| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Cellular Biology (I.J.G.R., A.E.F.,
S.O., J.S.R.) Baylor College of Medicine Houston, Texas
77030
Department of Molecular and Cell Biology (G.L.F.)
University of California Berkeley Berkeley, California 94720
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The binding of FSH and LH to their cognate receptors leads to the
stimulation of adenylyl cyclase and the production of cAMP. A plethora
of studies have documented convincingly that cAMP mediates many
intracellular functions by activating cAMP-dependent protein kinase, A
kinase (11). The activated A kinase catalytic (C) subunit can
translocate to the nucleus and phosphorylate transcription factors,
such as the cAMP responsive element (CRE) binding protein CREB (12, 13, 14)
leading to increased expression of ovarian genes, such as aromatase
(13, 15) and inhibin 
(16). Recent studies indicate that
transcriptional activation of CREB is more complex since
phosphorylation of Ser133 is necessary but not sufficient for
activation of transcription (17, 18). Moreover, there are many genes
induced by FSH and LH in granulosa cells that do not contain CREs
within their proximal promoters and are induced by other transcription
factors and response elements (1, 10). Increasing evidence also
indicates that multiple cellular signaling cascades, in addition to A
kinase, coordinate cellular responses to trophic hormone stimulation of
G protein-coupled receptors (19, 20, 21, 22).
One gene that is transcriptionally regulated by FSH and A kinase in granulosa cells is an immediate-early kinase, known as serum- and glucocorticoid-inducible kinase (Sgk) (23, 24, 25). FSH-mediated transcription of this gene in granulosa cells is biphasic and regulated, in part, by Sp1/Sp3 but not CREB (23). The initial induction of Sgk is rapid and is associated with proliferative stages of granulosa cell function. At this time Sgk is localized to the nucleus (24, 25). The secondary increase in Sgk occurs as granulosa cells differentiate into luteal cells; in these cells Sgk is preferentially localized to the cytoplasm (24, 25). These observations have been made both in vivo as well as in primary granulosa cells in culture, thereby suggesting that Sgk can phosphorylate nuclear targets as well as cytoplasmic targets.
Interestingly, Sgk has recently been shown to have its highest homology
to protein kinase B (PKB)/(Akt) and to require phosphorylation (Thr
256) within its activation loop for activation (26). Upstream kinases
in the cascade leading to the phosphorylation of PKB (27) and Sgk (26)
include the dual functional phosphatidylinositol 3-kinase (PI3-K) (28)
and phosphoinositide-dependent kinase (PDK1) (28, 29). PKB, in turn, is
known to phosphorylate numerous proteins, among which are glycogen
synthase kinase-3 (GSK-3) (30) and the winged-helix family of
transcription factors known as Forkhead (FKHR) (31, 32, 33). This pathway
is stimulated by numerous growth factors including insulin and
insulin-like growth factor I (IGF-I) (34, 35) by activation of
monomeric Ras or ras-related proteins (36). Importantly, this
IGF-I/PKB/FKHR pathway has been conserved from Caenorhabditis.
elegans (characterized by various daf mutants) to
mammals (32, 33, 37, 38). Recently, additional links between G
protein-coupled receptors, cAMP, and PI3-K signaling pathways have been
observed (19, 21). The activation loop of A kinase, like that of PKB
and Sgk, has been shown to be a substrate for PDK1 (39). Conversely,
overexpression of A kinase has been shown to activate PKB by a
PI3-K-independent pathway (40) whereas TSH via cAMP (but not A kinase)
has been shown to stimulate phosphorylation of PKB/Akt in a thyroid
cell line (41). In some cells, Gß
activates PI3-K (19, 20, 21).
Based on these and other recent studies it now appears that cAMP may act at a specific molecular "switch board" to control diverse cellular signaling pathways in a cell- and tissue-specific manner. For example, FSH has been reported to activate p38 mitogen- activated protein kinase (p38MAPK) in granulosa cells via A kinase (42). In PC12 cells, cAMP has been shown to differentially alter the activity of two serine/threonine kinases, Raf-1 and B-Raf, by mechanisms that are dependent of A kinase activation of Rap1 (43, 44). Whereas cAMP exerts inhibitory effects on Raf-1, it stimulates B-Raf (43, 45, 46). In addition to A kinase, recent studies have identified a set of cAMP-regulated guanine nucleotide exchange factors (cAMP-GEFs) that includes cAMP-GEFI (also called Epac, exchange protein directly activated by cAMP) (47, 48) and cAMP-GEFII (48). cAMP-GEFI has been shown to regulate the activity of Rap1, and GTP-Rap1 can activate B-Raf kinase, leading to activation of the extracellular regulated kinase (ERK) pathway. These cAMP-GEFs, by virtue of their activation of Rap-1 (43, 44) and possibly other GTPases, are potential activators of PI3-K, a known target of Ras (36, 49). Thus, cAMP may regulate specific members of the PKB and MAPK pathways (ERK, p38MAPK, and JNK) by A kinase-independent as well as A kinase-dependent mechanisms.
Based on these observations, we hypothesized that changes in the
response of granulosa cells to FSH and LH during differentiation might
involve A kinase activation of target genes, such as Sgk and aromatase,
as well as the activation by cAMP (or Gß) of alternative cellular
signaling cascades that might impact Sgk. To explore these
possibilities, we have analyzed and compared the pattern of expression
and phosphorylation (activation) of Sgk, PKB, and p38MAPK in granulosa
cells cultured in the presence of a variety of agonists known to
stimulate A kinase (FSH/T, forskolin), C kinase [phorbol myristate
(PMA)], and PI3-K (IGF-I). We have also analyzed the effects of
selective antagonists of A kinase (H89), C kinase (GF109203X), PI-3K
(LY294002 and wortmannin), and MEK1 [the upstream regulator of
extracellular regulated kinases, ERK (PD98059) and p38
mitogen-activated kinase, p38MAPK (SB203580)] on the
expression, phosphorylation, and activity of PKB and Sgk. Lastly, we
analyzed the expression pattern of cAMP-GEFI and GEF-II, Rap-1 and
Rap-2, as well as three members of the Raf family of serine/threonine
kinases (Raf-1, B-Raf, and A-Raf) thought to be regulated by the
Rap-related GTPases. A schematic outline of the signaling pathways
analyzed in granulosa cells is summarized in Fig. 10.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
).
Nonphosphorylated PKB was present in granulosa cells at 0 h and
remained essentially constant during culture with FSH/T (Fig. 1A). In
these same samples, phospho-PKB was low/negligible in cells cultured
overnight in the absence of hormone. However, PKB was phosphorylated
within 0.5 h after the addition of FSH/T and by 1.5 h reached
a level 6-fold above that of nontreated cells. The amount of
phospho-PKB decreased 50% at 6 h but began to increase again at
12 h and reached it highest level (9-fold above baseline) at
48 h after addition of FSH/T. These results indicate that PKB is
constitutively expressed but rapidly phosphorylated in granulosa cells
by exposure to FSH/T. The FSH-mediated phosphorylation of PKB is
biphasic, a pattern previously observed for the induction of the
PKB-related kinase, Sgk (23, 24, 25) and reaches its highest level at
48 h when the granulosa cells have differentiated to the
preovulatory phenotype.
|
). However, forskolin did
stimulate the phosphorylation of PKB in a pattern similar to that of
FSH/T: a rapid 5.0-fold increase was observed at 1 h, followed by
a decline to baseline at 6 h with a secondary 6-fold increase
occurring progressively between 24–48 h. Collectively, these results
show that cAMP activates cellular signals leading to the
phosphorylation of PKB.
To determine whether the decrease in phosphorylation of PKB at 6 h
was due to phosphodiesterase (PDE) activity and consequent decreases in
intracellular cAMP, rolipram, a specific inhibitor of the PDE4 isoform
expressed in granulosa was used (47). Granulosa cells were cultured
overnight as described above, at which time rolipram was added to the
cultures for 1 h preceding the addition of forskolin. When
forskolin was added to the rolipram-pretreated cells, the temporal
pattern of PKB phosphorylation was altered (Fig. 1C). The marked 7-fold
increase in phospho-PKB at 1 h was followed by a gradual decrease
throughout the 48 h period (Fig. 1C). Thus, rolipram delayed but
did not completely prevent a decline in cellular levels of
phospho-PKB.
Multiple Pathways Regulate PKB Phosphorylation
IGF-I has been shown to enhance granulosa cell responses to FSH
(5, 6) and to promote cell survival in the ovary (50). Since PKB has
been shown to be a specific downstream target of IGF-I/insulin, we
sought to determine whether the phosphorylation of PKB by FSH/T was
related to or enhanced by the effects of IGF-I. Accordingly, granulosa
cells were cultured overnight in serum-free medium. At that time, the
selective inhibitor of A-kinase (H89; 10 µM), was added
to the granulosa cells (26, 41). After the 1-h pretreatment with
inhibitor, FSH/T, forskolin, or 8-bromo-cAMP was added to the cultures
for an additional 1 h of stimulation. Cell extracts were prepared
and analyzed by Western blotting. PKB was rapidly phosphorylated within
1 h of exposure to FSH/T, forskolin, as well as 8-bromo-cAMP (Fig. 2A). The rapid phosphorylation of PKB by
FSH/T, forskolin, and 8-bromo-cAMP was not inhibited by H89; rather H89
slightly enhanced the phosphorylation of PKB. Thus, PKB (ser473) is not
a direct substrate for A kinase in granulosa cells.
|
). Although the tyrosine kinase inhibitor AG18 has been shown to be a
potent inhibitor of FSH-regulated gene expression in granulosa cells
(51), this tyrphostin had no effect on FSH- or
forskolin-stimulated phosphorylation of PKB (data not shown).
In marked contrast, the C kinase activator PMA failed to stimulate the
phosphorylation of PKB, confirming previous results (Fig. 2A) (26).
Moreover, additional experiments showed that PMA completely blocked
FSH/T-mediated phosphorylation of PKB (Fig. 6). These results suggest
that activation of C kinase antagonizes cAMP-mediated phosphorylation
of PKB.
|
). Furthermore, the IGF-I-induced phosphorylation of PKB
was not affected by inhibitors of A kinase (H89) or ERK (PD98050) but
was blocked by the PI3-K inhibitors (LY294002 and wortmannin) and
reduced by the p38MAPK inhibitor (SB203580). The levels of PKB protein
remained essentially constant in granulosa cells exposed to the various
agonists and inhibitors (Fig. 2A). These results indicate that PKB is a
downstream target of both IGF-I and cAMP-regulated signaling cascades
that are independent of A kinase activation but require PI3-K.
To determine whether H89 was effectively blocking A kinase activity,
the phosphorylation of CREB and PKB was analyzed in additional cultures
(Fig. 2B). Granulosa cells were cultured in the presence of FSH/T for
10 min or 30 min with or without H89 (10 and 20 µM). As
shown, FSH/T stimulated an increase of approximately 7-fold in
phospho-CREB that was reduced in a dose-dependent manner by H89.
Conversely, phosphorylation of PKB by FSH/T increased progressively
with time and dose of H89. These data indicate that H89 reduces A
kinase phosphorylation of CREB but not that of PKB.
To directly measure the activity of PKB in granulosa cells, the
phosphorylation of endogenous GSK-3, as well as a synthetic substrate
(cross-tide), was analyzed (Fig. 2C). FSH/T and IGF-I stimulated
phosphorylation of endogenous GSK-3 in a biphasic pattern, similar to
that observed for PKB phosphorylation (Fig. 1A): GSK-3 (Ser21/9)
phosphorylation increased 48- and 74-fold at 0.5 h and 1 h,
respectively, declined at 6 h, and then increased to 96-fold by
48 h of stimulation with FSH/T. PMA alone did not stimulate GSK-3
phosphorylation but it did reduce the response of FSH/T by 50% (not
shown). For in vitro kinase assays, granulosa cells were
cultured overnight. At that time the cells were stimulated (1 h) with
FSH/T, IGF-I, or FSH/T after 1-h pretreatment with LY294002.
Cell extracts were prepared, after which PKB was immunoprecipitated and
its activity analyzed using a GSK-3 fusion protein as the substrate.
Phospho-GSK-3 (Ser21/9) was detected by immunoblotting. PKB
activity was low in cells cultured in the absence
of hormones but was stimulated 4.7-fold by FSH/T and 6.1-fold by IGF-I.
The PI3-K inhibitor LY294002 blocked FSH-mediated GSK-3
phosphorylation. Collectively, these results indicate that FSH/T- and
IGF-I-mediated, PI3-K-dependent phosphorylation of PKB is related to
increased enzymatic activity (Fig. 2C).
Regulation of PKB Phosphorylation Is Dependent on Granulosa Cell
Differentiation
We have previously shown that granulosa cell differentiation is
associated with changes in the activation of A kinase, its subcellular
localization, and its ability to induce target genes such as Sgk and
aromatase (25). Therefore, we sought in these experiments to determine
whether the ability of FSH/T, forskolin, and IGF-I to phosphorylate PKB
was also dependent on the stage of granulosa cell differentiation. For
these experiments, granulosa cells were cultured in the continuous
presence of FSH/T for either 24 h or 48 h. This regimen
stimulates granulosa differentiation and the expression of genes, such
as aromatase and LH receptor, that characterize the preovulatory
phenotype (1). At each time interval, either H89, LY294002, wortmannin,
PD98059, or SB203580 was added to the cultures for 1 h before
the preparation of the extracts. As shown in Fig. 3A, PKB was present in a phosphorylated
form at 24 h of culture with FSH/T, and its phosphorylation was
increased almost 2-fold by exposing cells to the A kinase inhibitor,
H89. PKB phosphorylation was blocked effectively by LY294002 or
wortmannin whereas PD98059 had no detectable effect and SB203580
reduced phosphorylation slightly. After 48 h of culture with
FSH/T, the phosphorylation of PKB was affected less by the inhibitors:
H89 failed to enhance PKB phosphorylation and the inhibitory
effects of LY294002 and wortmannin, as well as SB203580, were
diminished (Fig. 3A). Exposure of granulosa cells to the inhibitors
for 2–4 h was required to observe the enhancing effects of H89 and the
inhibitory effects of LY294002, wortmannin, and SB203580 (Fig. 3B).
Levels of phospho-PKB were also elevated in luteinized granulosa cells
in vitro and in functional corpora lutea of pregnant rats
(data not shown). Collectively, these results indicate that the
mechanisms controlling the high steady-state levels of phosphorylated
PKB are enhanced as the granulosa cells differentiate.
|
), shown in previous studies to be
phosphorylated Sgk (26, 52). The amount and phosphorylation of Sgk by
FSH/T and forskolin were reduced by H89 50% and 73%, respectively.
Surprisingly, LY294002 not only abolished the presence of
phosphorylated bands but also reduced the amount of Sgk protein.
Compared with LY294002, wortmannin was surprisingly ineffective as an
inhibitor of Sgk phosphorylation. SB203580 but not PD98059 also reduced
Sgk phosphorylation.
|
). In contrast, IGF-I alone increased the amount and
phosphorylation of Sgk 1.6-fold, an effect that was blocked by the
PI3-K inhibitors, LY294002 and wortmannin, and SB203580 (Fig. 4).
To examine the regulation of Sgk expression and phosphorylation during
differentiation, granulosa cells were cultured with FSH/T for 24–48 h.
During this period, Sgk protein and its phosphorylation increased in
granulosa cells as indicated by the presence of multiple bands (Fig. 5). However, the effects of specific
kinase inhibitors changed markedly. Unexpectedly, the amount of
phospho-Sgk was unaffected by the addition of H89 at 24 h of
culture with FSH/T, thereby suggesting an A kinase- independent pathway
was predominant. Sgk phosphorylation was reduced by exposing the cells
to LY294002 or wortmannin for 1 h, with LY294002 being slightly
more effective (Fig. 5). By 48 h of culture with FSH/T, the
inhibitors were either ineffective (H89) or had only a marginal effect
(LY294002 and wortmannin) on the phosphorylated state of Sgk.
Furthermore, we have shown that Sgk is expressed at elevated levels and
is highly phosphorylated in luteinized granulosa cells in
vitro and in vivo (23, 24). Collectively, these results
indicate that the mechanisms controlling the steady-state levels of
phosphorylated Sgk, as well as PKB, change as the cells differentiate
in the presence of FSH/T.
|
, A and B, respectively). However,
phosphorylation of these two kinases was either totally blocked (PKB)
or reduced (Sgk) when PMA was added to the cells in combination with
FSH/T. Inclusion of the C kinase inhibitor partially or completely
restored the FSH-induced phosphorylation of PKB and Sgk, respectively.
PMA (1 h exposure) also dramatically reduced PKB and Sgk
phosphorylation in cells cultured with FSH/T for 48 h (data not
shown).
In contrast, PMA exerted less of an effect on IGF-I-mediated
phosphorylation of PKB and Sgk (Fig. 6, A and B, respectively). Nor did
PMA markedly alter FSH-induced phosphorylation of CREB (data not
shown). These results indicate that the inhibitory effects of PMA on
FSH/T-mediated phosphorylation of PKB and Sgk are mediated by C kinase
and impact steps other than or in addition to A kinase. Since PMA did
not markedly alter the actions of IGF-I (Fig. 6) and does not alter
cAMP production in granulosa cells (8), PMA appears to block
FSH-mediated PKB phosphorylation at some step(s) upstream of PI3-K that
is distinct from the pathway by which IGF-I activates PI3-K.
FSH/T and IGF-I Act Synergistically to Enhance Phosphorylation of
PKB but Not Sgk
Since FSH/T and IGF have been shown to act synergistically
to regulate some aspects of granulosa cell function, additional
experiments were done to determine whether FSH/T and IGF-I might
synergize to enhance the phosphorylation of PKB and Sgk. Granulosa
cells were cultured overnight and then stimulated for 1 h with
either FSH/T, IGF-I, or the combination at the doses used in the
previous experiments. As shown in Fig. 7, PKB was phosphorylated by either FSH/T (taken as control; 1.0) or IGF-I
(1.7-fold), and total phosphorylation was enhanced (3.8-fold) by
costimulation with FSH/T and IGF-I. As in previous experiments, PKB
phosphorylation induced by these agonists was blocked by a 1-h
pretreatment of cells with the PI3-K and p38MAPK inhibitors, LY294002
and SB203580, respectively. In contrast, Sgk is selectively induced and
phosphorylated by FSH/T (9.4-fold) compared with IGF-I (3.9-fold).
Although Sgk was phosphorylated by each agonist and was inhibited by
LY294002, no apparent synergy was observed when cells were exposed to
both FSH/T and IGF-I (8.7-fold vs. 9.4-fold with FSH/T
alone). Collectively, these results indicate that the mechanisms by
which cAMP and IGF act to phosphorylate PKB and Sgk involve similar
(PI3-K) but also distinct pathways, one of which may be p38MAPK.
|
, FSH/T stimulated a rapid
approximately 2-fold increase in the phosphorylation of p38MAPK at
1 h. The A kinase inhibitor H89 did not block this
phosphorylation. Rather H89, LY294002, wortmannin, and PD98059 enhanced
FSH/T- stimulated phosphorylation of p38MAPK by another 2-fold.
However, the p38MAPK- selective inhibitor SB203580 did block
FSH/T-mediated phosphorylation of p38MAPK. Although the exact mechanism
by which SB230580 blocks phosphorylation of p38MAPK is not known,
the inhibitor may bind to the enzyme in such a way to mask a critical
phosphorylation site (thereby inhibiting activation) or alter the
conformation of the kinase preventing its phosphorylation and
activation. Levels of nonphosphorylated p38MAPK remained constant in
all treatment groups (Figs. 8). Collectively, these results indicate
that the phosphorylation of p38MAPK is complex and is not mediated by
the same mechanisms controlling the phosphorylation of PKB and Sgk.
|
, A and B)
or in rats stimulated with gonadotropins in vivo (data not
shown). RT-PCR analyses were also done to document that the GTPase
Rap1b is expressed, but not regulated, by hormones in granulosa cells
(Fig. 9D). Western blot analyses (Fig. 9C) also confirmed the presence
and constitutive expression of Rap1a/b as well as Rap2 in granulosa
cells cultured with FSH/T for 0–48 h. In addition, potential
downstream targets of Rap proteins were also expressed. The
serine/threonine kinases Raf-1 and Raf-B appeared to be constitutively
expressed in granulosa cells. Raf-A was low in unstimulated cells but
was increased by FSH/T at 1, 6, and 48 h (Fig. 9C). In addition,
the multiple immunoreactive Raf-A bands indicate that Raf-A may also be
phosphorylated in these cells by FSH/T. Although p27-Ki-Ras is
expressed in granulosa cells (as shown by pan-Ras antibody), there is
yet no evidence that it is a target for cAMP-GEFs. Based on the
presence of these cellular signaling molecules in granulosa cells, it
is possible that FSH and cAMP-stimulated phosphorylation of PKB, Sgk,
or p38MAPK involves cAMP activation of specific cAMP-GEFs, Rap1 (or a
related GTPases) followed by the activation of PI3-K or specific Raf
kinases.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
).
|
(59, 60). Phosphorylation of these proteins by PKB
renders them inactive (59). One isoform of PKB, PKBß/Akt2, has been
shown to be amplified in ovarian carcinomas (61). In contrast,
expression of Sgk is hormonally regulated rather than constitutive and
its transcription is controlled by numerous hormones (62, 63, 64, 65),
including FSH/cAMP (23, 24). With the exception of an epithelial sodium
channel (64, 65), functional targets of Sgk action remain largely
unknown. Based on the preferred consensus substrate for each kinase
[PKB: RNRNN (S/T) and Sgk: KKRNRRLS] (26, 33), it is likely that they
phosphorylate different substrates and thereby control distinct
cellular functions, some of which, based on their coordinated
activation by PI3-K/PDK1, may be synergistic. Sgk may be one of the
missing links by which PI3-K mediates the expression of
phosphoenolpyruvate carboxykinase (PEPCK) (66, 67). In the rat ovary, PKB is constitutively expressed in granulosa cells and luteal cells. Most striking is the rapid phosphorylation (and activation) of PKB in granulosa cells in response to FSH/T (forskolin and 8-bromo-cAMP), which mimics the response stimulated by IGF-I. Furthermore, the pathways by which FSH and IGF-I stimulate PKB phosphorylation appear to involve similar intermediary steps. Specifically, the A kinase inhibitor H89 does not block phosphorylation of PKB by FSH/cAMP, indicating that it occurs by mechanisms independent of A kinase. Cass and colleagues (41, 58) have made similar observations; TSH and cAMP stimulate PKB phosphorylation in a thyroid cell line that is independent of A kinase. Rather, rapid phosphorylation of PKB by either FSH or IGF-I was blocked by the PI3-K inhibitors, LY294002 and wortmannin, and to a lesser extent by the p38MAPK inhibitor, SB203580. Thus, FSH, forskolin, and 8-bromo-cAMP can be added to the growing list of stimuli known to rapidly phosphorylate and thereby activate PKB. Moreover, FSH/cAMP and IGF-I acted synergistically to enhance PKB phosphorylation, indicating that signals activated by FSH (cAMP) impact the same or a similar signaling cascade and target the same substrates (i.e. GSK-3) as IGF-I. This synergism between cAMP and IGF-I on PKB phosphorylation may be one crucial mechanism by which these pathways enhance expression of genes such as aromatase and the LH receptor. The ability of PMA to prevent FSH-stimulated (but not IGF-I stimulated) phosphorylation of PKB indicates that activation of C kinase antagonizes the steps(s) by which FSH mediates activation of PI3-kinase or PDK1. Moreover, these steps (Ras-like related proteins?) controlled by FSH are distinct from those activated by the IGF-I pathway.
FSH/cAMP-mediated phosphorylation of PKB and GSK-3 is biphasic: PKB phosphorylation increases rapidly within 0.5 to 1 h, declines at 6 h, and exhibits a secondary, progressive increase from 12–48 h, a pattern similar to the induction of Sgk (23, 24, 25). These results indicate that as granulosa cells differentiate in response to FSH/T or forskolin, the phosphorylation of PKB is increased. Unexpectedly, the ability of PI3-K and p38MAPK inhibitors to block or reduce PKB phosphorylation was diminished as granulosa cells differentiate. Thus, although LY294002 and wortmannin completely blocked PKB phosphorylation if added from 23–24 h of culture, this response was greatly diminished if the inhibitors were added from 47–48 h. By 48 h of culture with FSH/T, PKB phosphorylation was only partially reduced by the addition of LY294002 or wortmannin for 1 h, whereas longer exposure (2 h and 4 h) did reduce PKB phosphorylation. These results clearly show that a pathway distinct from that of A kinase is involved in PKB phosphorylation by FSH/T and forskolin in granulosa cells. These results also indicate that as granulosa cells differentiate, intracellular mechanisms favoring high steady-state levels of PKB phosphorylation are established. What these mechanisms are remain highly speculative. Since the phosphorylation of Sgk as well as PKB is increased as the cells differentiate, perhaps the most likely explanation for the loss of sensitivity to the kinase inhibitors is that the content or activity of an endogenous phosphatase is greatly decreased. Therefore, the turnover of phosphate would be less. Alternatively, there may be decreased activity of the lipid phosphatase PTEN (phosphatase and tensin homolog deleted on chromosome 10), which regulates the levels of activating phosphoinositides (68, 69), or in the differentiated cells the phosphorylation of PKB and Sgk may be regulated by activation of other kinases that are less sensitive to LY294002 and wortmannin. If one role of activated PKB is to favor cell survival and prevent apoptosis, the elevated levels of phospho-PKB in the differentiated granulosa cells at 48 h may play a role in maintaining and establishing the stable phenotype of luteal cells.
More complex is the manner by which FSH/T and forskolin regulate the expression and phosphorylation of Sgk, a PKB-related kinase. We have shown herein and elsewhere (23, 24, 25) that FSH/T and forskolin induce Sgk in a biphasic manner. Based on transfection studies and analyses of mRNA, the rapid effects of FSH and forskolin appear to be mediated primarily at the transcriptional level and involve the transcription factors Sp1/Sp3 (23). The studies herein confirm that the rapid increase in Sgk protein occurs primarily by an A kinase-dependent (H89 inhibited) mechanism: neither IGF-I nor PMA caused major increases in Sgk protein. However, A kinase is not the only factor involved in mediating the rapid phosphorylation of Sgk that occurs in response to FSH/T and forskolin. The PI3-K inhibitors LY294002 and wortmannin, as well as the p38MAPK inhibitor SB203580, reduced the levels of phosphorylated Sgk at 1 h. Although IGF-I did not increase the levels of Sgk protein, this growth factor did stimulate Sgk phosphorylation by mechanisms that were sensitive to inhibitors of PI3-K and p38MAPK. The marked inhibitory effect of LY294002 compared with wortmannin on FSH- and forskolin-mediated induction and phosphorylation of Sgk suggests that LY294002 is more effective in blocking a specific isoform of PI3-K or another kinase that is critical for the phosphorylation of Sgk. Of note, the Sgk antibody is not a phospho-specific antibody. Therefore, multiple bands observed by Western blot likely reflect phosphorylation at multiple sites by multiple kinases. Furthermore, the loss of Sgk protein in response to LY294002, as well as p38MAPK inhibitor SB203580, suggests that phosphorylated forms of Sgk may be more stable than nonphosphorylated Sgk. By preventing phosphorylation, LY294002 and SB203580 allow increased degradation of Sgk protein. In this regard, it is of interest that both the amount, as well as the phosphorylation, of Sgk increase markedly in granulosa cells cultured in the presence of FSH/T for 24–48 h. At 24 h, Sgk phosphorylation was no longer inhibited by H89 or SB203580; by 48 h Sgk phosphorylation was much less sensitive to the inhibitor effects of LY294002 and wortmannin. These results indicate that the steady-state levels of Sgk and phospho-Sgk were enhanced as the cells differentiated. Thus, Sgk appears to act in concert with PKB to maintain expression of genes (aromatase and LH receptor?) and to establish the stable luteal cell phenotype.
The mechanisms that control the phosphorylation of p38MAPK by FSH and forskolin are distinct from those regulating phosphorylation of PKB and Sgk. Based on results presented herein and published recently by others, both positive (Ras-Raf-mediated and A-kinase) and negative (A-kinase and PI3-K-mediated) regulatory mechanisms appear to be involved (42, 70, 71). Specifically, FSH-mediated phosphorylation of p38MAPK has been reported to be dependent on A-kinase (H89-sensitive) (42). In contrast, we observed that inhibition of A kinase (H89), as well as PI3-K (LY294002), enhanced FSH- as well as IGF-I-mediated phosphorylation of p38MAPK. Although these two studies have used similar granulosa cell culture models and doses of hormone, Maizels et al. (42) analyzed p38MAPK phosphorylation at 10 min after addition of hormone rather than at 1 h as described herein. One explanation to account for these different observations is that there is a rapid but narrow time interval during which p38MAPK phosphorylation is A kinase dependent [10 min in the study by Maizels et al. (42)]. After this critical interval, there appear to be other mechanisms (both positive and negative) by which cAMP regulates the phosphorylation of p38MAPK, and these appear to be similar to those by which IGF-I mediates p38MAPK phosphorylation. Positive regulation of p38MAPK by IGF is mediated indirectly by activation of specific Ras-Raf proteins (70). Negative regulation of MAPK (and therefore possibly p38MAPK) by IGF-I is mediated by activation of PI3-K and PKB, the latter of which phosphorylates and inactivates Raf as indicated by recent genetic approaches (71, 72). Thus the balance and interaction of p38MAPK and PKB may be critical for altering cell function since p38MAPK also impacts phosphorylation of PKB. We show herein that granulosa cells and luteal cells express the Ras-related proteins Ki-Ras, confirming results of others (73) as well as Rap1 and Rap2 (74). Granulosa cells also express several members of the Raf family of serine kinases: Raf-1, A-Raf , and B-Raf providing several downstream targets for Ras-like proteins. In addition, granulosa cells express the guanine nucleotide exchange factors, cAMP-GEFI (also known as Epac) and cAMP-GEFII. Thus, it is highly likely that in granulosa cells FSH via cAMP activates p38MAPK by a cascade involving cAMP-GEFs, specific GTPases (most likely Rap1), and one or more of the serine/threonine kinases [most likely B-Raf (43, 46)] or another related protein. Since FSH/T and forskolin can also phosphorylate and activate PKB, FSH/T (cAMP) likely exerts its inhibitory effects on p38MAPK by activating PKB, as has been documented for IGF-I (71, 72). Alternatively, the negative effects of FSH may be mediated by selective activation of Raf-1 (44).
In summary, we provide several lines of evidence that FSH impacts
different cellular signaling cascades in granulosa cells that lead to
the phosphorylation of diverse kinases: PKB, Sgk, and p38MAPK (Fig. 10). 1) FSH via cAMP (but not A kinase) activates the PI3-K pathway
leading to the phosphorylation of PKB. This effect of FSH mimics and
enhances IGF-I-mediated phosphorylation of PKB. FSH/cAMP activation of
PI3-K likely involves a specific Ras or Ras-related protein such as the
cAMP-GEFs since the effects of FSH [like TSH (41)] were mimicked by
forskolin and 8-bromo-cAMP. However, we cannot entirely rule out the
possibility that FSH also activates Gß that can activate PI3-K,
a specific isoform of PI3-K. PMA (C kinase) blocks FSH- but not
IGF-I-mediated phosphorylation of PKB, indicating that FSH and IGF-I
enter the PI3-K pathway by different steps. 2) FSH/cAMP acts via A
kinase to induce expression of Sgk. Sgk is then phosphorylated and
activated by A kinase and PI3-K pathways. 3) FSH via a putative
cAMP-GEF/ras/raf pathway leads to the phosphorylation of p38MAPK,
whereas both A-kinase and PI3-K/PKB inhibit this cAMP-GEF/ras/raf
pathway. Based on the absence of an effect of the MEK1 inhibitor
(PD98059) on the phosphorylation of PKB, Sgk, and p38MAPK, the ERK
pathway has been omitted from the diagram.
Since IGF-I alone can phosphorylate PKB but is less effective in stimulating granulosa cell differentiation, the transcriptional activation of specific genes in granulosa cells appears to require hormone/cAMP activation of A kinase and other signaling cascades. The PKB and Sgk pathways appear to be enhanced in terminally differentiated granulosa cells, indicating that they act in concert as survival factors. Coincident with this, A kinase and PI3-K/PKB appear to exert negative feedback effects on the putative GEF/ras-rap/raf activation of p38MAPK. These results provide some of the first evidence in granulosa cells that FSH and cAMP act to coordinate diverse cellular signaling cascades that are independent of A kinase activation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
/ß
93313 were from New England Biolabs, Inc. (Beverly, MA).
Antibodies for Rap 1 (121:sc-65), Raf-1 (C-12; SC-133), Raf-B (C19;
SC-166) and Raf-A (C-20; SC-408), Ki-Ras (pan-ras; F132; SC-32), and
GSK-3 (SC-7879) were from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Antibodies for Rap2 (R 230200) were from
Transduction Laboratories, Inc. (Lexington, KY). Affinity-
purified Sgk antibody was generated in the laboratory of Dr. Gary
Firestone (Berkeley, CA). Inhibitor LY294002 (270–038-M005) was from
Alexis (San Diego, CA), and wortmannin (no. 681675), SB203580 (no.
559395), and H89 (no. 371963) were from Calbiochem (San
Diego, CA). PD98059 (no. 9900S) was from New England Biolabs, Inc. and GF109203X (no. G2911) was from Sigma.
TRIzol reagent (no. 15596) was obtained from Life Technologies, Inc. Electrophoresis and molecular biology grade reagents were
purchased from Sigma, Bio-Rad Laboratories, Inc. (Richmond, CA), and Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were purchased
from Genosys (The Woodlands, TX). All RT-PCR reagents were from
Promega Corp. (Madison, WI) except for
deoxyribonucleotides (dNTPs; Roche Molecular Biochemicals). -32P[dCTP] was from
ICN Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL).
Animals
Intact immature (day 23 of age) Holtzman Sprague Dawley
female rats (Harlan Sprague Dawley, Inc., Indianapolis,
IN) were housed under a 16-h light, 8-h dark schedule in the Center for
Comparative Medicine at Baylor College of Medicine and provided food
and water ad libitum. Animals were treated in accordance
with the NIH Guide for the Care and Use of Laboratory Animals, as
approved by the Animal Care and Use Committee at Baylor College of
Medicine (Houston, TX).
Granulosa Cell Cultures
Granulosa cells were harvested from untreated or E-primed
immature (day 25) rats as previously described (3, 4) and as indicated
in the Results and figure legends. Briefly, cells were
cultured at a density of 1 x 106 cells per
3 ml serum-free medium (DMEM:F12 containing Penicillin and
Streptomycin) in multiwell (35-mm) dishes that were serum coated (4).
Cells were cultured in defined medium overnight (0 h) followed by the
addition of FSH (50 ng/ml) and T (10 ng/ml), forskolin (10
µM), and other agonists/inhibitors as indicated
in the figures and figure legends. FSH/T were used to stimulate the
differentiation including the induction of aromatase (4), LH receptor
(9), and inhibin (14). Forskolin and 8-bromo-cAMP alone were used to
determine the relative effects of cAMP on specific cell functions.
RNA Isolation and RT-PCR Assays
Total RNA was isolated from cultured cells with Trizol according
to specifications provided by the manufacturer. Each RNA sample was
pooled from three replicate wells. The RNA was purified by sequential
phenol, phenol-chloroform, and chloroform extraction, followed by
ethanol precipitation. The RNA was resuspended in 0.1%
diethylpyrocarbamate-treated water and its concentration determined by
absorbance at 260 nm.
Based on the known sequences for cAMP-GEFI [Genbank accession no. U78167 (47, 48)], cAMP-GEFII [Genbank accession nono..U78517 (48)], and Rap1b (Genbank accession no. U07795), oligonucleotide primer pairs were designed and used in the RT-PCR reactions according to procedures described previously (51). After the RT step that contained 500 ng input RNA, the reaction mixture was split into separate aliquots to which specific primer pairs for cAMP-GEFI (forward, 5'-TGGTGCTGAAGAGAATGCAC-3' and reverse 5'-CCTGGAAGGTCCAGTCATGT-3', cAMP-GEFII (forward, 5'-AGGTGCTTTTGCAGCAGTTT-3' and reverse, 5'-GGTACGCCAAGTCTTTCGAG3') Rap1b (forward, TTATAGAAAGCAAGTTGAAGT and reverse, CACTAGGTCATAAAAGATCTCG) or the ribosomal protein L19 (75) were added for 30 cycles using standard temperatures and times that gave a linear increase of DNA product to input RNA from 300 to 1500 ng (data not shown). The amplified cDNA products for cAMP-GEFI (399 bp), GEFII (404 bp), Rap1b (370 bp), and L19 (196 bp) were resolved by acrylamide gel electrophoresis, and radioactive PCR product bands were quantified by phosphoimage analysis (Betascope 603 Blot Analyzer; Betagen Corp., Mountain View, CA). Separate reactions were done for L19 since generation of the L19 product interfered with the amplification of cAMP-GEFI and cAMP-GEFII. Data are presented as the ratio of radioactivity in the GEFI/GEFII lanes relative to L19 bands.
Cell Extracts and Western Blot Analyses
Total cell extracts were prepared according to a method of Ginty
(76) by adding to each well hot (100 C) Tris-buffer containing 10% SDS
and ß-mercaptoethanol. The cells were rapidly scraped with a rubber
policeman and the extract transferred to an Eppendorf tube
(Madison, WI) at 100 C for 5 min. Extracts were stored at 4 C until
analyzed by SDS-PAGE). After SDS-PAGE, samples were electrophoretically
transferred to nylon filter, washed briefly in PBS, and blotted with
either 3% BSA or 5% Carnation milk at room temperature for 1 h.
Antibodies were added in the same blocking solutions at the dilutions
indicated in the figure legends. Immunoreactive proteins were
visualized with enhanced chemiluminescence (ECL) according to the
specification of the supplier (Pierce Chemical Co.,
Rockford, IL). Immunoreactive bands were quantified by image analysis
of autoradiograms (ECL) using AlphaImager 2000 (3.3), (Alpha Innotech
Corp., San Leandro, CA).
PKB Enzyme Activity
To measure the enzymatic activity of PKB, granulosa cells were
cultured as in previous experiments. Cells were lysed, extracts were
prepared, and the activity of PKB/Akt was measured using the Akt kinase
assay kit (New England Biolabs, Inc.). Briefly, PKB was
immunoprecipitated (IP) using an anti-PKB antibody cross-linked to
agarose hydrazide beads. After IP, the beads were washed and incubated
with a kinase reaction mixture containing GSK-3/ß cross-tide
fusion protein and ATP. Phosphorylated GSK-3/ß was analyzed by
SDS-PAGE and immunodetection with a specific anti-phospho (ser21/9)
GSK-3/ß antibody.
|
FOOTNOTES |
|---|
These studies were supported in part by NIH Grants HD-16272 and 16229 (J.S.R.) and CA-71514 (G.L.F.).
Received for publication December 20, 1999. Revision received April 6, 2000. Accepted for publication April 27, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
by direct
interaction with two domains of the catalytic p110 subunit. J Biol
Chem 273:7024–7029o with Rap1
GTPase-activating protein. J Biol Chem 274:21507–21510This article has been cited by other articles:
 |
|
 |
|
  Z. Liu, M. D. Rudd, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, H.-Y. Fan, A. J. Zeleznik, and J. S. Richards FSH and FOXO1 Regulate Genes in the Sterol/Steroid and Lipid Biosynthetic Pathways in Granulosa Cells Mol. Endocrinol., May 1, 2009; 23(5): 649 - 661. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. F. Ackermann, K. M. Boini, H. Volkl, M. Bhandaru, P. M. Bareiss, L. Just, V. Vallon, K. Amann, D. Kuhl, Y. Feng, et al. SGK1-sensitive renal tubular glucose reabsorption in diabetes Am J Physiol Renal Physiol, April 1, 2009; 296(4): F859 - F866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Choi, C.-L. Chen, S. L. Poon, H.-S. Wang, and P. C K Leung Gonadotropin-stimulated epidermal growth factor receptor expression in human ovarian surface epithelial cells: involvement of cyclic AMP-dependent exchange protein activated by cAMP pathway Endocr. Relat. Cancer, March 1, 2009; 16(1): 179 - 188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Peralta, M. C. Romano, and P. N. Velazquez Signaling pathways involved in the effect of follicle-stimulating hormone on chick embryo testis cell proliferation Poult. Sci., February 1, 2009; 88(2): 380 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Alam, J. Weck, E. Maizels, Y. Park, E. J. Lee, M. Ashcroft, and M. Hunzicker-Dunn Role of the Phosphatidylinositol-3-Kinase and Extracellular Regulated Kinase Pathways in the Induction of Hypoxia-Inducible Factor (HIF)-1 Activity and the HIF-1 Target Vascular Endothelial Growth Factor in Ovarian Granulosa Cells in Response to Follicle-Stimulating Hormone Endocrinology, February 1, 2009; 150(2): 915 - 928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Deepa and L. Q. Dong APPL1: role in adiponectin signaling and beyond Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E22 - E36. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sen, L. Lv, N. Bello, J. J. Ireland, and G. W. Smith Cocaine- and Amphetamine-Regulated Transcript Accelerates Termination of Follicle-Stimulating Hormone-Induced Extracellularly Regulated Kinase 1/2 and Akt Activation by Regulating the Expression and Degradation of Specific Mitogen-Activated Protein Kinase Phosphatases in Bovine Granulosa Cells Mol. Endocrinol., December 1, 2008; 22(12): 2655 - 2676. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-N. Lague, M. Paquet, H.-Y. Fan, M. J. Kaartinen, S. Chu, S. P. Jamin, R. R. Behringer, P. J. Fuller, A. Mitchell, M. Dore, et al. Synergistic effects of Pten loss and WNT/CTNNB1 signaling pathway activation in ovarian granulosa cell tumor development and progression Carcinogenesis, November 1, 2008; 29(11): 2062 - 2072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sheng, T. Sun, B. Cong, P. He, Y. Zhang, J. Yan, C. Lu, and X. Ni Corticotropin-releasing hormone stimulates SGK-1 kinase expression in cultured hippocampal neurons via CRH-R1 Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E938 - E946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-Y. Fan, Z. Liu, N. Cahill, and J. S. Richards Targeted Disruption of Pten in Ovarian Granulosa Cells Enhances Ovulation and Extends the Life Span of Luteal Cells Mol. Endocrinol., September 1, 2008; 22(9): 2128 - 2140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hong, L. Lou, S. Gupta, F. Ribeiro-Neto, and D. L. Altschuler A Novel Epac-Rap-PP2A Signaling Module Controls cAMP-dependent Akt Regulation J. Biol. Chem., August 22, 2008; 283(34): 23129 - 23138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Escamilla-Hernandez, L. Little-Ihrig, K. E. Orwig, J. Yue, U. Chandran, and A. J. Zeleznik Constitutively Active Protein Kinase A Qualitatively Mimics the Effects of Follicle-Stimulating Hormone on Granulosa Cell Differentiation Mol. Endocrinol., August 1, 2008; 22(8): 1842 - 1852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-Y. Fan, M. Shimada, Z. Liu, N. Cahill, N. Noma, Y. Wu, J. Gossen, and J. S. Richards Selective expression of KrasG12D in granulosa cells of the mouse ovary causes defects in follicle development and ovulation Development, June 15, 2008; 135(12): 2127 - 2137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Uribe, T. Zarinan, M. A. Perez-Solis, R. Gutierrez-Sagal, E. Jardon-Valadez, A. Pineiro, J. A. Dias, and A. Ulloa-Aguirre Functional and Structural Roles of Conserved Cysteine Residues in the Carboxyl-Terminal Domain of the Follicle-Stimulating Hormone Receptor in Human Embryonic Kidney 293 Cells Biol Reprod, May 1, 2008; 78(5): 869 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Looyenga and G. D. Hammer Genetic Removal of Smad3 from Inhibin-Null Mice Attenuates Tumor Progression by Uncoupling Extracellular Mitogenic Signals from the Cell Cycle Machinery Mol. Endocrinol., October 1, 2007; 21(10): 2440 - 2457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Wayne, H.-Y. Fan, X. Cheng, and J. S. Richards Follicle-Stimulating Hormone Induces Multiple Signaling Cascades: Evidence that Activation of Rous Sarcoma Oncogene, RAS, and the Epidermal Growth Factor Receptor Are Critical for Granulosa Cell Differentiation Mol. Endocrinol., August 1, 2007; 21(8): 1940 - 1957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Needle, K. Piparo, D. Cole, C. Worrall, I. Whitehead, G. Mahon, and L. T. Goldsmith Protein Kinase A-Independent cAMP Stimulation of Progesterone in a Luteal Cell Model Is Tyrosine Kinase Dependent but Phosphatidylinositol-3-Kinase and Mitogen-Activated Protein Kinase Independent Biol Reprod, July 1, 2007; 77(1): 147 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D Rudd, I. Gonzalez-Robayna, I. Hernandez-Gonzalez, N. L Weigel, W. E Bingman III, and J. S Richards Constitutively active FOXO1a and a DNA-binding domain mutant exhibit distinct co-regulatory functions to enhance progesterone receptor A activity J. Mol. Endocrinol., June 1, 2007; 38(6): 673 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Choi, A. S. T. Wong, H.-F. Huang, and P. C. K. Leung Gonadotropins and Ovarian Cancer Endocr. Rev., June 1, 2007; 28(4): 440 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Neganova, H. Al-Qassab, H. Heffron, C. Selman, A. I. Choudhury, S. J. Lingard, I. Diakonov, M. Patterson, M. Ghatei, S. R. Bloom, et al. Role of Central Nervous System and Ovarian Insulin Receptor Substrate 2 Signaling in Female Reproductive Function in the Mouse Biol Reprod, June 1, 2007; 76(6): 1045 - 1053. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kwintkiewicz, Z. Cai, and C. Stocco Follicle-Stimulating Hormone-Induced Activation of Gata4 Contributes in the Up-Regulation of Cyp19 Expression in Rat Granulosa Cells Mol. Endocrinol., April 1, 2007; 21(4): 933 - 947. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sasseville, N. Cote, C. Vigneault, C. Guillemette, and F. J. Richard 3'5'-Cyclic Adenosine Monophosphate-Dependent Up-Regulation of Phosphodiesterase Type 3A in Porcine Cumulus Cells Endocrinology, April 1, 2007; 148(4): 1858 - 1867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K E Ryan, S M Casey, M J Canty, M A Crowe, F Martin, and A C O Evans Akt and Erk signal transduction pathways are early markers of differentiation in dominant and subordinate ovarian follicles in cattle Reproduction, March 1, 2007; 133(3): 617 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Lu, A. Amleh, J. Sun, X. Jin, S. D. McCullough, R. Baer, D. Ren, R. Li, and Y. Hu Ubiquitination and Proteasome-Mediated Degradation of BRCA1 and BARD1 during Steroidogenesis in Human Ovarian Granulosa Cells Mol. Endocrinol., March 1, 2007; 21(3): 651 - 663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C.K. Leung and J.-H. Choi Endocrine signaling in ovarian surface epithelium and cancer Hum. Reprod. Update, March 1, 2007; 13(2): 143 - 162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-J. Chen, P.-W. Hsiao, M.-T. Lee, J I. Mason, F.-C. Ke, and J.-J. Hwang Interplay of PI3K and cAMP/PKA signaling, and rapamycin-hypersensitivity in TGF{beta}1 enhancement of FSH-stimulated steroidogenesis in rat ovarian granulosa cells J. Endocrinol., February 1, 2007; 192(2): 405 - 419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sayasith, K. A Brown, and J. Sirois Gonadotropin-dependent regulation of bovine pituitary adenylate cyclase-activating polypeptide in ovarian follicles prior to ovulation Reproduction, February 1, 2007; 133(2): 441 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J M Silva, M Hamel, M Sahmi, and C A Price Control of oestradiol secretion and of cytochrome P450 aromatase messenger ribonucleic acid accumulation by FSH involves different intracellular pathways in oestrogenic bovine granulosa cells in vitro. Reproduction, December 1, 2006; 132(6): 909 - 917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Sandu, F. Artunc, M. Palmada, R. Rexhepaj, F. Grahammer, A. Hussain, C. Yun, D. R. Alessi, and F. Lang Impaired intestinal NHE3 activity in the PDK1 hypomorphic mouse Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G868 - G876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol Rev, October 1, 2006; 86(4): 1151 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jo and T. E. Curry Jr. Luteinizing Hormone-Induced RUNX1 Regulates the Expression of Genes in Granulosa Cells of Rat Periovulatory Follicles Mol. Endocrinol., September 1, 2006; 20(9): 2156 - 2172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Lotfi, Z. Li, J. Sun, Y. Zuo, P. P. L. Lam, Y. Kang, M. Rahimi, D. Islam, P. Wang, H. Y. Gaisano, et al. Role of the Exchange Protein Directly Activated by Cyclic Adenosine 5'-Monophosphate (Epac) Pathway in Regulating Proglucagon Gene Expression in Intestinal Endocrine L Cells Endocrinology, August 1, 2006; 147(8): 3727 - 3736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sahmi, E. S Nicola, and C. A Price Hormonal regulation of cytochrome P450 aromatase mRNA stability in non-luteinizing bovine granulosa cells in vitro. J. Endocrinol., July 1, 2006; 190(1): 107 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Hernandez-Gonzalez, I. Gonzalez-Robayna, M. Shimada, C. M. Wayne, S. A. Ochsner, L. White, and J. S. Richards Gene Expression Profiles of Cumulus Cell Oocyte Complexes during Ovulation Reveal Cumulus Cells Express Neuronal and Immune-Related Genes: Does this Expand Their Role in the Ovulation Process? Mol. Endocrinol., June 1, 2006; 20(6): 1300 - 1321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shimada, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, and J. S. Richards Paracrine and Autocrine Regulation of Epidermal Growth Factor-Like Factors in Cumulus Oocyte Complexes and Granulosa Cells: Key Roles for Prostaglandin Synthase 2 and Progesterone Receptor Mol. Endocrinol., June 1, 2006; 20(6): 1352 - 1365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Grahammer, G. Henke, C. Sandu, R. Rexhepaj, A. Hussain, B. Friedrich, T. Risler, M. Metzger, L. Just, T. Skutella, et al. Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1 Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1114 - G1123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. N. Diouf, K. Sayasith, R. Lefebvre, D. W. Silversides, J. Sirois, and J. G. Lussier Expression of Phospholipase A2 Group IVA (PLA2G4A) Is Upregulated by Human Chorionic Gonadotropin in Bovine Granulosa Cells of Ovulatory Follicles Biol Reprod, June 1, 2006; 74(6): 1096 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Weck and K. E. Mayo Switching of NR5A Proteins Associated with the Inhibin {alpha}-Subunit Gene Promoter after Activation of the Gene in Granulosa Cells Mol. Endocrinol., May 1, 2006; 20(5): 1090 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. McDonald, A. C. Millena, S. Reddy, S. Finlay, J. Vizcarra, S. A. Khan, and J. S. Davis Follicle-Stimulating Hormone-Induced Aromatase in Immature Rat Sertoli Cells Requires an Active Phosphatidylinositol 3-Kinase Pathway and Is Inhibited via the Mitogen-Activated Protein Kinase Signaling Pathway Mol. Endocrinol., March 1, 2006; 20(3): 608 - 618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gambaryan, E. Butt, P. Tas, A. Smolenski, B. Allolio, and U. Walter Regulation of aldosterone production from zona glomerulosa cells by ANG II and cAMP: evidence for PKA-independent activation of CaMK by cAMP Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E423 - E433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, S. Asuri, J. F. Rebhun, A. F. Castro, N. C. Paranavitana, and L. A. Quilliam The RAP1 Guanine Nucleotide Exchange Factor Epac2 Couples Cyclic AMP and Ras Signals at the Plasma Membrane J. Biol. Chem., February 3, 2006; 281(5): 2506 - 2514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Moreau, P. Froment, L. Tosca, V. Moreau, and J. Dupont Expression and Regulation of the SCD2 Desaturase in the Rat Ovary Biol Reprod, January 1, 2006; 74(1): 75 - 87. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B.-e Xu, S. Stippec, A. Lazrak, C.-L. Huang, and M. H. Cobb WNK1 Activates SGK1 by a Phosphatidylinositol 3-Kinase-dependent and Non-catalytic Mechanism J. Biol. Chem., October 7, 2005; 280(40): 34218 - 34223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. X. Donadeu and M. Ascoli The Differential Effects of the Gonadotropin Receptors on Aromatase Expression in Primary Cultures of Immature Rat Granulosa Cells Are Highly Dependent on the Density of Receptors Expressed and the Activation of the Inositol Phosphate Cascade Endocrinology, September 1, 2005; 146(9): 3907 - 3916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Omori, K. Nakamura, S. Yamashita, H. Matsuda, T. Mizutani, K. Miyamoto, and T. Minegishi Effect of Follicle-Stimulating Hormone and Estrogen on the Expression of Betaglycan Messenger Ribonucleic Acid Levels in Cultured Rat Granulosa Cells Endocrinology, August 1, 2005; 146(8): 3379 - 3386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-Q. Yu, C.-S. Han, W. Yang, X. Jin, Z.-Y. Hu, and Y.-X. Liu Activation of the p38 MAPK pathway by follicle-stimulating hormone regulates steroidogenesis in granulosa cells differentially J. Endocrinol., July 1, 2005; 186(1): 85 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. H Walker and J. Cheng FSH and testosterone signaling in Sertoli cells Reproduction, July 1, 2005; 130(1): 15 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Ongeri, M. F. Verderame, and J. M. Hammond Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tajima, K. Yoshii, S. Fukuda, M. Orisaka, K. Miyamoto, A. Amsterdam, and F. Kotsuji Luteinizing Hormone-Induced Extracellular-Signal Regulated Kinase Activation Differently Modulates Progesterone and Androstenedione Production in Bovine Theca Cells Endocrinology, July 1, 2005; 146(7): 2903 - 2910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Simard, M.-L. Ricketts, S. Gingras, P. Soucy, F. A. Feltus, and M. H. Melner Molecular Biology of the 3{beta}-Hydroxysteroid Dehydrogenase/{Delta}5-{Delta}4 Isomerase Gene Family Endocr. Rev., June 1, 2005; 26(4): 525 - 582. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gillio-Meina, Y. Y. Hui, and H. A. LaVoie Expression of CCAAT/Enhancer Binding Proteins Alpha and Beta in the Porcine Ovary and Regulation in Primary Cultures of Granulosa Cells Biol Reprod, May 1, 2005; 72(5): 1194 - 1204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, E. Teuling, Y. Lo, D. Boerboom, A. E. Falender, K. H. Doyle, R. G. LeBaron, V. Thompson, et al. Regulated Expression of ADAMTS Family Members in Follicles and Cumulus Oocyte Complexes: Evidence for Specific and Redundant Patterns During Ovulation Biol Reprod, May 1, 2005; 72(5): 1241 - 1255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Park, E. T. Maizels, Z. J. Feiger, H. Alam, C. A. Peters, T. K. Woodruff, T. G. Unterman, E. J. Lee, J. L. Jameson, and M. Hunzicker-Dunn Induction of Cyclin D2 in Rat Granulosa Cells Requires FSH-dependent Relief from FOXO1 Repression Coupled with Positive Signals from Smad J. Biol. Chem., March 11, 2005; 280(10): 9135 - 9148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Wood, V. L. Nelson-Degrave, E. Jansen, J. M. McAllister, S. Mosselman, and J. F. Strauss III Valproate-induced alterations in human theca cell gene expression: clues to the association between valproate use and metabolic side effects Physiol Genomics, February 10, 2005; 20(3): 233 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts, A. Iatropoulou, D. Ciantar, J. Stark, D. L. Becker, S. Franks, and K. Hardy Follicle-Stimulating Hormone Affects Metaphase I Chromosome Alignment and Increases Aneuploidy in Mouse Oocytes Matured in Vitro Biol Reprod, January 1, 2005; 72(1): 107 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E C Chin, T E Harris, and D R E Abayasekara Changes in cAMP-dependent protein kinase (PKA) and progesterone secretion in luteinizing human granulosa cells J. Endocrinol., October 1, 2004; 183(1): 39 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E C Chin and D R E Abayasekara Progesterone secretion by luteinizing human granulosa cells: a possible cAMP-dependent but PKA-independent mechanism involved in its regulation J. Endocrinol., October 1, 2004; 183(1): 51 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1 Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Nechamen, R. M. Thomas, B. D. Cohen, G. Acevedo, P. I. Poulikakos, J. R. Testa, and J. A. Dias Human Follicle-Stimulating Hormone (FSH) Receptor Interacts with the Adaptor Protein APPL1 in HEK 293 Cells: Potential Involvement of the PI3K Pathway in FSH Signaling Biol Reprod, August 1, 2004; 71(2): 629 - 636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Villa-Diaz and T. Miyano Activation of p38 MAPK During Porcine Oocyte Maturation Biol Reprod, August 1, 2004; 71(2): 691 - 696. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Cunningham, Q. Zhu, and J. M. Hammond FoxO1a Can Alter Cell Cycle Progression by Regulating the Nuclear Localization of p27kip in Granulosa Cells Mol. Endocrinol., July 1, 2004; 18(7): 1756 - 1767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Palmada, M. Dieter, A. Speil, C. Bohmer, A. F. Mack, H. J. Wagner, K. Klingel, R. Kandolf, H. Murer, J. Biber, et al. Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1 Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G143 - G150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sekar and J. D. Veldhuis Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells Am J Physiol Endocrinol Metab, July 1, 2004; 287(1): E128 - E135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts, J. Stark, A. Iatropoulou, D. L. Becker, S. Franks, and K. Hardy Energy Substrate Metabolism of Mouse Cumulus-Oocyte Complexes: Response to Follicle-Stimulating Hormone Is Mediated by the Phosphatidylinositol 3-Kinase Pathway and Is Associated with Oocyte Maturation Biol Reprod, July 1, 2004; 71(1): 199 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Alam, E. T. Maizels, Y. Park, S. Ghaey, Z. J. Feiger, N. S. Chandel, and M. Hunzicker-Dunn Follicle-stimulating Hormone Activation of Hypoxia-inducible Factor-1 by the Phosphatidylinositol 3-Kinase/AKT/Ras Homolog Enriched in Brain (Rheb)/Mammalian Target of Rapamycin (mTOR) Pathway Is Necessary for Induction of Select Protein Markers of Follicular Differentiation J. Biol. Chem., May 7, 2004; 279(19): 19431 - 19440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Sasson, E. Rimon, A. Dantes, T. Cohen, V. Shinder, A. Land-Bracha, and A. Amsterdam Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases Mol. Hum. Reprod., May 1, 2004; 10(5): 299 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P. Kayampilly and K. M. J. Menon Inhibition of Extracellular Signal-Regulated Protein Kinase-2 Phosphorylation by Dihydrotestosterone Reduces Follicle-Stimulating Hormone-Mediated Cyclin D2 Messenger Ribonucleic Acid Expression in Rat Granulosa Cells Endocrinology, April 1, 2004; 145(4): 1786 - 1793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Morinaga, T. Yanase, M. Nomura, T. Okabe, K. Goto, N. Harada, and H. Nawata A Benzimidazole Fungicide, Benomyl, and Its Metabolite, Carbendazim, Induce Aromatase Activity in a Human Ovarian Granulose-Like Tumor Cell Line (KGN) Endocrinology, April 1, 2004; 145(4): 1860 - 1869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Yang and S. K. Roy Follicle Stimulating Hormone-Induced DNA Synthesis in the Granulosa Cells of Hamster Preantral Follicles Involves Activation of Cyclin-Dependent Kinase-4 Rather Than Cyclin D2 Synthesis Biol Reprod, February 1, 2004; 70(2): 509 - 517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Cunningham, Q. Zhu, T. G. Unterman, and J. M. Hammond Follicle-Stimulating Hormone Promotes Nuclear Exclusion of the Forkhead Transcription Factor FoxO1a via Phosphatidylinositol 3-Kinase in Porcine Granulosa Cells Endocrinology, December 1, 2003; 144(12): 5585 - 5594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Ochsner, A. J. Day, M. S. Rugg, R. M. Breyer, R. H. Gomer, and J. S. Richards Disrupted Function of Tumor Necrosis Factor-{alpha}-Stimulated Gene 6 Blocks Cumulus Cell-Oocyte Complex Expansion Endocrinology, October 1, 2003; 144(10): 4376 - 4384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hsieh, S. M. Mulders, R. R. Friis, A. Dharmarajan, and J. S. Richards Expression and Localization of Secreted Frizzled-Related Protein-4 in the Rodent Ovary: Evidence for Selective Up-Regulation in Luteinized Granulosa Cells Endocrinology, October 1, 2003; 144(10): 4597 - 4606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Zeleznik, D. Saxena, and L. Little-Ihrig Protein Kinase B Is Obligatory for Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation Endocrinology, September 1, 2003; 144(9): 3985 - 3994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Falender, R. Lanz, D. Malenfant, L. Belanger, and J. S. Richards Differential Expression of Steroidogenic Factor-1 and FTF/LRH-1 in the Rodent Ovary Endocrinology, August 1, 2003; 144(8): 3598 - 3610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ulloa-Aguirre, C. Timossi, J. Barrios-de-Tomasi, A. Maldonado, and P. Nayudu Impact of Carbohydrate Heterogeneity in Function of Follicle-Stimulating Hormone: Studies Derived from in Vitro and in Vivo Models Biol Reprod, August 1, 2003; 69(2): 379 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. SASSON, A. DANTES, K. TAJIMA, and A. AMSTERDAM Novel genes modulated by FSH in normal and immortalized FSH-responsive cells: new insights into the mechanism of FSH action FASEB J, July 1, 2003; 17(10): 1256 - 1266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Suh, J. H. Song, D. W. Kim, H. Kim, H. K. Chung, J. H. Hwang, J. M. Kim, E. S. Hwang, J. Chung, J.-H. Han, et al. Regulation of the Phosphatidylinositol 3-Kinase, Akt/Protein Kinase B, FRAP/Mammalian Target of Rapamycin, and Ribosomal S6 Kinase 1 Signaling Pathways by Thyroid-stimulating Hormone (TSH) and Stimulating type TSH Receptor Antibodies in the Thyroid Gland J. Biol. Chem., June 6, 2003; 278(24): 21960 - 21971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Yoshino, Y. Osuga, Y. Hirota, K. Koga, T. Yano, O. Tsutsumi, and Y. Taketani Akt as a possible intracellular mediator for decidualization in human endometrial stromal cells Mol. Hum. Reprod., May 1, 2003; 9(5): 265 - 269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Mukasa, M. Nomura, T. Tanaka, K. Tanaka, Y. Nishi, T. Okabe, K. Goto, T. Yanase, and H. Nawata Activin Signaling through Type IB Activin Receptor Stimulates Aromatase Activity in the Ovarian Granulosa Cell-Like Human Granulosa (KGN) Cells Endocrinology, April 1, 2003; 144(4): 1603 - 1611. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Russell, K. M. H. Doyle, I. Gonzales-Robayna, C. Pipaon, and J. S. Richards Egr-1 Induction in Rat Granulosa Cells by Follicle-Stimulating Hormone and Luteinizing Hormone: Combinatorial Regulation By Transcription Factors Cyclic Adenosine 3',5'-Monophosphate Regulatory Element Binding Protein, Serum Response Factor, Sp1, and Early Growth Response Factor-1 Mol. Endocrinol., April 1, 2003; 17(4): 520 - 533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lukas-Croisier, C. Lasala, J. Nicaud, P. Bedecarras, T. R. Kumar, M. Dutertre, M. M. Matzuk, J.-Y. Picard, N. Josso, and R. Rey Follicle-Stimulating Hormone Increases Testicular Anti-Mullerian Hormone (AMH) Production through Sertoli Cell Proliferation and a Nonclassical Cyclic Adenosine 5'-Monophosphate-Mediated Activation of the AMH Gene Mol. Endocrinol., April 1, 2003; 17(4): 550 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Boehmer, V. Wilhelm, M. Palmada, S. Wallisch, G. Henke, H. Brinkmeier, P. Cohen, B. Pieske, and F. Lang Serum and glucocorticoid inducible kinases in the regulation of the cardiac sodium channel SCN5A Cardiovasc Res, March 15, 2003; 57(4): 1079 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. W. Sun, H. Kobayashi, M. Suzuki, N. Kanayama, and T. Terao Follicle-Stimulating Hormone and Insulin-Like Growth Factor I Synergistically Induce Up-Regulation of Cartilage Link Protein (Crtl1) via Activation of Phosphatidylinositol-Dependent Kinase/Akt in Rat Granulosa Cells Endocrinology, March 1, 2003; 144(3): 793 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cottom, L. M. Salvador, E. T. Maizels, S. Reierstad, Y. Park, D. W. Carr, M. A. Davare, J. W. Hell, S. S. Palmer, P. Dent, et al. Follicle-stimulating Hormone Activates Extracellular Signal-regulated Kinase but Not Extracellular Signal-regulated Kinase Kinase through a 100-kDa Phosphotyrosine Phosphatase J. Biol. Chem., February 21, 2003; 278(9): 7167 - 7179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang and W. Ge Involvement of Cyclic Adenosine 3',5'-Monophosphate in the Differential Regulation of Activin {beta}A and {beta}B Expression by Gonadotropin in the Zebrafish Ovarian Follicle Cells Endocrinology, February 1, 2003; 144(2): 491 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. O. Carvalho, J. B. C. Carvalheira, M. H. M. Lima, S. F. Zimmerman, L. C. Caperuto, A. Amanso, A. L. Gasparetti, V. Meneghetti, L. F. Zimmerman, L. A. Velloso, et al. Novel Signal Transduction Pathway for Luteinizing Hormone and Its Interaction with Insulin: Activation of Janus Kinase/Signal Transducer and Activator of Transcription and Phosphoinositol 3-Kinase/Akt Pathways Endocrinology, February 1, 2003; 144(2): 638 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kagawa, L. Varticovski, Y. Sai, and I. M. Arias Mechanism by which cAMP activates PI3-kinase and increases bile acid secretion in WIF-B9 cells Am J Physiol Cell Physiol, December 1, 2002; 283(6): C1655 - C1666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Conti Specificity of the Cyclic Adenosine 3',5'-Monophosphate Signal in Granulosa Cell Function Biol Reprod, December 1, 2002; 67(6): 1653 - 1661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Liu, C. Chin-Chance, E.-J. Lee, and W. L. Lowe Jr. Activation of Phosphatidylinositol 3-Kinase Contributes to Insulin-Like Growth Factor I-Mediated Inhibition of Pancreatic {beta}-Cell Death Endocrinology, October 1, 2002; 143(10): 3802 - 3812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.L. Johnson, E.V. Solovieva, and J.T. Bridgham Relationship Between Steroidogenic Acute Regulatory Protein Expression and Progesterone Production in Hen Granulosa Cells During Follicle Development Biol Reprod, October 1, 2002; 67(4): 1313 - 1320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. K. Misra, G. Akabani, and S. V. Pizzo The Role of cAMP-dependent Signaling in Receptor-recognized Forms of alpha 2-Macroglobulin-induced Cellular Proliferation J. Biol. Chem., September 20, 2002; 277(39): 36509 - 36520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. M. Laurich, A. M. Trbovich, F. H. O'Neill, C. P. Houk, P. M. Sluss, A. H. Payne, P. K. Donahoe, and J. Teixeira Mullerian Inhibiting Substance Blocks the Protein Kinase A-Induced Expression of Cytochrome P450 17{alpha}-Hydroxylase/C17-20 Lyase mRNA in a Mouse Leydig Cell Line Independent of cAMP Responsive Element Binding Protein Phosphorylation Endocrinology, September 1, 2002; 143(9): 3351 - 3360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Eimerl and J. Orly Regulation of Steroidogenic Genes by Insulin-Like Growth Factor-1 and Follicle-Stimulating Hormone: Differential Responses of Cytochrome P450 Side-Chain Cleavage, Steroidogenic Acute Regulatory Protein, and 3{beta}-Hydroxysteroid Dehydrogenase/Isomerase in Rat Granulosa Cells Biol Reprod, September 1, 2002; 67(3): 900 - 910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Urban, Y. H. Bodenburg, and T. G. Wood NH2 terminus of PTB-associated splicing factor binds to the porcine P450scc IGF-I response element Am J Physiol Endocrinol Metab, September 1, 2002; 283(3): E423 - E427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lou, J. Urbani, F. Ribeiro-Neto, and D. L. Altschuler cAMP Inhibition of Akt Is Mediated by Activated and Phosphorylated Rap1b J. Biol. Chem., August 30, 2002; 277(36): 32799 - 32806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Salvador, E. Maizels, D. B. Hales, E. Miyamoto, H. Yamamoto, and M. Hunzicker-Dunn Acute Signaling by the LH Receptor Is Independent of Protein Kinase C Activation Endocrinology, August 1, 2002; 143(8): 2986 - 2994. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
