Molecular Endocrinology 14 (8): 1187-1197
Copyright © 2000 by The Endocrine Society
Human Androgen Receptor Mutation Disrupts Ternary Interactions between Ligand, Receptor Domains, and the Coactivator TIF2 (Transcription Intermediary Factor 2)
Joyce Lim1,
Farid J. Ghadessy1,2,
Abdullah A. R. Abdullah,
Leonard Pinsky,
Mark Trifiro and
E. L. Yong
Department of Obstetrics and Gynecology (J.L., F.J.G.,
E.L.Y.) National University of Singapore Republic of
Singapore 119074
Department of Genetics (A.A.R.A., L.P.,
M.T.) Lady Davis Institute of Medical Research McGill
University Montréal, Québec, Canada H3T 1E2
 |
ABSTRACT
|
|---|
The androgen receptor (AR) is a ligand-dependent
X-linked nuclear transcription factor regulating male sexual
development and spermatogenesis. The receptor is activated when
androgen binds to the C-terminal ligand-binding domain (LBD),
triggering a cascade of molecular events, including interactions
between the LBD and the N-terminal transactivation domain (TAD), and
the recruitment of transcriptional coactivators. A nonconservative
asparagine to lysine substitution in AR residue 727 was encountered in
a phenotypically normal man with subfertility and depressed
spermatogenesis. This N727K mutation, although located in the LBD, did
not alter any ligand-binding characteristic of the AR in the patients
fibroblasts or when expressed in heterologous cells. Nonetheless, the
mutant AR displayed only half of wild-type transactivation capacity
when exposed to physiological or synthetic androgens. This
transactivation defect was consistently present when examined with two
different reporter systems in three cell lines, using three
androgen-driven promoters (including the complex human
prostate-specific antigen promoter), confirming the pathogenicity of
the mutation. In mammalian two-hybrid assays, N727K disrupted LBD
interactions with the AR TAD and with the coactivator, transcription
intermediary factor 2 (TIF2). Strikingly, the transactivation defect of
the mutant AR can be rectified in vitro with mesterolone,
consistent with the ability of this androgen analog to restore sperm
production in vivo. Mesterolone, but not the physiological
androgen dihydrotestosterone, restored mutant LBD interactions with the
TAD and with TIF2, when expressed as fusion proteins in the two-hybrid
assay. Our data support an emerging paradigm with respect to AR
mutations in the LBD and male infertility: pathogenicity is transmitted
through reduced interdomain and coactivator interactions, and androgen
analogs that are corrective in vitro may indicate hormonal
therapy.
 |
INTRODUCTION
|
|---|
Physiological androgens are essential for development and
maintenance of the male phenotype. Spermatogenesis is exquisitely
dependent on androgens, yet normal androgen levels commonly prevail in
males with idiopathic infertility. This has led us to the hypothesis
that androgen receptor (AR) deficiency or dysfunction could be the
cause of reduced sperm formation in some patients with male
infertility. Consistent with this is the discovery of
transactivation-defective AR mutations in several patients with
depressed spermatogenesis (1, 2, 3). All actions of androgens are mediated
by the AR, a member of the steroid/nuclear receptor superfamily of
ligand-activated transcription factors (4). Constituent members share a
modular structure comprising an N-terminal transactivation domain (TAD)
of variable length, a central DNA-binding domain (DBD) that enables
interaction with cognate response elements usually upstream of target
genes, and a C-terminal ligand-binding domain (LBD). Much of our
knowledge of the mechanism of action of the androgen receptor derives
from studies on LBDs of the retinoid X (RXR), thyroid hormone (THR),
and estrogen (ER) receptors. Like other steroid receptors, the AR LBD
binds specifically to its physiological ligands, testosterone (T) and
dihydrotestosterone (DHT), triggering a series of molecular events
culminating in the activation of androgen-responsive gene(s). Mutations
that disturb androgen binding to the AR LBD result in abrogation of
receptor function and androgen insensitivity syndromes in affected
males (4). The AR has a large TAD, which forms more than half of the
receptor protein (Fig. 1
). Unlike RXR, THR,
and ER, deletion of the LBD results in a TAD fragment that is
constitutively active. In many reporter gene assays, the activation
function of AR TAD, minus the LBD, is almost equivalent to the activity
of the liganded full-length AR (5, 6). In contrast AR LBD fragments, in
which the TAD is deleted, demonstrate very little intrinsic
transactivation function in various cell lines. Another unusual feature
is that functional interaction between the TAD and LBD is essential for
optimal AR activity. Mutants that selectively interfere with the
cooperation between TAD and LBD dramatically impair receptor activity
(7).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Location of the N727K Mutation in of the AR-LBD and
Alignment of Sequences Corresponding to Helices 3 and 4
The principal domains of the AR are schematically depicted
(top panel), and the portion forming predicted helices
H3 and H4 of the LBD is aligned with corresponding sequences from the
human progesterone (PR), glucocorticoid (GR), mineralocorticoid (MR),
and PPAR receptors. A mutation in AR residue 727 (*), changing
asparagine to lysine in a patient (TBL) with male infertility and
severely depressed sperm production, is in a highly conserved
coactivator-interacting signature sequence (underlined)
in the H3-H4 interhelical region. Conserved residues are in
bold. TAD, Transactivation domain; DNA-binding domain
(shaded box); LBD, ligand-binding domain.
|
|
Recently, it was demonstrated that activation functions of
steroid receptor LBDs are dependent on recruitment of coactivator
molecules that act as bridging factors linking these receptors to
preinitiation complexes and RNA polymerase II, thereby initiating
transcription. In a preliminary report, we have described a
nonconservative mutation (N727K) in the AR LBD of a man with severely
depressed spermatogenesis causing infertility (1). The mutation occurs
within a highly conserved 20 amino-acid region that constitutes a
signature sequence for the nuclear receptor superfamily (Fig. 1
) (8).
Mutational studies in the ER, PR, RAR, and THR demonstrate this region
to be integral to the function of a family of closely related p160
coactivator proteins comprising NcoA1/SRC1, TIF2/GRIP1/NcoA2/SRC2, and
pCIP/RAC3/ACTR/AIB1/SRC3 (9). These steroid receptor coactivators
associate in a ligand-dependent manner with nuclear receptors to
enhance transactivation. All have conserved LXXLL (L is leucine, X is
any amino acid) motifs in their nuclear receptor-interacting domains
that are critical for receptor-coactivator interactions. The tertiary
structures of all steroid receptor LBDs solved to date are very
similar, consisting essentially of a wedge-shaped helical sandwich made
up of 11 to 12
-helices disposed in three layers (10).
Crystallographic data from the ER (11) and peroxisome
proliferator-associated receptor (PPAR-
) (12) indicate the LXXLL
motif forms a short
-helix that binds in a hydrophobic groove on the
holoreceptor surface formed by helices 3 and 4 on one side, and helix
12 on the other. Two highly conserved residues, a glutamate in helix 12
and lysine in helix 3, serve to orient the LXXLL helix, and mutations
of these charged residues do not affect ligand binding, yet abrogate
ligand-dependent transactivation activity almost totally in the vitamin
D receptor (13), ER (14), and THR (15).
We have recently reported mutations in residue 886, 11 residues
upstream of the conserved glutamate in predicted helix 12 of the AR,
which by disrupting interdomain and receptor-coactivator interactions,
lead to minimal androgen insensitivity, depressed sperm production, and
male infertility (3). Here, we present evidence that another
transactivation-defective mutant, located at the opposite end of the
coactivator binding groove in helix 3/4, disrupts not only interaction
with the coactivator TIF2 (transcription intermediary factor 2), but
also interdomain interactions with the TAD. In vitro studies
were performed to illuminate the mechanism whereby pharmacological
therapy with the androgen analog, mesterolone, resulted in improved
sperm production and fertility in our patient.
 |
RESULTS
|
|---|
Oligospermic Patient with Amino Acid Substitution in the AR LBD
A patient with severe oligospermia and male infertility was found
to have a single C-to-G transversion in his AR gene causing an
asparagine-to-lysine substitution in codon 727 (Fig. 1
). Single-strand conformation polymorphism
analyses did not reveal any other AR mutation. The N727K mutation
involves a residue highly conserved among members of the steroid
receptor family that is predicted to lie between helices 3 and 4
of the AR LBD. Treatment with the androgen analog, mesterolone
(1
-methyl-DHT, 1
-methyl-17ß-hydroxy-5
-androstan-3-one),
restored normal sperm production and resulted in a healthy pregnancy
(1). Withdrawal of mesterolone therapy was associated with reversion to
poor sperm production, suggesting that mesterolone had a corrective
effect on mutant AR function in vivo.
Ligand Binding Characteristics of Mutant Receptor
The androgen-binding properties of the mutant receptor were
examined in fibroblast monolayers derived from subjects genital skin.
Binding to the natural androgen DHT was within normal limits, with a
dissociation constant (Kd) of 0.5 (normal,
0.290.54) nM and Bmax of 43
(normal, 2643) fmol DHT/mg protein at 37C (Fig. 2A
). In contrast, fibroblasts from another
subject with complete androgen insensitivity due to a splice-site
mutation causing a truncated AR LBD, had no DHT binding. Binding to the
synthetic androgen MB was also normal with Kd of
0.29 (N: 0.10.3) nM, Bmax: 28.5
(1550) (data not shown). Dissociation kinetics for DHT in fibroblasts
were within normal limits, with dissociation rate constant, k, of 9.2
(N: 8.89.9) (10-3/min) at 42 C (Fig. 2B
). To
test for subtle perturbations of androgen-binding kinetics in a more
homogenous intracellular milieu, the androgen-binding properties of AR
expressed in COS-7 cells were examined. The affinity constants
(Kd) of N727K for the synthetic androgens
methyltrienolone (MT, R1881) or mibolerone (MB) (Fig. 2C
) were 0.90 and
0.87 nM, respectively, no different from the wild
type (WT). Since mild abnormalities of AR ligand binding can
manifest solely as disordered dissociation kinetics, chase studies were
performed. The dissociation rates of T, DHT, and MB (Fig. 2D
) for N727K
at 42 C were similar to the WT. The mutation also did not manifest any
thermolability in ligand binding (data not shown). Competitive binding
assays indicate that the ability of unlabeled mesterolone to inhibit
binding of [3H]-T (Fig. 3A
) or [3H]-DHT (Fig. 3B
) to AR was similar to that observed for cold T and DHT.
Radiolabeled-androgen binding to AR was largely replaced by unlabeled
mesterolone at 5 nM, and near total displacement occurred
at doses above 50 nM. In contrast, the nonandrogen,
cortisol, did not inhibit [3H]-androgen
binding. There were no significant differences in the relative binding
affinity of mesterolone to WT or mutant AR. Thus, comprehensive
examination indicates N727K mutation did not affect the binding
kinetics of any androgen, including mesterolone, to the AR.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 2. Androgen Binding Properties of N727K AR
A, Primary fibroblast cultures were established from genital skin
biopsies of the infertile subject TBL, two normal controls (C1, C2),
and a patient with complete androgen insensitivity syndrome (CAIS) due
to a truncated LBD (38 ). Monolayers were exposed to
3[H]-DHT for 2 h at 37 C, and radiolabeled androgen
specifically bound (fmol 3[H]-DHT bound/mg total protein)
was measured to obtain the Scatchard plot. B, The dissociation kinetics
of 3[H]-DHT bound to fibroblasts from patient TBL was
compared with that from two normal controls (C1, C2). The percentage
(log scale) of 3[H]-DHT specifically bound after exposure
to 200-fold excess unlabeled DHT at 42 C was measured at the indicated
intervals. C, WT or mutant AR, transiently expressed in COS cells, was
exposed to increasing concentrations of 3[H]-MB at 37 C,
and the amount specifically bound (fmol 3[H]-MB bound/mg
total protein) was measured to obtain the Scatchard plot. D, WT or
mutant AR, transiently expressed in COS cells, was exposed to 3
nM 3[H]-MB and chased with 200-fold excess
unlabeled hormone at 42 C. The percentage of radiolabeled hormone
remaining was measured at the indicated intervals.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3. Competitive Binding of Androgens to AR
WT or N727K AR, transiently expressed in COS cells, was exposed to 3
nM [3H]-T (panel A) or [3H]-DHT
(panel B) alone or with increasing concentrations of unlabeled
mesterolone (MES), T, DHT, or cortisol (CORT) as indicated. The amount
of [3H]-androgen specifically bound after 3 h
incubation at 32 C was measured and expressed as a percentage relative
to controls not exposed to cold hormone. Each data point is the mean of
triplicate determinations.
|
|
Effect of N727K Mutation on Transactivation
Full-length WT or N727K AR was expressed in COS-7, CV1, and
HeLa cells, together with one of three androgen-driven reporter genes:
the mouse mammary tumor virus promoter attached to either GH
(MMTV-GH) or luciferase (MMTV-Luc) reporter
genes, and the human prostate-specific antigen promoter (16) driving
the luciferase reporter (PSA-Luc). With the
MMTV-Luc reporter, the mutant receptor consistently
displayed only 2550% of the transactivation capacity of the WT
receptor when exposed to increasing doses of T in COS-7 cells (Fig. 4
). The N727K mutant was partially
transactivation-defective with all doses (0.1 nM
to 300 nM) of the physiological androgens, T and
DHT, in Hela cells (Fig. 5
, A and B).
Interestingly, near-normal activity of mutant AR was observed with 0.1
nM DHT, accounting for normal male sexual
development in the subject. Mutant AR was also transactivation
defective (
50% lower) with the MMTV-GH reporter system,
both for DHT and MB in COS-7 and CV-1 cells; and with the human
androgen-regulated promoter, PSA-Luc in Hela cells (data not
shown). Different levels of WT and mutant receptor expression were not
the cause of reduced transactivation, since GH reporter
activity was normalized to unit ligand-AR complex, and equivalent
amounts of immunoactive WT and mutant AR were present in transfected
cells (Fig. 4
, inset). Thus, the N727K mutation consistently
disrupts ligand-dependent transactivational function of the AR, in the
contexts of simple, tumor viral, and complex human androgen-responsive
promoters, in all cell lines tested.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 4. Transcriptional Activity of Full-Length AR
Full-length WT (open bars) or N727K (closed
bars) AR was expressed in COS-7 cells and transcriptional
function, measured with MMTV-Luc, is luciferase activity (relative
light units) in the presence, and absence, of T. Cells from
representative wells, exposed to 30, 100, and 300 nM T,
respectively, were lysed; and 10 µg of cellular protein were loaded
onto a SDS-PAGE gel and AR labeled with specific antibody, PG-21
(inset).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5. Comparative Effect of T, DHT, and Mesterolone on AR
Activity
Hela cells were transfected with WT or N727K expression vectors and the
reporter MMTV-Luc and exposed to T (panel A), DHT (panel
B), and mesterolone (panel C), at the indicated doses (nM)
for 42 h. Androgen-induced AR activity was expressed as fold
increase in luciferase activity relative to cells not exposed to
androgen. Data points are mean ± SE of four
replicates.
|
|
Differential Effect of Mesterolone, Compared with T and DHT
Interestingly the synthetic androgen analog, mesterolone, induced
mutant AR activity to levels higher than that of the WT (Fig. 5C
). This
consistent restorative effect of mesterolone, at doses between 0.1300
nM, on mutant AR activity was in contrast to defective
transactivation observed with DHT and T (Fig. 5
, A and B). Similar
results were independently replicated using a different assay system
(MMTV-GH), wherein mesterolone increased the transactivation
capacity of the mutant receptor to levels exceeding that of WT (Fig. 6A
). With the multimeric reporter,
ARE-TATA-Luc, N727K was about half as transcriptionally
active as the WT when activated by DHT. In contrast, mesterolone was
able to augment mutant receptor function to levels comparable to, or
even greater than, that of WT (Fig. 6B
). Mesterolone also increased
N727K activity to levels observed with WT, with the complex human PSA
promoter (Fig. 6C
). These experiments suggest that mesterolone can
restore transactivation function of the N727K mutation in
vitro.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. Differential Effect of DHT and Mesterolone on AR
Activity
A, COS-1 cells were cotransfected with AR expression vectors and the
MMTV-GH reporter and exposed to increasing doses of
mesterolone (nM). Transactivation activity was expressed as
GH secreted per unit MB-AR complex. B, Hela cells were transfected with
WT or N727K expression vectors and the reporter
ARE-TATA-Luc and exposed to vehicle (-) or either DHT
or mesterolone (MES) at 0.1 or 1.0 nM doses. Luciferase
activity was measured in relative light units (RLU). C, AR activity
with the PSA-Luc promoter with either vehicle (-) or 1
nM each of DHT or MES in Hela cells.
|
|
Effect of Mutation on AR Interdomain Interactions
As the debilitating effects of the N727K mutation on receptor
function were not due to aberrant ligand binding, we next investigated
its effect on the TAD-LBD interdomain interactions in the mammalian
two-hybrid system, wherein the AR LBD is fused to the GAL-4 DNA-binding
domain (GAL4DBD) and AR TAD, to the VP-16 activation domain (VP16AD)
(5, 17) and protein-protein interactions measured with
pGAL4-TATA-Luc (Fig. 7A
). A
DHT-dependent functional interaction could be discerned between WT LBD
and TAD, and this interaction was reduced by up to a third for the
mutant LBD fusion protein. Reduced interaction of mutant LBD with TAD
was even more evident when increasing doses of the LBD fusion construct
were expressed (Fig. 7B
). Expression levels of mutant and WT LBD fusion
proteins were equivalent as judged by immunoblot analysis (Fig. 7B
, lower panel) and by measurement of specific DHT-binding
(1082 ± 3 vs. 1094 ± 12 fmol DHT bound/mg
protein for WT and mutant fusion constructs, respectively). Strikingly,
mesterolone can, dose-dependently, reverse defective mutant TAD/LBD
interactions (Fig. 7C
) to levels observed with WT LBD (Fig. 7A
),
suggesting that restoration of TAD-LBD interactions contributes to its
effects on the full-length receptor (Figs. 5C
and 6
). In contrast, the
presence of the N727K mutation did not affect LBD-LBD interactions when
the LBD fragments fused to GAL4DBD and VP16AD were coexpressed together
with the GAL4-TATA-Luc reporter gene. Although a 4-fold
increase in WT LBD-LBD interactions was observed with physiological
doses of DHT, mutant LBD-LBD interactions were no different from the WT
when exposed to DHT, mesterolone, and mibolerone (Fig. 7D
). Recent
studies suggest that p160 coactivators, such as TIF2, can augment
TAD-LBD interactions (18, 19, 20). To examine the role of TIF2 in TAD-LBD
interactions, increasing doses of TIF2 were coexpressed with TAD and
LBD fusion proteins (Fig. 7E
). TIF2 did not fully restore mutant
TAD-LBD interactions, suggesting that the coactivator was unable to
compensate for defective TAD-LBD interactions. Overall the experiments
indicate that N727K mutation disrupted the strong TAD-LBD, but not the
weak LBD-LBD, interdomain interactions of the AR. Defective TAD-LBD
interactions can be reversed by mesterolone, but not by DHT.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 7. Interaction between AR Domains in the Mammalian
Two-Hybrid Assay
Hela cells were transfected with Gal4DBD- or VP16AD-AR chimeric
proteins and protein-protein interactions were measured with
GAL4-Tata-Luc reporter gene. A, Chimeric proteins
VP16AD-ARTAD and WT, or mutant, Gal4DBD-ARLBD were coexpressed and
treated with increasing doses of DHT (nM). AR TAD-LBD
domain interactions induced Gal4-Tata-Luc reporter
activity and were expressed as fold increase in androgen-induced
luciferase activity. B, AR TAD-LBD protein-protein interactions with
increasing doses (ng) of WT or N727K pGal4DBD-ARLBD vector. Cells were
treated with DHT (0.5 nM) or vehicle, and activity of the
mutant LBD was expressed as a percentage of that observed with the WT.
Representative wild-type (W) or mutant (M) cells from each treatment
were lysed, and 10 µg of cellular protein were loaded onto an
SDS-PAGE gel and chimeric Gal4DBD-ARLBD protein was identified with a
specific antibody, SC510. C, Effect of mesterolone on AR TAD-LBD
interactions. Experiment as in panel A, but with addition of indicated
doses of mesterolone (nM). D, AR LBD-LBD interactions with
WT or mutant VP16AD-ARLBDs coexpressed with their Gal4DBD-ARLBD
counterparts. After transfection, cells were treated with 10
nM of either DHT, MES, MB, or with vehicle. E, Effect of
TIF2 on AR TAD-LBD interactions. Experiments was performed as in panel
A, with or without 0.5 nM DHT, in the presence of the
indicated amounts (ng) of coexpressed full-length TIF2. Data are fold
increase in androgen-induced reporter gene activity (mean ±
SE of at least 3 replicates), except where indicated.
|
|
Effect of Mutation on Interactions with TIF2
Residue 727 lies in a subdomain of the AR LBD, homologous to the
signature sequence on the PR, RXR, and ER, thought to mediate
interactions with coactivator molecules (10) (Fig. 1
). The effects of
the N727K on AR interaction with the coactivator TIF2 were studied.
Cotransfection of TIF2 and full-length WT or mutant AR resulted in a
small hormone-dependent increase in reporter gene activity with the
PSA-promoter construct (Fig. 8A
). In this
assay, the N727K AR was only half as transcriptionally active as the
full-length WT receptor when exposed to DHT. On the other hand,
mesterolone restored mutant AR function both in the presence and
absence of TIF2. Recent reports indicate that TIF2 fragments lacking
functional LXXLL motifs can interact in a hormone-independent manner
with the AR TAD (7, 21, 22). High intrinsic activity of TAD, perhaps
augmented by endogenous TIF2, may mask the activity of cotransfected
TIF2, resulting in only a small synergistic effect (Fig. 8A
). The
coactivator function of TIF2 was more evident with a DBD LBD fragment,
minus the strong intrinsic activity of the TAD, wherein activity of the
WT LBD fragment was increased in a dose-dependent manner by about 800%
(Fig. 8B
). In comparison, although coactivator augmentation of
transactivation activity was observed, mutant AR DBD LBD fragment
reduced coactivator function by up to 50% compared with the WT, in the
presence of nanomolar quantities of DHT. The mammalian two-hybrid
approach was next used to investigate the interaction of TIF2 with the
AR LBD. A TIF2 fragment comprising amino acids 581-1464 fused to the
VP16AD was coexpressed with WT or N727K LBD fusion protein, and TIF2-AR
LBD interactions were measured with the GAL4-TATA-Luc
reporter gene. In the absence of the TIF2 fusion protein, neither DHT
nor mesterolone caused any increase in reporter gene activity (Fig. 9A
). Coexpression of TIF2 and AR LBD fusion
proteins gave a hormone-dependent increase in luciferase activity.
Interactions of mutant AR LBD with TIF2 were reduced, being half as
much as the WT when exposed to DHT. In the presence of mesterolone,
mutant AR was also defective at low doses of TIF2, but higher doses of
TIF2 restored mutant LBD-TIF2 interactions. Mesterolone was more
effective than DHT in activating mutant LBD-TIF2 interactions for all
doses of androgen examined (Fig. 9
, B and C) suggesting that the
corrective effect of mesterolone on N727K function was mediated partly
through the coactivator.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 8. Effect of TIF2 on AR Activity in Hela Cells
A, Full-length WT or N727K AR was coexpressed with or without 30 ng
TIF2, and AR activity was measured with PSA-Luc reporter
in the presence or absence of 1 nM each of DHT or MES. B,
WT or mutant N-truncated AR fragment, AR(DBDLBD), comprising residues
507919 was coexpressed with increasing amounts of TIF2, and fold
increase in AR activity with or without 1 nM DHT was
measured with PSA-Luc reporter gene.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
Figure 9. Interaction between AR LBD and TIF2 Fragments in
the Mammalian Two-Hybrid Assay
The fusion proteins VP16AD-TIF2 and WT or mutant Gal4DBD-ARLBD were
coexpressed, and protein-protein interactions were measured with the
Gal4-Tata-Luc reporter. Vertical lines in
TIF2 fragment denote the relative positions of nuclear receptor
interacting (LXXLL) motifs. A, Effect of increasing doses of TIF2
(0/2.5/5/25 ng) with and without 1 nM of either DHT or MES.
B and C, Effects of the indicated doses (nM) of DHT (panel
B) and MES (panel C) on LBD-TIF2 interactions.
|
|
 |
DISCUSSION
|
|---|
In a preliminary report, we described a nonconservative N727K
mutation in the AR LBD of a subfertile male with severely depressed
sperm production (1). Since the mutation lies in the AR LBD, its effect
on ligand binding was comprehensively examined. Surprisingly the mutant
AR, whether expressed endogenously in the patients fibroblasts or
transiently in heterologous cells, did not exhibit any abnormal
androgen-binding characteristic. However, the transactivation ability
of N727K AR was partially deficient in all transfected cell lines, in
the presence of the physiological ligands, T and DHT, and the synthetic
androgen MB. This was true with all three androgen-regulated promoters
examined, including the complex human PSA promoter, validating the
pathogenicity of the mutation. Although pathogenic, the defect was
subtle, congruent with the observed minimal androgen insensitivity
phenotype, where external male sexual development was normal and the
sole abnormality was depressed spermatogenesis.
Natural (2, 15, 23) and engineered (14, 24, 25, 26) mutations in the
LBDs of various nuclear receptors have been described to abrogate
receptor function without an effect on ligand binding. Although the
crystal structure of the AR LBD has not been determined, it is very
likely to retain the canonical nuclear receptor structure. If so, one
can predict that residue 727 would lie in the interhelical region
between H3 and H4 (Fig. 1
). The residues homologous to AR 727 in the ER
(27) and PR (28) do not form contacts with bound ligand and are not
situated in the immediate vicinity of the ligand-binding pocket (10).
This is consistent with our observations that the N727K mutation does
not affect ligand binding. The structure of cocrystallized
PPAR
/SRC-1 (12) and ER
/GRIP1 (11) fragments indicate that the
H3-H4 interhelical regions and helix 12 form opposite boundaries of a
highly complementary recognition site for the LXXLL motifs of
coactivators. The position of the N727K mutant in predicted H3-H4
interhelical region, together with defective TIF2 interactions observed
with both the full-length receptor and with the LBD fragment in
two-hybrid assays, suggest that the pathogenicity of the
mutation is due, partly, to impairment of AR LBD coactivator
interactions. Interestingly, 9 of 10 amino acid substitutions in the
H3-H4 interhelical region (residues 720730) result in partial
androgen insensitivity or are associated with prostate cancer (29),
indicating that this region modulates receptor activity, in contrast to
mutations occurring in residues flanking this region that totally
disrupt AR activity causing complete androgen insensitivity.
Furthermore, homozygous SRC-1 knockout mice, although fertile, display
partial hormone resistance and decreased growth and development of the
testes in response to steroid hormones (30). We have previously
described another AR mutation (M886V) in predicted helix 12 that causes
defective TIF2 interactions and is associated with oligospermic
infertility (3). These two naturally occurring coactivator-defective AR
mutants, each positioned on opposite sides of the predicted TIF2
binding groove, suggest that defective coactivator action contributes
to minimal androgen insensitivity and impaired spermatogenesis.
In addition to defective interactions with TIF2, the N727K mutation
also disrupts TAD-LBD interactions in two-hybrid assays. In contrast,
no effect on LBD-LBD interactions was detected. Unlike other steroid
receptors, the AR TAD fragment has a stronger intrinsic transactivation
activity than liganded LBD fragment (5, 6, 7, 21, 22). The molecular
mechanisms whereby the TAD stimulates transcription is still largely
unknown, but interactions between TAD and LBD are essential for AR
activity. The N727K mutation, by disrupting TAD-LBD interaction,
indicates the importance of residue 727 for interaction(s) with the
TAD. Thus several molecular mechanisms most likely contribute to the
pathogenesis of androgen insensitivity by N727K. First, the mutation
reduces direct interactions of the LBD with TIF2. This was most clearly
observed in the two-hybrid system, when mutant AR, liganded to DHT, had
only half the ability of WT to interact with TIF2. Second, by reducing
TAD-LBD interactions, the function of the full-length receptor is
impaired, perhaps by disrupting the efficient recruitment of
coactivators that normally bind to the TAD in a hormone-independent
manner (7, 21, 22). The third possibility is that TIF2 mediates the
linking of AR LBD to the TAD, resulting in a more stable ternary
complex with improved transactivation activity. Coactivators are able
to mediate the interaction between the TAD and LBD of PR (19, 31),
enabling cooperativity between the N-terminal AF1 activation domain
with AF2 in the C-terminal end of the LBD. However, the synergistic
effect of TIF2 on AR TAD-LBD interaction has yet to be proven (22), and
further experiments are required to resolve the issue.
Empirical treatment with mesterolone in our subject was associated with
marked improvement in sperm parameters, impregnation and delivery of a
healthy child (1). Cessation of mesterolone therapy was temporally
followed by reversion to defective sperm production, suggesting that
the androgen analog was instrumental in restoring normal
spermatogenesis. The relative binding affinity of mesterolone to WT and
mutant AR is similar to that of DHT and T. However, in contrast to DHT
and T, mesterolone was able to restore mutant AR function to levels
observed for the WT. This differential effect of mesterolone was
evident with full-length AR in various cell lines, in different
promoters and with a wide range of hormone doses. Mesterolone restored
mutant LBD interactions with the TAD, and with TIF2 in two-hybrid
assays. Compared with DHT, mesterolone has an additional methyl residue
on carbon 1 of the phenolic A ring. The phenolic A ring of
progesterone, like estradiol, is nestled between residues in two
pincers formed by H3 and H4/H5 of their respective receptors (10). It
is plausible that when the bulkier mesterolone is liganded to mutant
AR, it can expose different TAD- and coactivator-interacting residues
in H3-H4 interhelical region, thereby diminishing the negative effect
of the N727K mutation. Indeed, structural analysis has shown that the
binding of estradiol or raloxifene induces different conformation
states in the ER, affecting binding of coactivator peptides (11).
Furthermore, crystallographic data show that when
troglitazone (Glaxco Wellcome Inc., Research
Triangle Park, NC) is bound to PPAR
, the SRC-1 LXXLL flanking
residues interacting with the H3-H4 interhelical region are different
from those employed when the receptor is bound to another ligand,
BRL 49653 (Glaxco Wellcome, Inc.)
(20). Another possibility, suggested by the differential affinities of
TIF2 LXXLL motifs for NR LBDs (32), is that mesterolone induces a
topography of the mutant LBD that favors stronger interaction with an
alternative LXXLL motif of TIF2. Provocatively, an AR germline mutation
(R726L) in the amino acid preceding residue 727, found in a prostate
cancer patient, did not cause any ligand-binding defect, but was
abnormally activated by the noncognate ligand, estradiol (33). Thus, it
seems likely that AR residue 727 defines a functional subdomain that,
although not directly contributing to the ligand-binding pocket, can be
indirectly affected by the presence of different ligands. Overall, our
findings are consistent with the hypothesis that the protein-protein
interacting surfaces of mutant AR is in an abnormal conformation with
DHT, but can be correctly positioned when mesterolone is the
ligand.
AR mutations in males present a unique opportunity for fine
structure-function correlations as they represent a natural knock-out
system for the single copy X-linked AR gene. The N727K
substitution disrupts interdomain and TIF2 interactions, resulting in
the mildest form of androgen insensitivity, which is manifested
solely as depressed spermatogenesis. The restorative effect of
mesterolone in vitro and in vivo suggests the
value of screening for this mutation in those with depressed
spermatogenesis and raises the possibility of directed hormonal
therapy.
 |
MATERIALS AND METHODS
|
|---|
Subjects
Our patient, TBL, was referred for the problem of subfertility
associated with sperm counts that were persistently <5 (normal,
>20) x 106/ml. Secondary sexual
characteristics were normal. Screening of his AR gene was performed
with single strand conformation polymorphism (SSCP) analyses, and
alleles with differential mobilities were sequenced. Genital skin was
biopsied from the patient and primary fibroblast cultures were
established (3). Fibroblasts containing a nonfunctional AR from a
subject with complete AIS (34) served as a negative control, while
those derived from healthy males undergoing circumcision were used as
normal controls. Written consents were obtained from subjects and
approval from the Hospital Ethical Committee.
Androgen-Binding Characteristics of AR
The androgen-binding properties of the AR were determined
according to standard techniques (3). In brief, cells were exposed to
increasing doses of tritiated androgens, and the amount of radiolabeled
androgen specifically bound was determined to calculate the
Kd and Bmax.
Thermolability
Thermolability was examined by comparing the binding properties at 37 C
and 42 C. A reduction of Bmax of more than 40%
defined thermolability.
Chase Experiments
To determine k, the rate constant of dissociation, cell monolayers were
preincubated with the radiolabeled androgens, and the proportion of
labeled hormone still specifically bound after exposure to excess
unlabeled hormone was determined at predetermined time intervals.
Competitive Androgen Binding Assays
These were performed by coincubating 3 nM of
[3H]-androgen with increasing doses of
unlabeled ligands at testicular temperature of 32 C and measuring the
amount of radiolabeled androgen specifically bound after a 3-h
incubation.
Plasmids
N727K AR
The mutation in our subjects was recreated in a cDNA fragment by
site-directed mutagenesis (35) and then substituted into the homologous
section of an AR expression vector, pSVhARo.
AR DBDLBD Fragment
The TAD fragment, bounded by the unique restriction sites
NheI/KpnI, was excised from full-length N727K and
WT plasmids, the remaining fragment was blunt ended and religated so as
to form the DBD coupled to the LBD fragment translated from the first
ATG at position 507.
Mammalian Two-Hybrid (CLONTECH Laboratories, Inc.,
Palo Alto, CA)
The pGAL4DBD-LBD was prepared by amplifying cDNA encoding the AR LBD
(exons 48) using pSVhARo as template with
(5'-agcccggaagctgaagaaactt-3') and
(5'-gtttccaaagcttcactgggtgtggaa-3') as forward and reverse
primers. This PCR product, including the stop codon in exon 8, was
partially digested with HindIII (site underlined)
and ligated in-frame into the SmaI/HindIII site
of pM containing GAL4DBD. The pVP16AD-ARTAD was made by restricting
pSVhARo with EagI and HindIII to release the
fragment encoding amino acids 14565 of the AR. The 5'-end of this
fragment was then ligated to a synthetic linker encoding the first 13
amino acids of ARTAD, and the resultant fragment encoding the entire
ARTAD was cloned in frame with the VP16 activation domain using pVP16
vector that had been cut with EcoRI, blunt ended, and
digested with HindIII. Plasmid pVP16AD-TIF2 was constructed
by a double digest of pSG5-TIF2 with HindIII/XbaI
followed by ligating to pVP16 with a similar site excised. The fusion
protein consisted of amino acids 581 to 1464 of TIF2 fused in frame to
the VP16 activation domain. The GAL4-TATA-Luc reporter
vector was obtained by amplifying the five GAL4 binding sites and the
adenovirus E1b minimal promoter of pG5CAT using
(5'-gattacgcggctagctaattcccgggatcc-3') and
(5'-tctcgccaagcttatgaattcgagctggcg-3') as forward and
reverse primers, respectively. The PCR product was double digested with
NheI/HindIII (sites underlined) and
ligated upstream of the luciferase gene in similarly prepared pGL-basic
(Promega Corp., Madison, WI) vector. The plasmids
pMMTV-Luc and pMMTV-GH contain the MMTV promoter
with its multiple androgen response elements cloned upstream of the
luciferase and GH genes, respectively. The
promoter region of the PSA gene was cloned from genomic DNA
of a healthy man using published sense
(acggtccatatggatcaagtcagctactctgg) and antisense
(agccgtcagctgaagcttggggctggggagcc) primers (16). This PCR
product was double digested with NdeI and SalI
(sites underlined) and cloned into a corresponding site in
the pGL-basic vector. The resultant PSA-Luc reporter gene
comprises nucleotides -1600 to +12 bp of the transcription start site
of the PSA gene promoter cloned upstream of the luciferase gene. All
constructs were sequenced to confirm the fidelity of the enzymatic
manipulations.
Mammalian Cell Culture and Transient Transfection
Mutant and WT plasmids were transfected into COS-7, CV-1, or
HeLa cells using lipofection technique (36). pCMV-ßGal was used to
normalize transfection efficiency. In some replicates, radiolabeled MB
or MT was added to the culture medium and specific androgen-binding
activity was determined. Transactivation activity was measured in
relative light units (RLU) and normalized to protein content and
transfection efficiency. In some experiments, COS-1 cells were
transfected with 1 µg of AR plasmid, 2 µg of pCMV-ßGal, and 10
µg of the reporter construct pMMTV-GH (37). Seventy-two hours after
androgen addition, secreted hGH (50 µl/sample) was measured by an
immunoassay kit (Nichols Institute Diagnostics, San Juan
Capistrano, CA), and the androgen-binding activity of the cells was
determined with [3H]MB.
Immunoblot Analyses
Immunoblot analyses were used to study the effect of the
mutation on AR protein production. The rabbit polyclonal antibody,
PG-21, which recognizes the first 21 N-terminal amino acids of the
human AR, was used to detect AR protein (35). A mouse monoclonal
antibody SC510 (Santa Cruz Biotechnology, Inc., Santa
Cruz, CA) was used to locate GAL4DBD fusion proteins. Protein-antibody
complexes were subsequently visualized by enhanced chemiluminescence
(38).
 |
ACKNOWLEDGMENTS
|
|---|
We wish to thank Dr. G. Jenster (MD Anderson Cancer Center,
Houston, TX) for his kind gift of ARE-TATA-Luc; Dr. G. Prins
(University of Illinois, Chicago, IL) for the AR antibody, PG-21; Dr.
P. Chambon, IGBMC (Strasbourg, France) for pSG5-TIF2; and Dr. S. Hsu
(National University of Singapore, Republic of Singapore) for SC510
monoclonal antibody.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: E. L. Yong, M.D., Ph.D., Department of Obstetrics and Gynecology, National University of Singapore, Lower Kent Ridge Road, Republic of Singapore 119074.
This work was supported by grants from the Fonds de la Recherche en
Santé du Québec (Hydro-Québec); Fonds pour la
Formulation de Chercheurs et lAide a la Recherche; and the Medical
Research Councils of Canada and Singapore.
1 Both authors contributed equally to this work. 
2 Current address: Medical Research Council Laboratory for Molecular
Biology, Cambridge, United Kingdom. 
Received for publication August 4, 1999.
Revision received April 10, 2000.
Accepted for publication April 18, 2000.
 |
REFERENCES
|
|---|
-
Yong EL, Ng SC, Roy AC, Yun G, Ratnam SS 1994 Pregnancy
after hormonal correction of severe spermatogenic defect due to
mutation in androgen receptor gene. Lancet 344:826827
-
Wang Q, Ghadessy FJ, Trounson A, Kretser D, McLachlan R, Ng
SC, Yong EL 1998 Azoospermia associated with a mutation in the
ligand-binding domain of an androgen receptor displaying normal ligand
binding, but defective transactivation. J Clin Endocrinol Metab 83:43034309[Abstract/Free Full Text]
-
Ghadessy FJ, Lim J, Abdullah AA, Panet-Raymond V, Choo CK,
Lumbroso R, Tut TG, Gottlieb B, Pinsky L, Trifiro MA, Yong EL 1999 Oligospermic infertility associated with an androgen receptor mutation
that disrupts interdomain and coactivator (TIF2) interactions. J
Clin Invest 103:15171525[Medline]
-
Quigley CA, De Bellis A, Marschke KB, El Awady MK, Wilson EM,
French FS 1995 Androgen receptor defects: historical, clinical and
molecular perspectives Endocr Rev 16:271321[Abstract/Free Full Text]
-
Langley E, Zhou ZX, Wilson EMJ 1995 Evidence for an
anti-parallel orientation of the ligand-activated human androgen
receptor dimer. J Biol Chem 270:2998329990[Abstract/Free Full Text]
-
Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann
AO 1998 Functional interactions of the AF-2 activation domain core
region of the human androgen receptor with the amino-terminal domain
and with the transcriptional coactivator TIF2 (transcriptional
intermediary factor 2). Mol Endocrinol 12:11721183[Abstract/Free Full Text]
-
Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160
coactivator-stimulated gene transcription. Mol Cell Biol 19:60856097[Abstract/Free Full Text]
-
Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D,
Gronemeyer H 1996 A canonical structure for the ligand-binding domain
of nuclear receptors. Nat Struct Biol 3:8794[CrossRef][Medline]
-
McKenna NJ, Lanz RB, OMalley BW 1999 Nuclear receptor
coregulators: cellular and molecular biology. Endocr Rev 20:321344[Abstract/Free Full Text]
-
Tanenbaum DM, Wang Y, Williams SP, Sigler PB 1998 Crystallographic comparison of the estrogen and progesterone
receptors ligand binding domains. Proc Natl Acad Sci USA 95:59986003[Abstract/Free Full Text]
-
Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA,
Greene GL 1998 The structural basis of estrogen receptor/coactivator
recognition and the antagonism of this interaction by tamoxifen. Cell 95:927937[CrossRef][Medline]
-
Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa
R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding
and co-activator assembly of the peroxisome proliferator-activated
receptor-
. Nature 395:137143[CrossRef][Medline]
-
Ana M Jiménez-Lara, Ana Aranda 1999 Lysine 246 of the
vitamin D receptor is crucial for ligand-dependent interaction with
coactivators and transcriptional activity. J Biol Chem 274:1350313510[Abstract/Free Full Text]
-
Mak HY, Hoare S, Henttu PM, Parker MG 1999 Molecular
determinants of the estrogen receptor-coactivator interface. Mol Cell
Biol 19:38953903[Abstract/Free Full Text]
-
Tagami T, Gu WX, Peairs PT, West BL, Jameson JL 1998 A novel
natural mutation in the thyroid hormone receptor defines a dual
functional domain that exchanges nuclear receptor corepressors and
coactivators. Mol Endocrinol 12:18881902[Abstract/Free Full Text]
-
Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO,
Trapman J 1996 Two androgen response regions cooperate in steroid
hormone regulated activity of the prostate-specific antigen promoter.
J Biol Chem 271:63796388[Abstract/Free Full Text]
-
Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW,
Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo
interaction between the amino-terminal, transactivation domain and the
ligand binding domain of the androgen receptor. Biochemistry 36:10521064[CrossRef][Medline]
-
Ikonen T, Palvimo JJ, Janne OAJ 1997 Interaction between the
amino- and carboxyl-terminal regions of the rat androgen receptor
modulates transcriptional activity and is influenced by nuclear
receptor coactivators. J Biol Chem 272:2982129828[Abstract/Free Full Text]
-
Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ,
Edwards DP, OMalley BW 1998 The steroid receptor coactivator-1
contains multiple receptor interacting and activation domains that
cooperatively enhance the activation function 1 (AF1) and AF2 domains
of steroid receptors. J Biol Chem 273:1210112108[Abstract/Free Full Text]
-
McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones
A, Inostroza J, Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK,
Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity
in nuclear receptor transcriptional activation. Genes Dev 12:33573368[Abstract/Free Full Text]
-
Bevan CL, Hoare S, Claessens F, Heery DM, Parker MG 1999 The
AF1 and AF2 domains of the androgen receptor interact with distinct
regions of SRC1. Mol Cell Biol 19:83838392[Abstract/Free Full Text]
-
He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding
domain mediates interdomain communication with the NH(2)-terminal
domain. J Biol Chem 274:3721937225[Abstract/Free Full Text]
-
Collingwood TN, Rajanayagam O, Adams M, Wagner R, Cavailles V,
Kalkhoven E, Matthews C, Nystrom E, Stenlof K, Lindstedt G, Tisell L,
Fletterick RJ, Parker MG, Chatterjee VK 1997 A natural transactivation
mutation in the thyroid hormone ß receptor: impaired interaction with
putative transcriptional mediators. Proc Natl Acad Sci USA 94:248253[Abstract/Free Full Text]
-
Danielian PS, White R, Lees JA, Parker MG 1992 Identification
of a conserved region required for hormone dependent transcriptional
activation by steroid hormone receptors. EMBO J 11:10251033[Medline]
-
Wrenn CK, Katzenellenbogen BS 1993 Structure-function analysis
of the hormone binding domain of the human estrogen receptor by
region-specific mutagenesis and phenotypic screening in yeast. J
Biol Chem 268:2408924098[Abstract/Free Full Text]
-
Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW,
Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent
coactivator binding to a hydrophobic cleft on nuclear receptors.
Science 280:17471749[Abstract/Free Full Text]
-
Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom
O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular
basis of agonism and antagonism in the oestrogen receptor. Nature 389:753758[CrossRef][Medline]
-
Williams SP, Sigler PB 1998 Atomic structure of progesterone
complexed with its receptor. Nature 393:392396[CrossRef][Medline]
-
Gottlieb B, Lehvaslaiho H, Beitel LK, Lumbroso R, Pinsky L,
Trifiro M 1998 The androgen receptor gene mutations database. Nucleic
Acids Res 26: 234238
-
Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, OMalley BW 1998 Partial hormone resistance in mice with disruption of the steroid
receptor coactivator-1 (SRC-1) gene. Science 279:19221925[Abstract/Free Full Text]
-
Tetel MJ, Giangrande PH, Leonhardt SA, McDonnell DP, Edwards
DP 1999 Hormone-dependent interaction between the amino- and
carboxyl-terminal domains of progesterone receptor in vitro
and in vivo. Mol Endocrinol 13:910924[Abstract/Free Full Text]
-
Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding
motifs and mediates transactivation through CBP binding-dependent and
-independent pathways. EMBO J 17:507519[CrossRef][Medline]
-
Elo JP, Kvist L, Leinonen K, Isomaa V, Henttu P, Lukkarinen O,
Vihko P 1995 Mutated human androgen receptor gene detected in a
prostatic cancer patient is also activated by estradiol. J Clin
Endocrinol Metab 80:34943500[Abstract]
-
Yong EL, Chua KL, Yang M, Roy A, Ratnam SS 1994 Complete
androgen insensitivity due to a splice-site mutation in the androgen
receptor gene and genetic screening with single stranded conformation
polymorphism (SSCP). Fertil Steril 61:856862[Medline]
-
Yong EL, Tut TG, Ghadessy FJ, Prins G, Ratnam SS 1998 Partial
androgen insensitivity and correlations with the predicted three
dimensional structure of the androgen receptor ligand-binding domain.
Mol Cell Endocrinol 137:4150[CrossRef][Medline]
-
Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L, Yong EL 1997 Long
polyglutamine tracts in the androgen receptor are associated with
reduced trans-activation, impaired sperm production, and male
infertility. J Clin Endocrinol Metab 82:37773782[Abstract/Free Full Text]
-
Skolny DL, Beitel LK, Ginsberg J, Pekeles G, Arbour L, Pinsky
L, Trifiro MA 1999 Discordant measures of androgen binding kinetics in
two mutant receptors causing mild or partial androgen insensitivity
respectively. J Clin Endocrinol Metab 84:805810[Abstract/Free Full Text]
-
Lim J, Ghadessy FJ, Yong EL 1997 A novel splice site mutation
in the androgen receptor gene results in exon skipping and a
non-functional truncated protein. Mol Cell Endocrinol 131:205210[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. P. Steinkamp, O. A. O'Mahony, M. Brogley, H. Rehman, E. W. LaPensee, S. Dhanasekaran, M. D. Hofer, R. Kuefer, A. Chinnaiyan, M. A. Rubin, et al.
Treatment-Dependent Androgen Receptor Mutations in Prostate Cancer Exploit Multiple Mechanisms to Evade Therapy
Cancer Res.,
May 15, 2009;
69(10):
4434 - 4442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Liu, J. Li, P. Shen, B. Husna, E. S. Tai, and E. L. Yong
A Natural Polymorphism in Peroxisome Proliferator-Activated Receptor-{alpha} Hinge Region Attenuates Transcription due to Defective Release of Nuclear Receptor Corepressor from Chromatin
Mol. Endocrinol.,
May 1, 2008;
22(5):
1078 - 1092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Estebanez-Perpina, L. A. Arnold, P. Nguyen, E. D. Rodrigues, E. Mar, R. Bateman, P. Pallai, K. M. Shokat, J. D. Baxter, R. K. Guy, et al.
A surface on the androgen receptor that allosterically regulates coactivator binding
PNAS,
October 9, 2007;
104(41):
16074 - 16079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Jaaskelainen, A Deeb, J W Schwabe, N P Mongan, H Martin, and I A Hughes
Human androgen receptor gene ligand-binding-domain mutations leading to disrupted interaction between the N- and C-terminal domains.
J. Mol. Endocrinol.,
April 1, 2006;
36(2):
361 - 368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Igarashi-Migitaka, A. Takeshita, N. Koibuchi, S. Yamada, R. Ohtani-Kaneko, and K. Hirata
Differential expression of p160 steroid receptor coactivators in the rat testis and epididymis
Eur. J. Endocrinol.,
October 1, 2005;
153(4):
595 - 604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Burd, C. E. Petre, H. Moghadam, E. M. Wilson, and K. E. Knudsen
Cyclin D1 Binding to the Androgen Receptor (AR) NH2-Terminal Domain Inhibits Activation Function 2 Association and Reveals Dual Roles for AR Corepression
Mol. Endocrinol.,
March 1, 2005;
19(3):
607 - 620.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Umar, C. A. Berrevoets, N. M. Van, M. van Leeuwen, M. Verbiest, W. J. Kleijer, D. Dooijes, J. A. Grootegoed, S. L. S. Drop, and A. O. Brinkmann
Functional Analysis of a Novel Androgen Receptor Mutation, Q902K, in an Individual with Partial Androgen Insensitivity
J. Clin. Endocrinol. Metab.,
January 1, 2005;
90(1):
507 - 515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. A. Elhaji, J. Hui Wu, B. Gottlieb, L. K. Beitel, C. Alvarado, G. Batist, and M. A. Trifiro
An Examination of How Different Mutations at Arginine 855 of the Androgen Receptor Result in Different Androgen Insensitivity Phenotypes
Mol. Endocrinol.,
August 1, 2004;
18(8):
1876 - 1886.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Ghali, B. Gottlieb, R. Lumbroso, L. K. Beitel, Y. Elhaji, J. Wu, L. Pinsky, and M. A. Trifiro
The Use of Androgen Receptor Amino/Carboxyl-Terminal Interaction Assays to Investigate Androgen Receptor Gene Mutations in Subjects with Varying Degrees of Androgen Insensitivity
J. Clin. Endocrinol. Metab.,
May 1, 2003;
88(5):
2185 - 2193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Loy, K. S. Sim, and E. L. Yong
Filamin-A fragment localizes to the nucleus to regulate androgen receptor and coactivator functions
PNAS,
April 15, 2003;
100(8):
4562 - 4567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dejager, H. Bry-Gauillard, E. Bruckert, B. Eymard, F. Salachas, E. LeGuern, S. Tardieu, R. Chadarevian, P. Giral, and G. Turpin
A Comprehensive Endocrine Description of Kennedy's Disease Revealing Androgen Insensitivity Linked to CAG Repeat Length
J. Clin. Endocrinol. Metab.,
August 1, 2002;
87(8):
3893 - 3901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Holter, N. Kotaja, S. Makela, L. Strauss, S. Kietz, O. A. Janne, J.-A. Gustafsson, J. J. Palvimo, and E. Treuter
Inhibition of Androgen Receptor (AR) Function by the Reproductive Orphan Nuclear Receptor DAX-1
Mol. Endocrinol.,
March 1, 2002;
16(3):
515 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Yoshikawa, Y. Makino, K. Okamoto, C. Morimoto, I. Makino, and H. Tanaka
Distinct Interaction of Cortivazol with the Ligand Binding Domain Confers Glucocorticoid Receptor Specificity. CORTIVAZOL IS A SPECIFIC LIGAND FOR THE GLUCOCORTICOID RECEPTOR
J. Biol. Chem.,
February 8, 2002;
277(7):
5529 - 5540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.C. Ong, P.R. Kolatkar, and E.L. Yong
Androgen receptor mutations causing human androgen insensitivity syndromes show a key role of residue M807 in Helix 8-Helix 10 interactions and in receptor ligand-binding domain stability
Mol. Hum. Reprod.,
February 1, 2002;
8(2):
101 - 108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Thompson, F. Saatcioglu, O. A. Janne, and J. J. Palvimo
Disrupted Amino- and Carboxyl-Terminal Interactions of the Androgen Receptor Are Linked to Androgen Insensitivity
Mol. Endocrinol.,
June 1, 2001;
15(6):
923 - 935.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Wang, J. Lu, and E. L. Yong
Ligand- and Coactivator-mediated Transactivation Function (AF2) of the Androgen Receptor Ligand-binding Domain Is Inhibited by the Cognate Hinge Region
J. Biol. Chem.,
March 2, 2001;
276(10):
7493 - 7499.
[Abstract]
[Full Text]
[PDF]
|
 |
|