Molecular Endocrinology 14 (8): 1283-1300
Copyright © 2000 by The Endocrine Society
Follicle-Stimulating Hormone (FSH) Stimulates Phosphorylation and Activation of Protein Kinase B (PKB/Akt) and Serum and Glucocorticoid-Induced Kinase (Sgk): Evidence for A Kinase-Independent Signaling by FSH in Granulosa Cells
Ignacio J. Gonzalez-Robayna,
Allison E. Falender,
Scott Ochsner,
Gary L. Firestone and
JoAnne S. Richards
Department of Molecular and Cellular Biology (I.J.G.R., A.E.F.,
S.O., J.S.R.) Baylor College of Medicine Houston, Texas
77030
Department of Molecular and Cell Biology (G.L.F.)
University of California Berkeley Berkeley, California 94720
 |
ABSTRACT
|
|---|
FSH stimulates in ovarian granulosa cells diverse,
differentiation-dependent responses that implicate activation of
specific cellular signaling cascades. In these studies three kinases
were investigated to determine their relationship to FSH, cAMP, and A
kinase signaling: protein kinase B (PKB/Akt), serum and
glucocorticoid-induced kinase (Sgk), and p38 mitogen-activated protein
kinase (p38MAPK). The phosphorylation (activation) of these kinases was
analyzed by using selective agonists/inhibitors: forskolin/H89
for cAMP-dependent protein kinase (A kinase), insulin-like growth
factor I (IGF-I)/LY294002 and wortmannin for
phosphatidylinositol-dependent kinase (PI3-K), and phorbol myristate
(PMA)/GF109203X for diacylglycerol and
Ca++-dependent kinases (C kinases). An
inhibitor (PD98059) of MEK1, which regulates extracellular regulated
kinases (ERKs), and SB203580, which inhibits p38MAPK, were also used.
In addition, we analyzed the expression of the recently described,
cAMP-regulated guanine nucleotide exchange factors (cAMP-GEFI and
GEFII) that impact Ras-related GTPases and Raf kinases, known
regulators of various protein kinase cascades. We provide evidence that
FSH, forskolin, and 8-bromo-cAMP stimulate phosphorylation of PKB by
mechanisms involving PI3-K (LY294002/wortmannin sensitive) not A kinase
(H89 insensitive), a pattern of response mimicking that of IGF-I. In
contrast, FSH induction and phosphorylation of Sgk protein requires A
kinase (H89 sensitive) but also involves PI3-K (LY294002 sensitive) as
well as p38MAPK (SB203580 sensitive) pathways. PMA (C kinase) abolished
FSH-mediated (but not IGF-I-mediated) phosphorylation of PKB at a
step(s) upstream of PI3-K and independent of A kinase. Lastly,
FSH-mediated phosphorylation of p38MAPK is negatively affected by A
kinase and PI3-K, suggesting that it may be downstream of specific
members of the cAMP-GEF/Rap/Raf pathway. We propose that cAMP
activation of A kinase is obligatory for transcription of Sgk in
granulosa cells whereas cAMP (IGF-I-like)-mediated phosphorylation
(activation) of PKB and Sgk (via PI3-K), as well as p38MAPK, involves
other cellular events. These results provide new and exciting evidence
that cAMP acts in granulosa cells by A kinase-dependent and
-independent mechanisms, each of which controls specific kinase
cascades.
 |
INTRODUCTION
|
|---|
The growth of ovarian follicles and the differentiation of
granulosa cells are complex processes that depend on the pituitary
gonadotropins, FSH and LH (1). During follicular growth the response of
granulosa cells to these hormones changes dramatically; the precise
molecular and biochemical mechanisms involved remain largely unknown.
In small follicles, FSH regulates granulosa cell proliferation and the
expression in these cells of the cell cycle-regulatory molecule, cyclin
D2 (2, 3). As follicles mature to the preovulatory stage, FSH induces
the expression of differentiation-specific genes encoding aromatase and
LH receptor (1). These effects of FSH on granulosa cell function can be
enhanced by steroids (1, 4) and IGF-I (5, 6, 7). The LH surge, in turn,
rapidly curtails the proliferation of granulosa cells and stimulates
their terminal differentiation to luteal cells. Within 25 h after the
LH surge, cellular levels of mRNA and protein for cyclin D2 (2, 3),
aromatase (8), and the LH receptor (9) are drastically reduced.
Although the LH surge down-regulates the expression of these genes
associated with follicular development, it induces the expression of
genes involved in ovulation and luteinization (10). Within 5 h of
exposure to the LH surge, granulosa cells have been entirely
reprogrammed to become nondividing, functional luteal cells. Once
granulosa cells have terminally differentiated to luteal cells, their
response to LH is markedly altered, and they no longer respond to
changes in cAMP.
The binding of FSH and LH to their cognate receptors leads to the
stimulation of adenylyl cyclase and the production of cAMP. A plethora
of studies have documented convincingly that cAMP mediates many
intracellular functions by activating cAMP-dependent protein kinase, A
kinase (11). The activated A kinase catalytic (C) subunit can
translocate to the nucleus and phosphorylate transcription factors,
such as the cAMP responsive element (CRE) binding protein CREB (12, 13, 14)
leading to increased expression of ovarian genes, such as aromatase
(13, 15) and inhibin
(16). Recent studies indicate that
transcriptional activation of CREB is more complex since
phosphorylation of Ser133 is necessary but not sufficient for
activation of transcription (17, 18). Moreover, there are many genes
induced by FSH and LH in granulosa cells that do not contain CREs
within their proximal promoters and are induced by other transcription
factors and response elements (1, 10). Increasing evidence also
indicates that multiple cellular signaling cascades, in addition to A
kinase, coordinate cellular responses to trophic hormone stimulation of
G protein-coupled receptors (19, 20, 21, 22).
One gene that is transcriptionally regulated by FSH and A kinase in
granulosa cells is an immediate-early kinase, known as serum- and
glucocorticoid-inducible kinase (Sgk) (23, 24, 25). FSH-mediated
transcription of this gene in granulosa cells is biphasic and
regulated, in part, by Sp1/Sp3 but not CREB (23). The initial induction
of Sgk is rapid and is associated with proliferative stages of
granulosa cell function. At this time Sgk is localized to the nucleus
(24, 25). The secondary increase in Sgk occurs as granulosa cells
differentiate into luteal cells; in these cells Sgk is preferentially
localized to the cytoplasm (24, 25). These observations have been made
both in vivo as well as in primary granulosa cells in
culture, thereby suggesting that Sgk can phosphorylate nuclear targets
as well as cytoplasmic targets.
Interestingly, Sgk has recently been shown to have its highest homology
to protein kinase B (PKB)/(Akt) and to require phosphorylation (Thr
256) within its activation loop for activation (26). Upstream kinases
in the cascade leading to the phosphorylation of PKB (27) and Sgk (26)
include the dual functional phosphatidylinositol 3-kinase (PI3-K) (28)
and phosphoinositide-dependent kinase (PDK1) (28, 29). PKB, in turn, is
known to phosphorylate numerous proteins, among which are glycogen
synthase kinase-3 (GSK-3) (30) and the winged-helix family of
transcription factors known as Forkhead (FKHR) (31, 32, 33). This pathway
is stimulated by numerous growth factors including insulin and
insulin-like growth factor I (IGF-I) (34, 35) by activation of
monomeric Ras or ras-related proteins (36). Importantly, this
IGF-I/PKB/FKHR pathway has been conserved from Caenorhabditis.
elegans (characterized by various daf mutants) to
mammals (32, 33, 37, 38). Recently, additional links between G
protein-coupled receptors, cAMP, and PI3-K signaling pathways have been
observed (19, 21). The activation loop of A kinase, like that of PKB
and Sgk, has been shown to be a substrate for PDK1 (39). Conversely,
overexpression of A kinase has been shown to activate PKB by a
PI3-K-independent pathway (40) whereas TSH via cAMP (but not A kinase)
has been shown to stimulate phosphorylation of PKB/Akt in a thyroid
cell line (41). In some cells, Gß
activates PI3-K (19, 20, 21).
Based on these and other recent studies it now appears that cAMP may
act at a specific molecular "switch board" to control diverse
cellular signaling pathways in a cell- and tissue-specific manner. For
example, FSH has been reported to activate p38 mitogen- activated
protein kinase (p38MAPK) in granulosa cells via A kinase (42). In PC12
cells, cAMP has been shown to differentially alter the activity of two
serine/threonine kinases, Raf-1 and B-Raf, by mechanisms that are
dependent of A kinase activation of Rap1 (43, 44). Whereas cAMP exerts
inhibitory effects on Raf-1, it stimulates B-Raf (43, 45, 46). In
addition to A kinase, recent studies have identified a set of
cAMP-regulated guanine nucleotide exchange factors (cAMP-GEFs) that
includes cAMP-GEFI (also called Epac, exchange protein directly
activated by cAMP) (47, 48) and cAMP-GEFII (48). cAMP-GEFI has been
shown to regulate the activity of Rap1, and GTP-Rap1 can activate B-Raf
kinase, leading to activation of the extracellular regulated kinase
(ERK) pathway. These cAMP-GEFs, by virtue of their activation of Rap-1
(43, 44) and possibly other GTPases, are potential activators of PI3-K,
a known target of Ras (36, 49). Thus, cAMP may regulate specific
members of the PKB and MAPK pathways (ERK, p38MAPK, and JNK) by A
kinase-independent as well as A kinase-dependent mechanisms.
Based on these observations, we hypothesized that changes in the
response of granulosa cells to FSH and LH during differentiation might
involve A kinase activation of target genes, such as Sgk and aromatase,
as well as the activation by cAMP (or Gß
) of alternative cellular
signaling cascades that might impact Sgk. To explore these
possibilities, we have analyzed and compared the pattern of expression
and phosphorylation (activation) of Sgk, PKB, and p38MAPK in granulosa
cells cultured in the presence of a variety of agonists known to
stimulate A kinase (FSH/T, forskolin), C kinase [phorbol myristate
(PMA)], and PI3-K (IGF-I). We have also analyzed the effects of
selective antagonists of A kinase (H89), C kinase (GF109203X), PI-3K
(LY294002 and wortmannin), and MEK1 [the upstream regulator of
extracellular regulated kinases, ERK (PD98059) and p38
mitogen-activated kinase, p38MAPK (SB203580)] on the
expression, phosphorylation, and activity of PKB and Sgk. Lastly, we
analyzed the expression pattern of cAMP-GEFI and GEF-II, Rap-1 and
Rap-2, as well as three members of the Raf family of serine/threonine
kinases (Raf-1, B-Raf, and A-Raf) thought to be regulated by the
Rap-related GTPases. A schematic outline of the signaling pathways
analyzed in granulosa cells is summarized in Fig. 10.
 |
RESULTS
|
|---|
PKB Is Phosphorylated in Granulosa Cells Cultured with FSH/T and
Forskolin
PKB has been shown to be phosphorylated and activated by several
cellular signaling pathways. To determine whether FSH might regulate
the function of granulosa cells via this pathway, granulosa cells were
isolated from ovaries of 17ß-estradiol-primed, immature female rats
and cultured overnight in defined medium (DMEM:F12) on serum-coated
dishes (4). At that time FSH (50 ng/ml) and testosterone (T; 10 ng/ml)
were added to the cultures to stimulate granulosa cell differentiation
leading to the transcription of genes, such as aromatase (CYP19) (4)
and LH receptor (9), that specifically characterize granulosa cells of
preovulatory follicles (1). At selected time intervals (048 h),
protein extracts were prepared using a buffer containing SDS (25). The
presence of PKB and phospho-PKB was analyzed by Western blotting using
antibodies specific for the nonphosphorylated (inactive) and phospho-
(active) forms of PKB (Fig. 1A
).
Nonphosphorylated PKB was present in granulosa cells at 0 h and
remained essentially constant during culture with FSH/T (Fig. 1A
). In
these same samples, phospho-PKB was low/negligible in cells cultured
overnight in the absence of hormone. However, PKB was phosphorylated
within 0.5 h after the addition of FSH/T and by 1.5 h reached
a level 6-fold above that of nontreated cells. The amount of
phospho-PKB decreased 50% at 6 h but began to increase again at
12 h and reached it highest level (9-fold above baseline) at
48 h after addition of FSH/T. These results indicate that PKB is
constitutively expressed but rapidly phosphorylated in granulosa cells
by exposure to FSH/T. The FSH-mediated phosphorylation of PKB is
biphasic, a pattern previously observed for the induction of the
PKB-related kinase, Sgk (23, 24, 25) and reaches its highest level at
48 h when the granulosa cells have differentiated to the
preovulatory phenotype.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 1. FSH and Forskolin Stimulate PKB Phosphorylation in
Granulosa Cells
Granulosa cells were harvested from ovaries of E-primed immature female
rats and cultured overnight (0 h) in defined medium, DMEM-F12. At that
time (A) FSH (50 ng/ml) and T (10 ng/ml) or (B) forskolin (10
µM) were added to the cells. Cell extracts were prepared
at the designated intervals and used for Western blot analyses using
antibodies specific for PKB (inactive) (1:1000) or phosphorylated PKB
(active) (1:1000). In panel C, the phosphodiesterase (PDE4)
inhibitor, rolipram (10 µM), was added to the cultures
1 h before the addition of forskolin. Cell extracts were prepared
and analyzed as in panels A and B. Numbers at the bottom of
each lane in this and subsequent figures for PKB indicate the fold
increase in phosphorylation (ratio of phosphoprotein to protein in each
sample) relative to control. Results are representative of two highly
reproducible experiments per treatment group.
|
|
To determine whether the effects of FSH/T could be mimicked by direct
activation of adenylyl cyclase, granulosa cells were cultured under
similar conditions overnight (0 h) and then forskolin (10
µM) was added. Forskolin had no effect on the levels of
nonphosphorylated PKB protein (Fig. 1B
). However, forskolin did
stimulate the phosphorylation of PKB in a pattern similar to that of
FSH/T: a rapid 5.0-fold increase was observed at 1 h, followed by
a decline to baseline at 6 h with a secondary 6-fold increase
occurring progressively between 2448 h. Collectively, these results
show that cAMP activates cellular signals leading to the
phosphorylation of PKB.
To determine whether the decrease in phosphorylation of PKB at 6 h
was due to phosphodiesterase (PDE) activity and consequent decreases in
intracellular cAMP, rolipram, a specific inhibitor of the PDE4 isoform
expressed in granulosa was used (47). Granulosa cells were cultured
overnight as described above, at which time rolipram was added to the
cultures for 1 h preceding the addition of forskolin. When
forskolin was added to the rolipram-pretreated cells, the temporal
pattern of PKB phosphorylation was altered (Fig. 1C
). The marked 7-fold
increase in phospho-PKB at 1 h was followed by a gradual decrease
throughout the 48 h period (Fig. 1C
). Thus, rolipram delayed but
did not completely prevent a decline in cellular levels of
phospho-PKB.
Multiple Pathways Regulate PKB Phosphorylation
IGF-I has been shown to enhance granulosa cell responses to FSH
(5, 6) and to promote cell survival in the ovary (50). Since PKB has
been shown to be a specific downstream target of IGF-I/insulin, we
sought to determine whether the phosphorylation of PKB by FSH/T was
related to or enhanced by the effects of IGF-I. Accordingly, granulosa
cells were cultured overnight in serum-free medium. At that time, the
selective inhibitor of A-kinase (H89; 10 µM), was added
to the granulosa cells (26, 41). After the 1-h pretreatment with
inhibitor, FSH/T, forskolin, or 8-bromo-cAMP was added to the cultures
for an additional 1 h of stimulation. Cell extracts were prepared
and analyzed by Western blotting. PKB was rapidly phosphorylated within
1 h of exposure to FSH/T, forskolin, as well as 8-bromo-cAMP (Fig. 2A
). The rapid phosphorylation of PKB by
FSH/T, forskolin, and 8-bromo-cAMP was not inhibited by H89; rather H89
slightly enhanced the phosphorylation of PKB. Thus, PKB (ser473) is not
a direct substrate for A kinase in granulosa cells.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2. Phosphorylation and Activation of
PKB by FSH, Forskolin, 8-br-cAMP, PMA, and IGF-I: Roles of PI3-K and
p38MAPK
A (PKB phosphorylation), Granulosa cells were harvested and cultured
and cell extracts were prepared essentially as described above (Fig. 1 ). Selective inhibitors of A kinase (H89; 10
µM), PI3-K (LY294002; 25
µM and wortmannin; 0.1
µM), MEK1/ERK (PD98059; 20
µM), and p38MAPK (SB203580; 20
µM) were added 1 h before the addition of
FSH/T, forskolin, 8-bromo-cAMP, PMA, and IGF-I at the doses indicated.
After 1 h of stimulation with the agonists, cell extracts were
prepared for Western blotting as in Fig. 1 . Results obtained with
8-bromo-cAMP were similar to those obtained for FSH/T and forskolin
(data not shown) The numbers at the base (or top
for PMA and IGF-I) of each lane represent fold increases in phospho
(active) PKB in response to agonists/antagonists relative to that in
nonstimulated cells (0 h). Results are representative of two highly
reproducible experiments. B (Specificity of H89), Additional
granulosa cells were cultured in the presence of FSH/T for 10 min or 30
min without or with the A kinase inhibitor H89 at doses of 10 and 20
µM. Cell extracts were prepared and analyzed
for phospho-CREB, CREB, and phospho-PKB. Numbers at the base of
each lane represent the fold increases in phospho-CREB or
phosho-PKB relative to 0 h control. C (Endogenous
phosphorylation of GSK-3/PKB activity), Granulosa cells were
cultured with FSH/T as described in Fig. 1 . Cell extracts were prepared
and endogenous levels of phosphorylated GSK-3 were analyzed by Western
blot using a specific phospho (Ser21/9) GSK-3 /ß antibody (1:000).
To measure PKB activity, granulosa cells were cultured overnight and
then treated 1 h with FSH/T, IGF-I, or LY294002 (1 h) followed by
FSH/T (1 h). Cell lysates were prepared and PKB was immunoprecipitated
(IP) from granulosa cell extracts. PKB activity was measured using a
GSK-3 /ß cross-tide fusion protein as a substrate.
Phospho-GSK-3 /ß was analyzed by SDS-PGE and immunoblotting with a
specific phospho-GSK-3 /ß antibody (1:1000). Results are
representative of two experiments giving identical results.
|
|
Since PKB is a downstream substrate of the PI3-K pathway, we next
determined whether FSH/T-stimulated phosphorylation of PKB was mediated
by this pathway or by the MAPK pathway. Cells were cultured as above
and selective inhibitors of PI3-kinase (LY294002; wortmannin), MEK1/ERK
(PD98050), and p38MAPK (SB203580) were added to the cells for 1 h
at doses routinely used in other studies. As shown, FSH/T-mediated
phosphorylation of PKB was abolished by exposure to the PI3-kinase
inhibitors, LY294002 and wortmannin. Whereas the MEK1 inhibitor
(PD98050) failed to block FSH/T-mediated PKB phosphorylation, the
p38MAPK inhibitor (SB203580) did reduce PKB phosphorylation. Identical
results were observed when either forskolin or 8-bromo-cAMP was added
to the cultures; the PI3-K inhibitors blocked PKB phosphorylation (Fig. 2A
). Although the tyrosine kinase inhibitor AG18 has been shown to be a
potent inhibitor of FSH-regulated gene expression in granulosa cells
(51), this tyrphostin had no effect on FSH- or
forskolin-stimulated phosphorylation of PKB (data not shown).
In marked contrast, the C kinase activator PMA failed to stimulate the
phosphorylation of PKB, confirming previous results (Fig. 2A
) (26).
Moreover, additional experiments showed that PMA completely blocked
FSH/T-mediated phosphorylation of PKB (Fig. 6
). These results suggest
that activation of C kinase antagonizes cAMP-mediated phosphorylation
of PKB.
IGF-I is a major activator of PKB in other cells. When it was added to
the granulosa cell cultures, it stimulated the expected phosphorylation
of PKB (Fig. 2A
). Furthermore, the IGF-I-induced phosphorylation of PKB
was not affected by inhibitors of A kinase (H89) or ERK (PD98050) but
was blocked by the PI3-K inhibitors (LY294002 and wortmannin) and
reduced by the p38MAPK inhibitor (SB203580). The levels of PKB protein
remained essentially constant in granulosa cells exposed to the various
agonists and inhibitors (Fig. 2A
). These results indicate that PKB is a
downstream target of both IGF-I and cAMP-regulated signaling cascades
that are independent of A kinase activation but require PI3-K.
To determine whether H89 was effectively blocking A kinase activity,
the phosphorylation of CREB and PKB was analyzed in additional cultures
(Fig. 2B
). Granulosa cells were cultured in the presence of FSH/T for
10 min or 30 min with or without H89 (10 and 20 µM). As
shown, FSH/T stimulated an increase of approximately 7-fold in
phospho-CREB that was reduced in a dose-dependent manner by H89.
Conversely, phosphorylation of PKB by FSH/T increased progressively
with time and dose of H89. These data indicate that H89 reduces A
kinase phosphorylation of CREB but not that of PKB.
To directly measure the activity of PKB in granulosa cells, the
phosphorylation of endogenous GSK-3, as well as a synthetic substrate
(cross-tide), was analyzed (Fig. 2C
). FSH/T and IGF-I stimulated
phosphorylation of endogenous GSK-3 in a biphasic pattern, similar to
that observed for PKB phosphorylation (Fig. 1A
): GSK-3 (Ser21/9)
phosphorylation increased 48- and 74-fold at 0.5 h and 1 h,
respectively, declined at 6 h, and then increased to 96-fold by
48 h of stimulation with FSH/T. PMA alone did not stimulate GSK-3
phosphorylation but it did reduce the response of FSH/T by 50% (not
shown). For in vitro kinase assays, granulosa cells were
cultured overnight. At that time the cells were stimulated (1 h) with
FSH/T, IGF-I, or FSH/T after 1-h pretreatment with LY294002.
Cell extracts were prepared, after which PKB was immunoprecipitated and
its activity analyzed using a GSK-3 fusion protein as the substrate.
Phospho-GSK-3 (Ser21/9) was detected by immunoblotting. PKB
activity was low in cells cultured in the absence
of hormones but was stimulated 4.7-fold by FSH/T and 6.1-fold by IGF-I.
The PI3-K inhibitor LY294002 blocked FSH-mediated GSK-3
phosphorylation. Collectively, these results indicate that FSH/T- and
IGF-I-mediated, PI3-K-dependent phosphorylation of PKB is related to
increased enzymatic activity (Fig. 2C
).
Regulation of PKB Phosphorylation Is Dependent on Granulosa Cell
Differentiation
We have previously shown that granulosa cell differentiation is
associated with changes in the activation of A kinase, its subcellular
localization, and its ability to induce target genes such as Sgk and
aromatase (25). Therefore, we sought in these experiments to determine
whether the ability of FSH/T, forskolin, and IGF-I to phosphorylate PKB
was also dependent on the stage of granulosa cell differentiation. For
these experiments, granulosa cells were cultured in the continuous
presence of FSH/T for either 24 h or 48 h. This regimen
stimulates granulosa differentiation and the expression of genes, such
as aromatase and LH receptor, that characterize the preovulatory
phenotype (1). At each time interval, either H89, LY294002, wortmannin,
PD98059, or SB203580 was added to the cultures for 1 h before
the preparation of the extracts. As shown in Fig. 3A
, PKB was present in a phosphorylated
form at 24 h of culture with FSH/T, and its phosphorylation was
increased almost 2-fold by exposing cells to the A kinase inhibitor,
H89. PKB phosphorylation was blocked effectively by LY294002 or
wortmannin whereas PD98059 had no detectable effect and SB203580
reduced phosphorylation slightly. After 48 h of culture with
FSH/T, the phosphorylation of PKB was affected less by the inhibitors:
H89 failed to enhance PKB phosphorylation and the inhibitory
effects of LY294002 and wortmannin, as well as SB203580, were
diminished (Fig. 3A
). Exposure of granulosa cells to the inhibitors
for 24 h was required to observe the enhancing effects of H89 and the
inhibitory effects of LY294002, wortmannin, and SB203580 (Fig. 3B
).
Levels of phospho-PKB were also elevated in luteinized granulosa cells
in vitro and in functional corpora lutea of pregnant rats
(data not shown). Collectively, these results indicate that the
mechanisms controlling the high steady-state levels of phosphorylated
PKB are enhanced as the granulosa cells differentiate.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 3. PKB Phosphorylation Is Dependent on Granulosa Cell
Differentiation
Granulosa cells were cultured in the presence of FSH/T for 24 or
48 h at which time inhibitors were added for 1 h (panel A) or
for 2 h and 4 h (panel B). Cell extracts were prepared to
analyze the amount of phospho (active) and non-phospho (inactive) PKB.
|
|
Regulation of Sgk Expression and Phosphorylation by Multiple
Pathways
Since Sgk is induced by FSH/T and forskolin in granulosa cells and
since it is related most closely in structure and substrate specificity
to PKB (26), we next analyzed the induction of Sgk and its
phosphorylation state. Granulosa cells were cultured with the same
agonists and inhibitors as described above. Sgk protein was induced
15-fold by FSH/T and forskolin; it was also phosphorylated as indicated
by the increased number of slower migrating immunoreactive bands (Fig. 4
), shown in previous studies to be
phosphorylated Sgk (26, 52). The amount and phosphorylation of Sgk by
FSH/T and forskolin were reduced by H89 50% and 73%, respectively.
Surprisingly, LY294002 not only abolished the presence of
phosphorylated bands but also reduced the amount of Sgk protein.
Compared with LY294002, wortmannin was surprisingly ineffective as an
inhibitor of Sgk phosphorylation. SB203580 but not PD98059 also reduced
Sgk phosphorylation.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4. Induction and Phosphorylation of Sgk by FSH/T,
Forskolin, PMA, and IGF-I
Granulosa cells were harvested and cultured with agonists and
inhibitors described as in Fig. 2 . Cell extracts were prepared and used
for Western blotting using an affinity-purified antibody to Sgk (24 25 ). The slower migrating, immunoreactive bands are phosphorylated
forms of Sgk, as determined previously (23 24 ). The data are
representative of two separate experiments. Numbers at the base
of each lane represent the fold increase in immunoreactive
[phospho (active) and non-phospho (inactive)] Sgk relative to
nonstimulated cells (0 h).
|
|
PMA neither induced Sgk protein nor stimulated its phosphorylation
(Fig. 4
). In contrast, IGF-I alone increased the amount and
phosphorylation of Sgk 1.6-fold, an effect that was blocked by the
PI3-K inhibitors, LY294002 and wortmannin, and SB203580 (Fig. 4
).
To examine the regulation of Sgk expression and phosphorylation during
differentiation, granulosa cells were cultured with FSH/T for 2448 h.
During this period, Sgk protein and its phosphorylation increased in
granulosa cells as indicated by the presence of multiple bands (Fig. 5
). However, the effects of specific
kinase inhibitors changed markedly. Unexpectedly, the amount of
phospho-Sgk was unaffected by the addition of H89 at 24 h of
culture with FSH/T, thereby suggesting an A kinase- independent pathway
was predominant. Sgk phosphorylation was reduced by exposing the cells
to LY294002 or wortmannin for 1 h, with LY294002 being slightly
more effective (Fig. 5
). By 48 h of culture with FSH/T, the
inhibitors were either ineffective (H89) or had only a marginal effect
(LY294002 and wortmannin) on the phosphorylated state of Sgk.
Furthermore, we have shown that Sgk is expressed at elevated levels and
is highly phosphorylated in luteinized granulosa cells in
vitro and in vivo (23, 24). Collectively, these results
indicate that the mechanisms controlling the steady-state levels of
phosphorylated Sgk, as well as PKB, change as the cells differentiate
in the presence of FSH/T.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 5. Sgk Phosphorylation Is Dependent on Granulosa Cell
Differentiation
Granulosa cells were harvested, cultured for 24 and 48 h with
FSH/T, and exposed to inhibitors as in Fig. 3 . Cell extracts were
prepared and used for Western blotting using an affinity-purified
antibody to Sgk as in the legend of Fig. 4 .
|
|
PMA Blocks Phosphorylation of PKB in Response to FSH/T
As shown above, treatment of granulosa cells with PMA alone failed
to stimulate phosphorylation of either PKB or Sgk. To determine whether
PMA (via C kinase) might alter the response of granulosa cells to FSH/T
or IGF-I, additional experiments were performed. Granulosa cells were
cultured overnight in serum-free medium at which time they were
pretreated for 1 h with the C kinase inhibitor (GF109203X) or
vehicle. At this time (designated 0 h), FSH/T, IGF-I, or PMA was
then added to the cells either alone or in combination for 1 h. As
in previous experiments, FSH/T and IGF-I stimulated PKB and Sgk
phosphorylation, whereas PMA alone was ineffective (Fig. 6
, A and B, respectively). However,
phosphorylation of these two kinases was either totally blocked (PKB)
or reduced (Sgk) when PMA was added to the cells in combination with
FSH/T. Inclusion of the C kinase inhibitor partially or completely
restored the FSH-induced phosphorylation of PKB and Sgk, respectively.
PMA (1 h exposure) also dramatically reduced PKB and Sgk
phosphorylation in cells cultured with FSH/T for 48 h (data not
shown).
In contrast, PMA exerted less of an effect on IGF-I-mediated
phosphorylation of PKB and Sgk (Fig. 6
, A and B, respectively). Nor did
PMA markedly alter FSH-induced phosphorylation of CREB (data not
shown). These results indicate that the inhibitory effects of PMA on
FSH/T-mediated phosphorylation of PKB and Sgk are mediated by C kinase
and impact steps other than or in addition to A kinase. Since PMA did
not markedly alter the actions of IGF-I (Fig. 6
) and does not alter
cAMP production in granulosa cells (8), PMA appears to block
FSH-mediated PKB phosphorylation at some step(s) upstream of PI3-K that
is distinct from the pathway by which IGF-I activates PI3-K.
FSH/T and IGF-I Act Synergistically to Enhance Phosphorylation of
PKB but Not Sgk
Since FSH/T and IGF have been shown to act synergistically
to regulate some aspects of granulosa cell function, additional
experiments were done to determine whether FSH/T and IGF-I might
synergize to enhance the phosphorylation of PKB and Sgk. Granulosa
cells were cultured overnight and then stimulated for 1 h with
either FSH/T, IGF-I, or the combination at the doses used in the
previous experiments. As shown in Fig. 7
, PKB was phosphorylated by either FSH/T (taken as control; 1.0) or IGF-I
(1.7-fold), and total phosphorylation was enhanced (3.8-fold) by
costimulation with FSH/T and IGF-I. As in previous experiments, PKB
phosphorylation induced by these agonists was blocked by a 1-h
pretreatment of cells with the PI3-K and p38MAPK inhibitors, LY294002
and SB203580, respectively. In contrast, Sgk is selectively induced and
phosphorylated by FSH/T (9.4-fold) compared with IGF-I (3.9-fold).
Although Sgk was phosphorylated by each agonist and was inhibited by
LY294002, no apparent synergy was observed when cells were exposed to
both FSH/T and IGF-I (8.7-fold vs. 9.4-fold with FSH/T
alone). Collectively, these results indicate that the mechanisms by
which cAMP and IGF act to phosphorylate PKB and Sgk involve similar
(PI3-K) but also distinct pathways, one of which may be p38MAPK.
p38MAPK Is Phosphorylated in Cells Cultured in the
Presence of FSH/T
Because the p38MAPK inhibitor SB203580 appeared to
reduce the phosphorylation of PKB and Sgk, we sought to determine
whether p38MAPK was phosphorylated in response to FSH/T. Additional
cultures were prepared and protein extracts were analyzed by Western
blotting using antibodies specific for p38MAPK and phospho-p38MAPK. As
shown in Fig. 8
, FSH/T stimulated a rapid
approximately 2-fold increase in the phosphorylation of p38MAPK at
1 h. The A kinase inhibitor H89 did not block this
phosphorylation. Rather H89, LY294002, wortmannin, and PD98059 enhanced
FSH/T- stimulated phosphorylation of p38MAPK by another 2-fold.
However, the p38MAPK- selective inhibitor SB203580 did block
FSH/T-mediated phosphorylation of p38MAPK. Although the exact mechanism
by which SB230580 blocks phosphorylation of p38MAPK is not known,
the inhibitor may bind to the enzyme in such a way to mask a critical
phosphorylation site (thereby inhibiting activation) or alter the
conformation of the kinase preventing its phosphorylation and
activation. Levels of nonphosphorylated p38MAPK remained constant in
all treatment groups (Figs. 8
). Collectively, these results indicate
that the phosphorylation of p38MAPK is complex and is not mediated by
the same mechanisms controlling the phosphorylation of PKB and Sgk.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 8. p38MAPK Is Phosphorylated by FSH/T and IGF-I in
Granulosa Cells
Granulosa cells were harvested, cultured, and exposed to agonists and
antagonists as in Fig. 2 . Cell extracts were prepared and used for
Western blotting with antibodies specific for p38MAPK (1:500) and
phospho-p38MAPK (1:500). Results are representative of two separate
experiments giving identical results.
|
|
Other Mediators of cAMP Action in Granulosa Cells
One of the surprising and novel results of these experiments is
the observation that PKB is phosphorylated by FSH/T as well as by
forskolin and 8-bromo-cAMP, a response that was not inhibited but
rather enhanced by blocking A kinase activity with H89. These
observations suggested that FSH activates alternate and distinct
pathways in granulosa cells. Recently, cAMP has been shown to bind
specific guanine nucleotide exchange factors, cAMP-GEFI (also called
exchange protein activated by cAMP, Epac) and cAMP-GEFII) (47, 48). In
some cells cAMP-GEFI has been shown to regulate the activity of the
Ras-related GTPase, Rap1 (48). By designing specific primer pairs based
on the published sequences of cAMP-GEFI (47, 48) and cAMP-GEFII (48),
we have determined by RT-PCR analyses, subcloning, and sequencing that
transcripts for both cAMP-GEFI and cAMP-GEFII are present in granulosa
cells. Furthermore, expression of cAMP-GEFI and GEFII was not
hormonally regulated in granulosa cells cultured in vitro
with FSH/T for 048 h (Fig. 9
, A and B)
or in rats stimulated with gonadotropins in vivo (data not
shown). RT-PCR analyses were also done to document that the GTPase
Rap1b is expressed, but not regulated, by hormones in granulosa cells
(Fig. 9D
). Western blot analyses (Fig. 9C
) also confirmed the presence
and constitutive expression of Rap1a/b as well as Rap2 in granulosa
cells cultured with FSH/T for 048 h. In addition, potential
downstream targets of Rap proteins were also expressed. The
serine/threonine kinases Raf-1 and Raf-B appeared to be constitutively
expressed in granulosa cells. Raf-A was low in unstimulated cells but
was increased by FSH/T at 1, 6, and 48 h (Fig. 9C
). In addition,
the multiple immunoreactive Raf-A bands indicate that Raf-A may also be
phosphorylated in these cells by FSH/T. Although p27-Ki-Ras is
expressed in granulosa cells (as shown by pan-Ras antibody), there is
yet no evidence that it is a target for cAMP-GEFs. Based on the
presence of these cellular signaling molecules in granulosa cells, it
is possible that FSH and cAMP-stimulated phosphorylation of PKB, Sgk,
or p38MAPK involves cAMP activation of specific cAMP-GEFs, Rap1 (or a
related GTPases) followed by the activation of PI3-K or specific Raf
kinases.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 9. Expression of cAMP-GEFI and cAMP-GEF-II, Rap1,
Rap2, and Ki-ras, as Well as Raf-1, Raf-B, and Raf-A in Granulosa Cells
A and B, Granulosa cells were cultured with FSH/T for 072 h; total
cellular RNA was extracted at 0, 2, 24, 48, and 72 h. Transcripts
encoding cAMP-GEFI and cAMP-GEFII, as well as the ribosomal protein
L19, were analyzed by RT-PCR using specific primer pairs, yielding
amplified cDNA products of 399 bp, 404 bp, and 196 bp, respectively.
Amplified products were verified by subcloning and sequence analyses.
As shown, expression of cAMP-GEFI and GEFII was not hormonally
regulated in granulosa cells. Data are representative of four separate
experiments. C, Granulosa cells were cultured with FSH/T as described
in Fig. 1 . Cell extracts were prepared and used to analyze by
immunoblotting the Ras-related GTPases, Rap1 (1:500), Rap2 (1:3000),
and Ki-ras (1:1000), as well as the Raf family of serine/threonine
kinases, Raf-1 (1:500), Raf-B (1:500), and Raf-A (1:1000). Results are
representative of two separate experiments. D, Total cellular RNA was
prepared from granulosa cells cultured in the presence of FSH/T for
048 h. Primers specific for Rap1b were used to amplify a 370-bp Rap1b
cDNA; primers for the ribosomal protein L19 were used as an internal
control. The levels of Rap1b were plotted relative to those of L19. The
Ra1b cDNA product was verified by sequence analysis. Data are
representative of two separate experiments.
|
|
 |
DISCUSSION
|
|---|
The control of granulosa cell proliferation and
differentiation by FSH and LH is complex. In small follicles, low
levels of FSH stimulate proliferation, whereas in large follicles FSH
stimulates differentiation and the expression of specific genes, such
as aromatase and the LH receptor (1, 3). The LH surge terminates
granulosa cell proliferation and rapidly reprograms granulosa cells to
become luteal cells. The cellular signaling events that are triggered
by and mediate these diverse responses to FSH and LH remain unclear but
appear to require cAMP as an obligatory second messenger. The central
importance of A kinase in mediating many of the effects of cAMP has
been confirmed by numerous approaches using specific A kinase
inhibitors, such as H89 (41, 51) and PKI (53, 54). Intracellular
trafficking (55) and specific docking sites (56, 57) of A kinase also
appear critical for function. Lastly, the interaction of A kinase with
other signaling systems, steroid and peptide, has been proposed to
account for selective cellular responses to these gonadotropins (1).
However, some effects of cAMP cannot be explained by activation of A
kinase (41, 53, 54, 58). We provide evidence herein that FSH/T,
forskolin, and 8-bromo-cAMP stimulate the phosphorylation of three
distinct kinases, PKB, Sgk, and p38MAPK by cellular signaling
mechanisms independent of A-kinase (Fig. 10
).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 10. Model of cAMP Actions in Granulosa Cells
FSH via activation of A kinase induces the expression of specific
genes, such as Sgk (23 24 ). FSH via PI3-K and its downstream targets,
PDK1 (but not A-kinase), phosphorylates PKB in a manner that mimics and
enhances IGF-I-induced phosphorylation and activation of PKB. IGF-I via
PI3-K also phosphorylates PKB and Sgk. PMA (via C kinase) inhibits
cAMP-mediated (but not IGF-I-mediated) phosphorylation of PKB and Sgk.
We propose that FSH likely acts via a cAMP-GEF/ras-Rap/Raf pathway,
which is upstream of PI3-K. cAMP, by mechanisms that are also
independent of A-kinase and PI3-K, also leads to the phosphorylation of
p38MAPK, likely by a cAMP-GEF/ras-Rap/Raf pathway. Thus, FSH appears to
activate both A kinase-dependent and A kinase-independent pathways in
granulosa cells, each of which controls specific kinase cascades.
|
|
PKB and Sgk have been shown to have similar protein structure and
require phosphorylation of specific amino acid residues within the
activation loop to be functionally active. However, as described
herein, there are also some major differences between these two
kinases. First, PKB has an N-terminal pleckstrin homology (PH) domain
that binds phosphoinositides and targets the kinase to the plasma
membrane (28). PKB is highly conserved, ubiquitously expressed, and
activated by many cell surface receptors, most notably IGF-I (31, 33).
IGF-I-mediated activation of PKB is dependent on the activation of
upstream kinases, PI3-K and PDK1 (28). Some of the targets of PKB
action in cells are known. These include the forkhead (FKHR-1)
transcription factor (33), which regulates the transcriptional activity
of genes, including the insulin-like growth factor binding protein
(IGFBP-1) (31); glycogen synthase kinase-3 (GSK-3)(27, 59); and the
apoptotic factors, BAD and caspase-9 (Ref. 33 and references therein),
as well as IKK
(59, 60). Phosphorylation of these proteins by PKB
renders them inactive (59). One isoform of PKB, PKBß/Akt2, has been
shown to be amplified in ovarian carcinomas (61). In contrast,
expression of Sgk is hormonally regulated rather than constitutive and
its transcription is controlled by numerous hormones (62, 63, 64, 65),
including FSH/cAMP (23, 24). With the exception of an epithelial sodium
channel (64, 65), functional targets of Sgk action remain largely
unknown. Based on the preferred consensus substrate for each kinase
[PKB: RNRNN (S/T) and Sgk: KKRNRRLS] (26, 33), it is likely that they
phosphorylate different substrates and thereby control distinct
cellular functions, some of which, based on their coordinated
activation by PI3-K/PDK1, may be synergistic. Sgk may be one of the
missing links by which PI3-K mediates the expression of
phosphoenolpyruvate carboxykinase (PEPCK) (66, 67).
In the rat ovary, PKB is constitutively expressed in granulosa cells
and luteal cells. Most striking is the rapid phosphorylation (and
activation) of PKB in granulosa cells in response to FSH/T (forskolin
and 8-bromo-cAMP), which mimics the response stimulated by IGF-I.
Furthermore, the pathways by which FSH and IGF-I stimulate PKB
phosphorylation appear to involve similar intermediary steps.
Specifically, the A kinase inhibitor H89 does not block phosphorylation
of PKB by FSH/cAMP, indicating that it occurs by mechanisms independent
of A kinase. Cass and colleagues (41, 58) have made similar
observations; TSH and cAMP stimulate PKB phosphorylation in a thyroid
cell line that is independent of A kinase. Rather, rapid
phosphorylation of PKB by either FSH or IGF-I was blocked by the PI3-K
inhibitors, LY294002 and wortmannin, and to a lesser extent by the
p38MAPK inhibitor, SB203580. Thus, FSH, forskolin, and 8-bromo-cAMP can
be added to the growing list of stimuli known to rapidly phosphorylate
and thereby activate PKB. Moreover, FSH/cAMP and IGF-I acted
synergistically to enhance PKB phosphorylation, indicating that signals
activated by FSH (cAMP) impact the same or a similar signaling cascade
and target the same substrates (i.e. GSK-3) as IGF-I. This
synergism between cAMP and IGF-I on PKB phosphorylation may be one
crucial mechanism by which these pathways enhance expression of genes
such as aromatase and the LH receptor. The ability of PMA to prevent
FSH-stimulated (but not IGF-I stimulated) phosphorylation of PKB
indicates that activation of C kinase antagonizes the steps(s) by which
FSH mediates activation of PI3-kinase or PDK1. Moreover, these steps
(Ras-like related proteins?) controlled by FSH are distinct from those
activated by the IGF-I pathway.
FSH/cAMP-mediated phosphorylation of PKB and GSK-3 is biphasic: PKB
phosphorylation increases rapidly within 0.5 to 1 h, declines at
6 h, and exhibits a secondary, progressive increase from 1248 h,
a pattern similar to the induction of Sgk (23, 24, 25). These results
indicate that as granulosa cells differentiate in response to FSH/T or
forskolin, the phosphorylation of PKB is increased. Unexpectedly, the
ability of PI3-K and p38MAPK inhibitors to block or reduce PKB
phosphorylation was diminished as granulosa cells differentiate. Thus,
although LY294002 and wortmannin completely blocked PKB phosphorylation
if added from 2324 h of culture, this response was greatly diminished
if the inhibitors were added from 4748 h. By 48 h of culture
with FSH/T, PKB phosphorylation was only partially reduced by the
addition of LY294002 or wortmannin for 1 h, whereas longer
exposure (2 h and 4 h) did reduce PKB phosphorylation. These
results clearly show that a pathway distinct from that of A kinase is
involved in PKB phosphorylation by FSH/T and forskolin in granulosa
cells. These results also indicate that as granulosa cells
differentiate, intracellular mechanisms favoring high steady-state
levels of PKB phosphorylation are established. What these mechanisms
are remain highly speculative. Since the phosphorylation of Sgk as well
as PKB is increased as the cells differentiate, perhaps the most likely
explanation for the loss of sensitivity to the kinase inhibitors is
that the content or activity of an endogenous phosphatase is
greatly decreased. Therefore, the turnover of phosphate
would be less. Alternatively, there may be decreased activity of the
lipid phosphatase PTEN (phosphatase and tensin homolog deleted on
chromosome 10), which regulates the levels of activating
phosphoinositides (68, 69), or in the differentiated cells the
phosphorylation of PKB and Sgk may be regulated by activation of other
kinases that are less sensitive to LY294002 and wortmannin. If one role
of activated PKB is to favor cell survival and prevent apoptosis, the
elevated levels of phospho-PKB in the differentiated granulosa cells at
48 h may play a role in maintaining and establishing the stable
phenotype of luteal cells.
More complex is the manner by which FSH/T and forskolin regulate the
expression and phosphorylation of Sgk, a PKB-related kinase. We have
shown herein and elsewhere (23, 24, 25) that FSH/T and forskolin induce Sgk
in a biphasic manner. Based on transfection studies and analyses of
mRNA, the rapid effects of FSH and forskolin appear to be mediated
primarily at the transcriptional level and involve the transcription
factors Sp1/Sp3 (23). The studies herein confirm that the rapid
increase in Sgk protein occurs primarily by an A kinase-dependent (H89
inhibited) mechanism: neither IGF-I nor PMA caused major increases in
Sgk protein. However, A kinase is not the only factor involved in
mediating the rapid phosphorylation of Sgk that occurs in response to
FSH/T and forskolin. The PI3-K inhibitors LY294002 and wortmannin, as
well as the p38MAPK inhibitor SB203580, reduced the levels of
phosphorylated Sgk at 1 h. Although IGF-I did not increase the
levels of Sgk protein, this growth factor did stimulate Sgk
phosphorylation by mechanisms that were sensitive to inhibitors of
PI3-K and p38MAPK. The marked inhibitory effect of LY294002 compared
with wortmannin on FSH- and forskolin-mediated induction and
phosphorylation of Sgk suggests that LY294002 is more effective in
blocking a specific isoform of PI3-K or another kinase that is critical
for the phosphorylation of Sgk. Of note, the Sgk antibody is not a
phospho-specific antibody. Therefore, multiple bands observed by
Western blot likely reflect phosphorylation at multiple sites by
multiple kinases. Furthermore, the loss of Sgk protein in response to
LY294002, as well as p38MAPK inhibitor SB203580, suggests that
phosphorylated forms of Sgk may be more stable than
nonphosphorylated Sgk. By preventing phosphorylation, LY294002 and
SB203580 allow increased degradation of Sgk protein. In this regard, it
is of interest that both the amount, as well as the phosphorylation, of
Sgk increase markedly in granulosa cells cultured in the presence of
FSH/T for 2448 h. At 24 h, Sgk phosphorylation was no longer
inhibited by H89 or SB203580; by 48 h Sgk phosphorylation was much
less sensitive to the inhibitor effects of LY294002 and wortmannin.
These results indicate that the steady-state levels of Sgk and
phospho-Sgk were enhanced as the cells differentiated. Thus, Sgk
appears to act in concert with PKB to maintain expression of genes
(aromatase and LH receptor?) and to establish the stable luteal cell
phenotype.
The mechanisms that control the phosphorylation of p38MAPK by FSH
and forskolin are distinct from those regulating phosphorylation of PKB
and Sgk. Based on results presented herein and published recently by
others, both positive (Ras-Raf-mediated and A-kinase) and negative
(A-kinase and PI3-K-mediated) regulatory mechanisms appear to be
involved (42, 70, 71). Specifically, FSH-mediated phosphorylation of
p38MAPK has been reported to be dependent on A-kinase
(H89-sensitive) (42). In contrast, we observed that inhibition of A
kinase (H89), as well as PI3-K (LY294002), enhanced FSH- as well as
IGF-I-mediated phosphorylation of p38MAPK. Although these two studies
have used similar granulosa cell culture models and doses of hormone,
Maizels et al. (42) analyzed p38MAPK phosphorylation at 10
min after addition of hormone rather than at 1 h as described
herein. One explanation to account for these different observations is
that there is a rapid but narrow time interval during which p38MAPK
phosphorylation is A kinase dependent [10 min in the study by Maizels
et al. (42)]. After this critical interval, there appear to
be other mechanisms (both positive and negative) by which cAMP
regulates the phosphorylation of p38MAPK, and these appear to be
similar to those by which IGF-I mediates p38MAPK phosphorylation.
Positive regulation of p38MAPK by IGF is mediated indirectly by
activation of specific Ras-Raf proteins (70). Negative
regulation of MAPK (and therefore possibly p38MAPK) by IGF-I is
mediated by activation of PI3-K and PKB, the latter of which
phosphorylates and inactivates Raf as indicated by recent genetic
approaches (71, 72). Thus the balance and interaction of p38MAPK and
PKB may be critical for altering cell function since p38MAPK also
impacts phosphorylation of PKB. We show herein that granulosa cells and
luteal cells express the Ras-related proteins Ki-Ras, confirming
results of others (73) as well as Rap1 and Rap2 (74). Granulosa cells
also express several members of the Raf family of serine kinases:
Raf-1, A-Raf , and B-Raf providing several downstream targets for
Ras-like proteins. In addition, granulosa cells express the
guanine nucleotide exchange factors, cAMP-GEFI (also known as Epac) and
cAMP-GEFII. Thus, it is highly likely that in granulosa cells FSH via
cAMP activates p38MAPK by a cascade involving cAMP-GEFs, specific
GTPases (most likely Rap1), and one or more of the serine/threonine
kinases [most likely B-Raf (43, 46)] or another related protein.
Since FSH/T and forskolin can also phosphorylate and activate PKB,
FSH/T (cAMP) likely exerts its inhibitory effects on p38MAPK by
activating PKB, as has been documented for IGF-I (71, 72).
Alternatively, the negative effects of FSH may be mediated by selective
activation of Raf-1 (44).
In summary, we provide several lines of evidence that FSH impacts
different cellular signaling cascades in granulosa cells that lead to
the phosphorylation of diverse kinases: PKB, Sgk, and p38MAPK (Fig. 10
). 1) FSH via cAMP (but not A kinase) activates the PI3-K pathway
leading to the phosphorylation of PKB. This effect of FSH mimics and
enhances IGF-I-mediated phosphorylation of PKB. FSH/cAMP activation of
PI3-K likely involves a specific Ras or Ras-related protein such as the
cAMP-GEFs since the effects of FSH [like TSH (41)] were mimicked by
forskolin and 8-bromo-cAMP. However, we cannot entirely rule out the
possibility that FSH also activates Gß
that can activate PI3-K
,
a specific isoform of PI3-K. PMA (C kinase) blocks FSH- but not
IGF-I-mediated phosphorylation of PKB, indicating that FSH and IGF-I
enter the PI3-K pathway by different steps. 2) FSH/cAMP acts via A
kinase to induce expression of Sgk. Sgk is then phosphorylated and
activated by A kinase and PI3-K pathways. 3) FSH via a putative
cAMP-GEF/ras/raf pathway leads to the phosphorylation of p38MAPK,
whereas both A-kinase and PI3-K/PKB inhibit this cAMP-GEF/ras/raf
pathway. Based on the absence of an effect of the MEK1 inhibitor
(PD98059) on the phosphorylation of PKB, Sgk, and p38MAPK, the ERK
pathway has been omitted from the diagram.
Since IGF-I alone can phosphorylate PKB but is less effective in
stimulating granulosa cell differentiation, the transcriptional
activation of specific genes in granulosa cells appears to require
hormone/cAMP activation of A kinase and other signaling cascades. The
PKB and Sgk pathways appear to be enhanced in terminally differentiated
granulosa cells, indicating that they act in concert as survival
factors. Coincident with this, A kinase and PI3-K/PKB appear to exert
negative feedback effects on the putative GEF/ras-rap/raf activation of
p38MAPK. These results provide some of the first evidence in granulosa
cells that FSH and cAMP act to coordinate diverse cellular signaling
cascades that are independent of A kinase activation.
 |
MATERIALS AND METHODS
|
|---|
Reagents
Media and cell culture reagents and materials were
purchased from Life Technologies, Inc. (Gaithersburg, MD),
Sigma (St. Louis, MO), Research Organics (Cleveland, OH),
Fisher Scientific (Fairlawn, NJ), Corning, Inc., Corning, NY), and HyClone Laboratories, Inc.
(Logan, UT). Trypsin, soybean trypsin inhibitor, DNAse, PMA, ATP,
dithiothreitol (DTT), 17ß-estradiol, 8-bromo-cAMP, and propylene
glycol were all purchased from Sigma. Ovine FSH (oFSH-16)
was a gift of the National Hormone and Pituitary Program (Rockville,
MD). Human chorionic gonadotropin (hCG) was from Organon
Special Chemicals (West Orange, NJ). Antibodies for PKB 9272,
phospho(ser 473)PKB 9271S, p38MAPK 9212, and
phospho(thre180/tyr182)p38MAPK 9211S and phospho(ser21/9)GSK-3
/ß
93313 were from New England Biolabs, Inc. (Beverly, MA).
Antibodies for Rap 1 (121:sc-65), Raf-1 (C-12; SC-133), Raf-B (C19;
SC-166) and Raf-A (C-20; SC-408), Ki-Ras (pan-ras; F132; SC-32), and
GSK-3 (SC-7879) were from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Antibodies for Rap2 (R 230200) were from
Transduction Laboratories, Inc. (Lexington, KY). Affinity-
purified Sgk antibody was generated in the laboratory of Dr. Gary
Firestone (Berkeley, CA). Inhibitor LY294002 (270038-M005) was from
Alexis (San Diego, CA), and wortmannin (no. 681675), SB203580 (no.
559395), and H89 (no. 371963) were from Calbiochem (San
Diego, CA). PD98059 (no. 9900S) was from New England Biolabs, Inc. and GF109203X (no. G2911) was from Sigma.
TRIzol reagent (no. 15596) was obtained from Life Technologies, Inc. Electrophoresis and molecular biology grade reagents were
purchased from Sigma, Bio-Rad Laboratories, Inc. (Richmond, CA), and Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were purchased
from Genosys (The Woodlands, TX). All RT-PCR reagents were from
Promega Corp. (Madison, WI) except for
deoxyribonucleotides (dNTPs; Roche Molecular Biochemicals).
-32P[dCTP] was from
ICN Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL).
Animals
Intact immature (day 23 of age) Holtzman Sprague Dawley
female rats (Harlan Sprague Dawley, Inc., Indianapolis,
IN) were housed under a 16-h light, 8-h dark schedule in the Center for
Comparative Medicine at Baylor College of Medicine and provided food
and water ad libitum. Animals were treated in accordance
with the NIH Guide for the Care and Use of Laboratory Animals, as
approved by the Animal Care and Use Committee at Baylor College of
Medicine (Houston, TX).
Granulosa Cell Cultures
Granulosa cells were harvested from untreated or E-primed
immature (day 25) rats as previously described (3, 4) and as indicated
in the Results and figure legends. Briefly, cells were
cultured at a density of 1 x 106 cells per
3 ml serum-free medium (DMEM:F12 containing Penicillin and
Streptomycin) in multiwell (35-mm) dishes that were serum coated (4).
Cells were cultured in defined medium overnight (0 h) followed by the
addition of FSH (50 ng/ml) and T (10 ng/ml), forskolin (10
µM), and other agonists/inhibitors as indicated
in the figures and figure legends. FSH/T were used to stimulate the
differentiation including the induction of aromatase (4), LH receptor
(9), and inhibin (14). Forskolin and 8-bromo-cAMP alone were used to
determine the relative effects of cAMP on specific cell functions.
RNA Isolation and RT-PCR Assays
Total RNA was isolated from cultured cells with Trizol according
to specifications provided by the manufacturer. Each RNA sample was
pooled from three replicate wells. The RNA was purified by sequential
phenol, phenol-chloroform, and chloroform extraction, followed by
ethanol precipitation. The RNA was resuspended in 0.1%
diethylpyrocarbamate-treated water and its concentration determined by
absorbance at 260 nm.
Based on the known sequences for cAMP-GEFI [Genbank accession no.
U78167 (47, 48)], cAMP-GEFII [Genbank accession nono..U78517 (48)], and
Rap1b (Genbank accession no. U07795), oligonucleotide primer pairs were
designed and used in the RT-PCR reactions according to procedures
described previously (51). After the RT step that contained 500 ng
input RNA, the reaction mixture was split into separate aliquots to
which specific primer pairs for cAMP-GEFI (forward,
5'-TGGTGCTGAAGAGAATGCAC-3' and reverse
5'-CCTGGAAGGTCCAGTCATGT-3', cAMP-GEFII (forward,
5'-AGGTGCTTTTGCAGCAGTTT-3' and reverse,
5'-GGTACGCCAAGTCTTTCGAG3') Rap1b (forward,
TTATAGAAAGCAAGTTGAAGT and reverse,
CACTAGGTCATAAAAGATCTCG) or the ribosomal protein
L19 (75) were added for 30 cycles using standard temperatures and times
that gave a linear increase of DNA product to input RNA from 300 to
1500 ng (data not shown). The amplified cDNA products for cAMP-GEFI
(399 bp), GEFII (404 bp), Rap1b (370 bp), and L19 (196 bp) were
resolved by acrylamide gel electrophoresis, and radioactive PCR product
bands were quantified by phosphoimage analysis (Betascope 603 Blot
Analyzer; Betagen Corp., Mountain View, CA). Separate reactions were
done for L19 since generation of the L19 product interfered with the
amplification of cAMP-GEFI and cAMP-GEFII. Data are presented as the
ratio of radioactivity in the GEFI/GEFII lanes relative to L19
bands.
Cell Extracts and Western Blot Analyses
Total cell extracts were prepared according to a method of Ginty
(76) by adding to each well hot (100 C) Tris-buffer containing 10% SDS
and ß-mercaptoethanol. The cells were rapidly scraped with a rubber
policeman and the extract transferred to an Eppendorf tube
(Madison, WI) at 100 C for 5 min. Extracts were stored at 4 C until
analyzed by SDS-PAGE). After SDS-PAGE, samples were electrophoretically
transferred to nylon filter, washed briefly in PBS, and blotted with
either 3% BSA or 5% Carnation milk at room temperature for 1 h.
Antibodies were added in the same blocking solutions at the dilutions
indicated in the figure legends. Immunoreactive proteins were
visualized with enhanced chemiluminescence (ECL) according to the
specification of the supplier (Pierce Chemical Co.,
Rockford, IL). Immunoreactive bands were quantified by image analysis
of autoradiograms (ECL) using AlphaImager 2000 (3.3), (Alpha Innotech
Corp., San Leandro, CA).
PKB Enzyme Activity
To measure the enzymatic activity of PKB, granulosa cells were
cultured as in previous experiments. Cells were lysed, extracts were
prepared, and the activity of PKB/Akt was measured using the Akt kinase
assay kit (New England Biolabs, Inc.). Briefly, PKB was
immunoprecipitated (IP) using an anti-PKB antibody cross-linked to
agarose hydrazide beads. After IP, the beads were washed and incubated
with a kinase reaction mixture containing GSK-3
/ß cross-tide
fusion protein and ATP. Phosphorylated GSK-3
/ß was analyzed by
SDS-PAGE and immunodetection with a specific anti-phospho (ser21/9)
GSK-3
/ß antibody.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: JoAnne S. Richards, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu
These studies were supported in part by NIH Grants HD-16272 and 16229
(J.S.R.) and CA-71514 (G.L.F.).
Received for publication December 20, 1999.
Revision received April 6, 2000.
Accepted for publication April 27, 2000.
 |
REFERENCES
|
|---|
-
Richards J 1994 Hormonal control of gene expression in
the ovary. Endocr Rev 15:725751[CrossRef][Medline]
-
Robker R, Richards J 1998 Hormone-induced proliferation and
differentiation of granulosa cells: a coordinated balance of the cell
cycle regulators cyclin D2 and p27KIP1. Mol Endocrinol 12:924940[Abstract/Free Full Text]
-
Robker R, Richards J 1998 Hormonal control of the cell cycle
in ovarian cells: proliferation versus differentiation. Biol Reprod 59:476482[Free Full Text]
-
Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome
P450 aromatase messenger ribonucleic acid and activity by steroids and
gonadotropins in rat granulosa cells. Endocrinology 129:14521462[Abstract]
-
Adashi EY, Resnick CE, Hernandez ER, May JV, Knecht M,
Svoboda ME, Van Wyk JJ 1988 Insulin-like growth factor-I as an
amplifier of follicle-stimulating hormone action: studies on
mechanism(s) and site(s) of action in rat granulosa cells.
Endocrinology 122:15831591[Abstract]
-
Hirakawa T, Minegishi T, Abe K, Kishi H, Ibuki Y,
Miyamoto K 1999 A role of insulin-like growth factor I in
luteinizing hormone receptor expression in granulosa cells.
Endocrinology 140:49654971[Abstract/Free Full Text]
-
Poretsky L, Cataldo NA, Rosenwaks Z, Guidice LC 1999 The
insulin-related ovarian regulatory system in health and disease. Endocr
Rev 20:535582[Abstract/Free Full Text]
-
Fitzpatrick SL, Carlone DL, Robker RL, Richards JS 1997 Expression of aromatase in the ovary: down-regulation of mRNA by the
ovulatory luteinizing hormone surge. Steroids 62:197206[CrossRef][Medline]
-
Segaloff DL, Wang H, Richards JS 1990 Hormonal regulation of
LH/CG receptor mRNA in rat ovarian cells during follicular development
and luteinization. Mol Endocrinol 4:18561865[Abstract]
-
Richards JS, Russell DL, Robker RL, Dajee M, Alliston TN 1998 Molecular Mechanisms of ovulation and luteinization. Mol Cell
Endocrinol 145:4754[CrossRef][Medline]
-
Taylor SS 1989 cAMP-dependent protein kinase. J Biol Chem 264:84438446[Free Full Text]
-
Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates
somatostatin gene transcription by phosphorylation of CREB at serine
133. Cell 59:675680[CrossRef][Medline]
-
Carlone DL, Richards JS 1997 Functional interactions,
phosphorylation, and levels of 3'5'-cyclic adenosine
monophosphate-regulatory element binding protein and steroidogenic
factor-1 mediate hormone-regulated and constitutive expression of
aromatase in gonadal cells. Mol Endocrinol 11:292304[Abstract/Free Full Text]
-
Mukherjee A, Park-Sarge O-K, Mayo KE 1996 Gonadotropins induce
rapid phosphorylation of the 3',5'-cyclic adenosine monophosphate
response element binding protein in ovarian granulosa cells.
Endocrinology 137:32343245[Abstract]
-
Fitzpatrick SL, Richards JS 1994 Identification of a cyclic
adenosine 3',5'-monophosphate response element in the rat aromatase
promoter that is required for transcriptional activation in rat
granulosa cells and R2C Leydig cells. Mol Endocrinol 8:13091319[Abstract]
-
Mukherjee A, Urban J, Sassone-Corsi P, Mayo KE 1998 Gondadotropins regulate inducible cyclic adenosine 3',5'-monophosphate
early repressor in the rat ovary. Mol Endocrinol 12:785800[Abstract/Free Full Text]
-
Hansen TVO, Rehfeld JF, Nielson FC 1999 Mitogen-activated
protein kinase and protein kinase A signaling pathways stimulate
cholecystokinin transcription via activation of cyclic adenosine
3',5'-monophosphate response element-binding protein. Mol Endocrinol 13:466475[Abstract/Free Full Text]
-
Seternes OM, Johansen B, Moens U 1999 A dominant role for the
Raf-MEK pathway in forskolin,120-tetradecanoly-phorbol acetate, and
platelet-derived growth factor-induced CREB (cAMP-responsive
element-binding protein) activation, uncouples from serine 133
phosphorylation in NIH 3T3 cells. Mol Endocrinol 13:10711083[Abstract/Free Full Text]
-
Gutkind JS 1998 The pathways connecting G protein-coupled
receptors to the nucleus through divergent mitogen-activated protein
kinase cascades. J Biol Chem 273:18391842[Free Full Text]
-
Dhanasekaran N, Heasley LE, Johnson GL 1995 G-protein-coupled receptor systems involved in cell growth and
oncogenesis. Endocr Rev 16:259270[CrossRef][Medline]
-
Leopoldt D, Hanck T, Exner T, Maier U, Wetzker R, Nurenberg B 1996 Gbg stimulates phosphoinositide 3-kinase-
by direct
interaction with two domains of the catalytic p110 subunit. J Biol
Chem 273:70247029[Abstract/Free Full Text]
-
Jordon JD, Carey KD, Stork PJS, RI 1999 Modulation of
Rap activity by direct interaction of G
o with Rap1
GTPase-activating protein. J Biol Chem 274:2150721510[Abstract/Free Full Text]
-
Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS 1997 Follicle stimulating hormone-regulated expression of
serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a
functional role for the Sp1 family in promoter activity. Mol Endocrinol 11:19341949[Abstract/Free Full Text]
-
Alliston TN, Gonzalez IG, Firestone GL, Richards JS 2000 Expression, localization of serum/glucocorticoid-induced kinase in the
rat ovary: relation to follicular growth, differentiation.
Endocrinology 141:385395[Abstract/Free Full Text]
-
Gonzalez-Robayna IJ, Alliston TN, Buse P, Firestone GL,
Richards JS 1999 Functional and subcellular changes in the A-kinase
signaling pathway: relation to aromatase and sgk expression during the
transition of granulosa cells to luteal cells. Mol Endocrinol 13:13181337[Abstract/Free Full Text]
-
Park J, Leong MLL, Buse P, Maiyar AC, Firestone GL, Hemmings
BA 1999 Serum and glucocorticoid-inducible kinase (SGK) is a target of
PI 3-kinase-stimulated signaling pathway. EMBO J 18:30243033[CrossRef][Medline]
-
Franke TF, Kaplan DR, Cantley LC 1997 PI3K: Downstream AKTion
blocks apoptosis. Cell 88:435437[CrossRef][Medline]
-
Remah LE, LCC 1999 The role of phosphoinositide 3-kinase
lipid products in cell function. J Biol Chem 274:83478350[Free Full Text]
-
Pullen N, Dennis PB, Andjelkovic M, Dufner A, Kozma SC,
Hemmings BA, Thomas G 1998 Phosphorylation and activation of p70s6k by
PDK1. Science 279:707710[Abstract/Free Full Text]
-
Datta SR, Brunet A, Greenberg ME 1999 Cellular survival: a
play in three Akts. Genes Dev 13:29052927[Free Full Text]
-
Guo S, Rena G, Cichy S, He X, Cohen P, Unterman T 1999 Phosphorylation of serine 256 by protein kinase B disrupts
transactivation by FKHR and mediates effects of insulin on insulin-like
growth factor-binding protein-1 promoter activity through a conserved
insulin response sequence. J Biol Chem 274:1718417192[Abstract/Free Full Text]
-
Rena G, Guo S, Cichy SC, Unterman TG, Cohen P 1999 Phosphorylation of the transcription factor forkhead family member FKHR
by protein kinase B. J Biol Chem 274:1717917183<