Molecular Endocrinology 14 (9): 1377-1386
Copyright © 2000 by The Endocrine Society
A Novel Glucocorticoid Receptor Binding Element within the Murine c-myc Promoter
Tianlin Ma,
John A. Copland,
Allan R. Brasier and
E. Aubrey Thompson
Department of Human Biological Chemistry and Genetics (E.A.T.)
and Department of Internal Medicine (J.A.C., A.R.B.) The
University of Texas Medical Branch Galveston, Texas 77555-0645
Department of Biochemistry (T.M.) Baylor College of
Medicine Houston, Texas 77330
 |
ABSTRACT
|
|---|
In the course of analyzing the murine c-myc
promoter response to glucocorticoid, we have identified a novel
glucocorticoid response element that does not conform to the consensus
glucocorticoid receptor-binding sequence. This c-myc promoter element
has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence
similarity to any known response element. Glucocorticoids activate
c-myc/reporter constructs that contain this element. Deletion of these
sequences from the c-myc promoter increases basal activity of the
promoter and blocks glucocorticoid induction. Insertion of this element
into SV40/reporters inhibits basal reporter gene activity in the
absence of glucocorticoids. Glucocorticoids stimulate activity of
reporters that contain this element. Recombinant glucocorticoid
receptor binds to this element in vitro. An unidentified
cellular repressor also binds to this element. The activated
glucocorticoid receptor displaces this protein(s). We conclude that the
glucocorticoid receptor binds to the c-myc promoter in competition with
this protein, which is a repressor of transcription. To our knowledge,
no glucocorticoid response element with such properties has ever been
reported.
 |
INTRODUCTION
|
|---|
The protooncogene c-myc is the cellular homolog
of the viral oncogene v-myc, a potent inducer of
hematopoietic malignancies (1). The product of the c-myc
gene serves essential functions in mammalian cells (2). Consequently,
there has been a considerable amount of effort applied to understanding
the role of c-myc in regulating cell proliferation, differentiation, or
death (reviewed in Ref. 3). The abundance of c-myc mRNA is regulated by
several mechanisms, including initiation of transcription,
transcriptional pausing, and mRNA degradation (reviewed in Refs. 3, 4). These parameters of c-myc expression are regulated by a large
number of hormones, growth factors, pharmacological agents, and
biological conditions (reviewed in Refs. 4, 5).
Consistent with the diverse array of agents that affect c-myc
transcription, a large number of protein-nucleic acid interactions with
the c-myc promoter have been identified both in vivo and
in vitro (6, 7, 8, 9). Among these are more unusual factors
that appear to bind to single-stranded domains within the c-myc
promoter so as to induce unwinding and torsional strain (10, 11, 12). It is
not presently understood how these elements interact to control
c-myc transcription; neither do we appreciate the mechanisms
whereby the signals propagated by many diverse stimuli/factors are
integrated so as to determine the level of c-myc expression.
We have a particular interest in the mechanisms that impinge upon
steroid regulation of c-myc expression. Glucocorticoids cause
G1 arrest of lymphoid cells, acting in part
through a mechanism that involves inhibition of c-myc expression
(13, 14, 15). Similar effects have been described for some fibroblastic
cells (16, 17). We have previously demonstrated that the synthetic
glucocorticoid dexamethasone is a potent inhibitor of c-myc
transcription initiation, and addition of glucocorticoids to mid-log
phase P1798 cells causes a decrease of 8090% in the steady state
abundance of c-myc mRNA with no significant change in the stability of
the transcript (18). The experiments described below were undertaken to
identify glucocorticoid receptor binding sites and potential
glucocorticoid response elements within the murine c-myc promoter, with
a view toward understanding how glucocorticoids regulate c-myc
transcription. In the course of these analyses, we have identified a
novel glucocorticoid response element that does not conform to the
consensus nucleotide sequence GTTACAnnnTGTTCT of the mouse mammary
tumor virus (MMTV) glucocorticoid response element (GRE) (19). The
novel c-myc element has the DNA sequence CAGGGTACATGGCGTATGTGTG. This
element acts as a repressor in transient transfection assays. The
glucocorticoid receptor binds to this element with high affinity
in vitro, as do unidentified cellular proteins that repress
transcription. Binding of these transcription factors is competitive,
so that activation of the glucocorticoid receptor de-represses the
promoter.
 |
RESULTS
|
|---|
Analysis of 5'-Deletion Mutants of the Murine c-myc
Promoter
Our previous observations suggest that c-myc transcription is
regulated by interaction with the glucocorticoid receptor (Refs. 14, 18 and T. Ma, unpublished data). However, analysis of glucocorticoid
regulation of the c-myc promoter yielded paradoxical results, as
illustrated by the data shown in Fig. 1
.
Promoter constructs containing more than 354 bp of 5'-flanking sequence
were induced by glucocorticoids (lanes 3 and 4). This result is
counterintuitive, since transcription of the endogenous
c-myc gene is inhibited. The experiment shown in Fig. 1
has
been repeated many times, and we have confirmed these results using
constructs that contain up to 2.5 kb of 5'-flanking sequence with the
same result. In transient expression assays, glucocorticoids stimulated
transcription of c-myc promoter constructs that contain more that 354
bp of 5'-flanking sequence. However, reporters containing less that 447
bp were inhibited by glucocorticoids (lanes 5 and 6). We also noted
that deletion of sequences between -447 and -354 resulted in a
significant increase in basal promoter activity (compare lanes 3 and
5).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1. Deletional Analysis of Murine c-myc Promoter
P1798 cells were transfected with pCATbasic (lanes 1 and 2) or deletion
mutants of the murine c-myc promoter linked to a CAT reporter (lanes
312). Reporters were cotransfected with pCMVß and prGRPECE, as
described in Materials and Methods. CAT activity was
analyzed for midlog phase control cells (-) (lanes 1, 3, 5, 7, 9, and
11) and dexamethasone-treated cells (+) (lanes 2, 4, 6, 8, 10, and 12).
CAT activity was normalized as described in Materials and
Methods. A schematic of the murine c-myc promoter region is shown,
indicating potential glucocorticoid receptor binding sites in
relationship to the two major promoters, P1 and P2.
|
|
Although the observation is paradoxical in light of our understanding
of how c-myc transcription is regulated, our attention was focused on
the possibility that there might be a positive glucocorticoid response
element in the c-myc promoter, somewhere between -447 and -354 bp. We
searched the mouse c-myc promoter for the glucocorticoid receptor
consensus binding sequence ACAnnnTGTnCT. Even allowing two mismatches,
no such sequence was detected within 2.4 kb upstream of the P1
promoter. However, the computer did identify three potential
half-sites, defined by the sequence TGTTCT allowing one mismatch, as
shown in Fig. 1
. A perfectly conserved half-site
(-331TGTTCT-326)
was identified downstream of a known AP-1 element
(-351TGACGTA-345bp)
(20, 21). We designated this potentially interesting element as
"A/G" to indicate the possibility that it might function as a
composite AP-1/GRE (22, 23). Two additional possible half-sites were
identified by sequence analysis:
-304TGTTCG-295
and
-366TGTTCC-361.
Footprinting Analysis of the c-myc Promoter Region
Footprinting experiments were performed to investigate the
interactions of nuclear factors and GR with the c-myc promoter to -447
bp. Nuclear extracts from mid-log phase P1798 cells contained proteins
that interacted with this portion of the c-myc promoter, to the extent
that such extracts weakly protected a large number of nucleotides
between about -300 and -400 bp (Fig. 2A
). Both the consensus half-GRE at
approximately -330 and the AP-1 site (
-350) were protected. Two
additional regions were strongly protected, around -380 and around
-400. These two regions were referred to as -370/-406 domain in
Fig. 2A.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 2. Footprint Analysis of the c-myc Promoter from -447
to -52 bp
A, The 396-bp probe (30 fmol) was labeled on the coding strand
(upstream primer) and incubated with increasing concentrations of P1798
cell nuclear extract, as described in Materials and
Methods. Ideoxynucleotide sequencing reactions for A and G were
used as position markers. B, The binding reactions contained 30 fmol of
the 396-bp probe, labeled at noncoding strand (lanes 15) or coding
strand (lanes 610), plus 0, 0.4, 1, 2, 4 pmol of hGRDBD (lanes 1 and
6, 2 and 7, 3 and 8, 4 and 9, and 5 and 10, respectively). C, The
binding reactions contained 30 fmol of the 396-bp probe labeled on the
coding strand, without (lanes 1 and 8) or with 2 pmol of hGRDBD (lanes
27, and 914), and 0 to 500 pmol of competitor AGRE (lanes 37) or
mAGRE (lanes 1014). Lanes 1 and 8 had no competitors. A Maxim and
Gilbert G ladder was used as a position marker (lane G).
|
|
Human recombinant glucocorticoid receptor DNA-binding domain (24),
hereafter called hGRDBD, was analyzed for the ability to bind to the
mouse c-myc promoter region from +141 to -447 bp. Several potential
receptor-binding sites were detected in the region, as illustrated by
the data shown in Fig. 2B
. The receptor fragment bound to the half-GRE
of the A/G domain, as would be predicted by the nucleotide sequence
(TGTTCT). A second, relatively weak protection was observed around
-300 bp, and probably corresponds to the sequence TGTTCG at -304 to
-295. Deletion of this site has no effect on glucocorticoid
regulation, and this region has not been studied further.
We were surprised to observe a much stronger protection over the
-376/-401 region, which overlaps with the region (-370/-406) that
was strongly protected by nuclear extract proteins (Fig. 2A
). This
glucocorticoid receptor binding site will be designated GRB1. Although
it cannot be perceived from the data shown in Fig. 2B
, we noted in our
optimization studies that this GRB1 domain was invariably more strongly
protected than any other part of the promoter. This region does contain
the sequence
-393TGTACC-398,
but it is not obvious that this should bind hGRDBD with more avidity
that the TGTTCT consensus sequence at approximately -330 bp (A/G in
Fig. 2B
). Binding specificity was demonstrated by competition with an
oligonucleotide that corresponds to the glucocorticoid receptor binding
site from the rat angiotensinogen promoter (AGRE), as shown in Fig. 2C
, lanes 37. A mutant oligonucleotide (mAGRE) that does not bind the
glucocorticoid receptor (25) does not displace the A/G or GRB1 domain
footprints of hGRDBD (Fig. 2C
, lanes 1014).
The data shown in Fig. 2
indicate that the glucocorticoid receptor and
other nuclear proteins bind to sequences between -326 and -353 bp
(the A/G element) and to the sequences between -370 and -406 bp (the
GRB1 element) of the c-myc promoter. Dimeric synthetic oligonucleotides
that correspond to the A/G and GRB1 sequences were inserted downstream
of (at the 3'-end of) the coding sequences of chloroamphenicol
acetyltransferase (CAT) in an expression vector pCATpromoter that
contains the SV40 promoter but does not have the SV40 enhancer. These
constructs were transiently transfected into P1798 cells, and their
activity was determined in the presence and absence of dexamethasone.
As shown in Fig. 3A
, insertion of the A/G
sequences had little effect on basal activity of the SV40 promoter
(compare lanes 1 and 3). Glucocorticoids inhibited transcription from
the SV40 promoter (lanes 1 and 2) and from the SVA/G derivative (lanes
3 and 4), even as glucocorticoids inhibited transcription from the P2
TATA box of c-myc (Fig. 1
, lanes 11 and 12). Insertion of the GRB1
sequence at the 3'-end of CAT decreased expression of the reporter
(compare lanes 1 and 5), and addition of dexamethasone to
SVGRB-transfected cells stimulated expression of the reporter (lanes 5
and 6).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Effect of A/G and GRB1 on SV40 Promoter Activity
In the experiment shown in Panel A, P1798 cells were transiently
transfected with pCATpromoter (designated SV40 in lanes 1 and 2),
pSVA/G (lanes 3 and 4), and pSVGRB (lanes 5 and 6) together with
pCMVß and prGRPECE. The construction of these reporters and the
procedures for transfection are described in Materials and
Methods. Transfected cells were cultured in the absence (-)
(lanes 1, 3, and 5) or presence (+) (lanes 2, 4, and 6) of
dexamethasone. CAT activity of the cell lysates was analyzed according
to Materials and Methods. B, P1798 cells were
transfected with luciferase reporters. SV/Luc contains the SV40 core
promoter fused to GL3 luciferase. GRB/SV/Luc contains two copies of the
GRB1 binding site inserted in tandem upstream of the SV40 core
promoter, and SV/Luc/GRB contains two copies of the GRB1
oligonucleotide inserted downstream of the GL3 coding sequence.
Transfected cells were pooled and divided into two aliquots, one of
which received dexamethasone. Luciferase activity was assayed 24 h
after transfection. All reporters were cotransfected with an
SV40/ß-gal internal control, and luciferase data are normalized to
ß-gal expression.
|
|
The results shown in Fig. 3A
were confirmed using luciferase reporters.
The basal reporter (SV/Luc in Fig. 3B
) contains the SV40 basal
promoter fused to luciferase GL3. This reporter was repressed by
glucocorticoids, consistent with the data shown in Fig. 3A
(lanes 1 and
2). A reporter was constructed in which two copies of the GRB1
oligonucleotide were inserted in tandem upstream of the SV40 basal
promoter. This reporter is identified as GRB/SV/Luc in Fig. 3B
. The
basal activity of this promoter was significantly less than that of the
SV/Luc reporter (P < 0.003). This reporter was
strongly stimulated by addition of dexamethasone. In the experiment
shown in Fig. 3B
, the reporters were cotransfected with a
glucocorticoid receptor expression vector, as described in
Materials and Methods. However, P1798 cells contain abundant
endogenous glucocorticoid receptor, and >10 fold stimulation of
luciferase activity was observed when the activity of GRB/SV/Luc was
measured in glucocorticoid-treated cells that had not been
cotransfected with the glucocorticoid receptor expression construct
(data not shown). A third reporter was constructed in which two copies
of GRB1 were inserted downstream of the luciferase coding sequence.
This SV/Luc/GRB reporter is analogous to the SVGRB construct used in
the experiment shown in Fig. 3A
. As shown in Fig. 3B
, the basal
activity of SV/Luc/GRB was significantly repressed, relative to the
SV/Luc control (P < 0.0001). This reporter was
weakly stimulated by glucocorticoids.
Interaction between hGRDBD and AGRE, mAGRE, A/G, and GRB1
Recombinant hGRDBD was used to analyze receptor binding to
synthetic oligonucleotides that correspond to AGRE, mAGRE, A/G, and
GRB1. As shown in Fig. 4A
, the receptor
fragment bound to an authentic GRE (AGRE) but not to a mutant (mAGRE),
indicating that the receptor binds in a sequence-specific manner. The
receptor had very low affinity for A/G. Moreover, the mobility of the
hGRDBD/A/G complex was significantly greater than that of the
hGRDBD/AGRE complex. This difference in mobility is consistent with the
conclusion that a single hGRDBD fragment binds to the TGTTCT half-site
in the A/G oligonucleotide, whereas two receptor fragments bind to the
authentic, palindromic AGRE. The hGRDBD bound to GRB1 at receptor
concentrations similar to those that bound the AGRE. The mobility of
the GRB1 complex was similar to that of the hGRDBD/AGRE complex,
suggesting that a dimeric hGRDBD interacts with GRB1. Interaction of
hGRDBD with GRB1 was sequence-specific, as evidenced by the observation
that the GRB1/hGRDBD complex could be displaced by addition of
unlabeled AGRE but not unlabeled mAGRE (Fig. 4B).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4. Interaction between hGRDBD and AGRE, mAGRE, A/G,
and GRB1
A, The binding reactions contained 10 fmol of labeled oligonucleotides
and increasing amounts of hGRDBD from 0 to 1 pmol. Conditions for
binding and resolution of gel shift entities are described in
Materials and Methods. B, The binding reactions
contained 10 fmol of labeled GRB1 oligonucleotides, 0.1 pmol hGRDBD,
and increasing amounts of AGRE (10-, 20-, 50-, and 100-fold molar
excess to GRB1) or mAGRE (10, 20, 50, and 100-fold molar excess). In
the experiment shown in panel C, 1.1, 2.2, 4.4, or 11 pmol of hGRDBD
(lanes 14, respectively) were resolved by SDS-PAGE, blotted,
renatured, and bound to 10 fmol of labeled GRB1.
|
|
The data shown in Fig. 4A
suggest that the affinity of GRB1 for hGRDBD
is similar to that for the AGRE, whereas the affinity of hGRDBD for the
A/G half-GRE oligonucleotide appeared to be significantly less.
However, this conclusion was complicated by the presence of a
contaminating principle that appeared to degrade unbound probe at
higher concentrations of hGRDBD. In an effort to circumvent this
problem, various concentrations of hGRDBD were resolved by
electrophoresis, renatured, and probed with labeled
oligonucleotides in a typical Southwestern experiment, as illustrated
in Fig. 4C
. Although it is difficult to make any rigorous conclusions
about affinity under these circumstances, the results are consistent
with the conclusion that the relative affinities of these probes are
approximately AGRE>GRB1>>A/G.
The relative affinities of hGRDBD for the various probes were evaluated
using a different preparation of hGRDBD that was washed more
extensively before elution from Ni-Sepharose and that appears to be
free of the principle that degrades the unbound probe. Binding data for
GRB1 are shown in Fig. 5A
. In addition,
we examined binding to two oligonucleotides that correspond to two
halves of GRB1. The oligonucleotide called GRB1a corresponds to
sequences
5'-403GTCCAGGGTACATGGCGTATT-383,
and contains the potential half-site sequence TGTACC. This half of GRB1
binds hGRDBD, but the binding is of low affinity. The mobility of the
GRBa/hGRDBD complex is greater than that of the GRB1/hGRDBD complex
when less than 2 pmol of receptor are added to the binding reaction,
suggesting that the GRB1a consists of a single hGRDBD bound to
the oligonucleotide. At receptor concentrations in excess of
2 pmol, we observe a larger complex, which we suspect is due to
aggregation. GRB1b, corresponding to sequences
5'-383TGTGTGGAGCGAG-371,
did not appear to bind hGRDBD at any concentration of receptor, up to
20 pmol. Quantitative binding data are shown in Fig. 5B
. These data
indicate that, within the limits of this sort of assay, the affinity of
hGRDBD for GRB1 is about half of that observed for AGRE, an authentic,
palindromic GRE. The data shown in Fig. 5
are consistent with the
conclusion that GRB1 is a high-affinity glucocorticoid receptor-binding
site, consisting of two halves each of which binds one hGRDBD. When
separated, one half (GRB1a) is a low-affinity hGRDBD-binding site
(probably due to the TGTACC motif), and the other (GRB1b) has little or
no inherent affinity for hGRDBD.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 5. hGRDBD Interaction with GRB1, GRBa, and GRBb
Oligonucleotides
Binding reactions were carried out with 20 fmol of labeled GRB1 or AGRE
plus 0. 0.05, 0.1, 0.2, 0.5, or 1 pmol hGRDBD or with 10 fmol GRB1a or
GRB1b plus 0, 1, 2, 5, 10, or 20 pmol of hGRDBD in 15 µl total
volume. Binding data are shown in panel A and quantitative data in
panel B.
|
|
Binding of P1798 Cell Nuclear Proteins and hGRDBD to GRB1
Oligonucleotides
The footprinting data shown in Fig. 2A
indicate that nuclear
extracts from P1798 cells contain proteins that bind to GRB1 domain,
and the deletion analysis suggests that these are repressors. The DNAse
protection data were confirmed by the gel mobility shift data shown in
Fig. 6A
. Nuclear proteins bound to
labeled GRB1 oligonucleotides to yield three discrete gel shift
entities (lane 2). Addition of unlabeled GRB1 oligonucleotide displaced
all three entities, whereas addition of AGRE, mAGRE, or consensus MMTV
GRE (reviewed in Ref. 19) had no significant effect on binding of
nuclear factors to labeled GRB1 oligonucleotides. None of the gel shift
entities formed by nuclear proteins could be supershifted by hGR
antibodies (data not shown). Moreover, addition of nuclear proteins
competed with hGRDBD for GRB1 oligonucleotides. In the experiment shown
in Fig. 6B
, hGRDBD was added in a concentration sufficient to shift all
of the labeled GRB1 oligonucleotide (lane 2). Addition of increasing
concentrations of nuclear protein resulted in a progressive decrease in
the hGRDBD-containing complex with a concomitant increase in the
nuclear protein-binding pattern. The data suggest that nuclear extract
proteins compete with GR, and that binding of proteins and GR is
mutually exclusive.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 6. Binding of P1798 Cell Nuclear Proteins and hGRDBD
to GRB1 Oligonucleotides
A, The binding reactions contained 10 fmol of labeled GRB1
oligonucleotide, 5 µg of nuclear proteins, and increasing amounts of
unlabeled oligonucleotide competitors, as indicated. The numbers
below each lane indicate the molar excess of unlabeled GRB1,
AGRE, mAGRE, or MMTV GRE. The first lane contains GRB1 probe with no
protein and the second lane contains no competitor. The binding
reactions were carried out as described in Materials and
Methods. B, The binding reactions contained 5 fmol of labeled
GRB1 oligonucleotide, 1 pmol hGRDBD (lane 2), and 0.1, 0.2, 0.5, 1, 2,
and 5 µg of P1798 cell nuclear extract (lanes 38, respectively).
Lane 1 contains labeled probe and no protein. Lane 9 contained probe
and 5 µ g of nuclear protein without hGRDBD.
|
|
 |
DISCUSSION
|
|---|
To decipher the mechanisms of glucocorticoid regulation of c-myc
promoter activity, we examined the DNA sequences and conducted a series
of experiments, both in vitro and in cultured cells, to
identify glucocorticoid receptor binding sites and potential
glucocorticoid response elements within the c-myc promoter region. No
consensus, high affinity receptor-binding site was identified by
computer search or by binding studies. There is a potential composite
AP-1/GRE at -351 to -326 bp, which might function as a
cis-acting element in response to dexamethasone (22, 23).
This region contains a perfect GR half-site, and recombinant GR can
bind to this region in vitro. However, deletion of this
putative composite GRE had no effect on glucocorticoid response of
c-myc/CAT. Neither did this element convey glucocorticoid
responsiveness to a heterologous (SV40) promoter.
We have identified a region between -354 and -447 bp of the c-myc
promoter that has two interesting properties. Deletion of this
region results in a significant increase in basal transcription
activity of c-myc reporters. Insertion of this GRB1 element
decreases basal activity of the minimal SV40 promoter. These data are
consistent with the conclusion that this element functions as a
position and distance-independent repressor of transcription. We have
shown that unidentified nuclear factors bind to this element, and we
propose that it is the interaction between these proteins and this
element that represses transcription from adjacent promoters.
In addition to low basal activity, promoters that contain this GRB1
element are regulated by glucocorticoids. Constructs that contain this
region are stimulated by dexamethasone, whereas constructs that do not
have this region are inhibited. The inhibition that prevails under
these circumstances can be observed even with constructs that contain
only basal promoter elements such as the c-myc P2 TATA box and the SV40
basal promoter. One possible interpretation of these observations is
that the GR interacts directly with some component of the core
transcription machinery so as to squelch transcription. There is
evidence that steroid hormone receptors have such properties (26, 27, 28, 29).
However, there is another possible explanation that may have more
physiological relevance. Mid-log phase P1798 cells have a population
doubling time of about 12 h, whereas glucocorticoid-treated P1798
cells are uniformly arrested in G1. It seems
reasonable that the overall rate of transcription must decrease to
accommodate such a transition, and almost every promoter that we have
ever examined is inhibited about 50% in glucocorticoid-treated P1798
cells. Recent data from our laboratory suggest that this may be linked
to expression of cyclin C, which is a component of RNA polymerase II
C-terminal kinase (P. Chi, manuscript in preparation).
The ability of the -447/-354 region to convey glucocorticoid
induction is unanticipated, since this element does not conform in any
obvious way to the consensus GRE sequence. Nevertheless, recombinant
GRDBD can bind to this region in vitro, as evidenced by
DNase I footprinting and electrophoretic mobility shift assay (EMSA).
This element appears to consist of two halves, one of which contains
the sequence TGTACC and has low affinity for GR. The other half of GRB1
has little or no affinity for GR in vitro. A similar
situation prevails with authentic GREs, in which the TGTnCT half of the
palindrome has low affinity and the "left hand" GTTACA half has
very little affinity for GR (30). We have been unsuccessful in
generating active, full-length recombinant GR; and one must acknowledge
some concerns about the fact that all of our binding data have been
done with the DNA-binding fragment. Nevertheless, these data clearly
indicate that the GR has the potential to bind to this element with
high affinity and in a sequence-specific manner.
Our working hypothesis is summarized in the cartoon shown in Fig. 7
. We propose that a repressor protein
binds to the GRB1 element in mid-log phase cells. This hypothetical
repressor footprints the sequence:
-406GCGGTCCAGGGTACATGgcgtaTTGTGTGGAGCGAGG-370.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. Hypothetical Model for
Glucocorticoid-Mediated Derepression at the GRB1 Element of the
c-myc Promoter
The basal transcription complex (BTC) is depicted associated with the
c-myc promoter, with the arrows illustrating the P1 and
P2 start sites. The data suggest that the hypothetical repressor (R),
bound to GRB1, is displaced by binding of the glucocorticoid repressor
(GR).
|
|
The nucleotides shown in uppercase letters in this
representation are protected, and those shown in lowercase
letters are unprotected. From the properties of this repressor, we
propose that it interacts with the basal transcriptional complex (BTC
in Fig. 7
) in some manner so as to inhibit transcription. This
hypothetical repressor protein has the ability to act in a manner that
is, to some extent, independent of distance and context; and few such
repressors have been characterized. The hGRDBD footprints:
-401CCAGGGTACATGGCGTATtGTGTGgAgC-374.
The boldface nucleotides are hypersensitive, and the
potential GRE half-site is underlined. The binding
footprints of the GR and the hypothetical repressor overlap, and
binding is competitive; but the footprinting data suggest that
different nucleotide sequences may be involved in binding the receptor
and the repressor.
We are unaware of any glucocorticoid response element that has the
properties of the GRB1 element. Although we have not measured binding
constants, the gel shift data infer that GRB1 binds a dimeric receptor
with relatively high affinity. There is nothing obvious about the
nucleotide sequences that would suggest that such was likely, although
GRB1 does contain some of the key nucleotides that have been identified
by mutagenesis and crystallographic studies of the GR/DNA binding
complex. Neither are we aware of any circumstance in which activation
by the glucocorticoid receptor involves competitive binding with a
repressor. It is possible that this element is not normally a
glucocorticoid response element. We may have identified the binding
site for some other member of the nuclear receptor superfamily, and it
may be an accident that this site happens to have significant affinity
for the glucocorticoid receptor under the conditions that we have
employed in these experiments. This remains to be established.
Likewise, it will be essential to identify the repressor protein(s)
that compete with GR (or some other nuclear receptor) for this GRB1
element.
 |
MATERIALS AND METHODS
|
|---|
Oligonucleotides
All oligonucleotides were chemically synthesized by Genosys (The
Woodlands, TX). Double-stranded oligonucleotides were made by mixing
two complimentary, single-stranded oligonucleotides at a concentration
of 50 µM each in TE (10 mM Tris-HCl, pH 8, 1
mM EDTA). The double-stranded MMTV GRE oligonucleotide had
the sequence 5'-TCGACTGTACAGGATGTTCTAGCTACT. AGRE, the angiotensinogen
promoter glucocorticoid response element, had the sequence
5'-CATCCACAAGCCCAGAACATTTTGTTTCAATATGGCTA, and the
mutant mAGRE had the sequence 5'-CCATAACATTTGTGGACAAT, as described by
Brasier et. al (25). The nucleotide designated A/G
corresponded to the c-myc promoter region from -353 to -315 bp
(relative to the P1 promoter start site) and had a sequence of
5'-GATCGGTGACTGATATACGCAGGGCAAGAACACAGTTCAGCCG. The oligonucleotide
probe designated GRB1 corresponded to the c-myc promoter region -403
to -371bp (relative to the P1 transcriptional start site) and had
the sequence 5'-GATCGTCCAGGGTACATGGCGTATTGTGTGGAGCGAG. GRB1a and
GRB1b corresponded to the c-myc promoter region -403 to -383 bp and
-383 to -371 bp, respectively, and had sequences of
5'-GTCCAGGGTACATGGCGTATT and 5'-TGTGTGGAGCGAG. Primers for generating
DNA probe (396 bp) in footprinting experiments corresponded to the
sequences 5'-CAGCCTTAGAGAGACGCC (from -447 to -430 bp) for upstream
and 5'-CCAGAGAACCTCTCTTTCTCCC' (-52 to -73bp) for downstream. Primers
for generating c-myc promoter-containing fragments were as follows:
upstream primer for pmyc(-447) was the same as the upstream primer for
the footprint probe; for pmyc(-354) the same as A/G sense strand
oligonucleotide; for pmyc(-308) 5'-GCGCCCGAACAACCGTACAG (-308 to
-289 bp); and pmyc(-65)CAT 5'-GAGAGGTTCTCTGGCTAATCCCC (-65 to -43
bp); and downstream primer 5'-GCACACACGGCTCTTCCAACC-3' (+229 to +209
bp).
Construction of Plasmids
PCR was used to generate 5'-deletions of the murine c-myc
promoter region by using p5'myc4 (18) as a template and Taq
DNA polymerase (Life Technologies, Inc., Gaithersburg, MD)
following the manufacturers instruction. These PCR products were
subcloned into pCRII vector (Stratagene, La Jolla, CA).
The HindIII c-myc promoter-containing fragments were
ligated into the HindII site of a promoterless plasmid
pCATbasic (Promega Corp., Madison, WI) to
generate pmyc(-447)CAT, pmyc(-354)CAT, pmyc(-308)CAT, and
pmyc(-65)CAT. For pmyc(+117)CAT, the 0.2 kb c-myc BamHI
fragment of pmyc(-65)CAT was removed. pmyc(-447)CAT,
pmyc(-354)CAT, pmyc(-308)CAT, pmyc(-65)CAT, and pmyc(+117)CAT
contained c-myc promoter region -447, -354, -308, -65, and +117 to
+141 bp upstream of CAT gene in pCATbasic, respectively. pSVA/G
and pSVGRB1 contained two head-to-tail copies of A/G and GRB1
oligonucleotides downstream of CAT gene in the reversed orientation at
BamHI site of pCATpromoter (Promega Corp.),
which has the SV40 promoter but lacks the SV40 enhancer. The luciferase
expression vectors were derivatives of pGL3 (CLONTECH Laboratories, Inc., Palo Alto, CA). GRB/SV/Luc was constructed
by inserting a tandem, head-to-tail GRB1 dimeric oligonucleotide into
the XhoI/BglII sites upstream of the SV40 minimum
promoter. SV/Luc/GRB was made by inserting the same dimeric GRB1
oligonucleotide into the SalI/BamHI sites
downstream of the SV40 polyadenylylation site that terminates GL3.
prGRPECE was constructed by cloning full-length rGR (a gift from Keith
Yamamoto, University of California San Francisco) into a
BamHI site of the PECE (a gift from Ivan Sadowski) driven by
the SV40 early promoter (A. R. Brasier, unpublished).
Cell Culture, Transfection, and Reporter Gene Assay
Mouse T-lymphoma P1798 cells were cultured to mid-log phase
(31), harvested, and washed once with serum-free RPMI 1640 medium. The
cells were suspended in serum-free RPMI 1640 at a concentration of
2 x 107 cells/ml and 1 x
107 cells were transiently transfected by
electroporation at 960 µF, 0.35 kV using a Gene Pulser (Bio-Rad Laboratories, Inc., Richmond, CA) with 10 µg CAT constructs, 2
µg pCMVß (CLONTECH Laboratories, Inc.) as an internal
control, and 5 µg prGRPECE. Luciferase reporter plasmids (2 µg)
were transfected into P1798 by electroporation, as described above,
along with 0.5 µg of SV/ß-gal as an internal control and 5 µg of
prGRPECE. After electroporation, nonaggregated cells were pooled in 8.5
ml 5%FBS-RPMI 1640 and split into two 4 ml cultures. One culture was
treated with 4 µl of 70% ethanol and the other with 4 µl of 70%
ethanol containing 0.1 mM dexamethasone (final
concentration: 0.1 µM). For CAT assay, the cells were
harvested 910 h after transfection, at which time both control and
glucocorticoid-treated cultures contained the same number of cells and
the same amount of total cellular protein. For luciferase, cells were
harvested 24 h after transfection. The cells were washed with PBS
and lysed by freeze-thaw in 50 ml of 0.25 mM Tris-HCl, pH
7.6 (32).
The cell lysates were used for determination of ß-galactosidase and
CAT activity. ß-Galactosidase activity was measured using the
Luminescent ß-Galactosidase Genetic Reporter System II
(CLONTECH Laboratories, Inc.). CAT activity was analyzed
using 540 µl (up to 20 µg) of cell lysates in 150 µl (32),
incubated at 37 C for 11.5 h. CAT reactions were normalized to
ß-galactosidase expression in the following manner. When different
promoters were compared, the extracts were first assayed for
ß-galactosidase. Extracts containing equal amounts of
ß-galactosidase activity were assayed for CAT. In this way, we
could normalize for transfection assay from one experiment to the next,
and therefore compare promoter activity. However, this procedure could
not be used to compare activity of a given promoter in control and
glucocorticoid-treated cells. Glucocorticoids inhibit the expression of
the SV40/ß-galactosidase promoter (as will be shown presently);
therefore, ß-galactosidase could not be used as an internal standard.
In those experiments in which we wished to compare control and
dexamethasone-treated extracts, we pooled all transfected cells to
ensure equal efficiency of transfection. The pooled cultures were
divided, and one-half received dexamethasone. Extracts were prepared,
and equal amounts of protein were assayed for reporter gene activity.
TLC was used to separate acetylated chloramphenicol, and labeled
product was detected by autoradiography. Each transient transfection
experiment was repeated at least three times.
Bacterial Expression of Human Glucocorticoid Receptor DNA Binding
Domain (hGRDBD)
The DNA sequence encoding the human glucocorticoid receptor DNA
binding domain (hGRDBD, amino acids 409499) (24) was ligated into a
BamHI site of the pRSET-A prokaryotic expression vector
(Invitrogen, San Diego, CA) producing an in-frame fusion
protein with the His-tag. The hGRDBD pRSET plasmid was transformed into
E. coli BL21 DE3 (pLysS), grown in LB containing 50 µg/ml
ampicillin and 20 µg/ml chloramphenicol at 37 C, and induced by
addition of 1 mM
ß-D-thiogalactopyranoside for 4 h. Cell
lysate was prepared by suspending cells in TDGN buffer [100
mM NaCl, 10 mM Tris-HCl, 1
mM dithiothreitol, 10% (vol/vol) glycerol, pH
8.0] followed by one cycle of freeze-thaw. Lysates were additionally
disrupted by French press (1000 lb/in2) and
centrifuged at 150,000 x g for 30 min at 4 C. The
bacterial lysate supernatant was then poured over a nickel agarose
column (QIAGEN, Chatsworth, CA). The column was washed
with 10 column volumes of TDGN buffer containing 50
mM imidazole. The His-tagged hGRDBD was
step-eluted with TDGN buffer containing 200 mM
imidazole. Fractions containing >90% pure hGRDBD (determined from
Coomassie blue stained SDS-PAGE) were pooled. Samples were combined and
dialyzed overnight in 1liter of TDGN at 4 C with 3 changes of the
buffer. Final protein concentration was between 110 mg/ml.
Footprinting and EMSA
The 396-bp probe, corresponding to c-myc promoter region -447
to -52 bp from p5'myc4, was amplified by PCR. The probe was labeled by
incorporating one of the primers labeled with
([
-32P]ATP, DuPont Merck Pharmaceutical Co., 7000 Ci/mmol) at the 5'-end. The probe was
then purified on 5% PAGE. P1798 cell nuclear extract was prepared, and
footprinting experiments were carried out as previously described
(24).
For EMSA, the A/G, AGRE, mAGRE, MMTV GRE, GRB1, GRB1a, and GRB1b
oligonucleotides were annealed before labeling with
[
-32P]ATP at both 5'-ends. Binding reactions
contained 10 fmol of labeled probes (5 x
103 cpm) (unless otherwise indicated in the
figure legends) plus unlabeled oligonucleotide competitors, nuclear
proteins, or hGRDBD, as indicated in the figure legends, in 15 µl
under the same condition used in footprinting experiments. Samples were
separated on 5% PAGE-0.5xTris-borate-EDTA and analyzed by
autoradiography.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: E. Aubrey Thompson, Ph.D., Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston, Texas 77555-0645. E-mail: athompso{at}utmb.edu
This work was supported in part by a grant from the National Cancer
Institute (CA-24347) to E.A.T.
Received for publication August 30, 1999.
Revision received May 31, 2000.
Accepted for publication June 1, 2000.
 |
REFERENCES
|
|---|
-
Sheiness D, Bishop JM 1979 DNA and RNA from uninfected
vertebrate cells contain nucleotide sequences related to the putative
transforming gene of avian myelocytomatosis virus. J Virol 31:514521[Abstract/Free Full Text]
-
Davis AC, Wims M, Spotts GD, Hann SR, Bradley A 1993 A null
c-myc mutation causes lethality before 10.5 days of gestation in
homozygotes and reduced fertility in heterozygous female mice. Genes
Dev 7:671682[Abstract/Free Full Text]
-
Spencer CA, Groudine M 1991 Control of c-myc regulation in
normal and neoplastic cells. Adv Cancer Res 56:148[Medline]
-
Marcu KB, Bossone SA, Patel AJ 1992 Myc function and
regulation. Annu Rev Biochem 61:809860[CrossRef][Medline]
-
Kelly K, Siebenlist U 1986 The regulation and expression of
c-myc in normal and malignant cells. Annu Rev Immunol 4:317338[CrossRef][Medline]
-
Hiebert SW, Lipp M, Nevins JR 1989 E1A-dependent
trans-activation of the human MYC promoter is mediated by the E2F
factor. Proc Natl Acad Sci USA 86:35943598[Abstract/Free Full Text]
-
Postel EH, Berberich SJ, Flint SJ, Ferrone CA 1993 Human
c-myc transcription factor PuF identified as nm23H2 nucleoside
diphosphate kinase, a candidate suppressor of tumor metastasis. Science 261:478480[Abstract/Free Full Text]
-
Komatsu M, Li H-O, Tsutsui H, Itakura K, Matsumura M,
Yokoyama KK 1997 MAZ, a Myc-associated zinc finger protein, is
essential for the ME1a1-mediated expression of the c-myc gene during
neuroectodermal differentiation of P19 cells. Oncogene 15:11231131[CrossRef][Medline]
-
Lee TC, Ziff EB 1999 Mxi1 is a repressor of the c-myc
promoter and reverses activation by USF. J Biol Chem 274:595606[Abstract/Free Full Text]
-
Cooney M, Czernuszewicz G, Postel EH, Flint SJ, Hogan ME 1988 Site-specific oligonucleotide binding represses transcription of the
human c-myc gene in vitro. Science 241:456459[Abstract/Free Full Text]
-
Reddoch JF, Miller DM 1995 Inhibition of nuclear protein
binding to two sites in the murine c-myc promoter by
intermolecular triplex formation. Biochemistry 34:76597667[CrossRef][Medline]
-
Kim H-G, Reddoch JF, Mayfield C, Ebbinghaus S, Vigneswaran N,
Thomas S, Jones Jr DE, Miller DM 1998 Inhibition of transcription of
the human c-myc protooncogene by intermolecular triplex.
Biochemistry 37:22992304[CrossRef][Medline]
-
Eastman-Reks SB, Vedeckis WV 1986 Glucocorticoid inhibition of
c-myc, c-myb, and c-Ki-ras expression in a mouse lymphoma cell line.
Cancer Res 46:24572462[Abstract/Free Full Text]
-
Forsthoefel AM, Thompson EA 1987 Glucocorticoid regulation of
transcription of the c-myc cellular protooncogene in P1798 cells. Mol
Endocrinol 1:899907[Abstract]
-
Yuh YS, Thompson EB 1989 Glucocorticoid effect on
oncogene/growth gene expression in human T lymphoblastic leukemic cell
line CCRF-CEM. Specific c-myc mRNA suppression by dexamethasone. J
Biol Chem 264:1090410910[Abstract/Free Full Text]
-
OBanion MK, Levenson RM, Brinckmann UG, Young DA 1992 Glucocorticoid modulation of transformed cell proliferation is oncogene
specific and correlates with effects on c-myc levels. Mol Endocrinol 6:13711380[Abstract]
-
Frost GH, Rhee K, Ma T, Thompson EA 1994 Expression of
c-myc in glucocorticoid-treated L929 fibroblastic cells. J
Steroid Biochem Mol Biol 50:109119[CrossRef][Medline]
-
Ma T, Mahajan PD, Thompson EA 1992 Glucocorticoid regulation
of c-myc promoter utilization in lymphoid cells. Endocrinology 6:960968
-
Beato M 1989 DNA regulatory elements for steroid hormones. J
Steroid Biochem 32:737747[CrossRef][Medline]
-
Lee W, Mitchell P, Tjian R 1987 Purified transcription factor
AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741752[CrossRef][Medline]
-
Takimoto M, Quinn JP, Farina AR, Staudt LM, Levens D 1989 Fos/jun and octamer-binding protein interact with a common site in a
negative element of the human c-myc gene. J Biol Chem 264:89928999[Abstract/Free Full Text]
-
Diamond MI, Miner JN, Yoshinaga SK, Yamamoto KR 1990 Transcription factor interactions: selectors of positive or negative
regulation from a single DNA element. Science 249:12661272[Abstract/Free Full Text]
-
Pearce D, Matsui W, Miner JN, Yamamoto KR 1998 Glucocorticoid
receptor transcriptional activity determined by spacing of receptor and
nonreceptor DNA sites. J Biol Chem 273:3008130085[Abstract/Free Full Text]
-
Hollenberg SM, Giguere V, Segul P, Evans RM 1987 Colocalization of DNA-binding and transcriptional activation functions
in the human glucocorticoid receptor. Cell 49:3946[CrossRef][Medline]
-
Brasier AR, Tate JE, Ron D, Habener JF 1989 Multiple
cis-acting DNA Regulatory elements mediate hepatic
angiotensinogen gene expression. Mol Endocrinol 3:10221034[Abstract]
-
Ing NH, Beekman JM, Tsai SY, Tsai MJ, OMalley BW 1992 Members of the steroid hormone receptor superfamily interact with TFIIB
(S300-II). J Biol Chem 267:1761717623[Abstract/Free Full Text]
-
Jacq X, Brou C, Lutz Y, Davidson I, Chambon P, Tora L 1994 Human TAFII30 is present in a distinct TFIID complex and is required
for transcriptional activation by the estrogen receptor. Cell 79:107117[CrossRef][Medline]
-
Schwerk C, Klotzbucher M, Sachs M, Ulber V, Klein-Hitpass L 1995 Identification of a transactivation function in the progesterone
receptor that interacts with the TAFII110 subunit of the TFIID complex.
J Biol Chem 270:2133121338[Abstract/Free Full Text]
-
Stöcklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor.
Nature 383:726728[CrossRef][Medline]
-
Tsai S, Carlstedt-Duke J, Weigel NL, Dahlman K, Gustafsson
J-A, Tsai M-J, OMalley B 1988 Molecular interactions of steroid
hormone receptor with its enhancer element: evidence for receptor
dimmer formation. Cell 55:361369[CrossRef][Medline]
-
Thompson Jr EA 1980 Properties of a cell-culture line derived
from lymphosarcoma P1798. Mol Cell Endocrinol 17:95102[CrossRef][Medline]
-
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Struhl K 1997 Current Protocols in Molecular Biology, John
Wiley & Sons, Inc., New York, pp 9.7.19.7.11
-
Rhee K, Ma T, Thompson EA 1994 The macromolecular state of the
transcription factor E2F and glucocorticoid regulation of c-myc
transcription. J Biol Chem 269:1703517042[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
H. Igarashi, K. L. Medina, T. Yokota, M. I. D. Rossi, N. Sakaguchi, P. C. Comp, and P. W. Kincade
Early lymphoid progenitors in mouse and man are highly sensitive to glucocorticoids
Int. Immunol.,
May 1, 2005;
17(5):
501 - 511.
[Abstract]
[Full Text]
[PDF]
|
 |
|