help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gonzalez-Robayna, I. J.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gonzalez-Robayna, I. J.
Right arrow Articles by Richards, J. S.
Molecular Endocrinology 14 (8): 1283-1300
Copyright © 2000 by The Endocrine Society

Follicle-Stimulating Hormone (FSH) Stimulates Phosphorylation and Activation of Protein Kinase B (PKB/Akt) and Serum and Glucocorticoid-Induced Kinase (Sgk): Evidence for A Kinase-Independent Signaling by FSH in Granulosa Cells

Ignacio J. Gonzalez-Robayna, Allison E. Falender, Scott Ochsner, Gary L. Firestone and JoAnne S. Richards

Department of Molecular and Cellular Biology (I.J.G.R., A.E.F., S.O., J.S.R.) Baylor College of Medicine Houston, Texas 77030
Department of Molecular and Cell Biology (G.L.F.) University of California Berkeley Berkeley, California 94720


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FSH stimulates in ovarian granulosa cells diverse, differentiation-dependent responses that implicate activation of specific cellular signaling cascades. In these studies three kinases were investigated to determine their relationship to FSH, cAMP, and A kinase signaling: protein kinase B (PKB/Akt), serum and glucocorticoid-induced kinase (Sgk), and p38 mitogen-activated protein kinase (p38MAPK). The phosphorylation (activation) of these kinases was analyzed by using selective agonists/inhibitors: forskolin/H89 for cAMP-dependent protein kinase (A kinase), insulin-like growth factor I (IGF-I)/LY294002 and wortmannin for phosphatidylinositol-dependent kinase (PI3-K), and phorbol myristate (PMA)/GF109203X for diacylglycerol and Ca++-dependent kinases (C kinases). An inhibitor (PD98059) of MEK1, which regulates extracellular regulated kinases (ERKs), and SB203580, which inhibits p38MAPK, were also used. In addition, we analyzed the expression of the recently described, cAMP-regulated guanine nucleotide exchange factors (cAMP-GEFI and GEFII) that impact Ras-related GTPases and Raf kinases, known regulators of various protein kinase cascades. We provide evidence that FSH, forskolin, and 8-bromo-cAMP stimulate phosphorylation of PKB by mechanisms involving PI3-K (LY294002/wortmannin sensitive) not A kinase (H89 insensitive), a pattern of response mimicking that of IGF-I. In contrast, FSH induction and phosphorylation of Sgk protein requires A kinase (H89 sensitive) but also involves PI3-K (LY294002 sensitive) as well as p38MAPK (SB203580 sensitive) pathways. PMA (C kinase) abolished FSH-mediated (but not IGF-I-mediated) phosphorylation of PKB at a step(s) upstream of PI3-K and independent of A kinase. Lastly, FSH-mediated phosphorylation of p38MAPK is negatively affected by A kinase and PI3-K, suggesting that it may be downstream of specific members of the cAMP-GEF/Rap/Raf pathway. We propose that cAMP activation of A kinase is obligatory for transcription of Sgk in granulosa cells whereas cAMP (IGF-I-like)-mediated phosphorylation (activation) of PKB and Sgk (via PI3-K), as well as p38MAPK, involves other cellular events. These results provide new and exciting evidence that cAMP acts in granulosa cells by A kinase-dependent and -independent mechanisms, each of which controls specific kinase cascades.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The growth of ovarian follicles and the differentiation of granulosa cells are complex processes that depend on the pituitary gonadotropins, FSH and LH (1). During follicular growth the response of granulosa cells to these hormones changes dramatically; the precise molecular and biochemical mechanisms involved remain largely unknown. In small follicles, FSH regulates granulosa cell proliferation and the expression in these cells of the cell cycle-regulatory molecule, cyclin D2 (2, 3). As follicles mature to the preovulatory stage, FSH induces the expression of differentiation-specific genes encoding aromatase and LH receptor (1). These effects of FSH on granulosa cell function can be enhanced by steroids (1, 4) and IGF-I (5, 6, 7). The LH surge, in turn, rapidly curtails the proliferation of granulosa cells and stimulates their terminal differentiation to luteal cells. Within 2–5 h after the LH surge, cellular levels of mRNA and protein for cyclin D2 (2, 3), aromatase (8), and the LH receptor (9) are drastically reduced. Although the LH surge down-regulates the expression of these genes associated with follicular development, it induces the expression of genes involved in ovulation and luteinization (10). Within 5 h of exposure to the LH surge, granulosa cells have been entirely reprogrammed to become nondividing, functional luteal cells. Once granulosa cells have terminally differentiated to luteal cells, their response to LH is markedly altered, and they no longer respond to changes in cAMP.

The binding of FSH and LH to their cognate receptors leads to the stimulation of adenylyl cyclase and the production of cAMP. A plethora of studies have documented convincingly that cAMP mediates many intracellular functions by activating cAMP-dependent protein kinase, A kinase (11). The activated A kinase catalytic (C) subunit can translocate to the nucleus and phosphorylate transcription factors, such as the cAMP responsive element (CRE) binding protein CREB (12, 13, 14) leading to increased expression of ovarian genes, such as aromatase (13, 15) and inhibin {alpha} (16). Recent studies indicate that transcriptional activation of CREB is more complex since phosphorylation of Ser133 is necessary but not sufficient for activation of transcription (17, 18). Moreover, there are many genes induced by FSH and LH in granulosa cells that do not contain CREs within their proximal promoters and are induced by other transcription factors and response elements (1, 10). Increasing evidence also indicates that multiple cellular signaling cascades, in addition to A kinase, coordinate cellular responses to trophic hormone stimulation of G protein-coupled receptors (19, 20, 21, 22).

One gene that is transcriptionally regulated by FSH and A kinase in granulosa cells is an immediate-early kinase, known as serum- and glucocorticoid-inducible kinase (Sgk) (23, 24, 25). FSH-mediated transcription of this gene in granulosa cells is biphasic and regulated, in part, by Sp1/Sp3 but not CREB (23). The initial induction of Sgk is rapid and is associated with proliferative stages of granulosa cell function. At this time Sgk is localized to the nucleus (24, 25). The secondary increase in Sgk occurs as granulosa cells differentiate into luteal cells; in these cells Sgk is preferentially localized to the cytoplasm (24, 25). These observations have been made both in vivo as well as in primary granulosa cells in culture, thereby suggesting that Sgk can phosphorylate nuclear targets as well as cytoplasmic targets.

Interestingly, Sgk has recently been shown to have its highest homology to protein kinase B (PKB)/(Akt) and to require phosphorylation (Thr 256) within its activation loop for activation (26). Upstream kinases in the cascade leading to the phosphorylation of PKB (27) and Sgk (26) include the dual functional phosphatidylinositol 3-kinase (PI3-K) (28) and phosphoinositide-dependent kinase (PDK1) (28, 29). PKB, in turn, is known to phosphorylate numerous proteins, among which are glycogen synthase kinase-3 (GSK-3) (30) and the winged-helix family of transcription factors known as Forkhead (FKHR) (31, 32, 33). This pathway is stimulated by numerous growth factors including insulin and insulin-like growth factor I (IGF-I) (34, 35) by activation of monomeric Ras or ras-related proteins (36). Importantly, this IGF-I/PKB/FKHR pathway has been conserved from Caenorhabditis. elegans (characterized by various daf mutants) to mammals (32, 33, 37, 38). Recently, additional links between G protein-coupled receptors, cAMP, and PI3-K signaling pathways have been observed (19, 21). The activation loop of A kinase, like that of PKB and Sgk, has been shown to be a substrate for PDK1 (39). Conversely, overexpression of A kinase has been shown to activate PKB by a PI3-K-independent pathway (40) whereas TSH via cAMP (but not A kinase) has been shown to stimulate phosphorylation of PKB/Akt in a thyroid cell line (41). In some cells, Gß{gamma} activates PI3-K (19, 20, 21).

Based on these and other recent studies it now appears that cAMP may act at a specific molecular "switch board" to control diverse cellular signaling pathways in a cell- and tissue-specific manner. For example, FSH has been reported to activate p38 mitogen- activated protein kinase (p38MAPK) in granulosa cells via A kinase (42). In PC12 cells, cAMP has been shown to differentially alter the activity of two serine/threonine kinases, Raf-1 and B-Raf, by mechanisms that are dependent of A kinase activation of Rap1 (43, 44). Whereas cAMP exerts inhibitory effects on Raf-1, it stimulates B-Raf (43, 45, 46). In addition to A kinase, recent studies have identified a set of cAMP-regulated guanine nucleotide exchange factors (cAMP-GEFs) that includes cAMP-GEFI (also called Epac, exchange protein directly activated by cAMP) (47, 48) and cAMP-GEFII (48). cAMP-GEFI has been shown to regulate the activity of Rap1, and GTP-Rap1 can activate B-Raf kinase, leading to activation of the extracellular regulated kinase (ERK) pathway. These cAMP-GEFs, by virtue of their activation of Rap-1 (43, 44) and possibly other GTPases, are potential activators of PI3-K, a known target of Ras (36, 49). Thus, cAMP may regulate specific members of the PKB and MAPK pathways (ERK, p38MAPK, and JNK) by A kinase-independent as well as A kinase-dependent mechanisms.

Based on these observations, we hypothesized that changes in the response of granulosa cells to FSH and LH during differentiation might involve A kinase activation of target genes, such as Sgk and aromatase, as well as the activation by cAMP (or Gß{gamma}) of alternative cellular signaling cascades that might impact Sgk. To explore these possibilities, we have analyzed and compared the pattern of expression and phosphorylation (activation) of Sgk, PKB, and p38MAPK in granulosa cells cultured in the presence of a variety of agonists known to stimulate A kinase (FSH/T, forskolin), C kinase [phorbol myristate (PMA)], and PI3-K (IGF-I). We have also analyzed the effects of selective antagonists of A kinase (H89), C kinase (GF109203X), PI-3K (LY294002 and wortmannin), and MEK1 [the upstream regulator of extracellular regulated kinases, ERK (PD98059) and p38 mitogen-activated kinase, p38MAPK (SB203580)] on the expression, phosphorylation, and activity of PKB and Sgk. Lastly, we analyzed the expression pattern of cAMP-GEFI and GEF-II, Rap-1 and Rap-2, as well as three members of the Raf family of serine/threonine kinases (Raf-1, B-Raf, and A-Raf) thought to be regulated by the Rap-related GTPases. A schematic outline of the signaling pathways analyzed in granulosa cells is summarized in Fig. 10.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PKB Is Phosphorylated in Granulosa Cells Cultured with FSH/T and Forskolin
PKB has been shown to be phosphorylated and activated by several cellular signaling pathways. To determine whether FSH might regulate the function of granulosa cells via this pathway, granulosa cells were isolated from ovaries of 17ß-estradiol-primed, immature female rats and cultured overnight in defined medium (DMEM:F12) on serum-coated dishes (4). At that time FSH (50 ng/ml) and testosterone (T; 10 ng/ml) were added to the cultures to stimulate granulosa cell differentiation leading to the transcription of genes, such as aromatase (CYP19) (4) and LH receptor (9), that specifically characterize granulosa cells of preovulatory follicles (1). At selected time intervals (0–48 h), protein extracts were prepared using a buffer containing SDS (25). The presence of PKB and phospho-PKB was analyzed by Western blotting using antibodies specific for the nonphosphorylated (inactive) and phospho- (active) forms of PKB (Fig. 1AGo). Nonphosphorylated PKB was present in granulosa cells at 0 h and remained essentially constant during culture with FSH/T (Fig. 1AGo). In these same samples, phospho-PKB was low/negligible in cells cultured overnight in the absence of hormone. However, PKB was phosphorylated within 0.5 h after the addition of FSH/T and by 1.5 h reached a level 6-fold above that of nontreated cells. The amount of phospho-PKB decreased 50% at 6 h but began to increase again at 12 h and reached it highest level (9-fold above baseline) at 48 h after addition of FSH/T. These results indicate that PKB is constitutively expressed but rapidly phosphorylated in granulosa cells by exposure to FSH/T. The FSH-mediated phosphorylation of PKB is biphasic, a pattern previously observed for the induction of the PKB-related kinase, Sgk (23, 24, 25) and reaches its highest level at 48 h when the granulosa cells have differentiated to the preovulatory phenotype.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. FSH and Forskolin Stimulate PKB Phosphorylation in Granulosa Cells

Granulosa cells were harvested from ovaries of E-primed immature female rats and cultured overnight (0 h) in defined medium, DMEM-F12. At that time (A) FSH (50 ng/ml) and T (10 ng/ml) or (B) forskolin (10 µM) were added to the cells. Cell extracts were prepared at the designated intervals and used for Western blot analyses using antibodies specific for PKB (inactive) (1:1000) or phosphorylated PKB (active) (1:1000). In panel C, the phosphodiesterase (PDE4) inhibitor, rolipram (10 µM), was added to the cultures 1 h before the addition of forskolin. Cell extracts were prepared and analyzed as in panels A and B. Numbers at the bottom of each lane in this and subsequent figures for PKB indicate the fold increase in phosphorylation (ratio of phosphoprotein to protein in each sample) relative to control. Results are representative of two highly reproducible experiments per treatment group.

 
To determine whether the effects of FSH/T could be mimicked by direct activation of adenylyl cyclase, granulosa cells were cultured under similar conditions overnight (0 h) and then forskolin (10 µM) was added. Forskolin had no effect on the levels of nonphosphorylated PKB protein (Fig. 1BGo). However, forskolin did stimulate the phosphorylation of PKB in a pattern similar to that of FSH/T: a rapid 5.0-fold increase was observed at 1 h, followed by a decline to baseline at 6 h with a secondary 6-fold increase occurring progressively between 24–48 h. Collectively, these results show that cAMP activates cellular signals leading to the phosphorylation of PKB.

To determine whether the decrease in phosphorylation of PKB at 6 h was due to phosphodiesterase (PDE) activity and consequent decreases in intracellular cAMP, rolipram, a specific inhibitor of the PDE4 isoform expressed in granulosa was used (47). Granulosa cells were cultured overnight as described above, at which time rolipram was added to the cultures for 1 h preceding the addition of forskolin. When forskolin was added to the rolipram-pretreated cells, the temporal pattern of PKB phosphorylation was altered (Fig. 1CGo). The marked 7-fold increase in phospho-PKB at 1 h was followed by a gradual decrease throughout the 48 h period (Fig. 1CGo). Thus, rolipram delayed but did not completely prevent a decline in cellular levels of phospho-PKB.

Multiple Pathways Regulate PKB Phosphorylation
IGF-I has been shown to enhance granulosa cell responses to FSH (5, 6) and to promote cell survival in the ovary (50). Since PKB has been shown to be a specific downstream target of IGF-I/insulin, we sought to determine whether the phosphorylation of PKB by FSH/T was related to or enhanced by the effects of IGF-I. Accordingly, granulosa cells were cultured overnight in serum-free medium. At that time, the selective inhibitor of A-kinase (H89; 10 µM), was added to the granulosa cells (26, 41). After the 1-h pretreatment with inhibitor, FSH/T, forskolin, or 8-bromo-cAMP was added to the cultures for an additional 1 h of stimulation. Cell extracts were prepared and analyzed by Western blotting. PKB was rapidly phosphorylated within 1 h of exposure to FSH/T, forskolin, as well as 8-bromo-cAMP (Fig. 2AGo). The rapid phosphorylation of PKB by FSH/T, forskolin, and 8-bromo-cAMP was not inhibited by H89; rather H89 slightly enhanced the phosphorylation of PKB. Thus, PKB (ser473) is not a direct substrate for A kinase in granulosa cells.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Phosphorylation and Activation of PKB by FSH, Forskolin, 8-br-cAMP, PMA, and IGF-I: Roles of PI3-K and p38MAPK

A (PKB phosphorylation), Granulosa cells were harvested and cultured and cell extracts were prepared essentially as described above (Fig. 1Go). Selective inhibitors of A kinase (H89; 10 µM), PI3-K (LY294002; 25 µM and wortmannin; 0.1 µM), MEK1/ERK (PD98059; 20 µM), and p38MAPK (SB203580; 20 µM) were added 1 h before the addition of FSH/T, forskolin, 8-bromo-cAMP, PMA, and IGF-I at the doses indicated. After 1 h of stimulation with the agonists, cell extracts were prepared for Western blotting as in Fig. 1Go. Results obtained with 8-bromo-cAMP were similar to those obtained for FSH/T and forskolin (data not shown) The numbers at the base (or top for PMA and IGF-I) of each lane represent fold increases in phospho (active) PKB in response to agonists/antagonists relative to that in nonstimulated cells (0 h). Results are representative of two highly reproducible experiments. B (Specificity of H89), Additional granulosa cells were cultured in the presence of FSH/T for 10 min or 30 min without or with the A kinase inhibitor H89 at doses of 10 and 20 µM. Cell extracts were prepared and analyzed for phospho-CREB, CREB, and phospho-PKB. Numbers at the base of each lane represent the fold increases in phospho-CREB or phosho-PKB relative to 0 h control. C (Endogenous phosphorylation of GSK-3/PKB activity), Granulosa cells were cultured with FSH/T as described in Fig. 1Go. Cell extracts were prepared and endogenous levels of phosphorylated GSK-3 were analyzed by Western blot using a specific phospho (Ser21/9) GSK-3{alpha}/ß antibody (1:000). To measure PKB activity, granulosa cells were cultured overnight and then treated 1 h with FSH/T, IGF-I, or LY294002 (1 h) followed by FSH/T (1 h). Cell lysates were prepared and PKB was immunoprecipitated (IP) from granulosa cell extracts. PKB activity was measured using a GSK-3{alpha}/ß cross-tide fusion protein as a substrate. Phospho-GSK-3{alpha}/ß was analyzed by SDS-PGE and immunoblotting with a specific phospho-GSK-3{alpha}/ß antibody (1:1000). Results are representative of two experiments giving identical results.

 
Since PKB is a downstream substrate of the PI3-K pathway, we next determined whether FSH/T-stimulated phosphorylation of PKB was mediated by this pathway or by the MAPK pathway. Cells were cultured as above and selective inhibitors of PI3-kinase (LY294002; wortmannin), MEK1/ERK (PD98050), and p38MAPK (SB203580) were added to the cells for 1 h at doses routinely used in other studies. As shown, FSH/T-mediated phosphorylation of PKB was abolished by exposure to the PI3-kinase inhibitors, LY294002 and wortmannin. Whereas the MEK1 inhibitor (PD98050) failed to block FSH/T-mediated PKB phosphorylation, the p38MAPK inhibitor (SB203580) did reduce PKB phosphorylation. Identical results were observed when either forskolin or 8-bromo-cAMP was added to the cultures; the PI3-K inhibitors blocked PKB phosphorylation (Fig. 2AGo). Although the tyrosine kinase inhibitor AG18 has been shown to be a potent inhibitor of FSH-regulated gene expression in granulosa cells (51), this tyrphostin had no effect on FSH- or forskolin-stimulated phosphorylation of PKB (data not shown).

In marked contrast, the C kinase activator PMA failed to stimulate the phosphorylation of PKB, confirming previous results (Fig. 2AGo) (26). Moreover, additional experiments showed that PMA completely blocked FSH/T-mediated phosphorylation of PKB (Fig. 6Go). These results suggest that activation of C kinase antagonizes cAMP-mediated phosphorylation of PKB.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 6. PMA Antagonizes FSH/T-Mediated Phosphorylation of PKB and Sgk

Granulosa cells were harvested and cultured overnight as in Fig. 1Go. The C-kinase inhibitor GF109203X (1 µM) was added to cells for 1 h pretreatment. At that time (0 h), FSH/T, IGF-I, PMA alone or combinations thereof were added. Cell extracts were prepared 1 h later and analyzed for PKB (A) and Sgk (B) as in Figs. 1Go and 4Go, respectively. Results are representative of two separate experiments.

 
IGF-I is a major activator of PKB in other cells. When it was added to the granulosa cell cultures, it stimulated the expected phosphorylation of PKB (Fig. 2AGo). Furthermore, the IGF-I-induced phosphorylation of PKB was not affected by inhibitors of A kinase (H89) or ERK (PD98050) but was blocked by the PI3-K inhibitors (LY294002 and wortmannin) and reduced by the p38MAPK inhibitor (SB203580). The levels of PKB protein remained essentially constant in granulosa cells exposed to the various agonists and inhibitors (Fig. 2AGo). These results indicate that PKB is a downstream target of both IGF-I and cAMP-regulated signaling cascades that are independent of A kinase activation but require PI3-K.

To determine whether H89 was effectively blocking A kinase activity, the phosphorylation of CREB and PKB was analyzed in additional cultures (Fig. 2BGo). Granulosa cells were cultured in the presence of FSH/T for 10 min or 30 min with or without H89 (10 and 20 µM). As shown, FSH/T stimulated an increase of approximately 7-fold in phospho-CREB that was reduced in a dose-dependent manner by H89. Conversely, phosphorylation of PKB by FSH/T increased progressively with time and dose of H89. These data indicate that H89 reduces A kinase phosphorylation of CREB but not that of PKB.

To directly measure the activity of PKB in granulosa cells, the phosphorylation of endogenous GSK-3, as well as a synthetic substrate (cross-tide), was analyzed (Fig. 2CGo). FSH/T and IGF-I stimulated phosphorylation of endogenous GSK-3 in a biphasic pattern, similar to that observed for PKB phosphorylation (Fig. 1AGo): GSK-3 (Ser21/9) phosphorylation increased 48- and 74-fold at 0.5 h and 1 h, respectively, declined at 6 h, and then increased to 96-fold by 48 h of stimulation with FSH/T. PMA alone did not stimulate GSK-3 phosphorylation but it did reduce the response of FSH/T by 50% (not shown). For in vitro kinase assays, granulosa cells were cultured overnight. At that time the cells were stimulated (1 h) with FSH/T, IGF-I, or FSH/T after 1-h pretreatment with LY294002. Cell extracts were prepared, after which PKB was immunoprecipitated and its activity analyzed using a GSK-3 fusion protein as the substrate. Phospho-GSK-3 (Ser21/9) was detected by immunoblotting. PKB activity was low in cells cultured in the absence of hormones but was stimulated 4.7-fold by FSH/T and 6.1-fold by IGF-I. The PI3-K inhibitor LY294002 blocked FSH-mediated GSK-3 phosphorylation. Collectively, these results indicate that FSH/T- and IGF-I-mediated, PI3-K-dependent phosphorylation of PKB is related to increased enzymatic activity (Fig. 2CGo).

Regulation of PKB Phosphorylation Is Dependent on Granulosa Cell Differentiation
We have previously shown that granulosa cell differentiation is associated with changes in the activation of A kinase, its subcellular localization, and its ability to induce target genes such as Sgk and aromatase (25). Therefore, we sought in these experiments to determine whether the ability of FSH/T, forskolin, and IGF-I to phosphorylate PKB was also dependent on the stage of granulosa cell differentiation. For these experiments, granulosa cells were cultured in the continuous presence of FSH/T for either 24 h or 48 h. This regimen stimulates granulosa differentiation and the expression of genes, such as aromatase and LH receptor, that characterize the preovulatory phenotype (1). At each time interval, either H89, LY294002, wortmannin, PD98059, or SB203580 was added to the cultures for 1 h before the preparation of the extracts. As shown in Fig. 3AGo, PKB was present in a phosphorylated form at 24 h of culture with FSH/T, and its phosphorylation was increased almost 2-fold by exposing cells to the A kinase inhibitor, H89. PKB phosphorylation was blocked effectively by LY294002 or wortmannin whereas PD98059 had no detectable effect and SB203580 reduced phosphorylation slightly. After 48 h of culture with FSH/T, the phosphorylation of PKB was affected less by the inhibitors: H89 failed to enhance PKB phosphorylation and the inhibitory effects of LY294002 and wortmannin, as well as SB203580, were diminished (Fig. 3AGo). Exposure of granulosa cells to the inhibitors for 2–4 h was required to observe the enhancing effects of H89 and the inhibitory effects of LY294002, wortmannin, and SB203580 (Fig. 3BGo). Levels of phospho-PKB were also elevated in luteinized granulosa cells in vitro and in functional corpora lutea of pregnant rats (data not shown). Collectively, these results indicate that the mechanisms controlling the high steady-state levels of phosphorylated PKB are enhanced as the granulosa cells differentiate.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 3. PKB Phosphorylation Is Dependent on Granulosa Cell Differentiation

Granulosa cells were cultured in the presence of FSH/T for 24 or 48 h at which time inhibitors were added for 1 h (panel A) or for 2 h and 4 h (panel B). Cell extracts were prepared to analyze the amount of phospho (active) and non-phospho (inactive) PKB.

 
Regulation of Sgk Expression and Phosphorylation by Multiple Pathways
Since Sgk is induced by FSH/T and forskolin in granulosa cells and since it is related most closely in structure and substrate specificity to PKB (26), we next analyzed the induction of Sgk and its phosphorylation state. Granulosa cells were cultured with the same agonists and inhibitors as described above. Sgk protein was induced 15-fold by FSH/T and forskolin; it was also phosphorylated as indicated by the increased number of slower migrating immunoreactive bands (Fig. 4Go), shown in previous studies to be phosphorylated Sgk (26, 52). The amount and phosphorylation of Sgk by FSH/T and forskolin were reduced by H89 50% and 73%, respectively. Surprisingly, LY294002 not only abolished the presence of phosphorylated bands but also reduced the amount of Sgk protein. Compared with LY294002, wortmannin was surprisingly ineffective as an inhibitor of Sgk phosphorylation. SB203580 but not PD98059 also reduced Sgk phosphorylation.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Induction and Phosphorylation of Sgk by FSH/T, Forskolin, PMA, and IGF-I

Granulosa cells were harvested and cultured with agonists and inhibitors described as in Fig. 2Go. Cell extracts were prepared and used for Western blotting using an affinity-purified antibody to Sgk (24 25 ). The slower migrating, immunoreactive bands are phosphorylated forms of Sgk, as determined previously (23 24 ). The data are representative of two separate experiments. Numbers at the base of each lane represent the fold increase in immunoreactive [phospho (active) and non-phospho (inactive)] Sgk relative to nonstimulated cells (0 h).

 
PMA neither induced Sgk protein nor stimulated its phosphorylation (Fig. 4Go). In contrast, IGF-I alone increased the amount and phosphorylation of Sgk 1.6-fold, an effect that was blocked by the PI3-K inhibitors, LY294002 and wortmannin, and SB203580 (Fig. 4Go).

To examine the regulation of Sgk expression and phosphorylation during differentiation, granulosa cells were cultured with FSH/T for 24–48 h. During this period, Sgk protein and its phosphorylation increased in granulosa cells as indicated by the presence of multiple bands (Fig. 5Go). However, the effects of specific kinase inhibitors changed markedly. Unexpectedly, the amount of phospho-Sgk was unaffected by the addition of H89 at 24 h of culture with FSH/T, thereby suggesting an A kinase- independent pathway was predominant. Sgk phosphorylation was reduced by exposing the cells to LY294002 or wortmannin for 1 h, with LY294002 being slightly more effective (Fig. 5Go). By 48 h of culture with FSH/T, the inhibitors were either ineffective (H89) or had only a marginal effect (LY294002 and wortmannin) on the phosphorylated state of Sgk. Furthermore, we have shown that Sgk is expressed at elevated levels and is highly phosphorylated in luteinized granulosa cells in vitro and in vivo (23, 24). Collectively, these results indicate that the mechanisms controlling the steady-state levels of phosphorylated Sgk, as well as PKB, change as the cells differentiate in the presence of FSH/T.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Sgk Phosphorylation Is Dependent on Granulosa Cell Differentiation

Granulosa cells were harvested, cultured for 24 and 48 h with FSH/T, and exposed to inhibitors as in Fig. 3Go. Cell extracts were prepared and used for Western blotting using an affinity-purified antibody to Sgk as in the legend of Fig. 4Go.

 
PMA Blocks Phosphorylation of PKB in Response to FSH/T
As shown above, treatment of granulosa cells with PMA alone failed to stimulate phosphorylation of either PKB or Sgk. To determine whether PMA (via C kinase) might alter the response of granulosa cells to FSH/T or IGF-I, additional experiments were performed. Granulosa cells were cultured overnight in serum-free medium at which time they were pretreated for 1 h with the C kinase inhibitor (GF109203X) or vehicle. At this time (designated 0 h), FSH/T, IGF-I, or PMA was then added to the cells either alone or in combination for 1 h. As in previous experiments, FSH/T and IGF-I stimulated PKB and Sgk phosphorylation, whereas PMA alone was ineffective (Fig. 6Go, A and B, respectively). However, phosphorylation of these two kinases was either totally blocked (PKB) or reduced (Sgk) when PMA was added to the cells in combination with FSH/T. Inclusion of the C kinase inhibitor partially or completely restored the FSH-induced phosphorylation of PKB and Sgk, respectively. PMA (1 h exposure) also dramatically reduced PKB and Sgk phosphorylation in cells cultured with FSH/T for 48 h (data not shown).

In contrast, PMA exerted less of an effect on IGF-I-mediated phosphorylation of PKB and Sgk (Fig. 6Go, A and B, respectively). Nor did PMA markedly alter FSH-induced phosphorylation of CREB (data not shown). These results indicate that the inhibitory effects of PMA on FSH/T-mediated phosphorylation of PKB and Sgk are mediated by C kinase and impact steps other than or in addition to A kinase. Since PMA did not markedly alter the actions of IGF-I (Fig. 6Go) and does not alter cAMP production in granulosa cells (8), PMA appears to block FSH-mediated PKB phosphorylation at some step(s) upstream of PI3-K that is distinct from the pathway by which IGF-I activates PI3-K.

FSH/T and IGF-I Act Synergistically to Enhance Phosphorylation of PKB but Not Sgk
Since FSH/T and IGF have been shown to act synergistically to regulate some aspects of granulosa cell function, additional experiments were done to determine whether FSH/T and IGF-I might synergize to enhance the phosphorylation of PKB and Sgk. Granulosa cells were cultured overnight and then stimulated for 1 h with either FSH/T, IGF-I, or the combination at the doses used in the previous experiments. As shown in Fig. 7Go, PKB was phosphorylated by either FSH/T (taken as control; 1.0) or IGF-I (1.7-fold), and total phosphorylation was enhanced (3.8-fold) by costimulation with FSH/T and IGF-I. As in previous experiments, PKB phosphorylation induced by these agonists was blocked by a 1-h pretreatment of cells with the PI3-K and p38MAPK inhibitors, LY294002 and SB203580, respectively. In contrast, Sgk is selectively induced and phosphorylated by FSH/T (9.4-fold) compared with IGF-I (3.9-fold). Although Sgk was phosphorylated by each agonist and was inhibited by LY294002, no apparent synergy was observed when cells were exposed to both FSH/T and IGF-I (8.7-fold vs. 9.4-fold with FSH/T alone). Collectively, these results indicate that the mechanisms by which cAMP and IGF act to phosphorylate PKB and Sgk involve similar (PI3-K) but also distinct pathways, one of which may be p38MAPK.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 7. FSH/T and IGF-I Act Synergistically to Enhance Phosphorylation of PKB but Not Sgk

To determine the interactions of FSH and IGF-I, granulosa cells were harvested and cultured overnight as in Fig. 1Go. At 0 h, selective inhibitors were added to the cells for 1 h. At that time FSH/T or IGF-I was added alone or in combination to the cells for 1 h. Cell extracts were prepared for Western blotting using specific antibodies as described in Figs. 1Go and 4Go. Results are representative of two separate but identical experiments.

 
p38MAPK Is Phosphorylated in Cells Cultured in the Presence of FSH/T
Because the p38MAPK inhibitor SB203580 appeared to reduce the phosphorylation of PKB and Sgk, we sought to determine whether p38MAPK was phosphorylated in response to FSH/T. Additional cultures were prepared and protein extracts were analyzed by Western blotting using antibodies specific for p38MAPK and phospho-p38MAPK. As shown in Fig. 8Go, FSH/T stimulated a rapid approximately 2-fold increase in the phosphorylation of p38MAPK at 1 h. The A kinase inhibitor H89 did not block this phosphorylation. Rather H89, LY294002, wortmannin, and PD98059 enhanced FSH/T- stimulated phosphorylation of p38MAPK by another 2-fold. However, the p38MAPK- selective inhibitor SB203580 did block FSH/T-mediated phosphorylation of p38MAPK. Although the exact mechanism by which SB230580 blocks phosphorylation of p38MAPK is not known, the inhibitor may bind to the enzyme in such a way to mask a critical phosphorylation site (thereby inhibiting activation) or alter the conformation of the kinase preventing its phosphorylation and activation. Levels of nonphosphorylated p38MAPK remained constant in all treatment groups (Figs. 8Go). Collectively, these results indicate that the phosphorylation of p38MAPK is complex and is not mediated by the same mechanisms controlling the phosphorylation of PKB and Sgk.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 8. p38MAPK Is Phosphorylated by FSH/T and IGF-I in Granulosa Cells

Granulosa cells were harvested, cultured, and exposed to agonists and antagonists as in Fig. 2Go. Cell extracts were prepared and used for Western blotting with antibodies specific for p38MAPK (1:500) and phospho-p38MAPK (1:500). Results are representative of two separate experiments giving identical results.

 
Other Mediators of cAMP Action in Granulosa Cells
One of the surprising and novel results of these experiments is the observation that PKB is phosphorylated by FSH/T as well as by forskolin and 8-bromo-cAMP, a response that was not inhibited but rather enhanced by blocking A kinase activity with H89. These observations suggested that FSH activates alternate and distinct pathways in granulosa cells. Recently, cAMP has been shown to bind specific guanine nucleotide exchange factors, cAMP-GEFI (also called exchange protein activated by cAMP, Epac) and cAMP-GEFII) (47, 48). In some cells cAMP-GEFI has been shown to regulate the activity of the Ras-related GTPase, Rap1 (48). By designing specific primer pairs based on the published sequences of cAMP-GEFI (47, 48) and cAMP-GEFII (48), we have determined by RT-PCR analyses, subcloning, and sequencing that transcripts for both cAMP-GEFI and cAMP-GEFII are present in granulosa cells. Furthermore, expression of cAMP-GEFI and GEFII was not hormonally regulated in granulosa cells cultured in vitro with FSH/T for 0–48 h (Fig. 9Go, A and B) or in rats stimulated with gonadotropins in vivo (data not shown). RT-PCR analyses were also done to document that the GTPase Rap1b is expressed, but not regulated, by hormones in granulosa cells (Fig. 9DGo). Western blot analyses (Fig. 9CGo) also confirmed the presence and constitutive expression of Rap1a/b as well as Rap2 in granulosa cells cultured with FSH/T for 0–48 h. In addition, potential downstream targets of Rap proteins were also expressed. The serine/threonine kinases Raf-1 and Raf-B appeared to be constitutively expressed in granulosa cells. Raf-A was low in unstimulated cells but was increased by FSH/T at 1, 6, and 48 h (Fig. 9CGo). In addition, the multiple immunoreactive Raf-A bands indicate that Raf-A may also be phosphorylated in these cells by FSH/T. Although p27-Ki-Ras is expressed in granulosa cells (as shown by pan-Ras antibody), there is yet no evidence that it is a target for cAMP-GEFs. Based on the presence of these cellular signaling molecules in granulosa cells, it is possible that FSH and cAMP-stimulated phosphorylation of PKB, Sgk, or p38MAPK involves cAMP activation of specific cAMP-GEFs, Rap1 (or a related GTPases) followed by the activation of PI3-K or specific Raf kinases.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 9. Expression of cAMP-GEFI and cAMP-GEF-II, Rap1, Rap2, and Ki-ras, as Well as Raf-1, Raf-B, and Raf-A in Granulosa Cells

A and B, Granulosa cells were cultured with FSH/T for 0–72 h; total cellular RNA was extracted at 0, 2, 24, 48, and 72 h. Transcripts encoding cAMP-GEFI and cAMP-GEFII, as well as the ribosomal protein L19, were analyzed by RT-PCR using specific primer pairs, yielding amplified cDNA products of 399 bp, 404 bp, and 196 bp, respectively. Amplified products were verified by subcloning and sequence analyses. As shown, expression of cAMP-GEFI and GEFII was not hormonally regulated in granulosa cells. Data are representative of four separate experiments. C, Granulosa cells were cultured with FSH/T as described in Fig. 1Go. Cell extracts were prepared and used to analyze by immunoblotting the Ras-related GTPases, Rap1 (1:500), Rap2 (1:3000), and Ki-ras (1:1000), as well as the Raf family of serine/threonine kinases, Raf-1 (1:500), Raf-B (1:500), and Raf-A (1:1000). Results are representative of two separate experiments. D, Total cellular RNA was prepared from granulosa cells cultured in the presence of FSH/T for 0–48 h. Primers specific for Rap1b were used to amplify a 370-bp Rap1b cDNA; primers for the ribosomal protein L19 were used as an internal control. The levels of Rap1b were plotted relative to those of L19. The Ra1b cDNA product was verified by sequence analysis. Data are representative of two separate experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The control of granulosa cell proliferation and differentiation by FSH and LH is complex. In small follicles, low levels of FSH stimulate proliferation, whereas in large follicles FSH stimulates differentiation and the expression of specific genes, such as aromatase and the LH receptor (1, 3). The LH surge terminates granulosa cell proliferation and rapidly reprograms granulosa cells to become luteal cells. The cellular signaling events that are triggered by and mediate these diverse responses to FSH and LH remain unclear but appear to require cAMP as an obligatory second messenger. The central importance of A kinase in mediating many of the effects of cAMP has been confirmed by numerous approaches using specific A kinase inhibitors, such as H89 (41, 51) and PKI (53, 54). Intracellular trafficking (55) and specific docking sites (56, 57) of A kinase also appear critical for function. Lastly, the interaction of A kinase with other signaling systems, steroid and peptide, has been proposed to account for selective cellular responses to these gonadotropins (1). However, some effects of cAMP cannot be explained by activation of A kinase (41, 53, 54, 58). We provide evidence herein that FSH/T, forskolin, and 8-bromo-cAMP stimulate the phosphorylation of three distinct kinases, PKB, Sgk, and p38MAPK by cellular signaling mechanisms independent of A-kinase (Fig. 10Go).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 10. Model of cAMP Actions in Granulosa Cells

FSH via activation of A kinase induces the expression of specific genes, such as Sgk (23 24 ). FSH via PI3-K and its downstream targets, PDK1 (but not A-kinase), phosphorylates PKB in a manner that mimics and enhances IGF-I-induced phosphorylation and activation of PKB. IGF-I via PI3-K also phosphorylates PKB and Sgk. PMA (via C kinase) inhibits cAMP-mediated (but not IGF-I-mediated) phosphorylation of PKB and Sgk. We propose that FSH likely acts via a cAMP-GEF/ras-Rap/Raf pathway, which is upstream of PI3-K. cAMP, by mechanisms that are also independent of A-kinase and PI3-K, also leads to the phosphorylation of p38MAPK, likely by a cAMP-GEF/ras-Rap/Raf pathway. Thus, FSH appears to activate both A kinase-dependent and A kinase-independent pathways in granulosa cells, each of which controls specific kinase cascades.

 
PKB and Sgk have been shown to have similar protein structure and require phosphorylation of specific amino acid residues within the activation loop to be functionally active. However, as described herein, there are also some major differences between these two kinases. First, PKB has an N-terminal pleckstrin homology (PH) domain that binds phosphoinositides and targets the kinase to the plasma membrane (28). PKB is highly conserved, ubiquitously expressed, and activated by many cell surface receptors, most notably IGF-I (31, 33). IGF-I-mediated activation of PKB is dependent on the activation of upstream kinases, PI3-K and PDK1 (28). Some of the targets of PKB action in cells are known. These include the forkhead (FKHR-1) transcription factor (33), which regulates the transcriptional activity of genes, including the insulin-like growth factor binding protein (IGFBP-1) (31); glycogen synthase kinase-3 (GSK-3)(27, 59); and the apoptotic factors, BAD and caspase-9 (Ref. 33 and references therein), as well as IKK{alpha} (59, 60). Phosphorylation of these proteins by PKB renders them inactive (59). One isoform of PKB, PKBß/Akt2, has been shown to be amplified in ovarian carcinomas (61). In contrast, expression of Sgk is hormonally regulated rather than constitutive and its transcription is controlled by numerous hormones (62, 63, 64, 65), including FSH/cAMP (23, 24). With the exception of an epithelial sodium channel (64, 65), functional targets of Sgk action remain largely unknown. Based on the preferred consensus substrate for each kinase [PKB: RNRNN (S/T) and Sgk: KKRNRRLS] (26, 33), it is likely that they phosphorylate different substrates and thereby control distinct cellular functions, some of which, based on their coordinated activation by PI3-K/PDK1, may be synergistic. Sgk may be one of the missing links by which PI3-K mediates the expression of phosphoenolpyruvate carboxykinase (PEPCK) (66, 67).

In the rat ovary, PKB is constitutively expressed in granulosa cells and luteal cells. Most striking is the rapid phosphorylation (and activation) of PKB in granulosa cells in response to FSH/T (forskolin and 8-bromo-cAMP), which mimics the response stimulated by IGF-I. Furthermore, the pathways by which FSH and IGF-I stimulate PKB phosphorylation appear to involve similar intermediary steps. Specifically, the A kinase inhibitor H89 does not block phosphorylation of PKB by FSH/cAMP, indicating that it occurs by mechanisms independent of A kinase. Cass and colleagues (41, 58) have made similar observations; TSH and cAMP stimulate PKB phosphorylation in a thyroid cell line that is independent of A kinase. Rather, rapid phosphorylation of PKB by either FSH or IGF-I was blocked by the PI3-K inhibitors, LY294002 and wortmannin, and to a lesser extent by the p38MAPK inhibitor, SB203580. Thus, FSH, forskolin, and 8-bromo-cAMP can be added to the growing list of stimuli known to rapidly phosphorylate and thereby activate PKB. Moreover, FSH/cAMP and IGF-I acted synergistically to enhance PKB phosphorylation, indicating that signals activated by FSH (cAMP) impact the same or a similar signaling cascade and target the same substrates (i.e. GSK-3) as IGF-I. This synergism between cAMP and IGF-I on PKB phosphorylation may be one crucial mechanism by which these pathways enhance expression of genes such as aromatase and the LH receptor. The ability of PMA to prevent FSH-stimulated (but not IGF-I stimulated) phosphorylation of PKB indicates that activation of C kinase antagonizes the steps(s) by which FSH mediates activation of PI3-kinase or PDK1. Moreover, these steps (Ras-like related proteins?) controlled by FSH are distinct from those activated by the IGF-I pathway.

FSH/cAMP-mediated phosphorylation of PKB and GSK-3 is biphasic: PKB phosphorylation increases rapidly within 0.5 to 1 h, declines at 6 h, and exhibits a secondary, progressive increase from 12–48 h, a pattern similar to the induction of Sgk (23, 24, 25). These results indicate that as granulosa cells differentiate in response to FSH/T or forskolin, the phosphorylation of PKB is increased. Unexpectedly, the ability of PI3-K and p38MAPK inhibitors to block or reduce PKB phosphorylation was diminished as granulosa cells differentiate. Thus, although LY294002 and wortmannin completely blocked PKB phosphorylation if added from 23–24 h of culture, this response was greatly diminished if the inhibitors were added from 47–48 h. By 48 h of culture with FSH/T, PKB phosphorylation was only partially reduced by the addition of LY294002 or wortmannin for 1 h, whereas longer exposure (2 h and 4 h) did reduce PKB phosphorylation. These results clearly show that a pathway distinct from that of A kinase is involved in PKB phosphorylation by FSH/T and forskolin in granulosa cells. These results also indicate that as granulosa cells differentiate, intracellular mechanisms favoring high steady-state levels of PKB phosphorylation are established. What these mechanisms are remain highly speculative. Since the phosphorylation of Sgk as well as PKB is increased as the cells differentiate, perhaps the most likely explanation for the loss of sensitivity to the kinase inhibitors is that the content or activity of an endogenous phosphatase is greatly decreased. Therefore, the turnover of phosphate would be less. Alternatively, there may be decreased activity of the lipid phosphatase PTEN (phosphatase and tensin homolog deleted on chromosome 10), which regulates the levels of activating phosphoinositides (68, 69), or in the differentiated cells the phosphorylation of PKB and Sgk may be regulated by activation of other kinases that are less sensitive to LY294002 and wortmannin. If one role of activated PKB is to favor cell survival and prevent apoptosis, the elevated levels of phospho-PKB in the differentiated granulosa cells at 48 h may play a role in maintaining and establishing the stable phenotype of luteal cells.

More complex is the manner by which FSH/T and forskolin regulate the expression and phosphorylation of Sgk, a PKB-related kinase. We have shown herein and elsewhere (23, 24, 25) that FSH/T and forskolin induce Sgk in a biphasic manner. Based on transfection studies and analyses of mRNA, the rapid effects of FSH and forskolin appear to be mediated primarily at the transcriptional level and involve the transcription factors Sp1/Sp3 (23). The studies herein confirm that the rapid increase in Sgk protein occurs primarily by an A kinase-dependent (H89 inhibited) mechanism: neither IGF-I nor PMA caused major increases in Sgk protein. However, A kinase is not the only factor involved in mediating the rapid phosphorylation of Sgk that occurs in response to FSH/T and forskolin. The PI3-K inhibitors LY294002 and wortmannin, as well as the p38MAPK inhibitor SB203580, reduced the levels of phosphorylated Sgk at 1 h. Although IGF-I did not increase the levels of Sgk protein, this growth factor did stimulate Sgk phosphorylation by mechanisms that were sensitive to inhibitors of PI3-K and p38MAPK. The marked inhibitory effect of LY294002 compared with wortmannin on FSH- and forskolin-mediated induction and phosphorylation of Sgk suggests that LY294002 is more effective in blocking a specific isoform of PI3-K or another kinase that is critical for the phosphorylation of Sgk. Of note, the Sgk antibody is not a phospho-specific antibody. Therefore, multiple bands observed by Western blot likely reflect phosphorylation at multiple sites by multiple kinases. Furthermore, the loss of Sgk protein in response to LY294002, as well as p38MAPK inhibitor SB203580, suggests that phosphorylated forms of Sgk may be more stable than nonphosphorylated Sgk. By preventing phosphorylation, LY294002 and SB203580 allow increased degradation of Sgk protein. In this regard, it is of interest that both the amount, as well as the phosphorylation, of Sgk increase markedly in granulosa cells cultured in the presence of FSH/T for 24–48 h. At 24 h, Sgk phosphorylation was no longer inhibited by H89 or SB203580; by 48 h Sgk phosphorylation was much less sensitive to the inhibitor effects of LY294002 and wortmannin. These results indicate that the steady-state levels of Sgk and phospho-Sgk were enhanced as the cells differentiated. Thus, Sgk appears to act in concert with PKB to maintain expression of genes (aromatase and LH receptor?) and to establish the stable luteal cell phenotype.

The mechanisms that control the phosphorylation of p38MAPK by FSH and forskolin are distinct from those regulating phosphorylation of PKB and Sgk. Based on results presented herein and published recently by others, both positive (Ras-Raf-mediated and A-kinase) and negative (A-kinase and PI3-K-mediated) regulatory mechanisms appear to be involved (42, 70, 71). Specifically, FSH-mediated phosphorylation of p38MAPK has been reported to be dependent on A-kinase (H89-sensitive) (42). In contrast, we observed that inhibition of A kinase (H89), as well as PI3-K (LY294002), enhanced FSH- as well as IGF-I-mediated phosphorylation of p38MAPK. Although these two studies have used similar granulosa cell culture models and doses of hormone, Maizels et al. (42) analyzed p38MAPK phosphorylation at 10 min after addition of hormone rather than at 1 h as described herein. One explanation to account for these different observations is that there is a rapid but narrow time interval during which p38MAPK phosphorylation is A kinase dependent [10 min in the study by Maizels et al. (42)]. After this critical interval, there appear to be other mechanisms (both positive and negative) by which cAMP regulates the phosphorylation of p38MAPK, and these appear to be similar to those by which IGF-I mediates p38MAPK phosphorylation. Positive regulation of p38MAPK by IGF is mediated indirectly by activation of specific Ras-Raf proteins (70). Negative regulation of MAPK (and therefore possibly p38MAPK) by IGF-I is mediated by activation of PI3-K and PKB, the latter of which phosphorylates and inactivates Raf as indicated by recent genetic approaches (71, 72). Thus the balance and interaction of p38MAPK and PKB may be critical for altering cell function since p38MAPK also impacts phosphorylation of PKB. We show herein that granulosa cells and luteal cells express the Ras-related proteins Ki-Ras, confirming results of others (73) as well as Rap1 and Rap2 (74). Granulosa cells also express several members of the Raf family of serine kinases: Raf-1, A-Raf , and B-Raf providing several downstream targets for Ras-like proteins. In addition, granulosa cells express the guanine nucleotide exchange factors, cAMP-GEFI (also known as Epac) and cAMP-GEFII. Thus, it is highly likely that in granulosa cells FSH via cAMP activates p38MAPK by a cascade involving cAMP-GEFs, specific GTPases (most likely Rap1), and one or more of the serine/threonine kinases [most likely B-Raf (43, 46)] or another related protein. Since FSH/T and forskolin can also phosphorylate and activate PKB, FSH/T (cAMP) likely exerts its inhibitory effects on p38MAPK by activating PKB, as has been documented for IGF-I (71, 72). Alternatively, the negative effects of FSH may be mediated by selective activation of Raf-1 (44).

In summary, we provide several lines of evidence that FSH impacts different cellular signaling cascades in granulosa cells that lead to the phosphorylation of diverse kinases: PKB, Sgk, and p38MAPK (Fig. 10Go). 1) FSH via cAMP (but not A kinase) activates the PI3-K pathway leading to the phosphorylation of PKB. This effect of FSH mimics and enhances IGF-I-mediated phosphorylation of PKB. FSH/cAMP activation of PI3-K likely involves a specific Ras or Ras-related protein such as the cAMP-GEFs since the effects of FSH [like TSH (41)] were mimicked by forskolin and 8-bromo-cAMP. However, we cannot entirely rule out the possibility that FSH also activates Gß{gamma} that can activate PI3-K{gamma}, a specific isoform of PI3-K. PMA (C kinase) blocks FSH- but not IGF-I-mediated phosphorylation of PKB, indicating that FSH and IGF-I enter the PI3-K pathway by different steps. 2) FSH/cAMP acts via A kinase to induce expression of Sgk. Sgk is then phosphorylated and activated by A kinase and PI3-K pathways. 3) FSH via a putative cAMP-GEF/ras/raf pathway leads to the phosphorylation of p38MAPK, whereas both A-kinase and PI3-K/PKB inhibit this cAMP-GEF/ras/raf pathway. Based on the absence of an effect of the MEK1 inhibitor (PD98059) on the phosphorylation of PKB, Sgk, and p38MAPK, the ERK pathway has been omitted from the diagram.

Since IGF-I alone can phosphorylate PKB but is less effective in stimulating granulosa cell differentiation, the transcriptional activation of specific genes in granulosa cells appears to require hormone/cAMP activation of A kinase and other signaling cascades. The PKB and Sgk pathways appear to be enhanced in terminally differentiated granulosa cells, indicating that they act in concert as survival factors. Coincident with this, A kinase and PI3-K/PKB appear to exert negative feedback effects on the putative GEF/ras-rap/raf activation of p38MAPK. These results provide some of the first evidence in granulosa cells that FSH and cAMP act to coordinate diverse cellular signaling cascades that are independent of A kinase activation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Media and cell culture reagents and materials were purchased from Life Technologies, Inc. (Gaithersburg, MD), Sigma (St. Louis, MO), Research Organics (Cleveland, OH), Fisher Scientific (Fairlawn, NJ), Corning, Inc., Corning, NY), and HyClone Laboratories, Inc. (Logan, UT). Trypsin, soybean trypsin inhibitor, DNAse, PMA, ATP, dithiothreitol (DTT), 17ß-estradiol, 8-bromo-cAMP, and propylene glycol were all purchased from Sigma. Ovine FSH (oFSH-16) was a gift of the National Hormone and Pituitary Program (Rockville, MD). Human chorionic gonadotropin (hCG) was from Organon Special Chemicals (West Orange, NJ). Antibodies for PKB 9272, phospho(ser 473)PKB 9271S, p38MAPK 9212, and phospho(thre180/tyr182)p38MAPK 9211S and phospho(ser21/9)GSK-3{alpha}/ß 93313 were from New England Biolabs, Inc. (Beverly, MA). Antibodies for Rap 1 (121:sc-65), Raf-1 (C-12; SC-133), Raf-B (C19; SC-166) and Raf-A (C-20; SC-408), Ki-Ras (pan-ras; F132; SC-32), and GSK-3 (SC-7879) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Antibodies for Rap2 (R 230200) were from Transduction Laboratories, Inc. (Lexington, KY). Affinity- purified Sgk antibody was generated in the laboratory of Dr. Gary Firestone (Berkeley, CA). Inhibitor LY294002 (270–038-M005) was from Alexis (San Diego, CA), and wortmannin (no. 681675), SB203580 (no. 559395), and H89 (no. 371963) were from Calbiochem (San Diego, CA). PD98059 (no. 9900S) was from New England Biolabs, Inc. and GF109203X (no. G2911) was from Sigma. TRIzol reagent (no. 15596) was obtained from Life Technologies, Inc. Electrophoresis and molecular biology grade reagents were purchased from Sigma, Bio-Rad Laboratories, Inc. (Richmond, CA), and Roche Molecular Biochemicals (Indianapolis, IN). Oligonucleotides were purchased from Genosys (The Woodlands, TX). All RT-PCR reagents were from Promega Corp. (Madison, WI) except for deoxyribonucleotides (dNTPs; Roche Molecular Biochemicals). {alpha}-32P[dCTP] was from ICN Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from Amersham Pharmacia Biotech (Arlington Heights, IL).

Animals
Intact immature (day 23 of age) Holtzman Sprague Dawley female rats (Harlan Sprague Dawley, Inc., Indianapolis, IN) were housed under a 16-h light, 8-h dark schedule in the Center for Comparative Medicine at Baylor College of Medicine and provided food and water ad libitum. Animals were treated in accordance with the NIH Guide for the Care and Use of Laboratory Animals, as approved by the Animal Care and Use Committee at Baylor College of Medicine (Houston, TX).

Granulosa Cell Cultures
Granulosa cells were harvested from untreated or E-primed immature (day 25) rats as previously described (3, 4) and as indicated in the Results and figure legends. Briefly, cells were cultured at a density of 1 x 106 cells per 3 ml serum-free medium (DMEM:F12 containing Penicillin and Streptomycin) in multiwell (35-mm) dishes that were serum coated (4). Cells were cultured in defined medium overnight (0 h) followed by the addition of FSH (50 ng/ml) and T (10 ng/ml), forskolin (10 µM), and other agonists/inhibitors as indicated in the figures and figure legends. FSH/T were used to stimulate the differentiation including the induction of aromatase (4), LH receptor (9), and inhibin (14). Forskolin and 8-bromo-cAMP alone were used to determine the relative effects of cAMP on specific cell functions.

RNA Isolation and RT-PCR Assays
Total RNA was isolated from cultured cells with Trizol according to specifications provided by the manufacturer. Each RNA sample was pooled from three replicate wells. The RNA was purified by sequential phenol, phenol-chloroform, and chloroform extraction, followed by ethanol precipitation. The RNA was resuspended in 0.1% diethylpyrocarbamate-treated water and its concentration determined by absorbance at 260 nm.

Based on the known sequences for cAMP-GEFI [Genbank accession no. U78167 (47, 48)], cAMP-GEFII [Genbank accession nono..U78517 (48)], and Rap1b (Genbank accession no. U07795), oligonucleotide primer pairs were designed and used in the RT-PCR reactions according to procedures described previously (51). After the RT step that contained 500 ng input RNA, the reaction mixture was split into separate aliquots to which specific primer pairs for cAMP-GEFI (forward, 5'-TGGTGCTGAAGAGAATGCAC-3' and reverse 5'-CCTGGAAGGTCCAGTCATGT-3', cAMP-GEFII (forward, 5'-AGGTGCTTTTGCAGCAGTTT-3' and reverse, 5'-GGTACGCCAAGTCTTTCGAG3') Rap1b (forward, TTATAGAAAGCAAGTTGAAGT and reverse, CACTAGGTCATAAAAGATCTCG) or the ribosomal protein L19 (75) were added for 30 cycles using standard temperatures and times that gave a linear increase of DNA product to input RNA from 300 to 1500 ng (data not shown). The amplified cDNA products for cAMP-GEFI (399 bp), GEFII (404 bp), Rap1b (370 bp), and L19 (196 bp) were resolved by acrylamide gel electrophoresis, and radioactive PCR product bands were quantified by phosphoimage analysis (Betascope 603 Blot Analyzer; Betagen Corp., Mountain View, CA). Separate reactions were done for L19 since generation of the L19 product interfered with the amplification of cAMP-GEFI and cAMP-GEFII. Data are presented as the ratio of radioactivity in the GEFI/GEFII lanes relative to L19 bands.

Cell Extracts and Western Blot Analyses
Total cell extracts were prepared according to a method of Ginty (76) by adding to each well hot (100 C) Tris-buffer containing 10% SDS and ß-mercaptoethanol. The cells were rapidly scraped with a rubber policeman and the extract transferred to an Eppendorf tube (Madison, WI) at 100 C for 5 min. Extracts were stored at 4 C until analyzed by SDS-PAGE). After SDS-PAGE, samples were electrophoretically transferred to nylon filter, washed briefly in PBS, and blotted with either 3% BSA or 5% Carnation milk at room temperature for 1 h. Antibodies were added in the same blocking solutions at the dilutions indicated in the figure legends. Immunoreactive proteins were visualized with enhanced chemiluminescence (ECL) according to the specification of the supplier (Pierce Chemical Co., Rockford, IL). Immunoreactive bands were quantified by image analysis of autoradiograms (ECL) using AlphaImager 2000 (3.3), (Alpha Innotech Corp., San Leandro, CA).

PKB Enzyme Activity
To measure the enzymatic activity of PKB, granulosa cells were cultured as in previous experiments. Cells were lysed, extracts were prepared, and the activity of PKB/Akt was measured using the Akt kinase assay kit (New England Biolabs, Inc.). Briefly, PKB was immunoprecipitated (IP) using an anti-PKB antibody cross-linked to agarose hydrazide beads. After IP, the beads were washed and incubated with a kinase reaction mixture containing GSK-3{alpha}/ß cross-tide fusion protein and ATP. Phosphorylated GSK-3{alpha}/ß was analyzed by SDS-PAGE and immunodetection with a specific anti-phospho (ser21/9) GSK-3{alpha} antibody.


    FOOTNOTES
 
Address requests for reprints to: JoAnne S. Richards, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu

These studies were supported in part by NIH Grants HD-16272 and 16229 (J.S.R.) and CA-71514 (G.L.F.).

Received for publication December 20, 1999. Revision received April 6, 2000. Accepted for publication April 27, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Richards J 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[CrossRef][Medline]
  2. Robker R, Richards J 1998 Hormone-induced proliferation and differentiation of granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and p27KIP1. Mol Endocrinol 12:924–940[Abstract/Free Full Text]
  3. Robker R, Richards J 1998 Hormonal control of the cell cycle in ovarian cells: proliferation versus differentiation. Biol Reprod 59:476–482[Free Full Text]
  4. Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology 129:1452–1462[Abstract]
  5. Adashi EY, Resnick CE, Hernandez ER, May JV, Knecht M, Svoboda ME, Van Wyk JJ 1988 Insulin-like growth factor-I as an amplifier of follicle-stimulating hormone action: studies on mechanism(s) and site(s) of action in rat granulosa cells. Endocrinology 122:1583–1591[Abstract]
  6. Hirakawa T, Minegishi T, Abe K, Kishi H, Ibuki Y, Miyamoto K 1999 A role of insulin-like growth factor I in luteinizing hormone receptor expression in granulosa cells. Endocrinology 140:4965–4971[Abstract/Free Full Text]
  7. Poretsky L, Cataldo NA, Rosenwaks Z, Guidice LC 1999 The insulin-related ovarian regulatory system in health and disease. Endocr Rev 20:535–582[Abstract/Free Full Text]
  8. Fitzpatrick SL, Carlone DL, Robker RL, Richards JS 1997 Expression of aromatase in the ovary: down-regulation of mRNA by the ovulatory luteinizing hormone surge. Steroids 62:197–206[CrossRef][Medline]
  9. Segaloff DL, Wang H, Richards JS 1990 Hormonal regulation of LH/CG receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:1856–1865[Abstract]
  10. Richards JS, Russell DL, Robker RL, Dajee M, Alliston TN 1998 Molecular Mechanisms of ovulation and luteinization. Mol Cell Endocrinol 145:47–54[CrossRef][Medline]
  11. Taylor SS 1989 cAMP-dependent protein kinase. J Biol Chem 264:8443–8446[Free Full Text]
  12. Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675–680[CrossRef][Medline]
  13. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3'5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  14. Mukherjee A, Park-Sarge O-K, Mayo KE 1996 Gonadotropins induce rapid phosphorylation of the 3',5'-cyclic adenosine monophosphate response element binding protein in ovarian granulosa cells. Endocrinology 137:3234–3245[Abstract]
  15. Fitzpatrick SL, Richards JS 1994 Identification of a cyclic adenosine 3',5'-monophosphate response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C Leydig cells. Mol Endocrinol 8:1309–1319[Abstract]
  16. Mukherjee A, Urban J, Sassone-Corsi P, Mayo KE 1998 Gondadotropins regulate inducible cyclic adenosine 3',5'-monophosphate early repressor in the rat ovary. Mol Endocrinol 12:785–800[Abstract/Free Full Text]
  17. Hansen TVO, Rehfeld JF, Nielson FC 1999 Mitogen-activated protein kinase and protein kinase A signaling pathways stimulate cholecystokinin transcription via activation of cyclic adenosine 3',5'-monophosphate response element-binding protein. Mol Endocrinol 13:466–475[Abstract/Free Full Text]
  18. Seternes OM, Johansen B, Moens U 1999 A dominant role for the Raf-MEK pathway in forskolin,12–0-tetradecanoly-phorbol acetate, and platelet-derived growth factor-induced CREB (cAMP-responsive element-binding protein) activation, uncouples from serine 133 phosphorylation in NIH 3T3 cells. Mol Endocrinol 13:1071–1083[Abstract/Free Full Text]
  19. Gutkind JS 1998 The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase cascades. J Biol Chem 273:1839–1842[Free Full Text]
  20. Dhanasekaran N, Heasley LE, Johnson GL 1995 G-protein-coupled receptor systems involved in cell growth and oncogenesis. Endocr Rev 16:259–270[CrossRef][Medline]
  21. Leopoldt D, Hanck T, Exner T, Maier U, Wetzker R, Nurenberg B 1996 Gbg stimulates phosphoinositide 3-kinase-{gamma} by direct interaction with two domains of the catalytic p110 subunit. J Biol Chem 273:7024–7029[Abstract/Free Full Text]
  22. Jordon JD, Carey KD, Stork PJS, RI 1999 Modulation of Rap activity by direct interaction of G{alpha}o with Rap1 GTPase-activating protein. J Biol Chem 274:21507–21510[Abstract/Free Full Text]
  23. Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS 1997 Follicle stimulating hormone-regulated expression of serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a functional role for the Sp1 family in promoter activity. Mol Endocrinol 11:1934–1949[Abstract/Free Full Text]
  24. Alliston TN, Gonzalez IG, Firestone GL, Richards JS 2000 Expression, localization of serum/glucocorticoid-induced kinase in the rat ovary: relation to follicular growth, differentiation. Endocrinology 141:385–395[Abstract/Free Full Text]
  25. Gonzalez-Robayna IJ, Alliston TN, Buse P, Firestone GL, Richards JS 1999 Functional and subcellular changes in the A-kinase signaling pathway: relation to aromatase and sgk expression during the transition of granulosa cells to luteal cells. Mol Endocrinol 13:1318–1337[Abstract/Free Full Text]
  26. Park J, Leong MLL, Buse P, Maiyar AC, Firestone GL, Hemmings BA 1999 Serum and glucocorticoid-inducible kinase (SGK) is a target of PI 3-kinase-stimulated signaling pathway. EMBO J 18:3024–3033[CrossRef][Medline]
  27. Franke TF, Kaplan DR, Cantley LC 1997 PI3K: Downstream AKTion blocks apoptosis. Cell 88:435–437[CrossRef][Medline]
  28. Remah LE, LCC 1999 The role of phosphoinositide 3-kinase lipid products in cell function. J Biol Chem 274:8347–8350[Free Full Text]
  29. Pullen N, Dennis PB, Andjelkovic M, Dufner A, Kozma SC, Hemmings BA, Thomas G 1998 Phosphorylation and activation of p70s6k by PDK1. Science 279:707–710[Abstract/Free Full Text]
  30. Datta SR, Brunet A, Greenberg ME 1999 Cellular survival: a play in three Akts. Genes Dev 13:2905–2927[Free Full Text]
  31. Guo S, Rena G, Cichy S, He X, Cohen P, Unterman T 1999 Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence. J Biol Chem 274:17184–17192[Abstract/Free Full Text]
  32. Rena G, Guo S, Cichy SC, Unterman TG, Cohen P 1999 Phosphorylation of the transcription factor forkhead family member FKHR by protein kinase B. J Biol Chem 274:17179–17183<