Department of Obstetrics and Gynecology, National University of Singapore, Lower Kent Ridge Road, Republic of Singapore 119074.

This work was supported by grants from the Fonds de la Recherche en Santé du Québec (Hydro-Québec); Fonds pour la Formulation de Chercheurs et l’Aide a la Recherche; and the Medical Research Councils of Canada and Singapore.

1 Both authors contributed equally to this work. Back

2 Current address: Medical Research Council Laboratory for Molecular Biology, Cambridge, United Kingdom. Back

Received for publication August 4, 1999. Revision received April 10, 2000. Accepted for publication April 18, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Yong EL, Ng SC, Roy AC, Yun G, Ratnam SS 1994 Pregnancy after hormonal correction of severe spermatogenic defect due to mutation in androgen receptor gene. Lancet 344:826–827
  2. Wang Q, Ghadessy FJ, Trounson A, Kretser D, McLachlan R, Ng SC, Yong EL 1998 Azoospermia associated with a mutation in the ligand-binding domain of an androgen receptor displaying normal ligand binding, but defective transactivation. J Clin Endocrinol Metab 83:4303–4309[Abstract/Free Full Text]
  3. Ghadessy FJ, Lim J, Abdullah AA, Panet-Raymond V, Choo CK, Lumbroso R, Tut TG, Gottlieb B, Pinsky L, Trifiro MA, Yong EL 1999 Oligospermic infertility associated with an androgen receptor mutation that disrupts interdomain and coactivator (TIF2) interactions. J Clin Invest 103:1517–1525[Medline]
  4. Quigley CA, De Bellis A, Marschke KB, El Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical and molecular perspectives Endocr Rev 16:271–321[Abstract/Free Full Text]
  5. Langley E, Zhou ZX, Wilson EMJ 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:29983–29990[Abstract/Free Full Text]
  6. Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann AO 1998 Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor 2). Mol Endocrinol 12:1172–1183[Abstract/Free Full Text]
  7. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 19:6085–6097[Abstract/Free Full Text]
  8. Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D, Gronemeyer H 1996 A canonical structure for the ligand-binding domain of nuclear receptors. Nat Struct Biol 3:87–94[CrossRef][Medline]
  9. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  10. Tanenbaum DM, Wang Y, Williams SP, Sigler PB 1998 Crystallographic comparison of the estrogen and progesterone receptor’s ligand binding domains. Proc Natl Acad Sci USA 95:5998–6003[Abstract/Free Full Text]
  11. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  12. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–143[CrossRef][Medline]
  13. Ana M Jiménez-Lara, Ana Aranda 1999 Lysine 246 of the vitamin D receptor is crucial for ligand-dependent interaction with coactivators and transcriptional activity. J Biol Chem 274:13503–13510[Abstract/Free Full Text]
  14. Mak HY, Hoare S, Henttu PM, Parker MG 1999 Molecular determinants of the estrogen receptor-coactivator interface. Mol Cell Biol 19:3895–3903[Abstract/Free Full Text]
  15. Tagami T, Gu WX, Peairs PT, West BL, Jameson JL 1998 A novel natural mutation in the thyroid hormone receptor defines a dual functional domain that exchanges nuclear receptor corepressors and coactivators. Mol Endocrinol 12:1888–1902[Abstract/Free Full Text]
  16. Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO, Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J Biol Chem 271:6379–6388[Abstract/Free Full Text]
  17. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36:1052–1064[CrossRef][Medline]
  18. Ikonen T, Palvimo JJ, Janne OAJ 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  19. Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ, Edwards DP, O’Malley BW 1998 The steroid receptor coactivator-1 contains multiple receptor interacting and activation domains that cooperatively enhance the activation function 1 (AF1) and AF2 domains of steroid receptors. J Biol Chem 273:12101–12108[Abstract/Free Full Text]
  20. McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J, Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK, Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 12:3357–3368[Abstract/Free Full Text]
  21. Bevan CL, Hoare S, Claessens F, Heery DM, Parker MG 1999 The AF1 and AF2 domains of the androgen receptor interact with distinct regions of SRC1. Mol Cell Biol 19:8383–8392[Abstract/Free Full Text]
  22. He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. J Biol Chem 274:37219–37225[Abstract/Free Full Text]
  23. Collingwood TN, Rajanayagam O, Adams M, Wagner R, Cavailles V, Kalkhoven E, Matthews C, Nystrom E, Stenlof K, Lindstedt G, Tisell L, Fletterick RJ, Parker MG, Chatterjee VK 1997 A natural transactivation mutation in the thyroid hormone ß receptor: impaired interaction with putative transcriptional mediators. Proc Natl Acad Sci USA 94:248–253[Abstract/Free Full Text]
  24. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  25. Wrenn CK, Katzenellenbogen BS 1993 Structure-function analysis of the hormone binding domain of the human estrogen receptor by region-specific mutagenesis and phenotypic screening in yeast. J Biol Chem 268:24089–24098[Abstract/Free Full Text]
  26. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  27. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  28. Williams SP, Sigler PB 1998 Atomic structure of progesterone complexed with its receptor. Nature 393:392–396[CrossRef][Medline]
  29. Gottlieb B, Lehvaslaiho H, Beitel LK, Lumbroso R, Pinsky L, Trifiro M 1998 The androgen receptor gene mutations database. Nucleic Acids Res 26: 234–238
  30. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925[Abstract/Free Full Text]
  31. Tetel MJ, Giangrande PH, Leonhardt SA, McDonnell DP, Edwards DP 1999 Hormone-dependent interaction between the amino- and carboxyl-terminal domains of progesterone receptor in vitro and in vivo. Mol Endocrinol 13:910–924[Abstract/Free Full Text]
  32. Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J 17:507–519[CrossRef][Medline]
  33. Elo JP, Kvist L, Leinonen K, Isomaa V, Henttu P, Lukkarinen O, Vihko P 1995 Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J Clin Endocrinol Metab 80:3494–3500[Abstract]
  34. Yong EL, Chua KL, Yang M, Roy A, Ratnam SS 1994 Complete androgen insensitivity due to a splice-site mutation in the androgen receptor gene and genetic screening with single stranded conformation polymorphism (SSCP). Fertil Steril 61:856–862[Medline]
  35. Yong EL, Tut TG, Ghadessy FJ, Prins G, Ratnam SS 1998 Partial androgen insensitivity and correlations with the predicted three dimensional structure of the androgen receptor ligand-binding domain. Mol Cell Endocrinol 137:41–50[CrossRef][Medline]
  36. Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L, Yong EL 1997 Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. J Clin Endocrinol Metab 82:3777–3782[Abstract/Free Full Text]
  37. Skolny DL, Beitel LK, Ginsberg J, Pekeles G, Arbour L, Pinsky L, Trifiro MA 1999 Discordant measures of androgen binding kinetics in two mutant receptors causing mild or partial androgen insensitivity respectively. J Clin Endocrinol Metab 84:805–810[Abstract/Free Full Text]
  38. Lim J, Ghadessy FJ, Yong EL 1997 A novel splice site mutation in the androgen receptor gene results in exon skipping and a non-functional truncated protein. Mol Cell Endocrinol 131:205–210[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. P. Steinkamp, O. A. O'Mahony, M. Brogley, H. Rehman, E. W. LaPensee, S. Dhanasekaran, M. D. Hofer, R. Kuefer, A. Chinnaiyan, M. A. Rubin, et al.
Treatment-Dependent Androgen Receptor Mutations in Prostate Cancer Exploit Multiple Mechanisms to Evade Therapy
Cancer Res., May 15, 2009; 69(10): 4434 - 4442.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. H. Liu, J. Li, P. Shen, B. Husna, E. S. Tai, and E. L. Yong
A Natural Polymorphism in Peroxisome Proliferator-Activated Receptor-{alpha} Hinge Region Attenuates Transcription due to Defective Release of Nuclear Receptor Corepressor from Chromatin
Mol. Endocrinol., May 1, 2008; 22(5): 1078 - 1092.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Estebanez-Perpina, L. A. Arnold, P. Nguyen, E. D. Rodrigues, E. Mar, R. Bateman, P. Pallai, K. M. Shokat, J. D. Baxter, R. K. Guy, et al.
A surface on the androgen receptor that allosterically regulates coactivator binding
PNAS, October 9, 2007; 104(41): 16074 - 16079.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
J Jaaskelainen, A Deeb, J W Schwabe, N P Mongan, H Martin, and I A Hughes
Human androgen receptor gene ligand-binding-domain mutations leading to disrupted interaction between the N- and C-terminal domains.
J. Mol. Endocrinol., April 1, 2006; 36(2): 361 - 368.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. Igarashi-Migitaka, A. Takeshita, N. Koibuchi, S. Yamada, R. Ohtani-Kaneko, and K. Hirata
Differential expression of p160 steroid receptor coactivators in the rat testis and epididymis
Eur. J. Endocrinol., October 1, 2005; 153(4): 595 - 604.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. J. Burd, C. E. Petre, H. Moghadam, E. M. Wilson, and K. E. Knudsen
Cyclin D1 Binding to the Androgen Receptor (AR) NH2-Terminal Domain Inhibits Activation Function 2 Association and Reveals Dual Roles for AR Corepression
Mol. Endocrinol., March 1, 2005; 19(3): 607 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Umar, C. A. Berrevoets, N. M. Van, M. van Leeuwen, M. Verbiest, W. J. Kleijer, D. Dooijes, J. A. Grootegoed, S. L. S. Drop, and A. O. Brinkmann
Functional Analysis of a Novel Androgen Receptor Mutation, Q902K, in an Individual with Partial Androgen Insensitivity
J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 507 - 515.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. A. Elhaji, J. Hui Wu, B. Gottlieb, L. K. Beitel, C. Alvarado, G. Batist, and M. A. Trifiro
An Examination of How Different Mutations at Arginine 855 of the Androgen Receptor Result in Different Androgen Insensitivity Phenotypes
Mol. Endocrinol., August 1, 2004; 18(8): 1876 - 1886.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. A. Ghali, B. Gottlieb, R. Lumbroso, L. K. Beitel, Y. Elhaji, J. Wu, L. Pinsky, and M. A. Trifiro
The Use of Androgen Receptor Amino/Carboxyl-Terminal Interaction Assays to Investigate Androgen Receptor Gene Mutations in Subjects with Varying Degrees of Androgen Insensitivity
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2185 - 2193.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Loy, K. S. Sim, and E. L. Yong
Filamin-A fragment localizes to the nucleus to regulate androgen receptor and coactivator functions
PNAS, April 15, 2003; 100(8): 4562 - 4567.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Dejager, H. Bry-Gauillard, E. Bruckert, B. Eymard, F. Salachas, E. LeGuern, S. Tardieu, R. Chadarevian, P. Giral, and G. Turpin
A Comprehensive Endocrine Description of Kennedy's Disease Revealing Androgen Insensitivity Linked to CAG Repeat Length
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3893 - 3901.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. Holter, N. Kotaja, S. Makela, L. Strauss, S. Kietz, O. A. Janne, J.-A. Gustafsson, J. J. Palvimo, and E. Treuter
Inhibition of Androgen Receptor (AR) Function by the Reproductive Orphan Nuclear Receptor DAX-1
Mol. Endocrinol., March 1, 2002; 16(3): 515 - 528.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Yoshikawa, Y. Makino, K. Okamoto, C. Morimoto, I. Makino, and H. Tanaka
Distinct Interaction of Cortivazol with the Ligand Binding Domain Confers Glucocorticoid Receptor Specificity. CORTIVAZOL IS A SPECIFIC LIGAND FOR THE GLUCOCORTICOID RECEPTOR
J. Biol. Chem., February 8, 2002; 277(7): 5529 - 5540.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y.C. Ong, P.R. Kolatkar, and E.L. Yong
Androgen receptor mutations causing human androgen insensitivity syndromes show a key role of residue M807 in Helix 8-Helix 10 interactions and in receptor ligand-binding domain stability
Mol. Hum. Reprod., February 1, 2002; 8(2): 101 - 108.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Thompson, F. Saatcioglu, O. A. Janne, and J. J. Palvimo
Disrupted Amino- and Carboxyl-Terminal Interactions of the Androgen Receptor Are Linked to Androgen Insensitivity
Mol. Endocrinol., June 1, 2001; 15(6): 923 - 935.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wang, J. Lu, and E. L. Yong
Ligand- and Coactivator-mediated Transactivation Function (AF2) of the Androgen Receptor Ligand-binding Domain Is Inhibited by the Cognate Hinge Region
J. Biol. Chem., March 2, 2001; 276(10): 7493 - 7499.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, J.
Right arrow Articles by Yong, E. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, J.
Right arrow Articles by Yong, E. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals