help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, T.
Right arrow Articles by Thompson, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, T.
Right arrow Articles by Thompson, E. A.
Molecular Endocrinology 14 (9): 1377-1386
Copyright © 2000 by The Endocrine Society

A Novel Glucocorticoid Receptor Binding Element within the Murine c-myc Promoter

Tianlin Ma, John A. Copland, Allan R. Brasier and E. Aubrey Thompson

Department of Human Biological Chemistry and Genetics (E.A.T.) and Department of Internal Medicine (J.A.C., A.R.B.) The University of Texas Medical Branch Galveston, Texas 77555-0645
Department of Biochemistry (T.M.) Baylor College of Medicine Houston, Texas 77330


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The protooncogene c-myc is the cellular homolog of the viral oncogene v-myc, a potent inducer of hematopoietic malignancies (1). The product of the c-myc gene serves essential functions in mammalian cells (2). Consequently, there has been a considerable amount of effort applied to understanding the role of c-myc in regulating cell proliferation, differentiation, or death (reviewed in Ref. 3). The abundance of c-myc mRNA is regulated by several mechanisms, including initiation of transcription, transcriptional pausing, and mRNA degradation (reviewed in Refs. 3, 4). These parameters of c-myc expression are regulated by a large number of hormones, growth factors, pharmacological agents, and biological conditions (reviewed in Refs. 4, 5).

Consistent with the diverse array of agents that affect c-myc transcription, a large number of protein-nucleic acid interactions with the c-myc promoter have been identified both in vivo and in vitro (6, 7, 8, 9). Among these are more unusual factors that appear to bind to single-stranded domains within the c-myc promoter so as to induce unwinding and torsional strain (10, 11, 12). It is not presently understood how these elements interact to control c-myc transcription; neither do we appreciate the mechanisms whereby the signals propagated by many diverse stimuli/factors are integrated so as to determine the level of c-myc expression.

We have a particular interest in the mechanisms that impinge upon steroid regulation of c-myc expression. Glucocorticoids cause G1 arrest of lymphoid cells, acting in part through a mechanism that involves inhibition of c-myc expression (13, 14, 15). Similar effects have been described for some fibroblastic cells (16, 17). We have previously demonstrated that the synthetic glucocorticoid dexamethasone is a potent inhibitor of c-myc transcription initiation, and addition of glucocorticoids to mid-log phase P1798 cells causes a decrease of 80–90% in the steady state abundance of c-myc mRNA with no significant change in the stability of the transcript (18). The experiments described below were undertaken to identify glucocorticoid receptor binding sites and potential glucocorticoid response elements within the murine c-myc promoter, with a view toward understanding how glucocorticoids regulate c-myc transcription. In the course of these analyses, we have identified a novel glucocorticoid response element that does not conform to the consensus nucleotide sequence GTTACAnnnTGTTCT of the mouse mammary tumor virus (MMTV) glucocorticoid response element (GRE) (19). The novel c-myc element has the DNA sequence CAGGGTACATGGCGTATGTGTG. This element acts as a repressor in transient transfection assays. The glucocorticoid receptor binds to this element with high affinity in vitro, as do unidentified cellular proteins that repress transcription. Binding of these transcription factors is competitive, so that activation of the glucocorticoid receptor de-represses the promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Analysis of 5'-Deletion Mutants of the Murine c-myc Promoter
Our previous observations suggest that c-myc transcription is regulated by interaction with the glucocorticoid receptor (Refs. 14, 18 and T. Ma, unpublished data). However, analysis of glucocorticoid regulation of the c-myc promoter yielded paradoxical results, as illustrated by the data shown in Fig. 1Go. Promoter constructs containing more than 354 bp of 5'-flanking sequence were induced by glucocorticoids (lanes 3 and 4). This result is counterintuitive, since transcription of the endogenous c-myc gene is inhibited. The experiment shown in Fig. 1Go has been repeated many times, and we have confirmed these results using constructs that contain up to 2.5 kb of 5'-flanking sequence with the same result. In transient expression assays, glucocorticoids stimulated transcription of c-myc promoter constructs that contain more that 354 bp of 5'-flanking sequence. However, reporters containing less that 447 bp were inhibited by glucocorticoids (lanes 5 and 6). We also noted that deletion of sequences between -447 and -354 resulted in a significant increase in basal promoter activity (compare lanes 3 and 5).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Deletional Analysis of Murine c-myc Promoter

P1798 cells were transfected with pCATbasic (lanes 1 and 2) or deletion mutants of the murine c-myc promoter linked to a CAT reporter (lanes 3–12). Reporters were cotransfected with pCMVß and prGRPECE, as described in Materials and Methods. CAT activity was analyzed for midlog phase control cells (-) (lanes 1, 3, 5, 7, 9, and 11) and dexamethasone-treated cells (+) (lanes 2, 4, 6, 8, 10, and 12). CAT activity was normalized as described in Materials and Methods. A schematic of the murine c-myc promoter region is shown, indicating potential glucocorticoid receptor binding sites in relationship to the two major promoters, P1 and P2.

 
Although the observation is paradoxical in light of our understanding of how c-myc transcription is regulated, our attention was focused on the possibility that there might be a positive glucocorticoid response element in the c-myc promoter, somewhere between -447 and -354 bp. We searched the mouse c-myc promoter for the glucocorticoid receptor consensus binding sequence ACAnnnTGTnCT. Even allowing two mismatches, no such sequence was detected within 2.4 kb upstream of the P1 promoter. However, the computer did identify three potential half-sites, defined by the sequence TGTTCT allowing one mismatch, as shown in Fig. 1Go. A perfectly conserved half-site (-331TGTTCT-326) was identified downstream of a known AP-1 element (-351TGACGTA-345bp) (20, 21). We designated this potentially interesting element as "A/G" to indicate the possibility that it might function as a composite AP-1/GRE (22, 23). Two additional possible half-sites were identified by sequence analysis: -304TGTTCG-295 and -366TGTTCC-361.

Footprinting Analysis of the c-myc Promoter Region
Footprinting experiments were performed to investigate the interactions of nuclear factors and GR with the c-myc promoter to -447 bp. Nuclear extracts from mid-log phase P1798 cells contained proteins that interacted with this portion of the c-myc promoter, to the extent that such extracts weakly protected a large number of nucleotides between about -300 and -400 bp (Fig. 2AGo). Both the consensus half-GRE at approximately -330 and the AP-1 site (~-350) were protected. Two additional regions were strongly protected, around -380 and around -400. These two regions were referred to as -370/-406 domain in Fig. 2A.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Footprint Analysis of the c-myc Promoter from -447 to -52 bp

A, The 396-bp probe (30 fmol) was labeled on the coding strand (upstream primer) and incubated with increasing concentrations of P1798 cell nuclear extract, as described in Materials and Methods. Ideoxynucleotide sequencing reactions for A and G were used as position markers. B, The binding reactions contained 30 fmol of the 396-bp probe, labeled at noncoding strand (lanes 1–5) or coding strand (lanes 6–10), plus 0, 0.4, 1, 2, 4 pmol of hGRDBD (lanes 1 and 6, 2 and 7, 3 and 8, 4 and 9, and 5 and 10, respectively). C, The binding reactions contained 30 fmol of the 396-bp probe labeled on the coding strand, without (lanes 1 and 8) or with 2 pmol of hGRDBD (lanes 2–7, and 9–14), and 0 to 500 pmol of competitor AGRE (lanes 3–7) or mAGRE (lanes 10–14). Lanes 1 and 8 had no competitors. A Maxim and Gilbert G ladder was used as a position marker (lane G).

 
Human recombinant glucocorticoid receptor DNA-binding domain (24), hereafter called hGRDBD, was analyzed for the ability to bind to the mouse c-myc promoter region from +141 to -447 bp. Several potential receptor-binding sites were detected in the region, as illustrated by the data shown in Fig. 2BGo. The receptor fragment bound to the half-GRE of the A/G domain, as would be predicted by the nucleotide sequence (TGTTCT). A second, relatively weak protection was observed around -300 bp, and probably corresponds to the sequence TGTTCG at -304 to -295. Deletion of this site has no effect on glucocorticoid regulation, and this region has not been studied further.

We were surprised to observe a much stronger protection over the -376/-401 region, which overlaps with the region (-370/-406) that was strongly protected by nuclear extract proteins (Fig. 2AGo). This glucocorticoid receptor binding site will be designated GRB1. Although it cannot be perceived from the data shown in Fig. 2BGo, we noted in our optimization studies that this GRB1 domain was invariably more strongly protected than any other part of the promoter. This region does contain the sequence -393TGTACC-398, but it is not obvious that this should bind hGRDBD with more avidity that the TGTTCT consensus sequence at approximately -330 bp (A/G in Fig. 2BGo). Binding specificity was demonstrated by competition with an oligonucleotide that corresponds to the glucocorticoid receptor binding site from the rat angiotensinogen promoter (AGRE), as shown in Fig. 2CGo, lanes 3–7. A mutant oligonucleotide (mAGRE) that does not bind the glucocorticoid receptor (25) does not displace the A/G or GRB1 domain footprints of hGRDBD (Fig. 2CGo, lanes 10–14).

The data shown in Fig. 2Go indicate that the glucocorticoid receptor and other nuclear proteins bind to sequences between -326 and -353 bp (the A/G element) and to the sequences between -370 and -406 bp (the GRB1 element) of the c-myc promoter. Dimeric synthetic oligonucleotides that correspond to the A/G and GRB1 sequences were inserted downstream of (at the 3'-end of) the coding sequences of chloroamphenicol acetyltransferase (CAT) in an expression vector pCATpromoter that contains the SV40 promoter but does not have the SV40 enhancer. These constructs were transiently transfected into P1798 cells, and their activity was determined in the presence and absence of dexamethasone. As shown in Fig. 3AGo, insertion of the A/G sequences had little effect on basal activity of the SV40 promoter (compare lanes 1 and 3). Glucocorticoids inhibited transcription from the SV40 promoter (lanes 1 and 2) and from the SVA/G derivative (lanes 3 and 4), even as glucocorticoids inhibited transcription from the P2 TATA box of c-myc (Fig. 1Go, lanes 11 and 12). Insertion of the GRB1 sequence at the 3'-end of CAT decreased expression of the reporter (compare lanes 1 and 5), and addition of dexamethasone to SVGRB-transfected cells stimulated expression of the reporter (lanes 5 and 6).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Effect of A/G and GRB1 on SV40 Promoter Activity

In the experiment shown in Panel A, P1798 cells were transiently transfected with pCATpromoter (designated SV40 in lanes 1 and 2), pSVA/G (lanes 3 and 4), and pSVGRB (lanes 5 and 6) together with pCMVß and prGRPECE. The construction of these reporters and the procedures for transfection are described in Materials and Methods. Transfected cells were cultured in the absence (-) (lanes 1, 3, and 5) or presence (+) (lanes 2, 4, and 6) of dexamethasone. CAT activity of the cell lysates was analyzed according to Materials and Methods. B, P1798 cells were transfected with luciferase reporters. SV/Luc contains the SV40 core promoter fused to GL3 luciferase. GRB/SV/Luc contains two copies of the GRB1 binding site inserted in tandem upstream of the SV40 core promoter, and SV/Luc/GRB contains two copies of the GRB1 oligonucleotide inserted downstream of the GL3 coding sequence. Transfected cells were pooled and divided into two aliquots, one of which received dexamethasone. Luciferase activity was assayed 24 h after transfection. All reporters were cotransfected with an SV40/ß-gal internal control, and luciferase data are normalized to ß-gal expression.

 
The results shown in Fig. 3AGo were confirmed using luciferase reporters. The basal reporter (SV/Luc in Fig. 3BGo) contains the SV40 basal promoter fused to luciferase GL3. This reporter was repressed by glucocorticoids, consistent with the data shown in Fig. 3AGo (lanes 1 and 2). A reporter was constructed in which two copies of the GRB1 oligonucleotide were inserted in tandem upstream of the SV40 basal promoter. This reporter is identified as GRB/SV/Luc in Fig. 3BGo. The basal activity of this promoter was significantly less than that of the SV/Luc reporter (P < 0.003). This reporter was strongly stimulated by addition of dexamethasone. In the experiment shown in Fig. 3BGo, the reporters were cotransfected with a glucocorticoid receptor expression vector, as described in Materials and Methods. However, P1798 cells contain abundant endogenous glucocorticoid receptor, and >10 fold stimulation of luciferase activity was observed when the activity of GRB/SV/Luc was measured in glucocorticoid-treated cells that had not been cotransfected with the glucocorticoid receptor expression construct (data not shown). A third reporter was constructed in which two copies of GRB1 were inserted downstream of the luciferase coding sequence. This SV/Luc/GRB reporter is analogous to the SVGRB construct used in the experiment shown in Fig. 3AGo. As shown in Fig. 3BGo, the basal activity of SV/Luc/GRB was significantly repressed, relative to the SV/Luc control (P < 0.0001). This reporter was weakly stimulated by glucocorticoids.

Interaction between hGRDBD and AGRE, mAGRE, A/G, and GRB1
Recombinant hGRDBD was used to analyze receptor binding to synthetic oligonucleotides that correspond to AGRE, mAGRE, A/G, and GRB1. As shown in Fig. 4AGo, the receptor fragment bound to an authentic GRE (AGRE) but not to a mutant (mAGRE), indicating that the receptor binds in a sequence-specific manner. The receptor had very low affinity for A/G. Moreover, the mobility of the hGRDBD/A/G complex was significantly greater than that of the hGRDBD/AGRE complex. This difference in mobility is consistent with the conclusion that a single hGRDBD fragment binds to the TGTTCT half-site in the A/G oligonucleotide, whereas two receptor fragments bind to the authentic, palindromic AGRE. The hGRDBD bound to GRB1 at receptor concentrations similar to those that bound the AGRE. The mobility of the GRB1 complex was similar to that of the hGRDBD/AGRE complex, suggesting that a dimeric hGRDBD interacts with GRB1. Interaction of hGRDBD with GRB1 was sequence-specific, as evidenced by the observation that the GRB1/hGRDBD complex could be displaced by addition of unlabeled AGRE but not unlabeled mAGRE (Fig. 4B).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Interaction between hGRDBD and AGRE, mAGRE, A/G, and GRB1

A, The binding reactions contained 10 fmol of labeled oligonucleotides and increasing amounts of hGRDBD from 0 to 1 pmol. Conditions for binding and resolution of gel shift entities are described in Materials and Methods. B, The binding reactions contained 10 fmol of labeled GRB1 oligonucleotides, 0.1 pmol hGRDBD, and increasing amounts of AGRE (10-, 20-, 50-, and 100-fold molar excess to GRB1) or mAGRE (10, 20, 50, and 100-fold molar excess). In the experiment shown in panel C, 1.1, 2.2, 4.4, or 11 pmol of hGRDBD (lanes 1–4, respectively) were resolved by SDS-PAGE, blotted, renatured, and bound to 10 fmol of labeled GRB1.

 
The data shown in Fig. 4AGo suggest that the affinity of GRB1 for hGRDBD is similar to that for the AGRE, whereas the affinity of hGRDBD for the A/G half-GRE oligonucleotide appeared to be significantly less. However, this conclusion was complicated by the presence of a contaminating principle that appeared to degrade unbound probe at higher concentrations of hGRDBD. In an effort to circumvent this problem, various concentrations of hGRDBD were resolved by electrophoresis, renatured, and probed with labeled oligonucleotides in a typical Southwestern experiment, as illustrated in Fig. 4CGo. Although it is difficult to make any rigorous conclusions about affinity under these circumstances, the results are consistent with the conclusion that the relative affinities of these probes are approximately AGRE>GRB1>>A/G.

The relative affinities of hGRDBD for the various probes were evaluated using a different preparation of hGRDBD that was washed more extensively before elution from Ni-Sepharose and that appears to be free of the principle that degrades the unbound probe. Binding data for GRB1 are shown in Fig. 5AGo. In addition, we examined binding to two oligonucleotides that correspond to two halves of GRB1. The oligonucleotide called GRB1a corresponds to sequences 5'-403GTCCAGGGTACATGGCGTATT-383, and contains the potential half-site sequence TGTACC. This half of GRB1 binds hGRDBD, but the binding is of low affinity. The mobility of the GRBa/hGRDBD complex is greater than that of the GRB1/hGRDBD complex when less than 2 pmol of receptor are added to the binding reaction, suggesting that the GRB1a consists of a single hGRDBD bound to the oligonucleotide. At receptor concentrations in excess of 2 pmol, we observe a larger complex, which we suspect is due to aggregation. GRB1b, corresponding to sequences 5'-383TGTGTGGAGCGAG-371, did not appear to bind hGRDBD at any concentration of receptor, up to 20 pmol. Quantitative binding data are shown in Fig. 5BGo. These data indicate that, within the limits of this sort of assay, the affinity of hGRDBD for GRB1 is about half of that observed for AGRE, an authentic, palindromic GRE. The data shown in Fig. 5Go are consistent with the conclusion that GRB1 is a high-affinity glucocorticoid receptor-binding site, consisting of two halves each of which binds one hGRDBD. When separated, one half (GRB1a) is a low-affinity hGRDBD-binding site (probably due to the TGTACC motif), and the other (GRB1b) has little or no inherent affinity for hGRDBD.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. hGRDBD Interaction with GRB1, GRBa, and GRBb Oligonucleotides

Binding reactions were carried out with 20 fmol of labeled GRB1 or AGRE plus 0. 0.05, 0.1, 0.2, 0.5, or 1 pmol hGRDBD or with 10 fmol GRB1a or GRB1b plus 0, 1, 2, 5, 10, or 20 pmol of hGRDBD in 15 µl total volume. Binding data are shown in panel A and quantitative data in panel B.

 
Binding of P1798 Cell Nuclear Proteins and hGRDBD to GRB1 Oligonucleotides
The footprinting data shown in Fig. 2AGo indicate that nuclear extracts from P1798 cells contain proteins that bind to GRB1 domain, and the deletion analysis suggests that these are repressors. The DNAse protection data were confirmed by the gel mobility shift data shown in Fig. 6AGo. Nuclear proteins bound to labeled GRB1 oligonucleotides to yield three discrete gel shift entities (lane 2). Addition of unlabeled GRB1 oligonucleotide displaced all three entities, whereas addition of AGRE, mAGRE, or consensus MMTV GRE (reviewed in Ref. 19) had no significant effect on binding of nuclear factors to labeled GRB1 oligonucleotides. None of the gel shift entities formed by nuclear proteins could be supershifted by hGR antibodies (data not shown). Moreover, addition of nuclear proteins competed with hGRDBD for GRB1 oligonucleotides. In the experiment shown in Fig. 6BGo, hGRDBD was added in a concentration sufficient to shift all of the labeled GRB1 oligonucleotide (lane 2). Addition of increasing concentrations of nuclear protein resulted in a progressive decrease in the hGRDBD-containing complex with a concomitant increase in the nuclear protein-binding pattern. The data suggest that nuclear extract proteins compete with GR, and that binding of proteins and GR is mutually exclusive.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 6. Binding of P1798 Cell Nuclear Proteins and hGRDBD to GRB1 Oligonucleotides

A, The binding reactions contained 10 fmol of labeled GRB1 oligonucleotide, 5 µg of nuclear proteins, and increasing amounts of unlabeled oligonucleotide competitors, as indicated. The numbers below each lane indicate the molar excess of unlabeled GRB1, AGRE, mAGRE, or MMTV GRE. The first lane contains GRB1 probe with no protein and the second lane contains no competitor. The binding reactions were carried out as described in Materials and Methods. B, The binding reactions contained 5 fmol of labeled GRB1 oligonucleotide, 1 pmol hGRDBD (lane 2), and 0.1, 0.2, 0.5, 1, 2, and 5 µg of P1798 cell nuclear extract (lanes 3–8, respectively). Lane 1 contains labeled probe and no protein. Lane 9 contained probe and 5 µ g of nuclear protein without hGRDBD.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
To decipher the mechanisms of glucocorticoid regulation of c-myc promoter activity, we examined the DNA sequences and conducted a series of experiments, both in vitro and in cultured cells, to identify glucocorticoid receptor binding sites and potential glucocorticoid response elements within the c-myc promoter region. No consensus, high affinity receptor-binding site was identified by computer search or by binding studies. There is a potential composite AP-1/GRE at -351 to -326 bp, which might function as a cis-acting element in response to dexamethasone (22, 23). This region contains a perfect GR half-site, and recombinant GR can bind to this region in vitro. However, deletion of this putative composite GRE had no effect on glucocorticoid response of c-myc/CAT. Neither did this element convey glucocorticoid responsiveness to a heterologous (SV40) promoter.

We have identified a region between -354 and -447 bp of the c-myc promoter that has two interesting properties. Deletion of this region results in a significant increase in basal transcription activity of c-myc reporters. Insertion of this GRB1 element decreases basal activity of the minimal SV40 promoter. These data are consistent with the conclusion that this element functions as a position and distance-independent repressor of transcription. We have shown that unidentified nuclear factors bind to this element, and we propose that it is the interaction between these proteins and this element that represses transcription from adjacent promoters.

In addition to low basal activity, promoters that contain this GRB1 element are regulated by glucocorticoids. Constructs that contain this region are stimulated by dexamethasone, whereas constructs that do not have this region are inhibited. The inhibition that prevails under these circumstances can be observed even with constructs that contain only basal promoter elements such as the c-myc P2 TATA box and the SV40 basal promoter. One possible interpretation of these observations is that the GR interacts directly with some component of the core transcription machinery so as to squelch transcription. There is evidence that steroid hormone receptors have such properties (26, 27, 28, 29). However, there is another possible explanation that may have more physiological relevance. Mid-log phase P1798 cells have a population doubling time of about 12 h, whereas glucocorticoid-treated P1798 cells are uniformly arrested in G1. It seems reasonable that the overall rate of transcription must decrease to accommodate such a transition, and almost every promoter that we have ever examined is inhibited about 50% in glucocorticoid-treated P1798 cells. Recent data from our laboratory suggest that this may be linked to expression of cyclin C, which is a component of RNA polymerase II C-terminal kinase (P. Chi, manuscript in preparation).

The ability of the -447/-354 region to convey glucocorticoid induction is unanticipated, since this element does not conform in any obvious way to the consensus GRE sequence. Nevertheless, recombinant GRDBD can bind to this region in vitro, as evidenced by DNase I footprinting and electrophoretic mobility shift assay (EMSA). This element appears to consist of two halves, one of which contains the sequence TGTACC and has low affinity for GR. The other half of GRB1 has little or no affinity for GR in vitro. A similar situation prevails with authentic GREs, in which the TGTnCT half of the palindrome has low affinity and the "left hand" GTTACA half has very little affinity for GR (30). We have been unsuccessful in generating active, full-length recombinant GR; and one must acknowledge some concerns about the fact that all of our binding data have been done with the DNA-binding fragment. Nevertheless, these data clearly indicate that the GR has the potential to bind to this element with high affinity and in a sequence-specific manner.

Our working hypothesis is summarized in the cartoon shown in Fig. 7Go. We propose that a repressor protein binds to the GRB1 element in mid-log phase cells. This hypothetical repressor footprints the sequence: -406GCGGTCCAGGGTACATGgcgtaTTGTGTGGAGCGAGG-370.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Hypothetical Model for Glucocorticoid-Mediated Derepression at the GRB1 Element of the c-myc Promoter

The basal transcription complex (BTC) is depicted associated with the c-myc promoter, with the arrows illustrating the P1 and P2 start sites. The data suggest that the hypothetical repressor (R), bound to GRB1, is displaced by binding of the glucocorticoid repressor (GR).

 
The nucleotides shown in uppercase letters in this representation are protected, and those shown in lowercase letters are unprotected. From the properties of this repressor, we propose that it interacts with the basal transcriptional complex (BTC in Fig. 7Go) in some manner so as to inhibit transcription. This hypothetical repressor protein has the ability to act in a manner that is, to some extent, independent of distance and context; and few such repressors have been characterized. The hGRDBD footprints: -401CCAGGGTACATGGCGTATtGTGTGgAgC-374.

The boldface nucleotides are hypersensitive, and the potential GRE half-site is underlined. The binding footprints of the GR and the hypothetical repressor overlap, and binding is competitive; but the footprinting data suggest that different nucleotide sequences may be involved in binding the receptor and the repressor.

We are unaware of any glucocorticoid response element that has the properties of the GRB1 element. Although we have not measured binding constants, the gel shift data infer that GRB1 binds a dimeric receptor with relatively high affinity. There is nothing obvious about the nucleotide sequences that would suggest that such was likely, although GRB1 does contain some of the key nucleotides that have been identified by mutagenesis and crystallographic studies of the GR/DNA binding complex. Neither are we aware of any circumstance in which activation by the glucocorticoid receptor involves competitive binding with a repressor. It is possible that this element is not normally a glucocorticoid response element. We may have identified the binding site for some other member of the nuclear receptor superfamily, and it may be an accident that this site happens to have significant affinity for the glucocorticoid receptor under the conditions that we have employed in these experiments. This remains to be established. Likewise, it will be essential to identify the repressor protein(s) that compete with GR (or some other nuclear receptor) for this GRB1 element.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Oligonucleotides
All oligonucleotides were chemically synthesized by Genosys (The Woodlands, TX). Double-stranded oligonucleotides were made by mixing two complimentary, single-stranded oligonucleotides at a concentration of 50 µM each in TE (10 mM Tris-HCl, pH 8, 1 mM EDTA). The double-stranded MMTV GRE oligonucleotide had the sequence 5'-TCGACTGTACAGGATGTTCTAGCTACT. AGRE, the angiotensinogen promoter glucocorticoid response element, had the sequence 5'-CATCCACAAGCCCAGAACATTTTGTTTCAATATGGCTA, and the mutant mAGRE had the sequence 5'-CCATAACATTTGTGGACAAT, as described by Brasier et. al (25). The nucleotide designated A/G corresponded to the c-myc promoter region from -353 to -315 bp (relative to the P1 promoter start site) and had a sequence of 5'-GATCGGTGACTGATATACGCAGGGCAAGAACACAGTTCAGCCG. The oligonucleotide probe designated GRB1 corresponded to the c-myc promoter region -403 to -371bp (relative to the P1 transcriptional start site) and had the sequence 5'-GATCGTCCAGGGTACATGGCGTATTGTGTGGAGCGAG. GRB1a and GRB1b corresponded to the c-myc promoter region -403 to -383 bp and -383 to -371 bp, respectively, and had sequences of 5'-GTCCAGGGTACATGGCGTATT and 5'-TGTGTGGAGCGAG. Primers for generating DNA probe (396 bp) in footprinting experiments corresponded to the sequences 5'-CAGCCTTAGAGAGACGCC (from -447 to -430 bp) for upstream and 5'-CCAGAGAACCTCTCTTTCTCCC' (-52 to -73bp) for downstream. Primers for generating c-myc promoter-containing fragments were as follows: upstream primer for pmyc(-447) was the same as the upstream primer for the footprint probe; for pmyc(-354) the same as A/G sense strand oligonucleotide; for pmyc(-308) 5'-GCGCCCGAACAACCGTACAG (-308 to -289 bp); and pmyc(-65)CAT 5'-GAGAGGTTCTCTGGCTAATCCCC (-65 to -43 bp); and downstream primer 5'-GCACACACGGCTCTTCCAACC-3' (+229 to +209 bp).

Construction of Plasmids
PCR was used to generate 5'-deletions of the murine c-myc promoter region by using p5'myc4 (18) as a template and Taq DNA polymerase (Life Technologies, Inc., Gaithersburg, MD) following the manufacturer’s instruction. These PCR products were subcloned into pCRII vector (Stratagene, La Jolla, CA). The HindIII c-myc promoter-containing fragments were ligated into the HindII site of a promoterless plasmid pCATbasic (Promega Corp., Madison, WI) to generate pmyc(-447)CAT, pmyc(-354)CAT, pmyc(-308)CAT, and pmyc(-65)CAT. For pmyc(+117)CAT, the 0.2 kb c-myc BamHI fragment of pmyc(-65)CAT was removed. pmyc(-447)CAT, pmyc(-354)CAT, pmyc(-308)CAT, pmyc(-65)CAT, and pmyc(+117)CAT contained c-myc promoter region -447, -354, -308, -65, and +117 to +141 bp upstream of CAT gene in pCATbasic, respectively. pSVA/G and pSVGRB1 contained two head-to-tail copies of A/G and GRB1 oligonucleotides downstream of CAT gene in the reversed orientation at BamHI site of pCATpromoter (Promega Corp.), which has the SV40 promoter but lacks the SV40 enhancer. The luciferase expression vectors were derivatives of pGL3 (CLONTECH Laboratories, Inc., Palo Alto, CA). GRB/SV/Luc was constructed by inserting a tandem, head-to-tail GRB1 dimeric oligonucleotide into the XhoI/BglII sites upstream of the SV40 minimum promoter. SV/Luc/GRB was made by inserting the same dimeric GRB1 oligonucleotide into the SalI/BamHI sites downstream of the SV40 polyadenylylation site that terminates GL3. prGRPECE was constructed by cloning full-length rGR (a gift from Keith Yamamoto, University of California San Francisco) into a BamHI site of the PECE (a gift from Ivan Sadowski) driven by the SV40 early promoter (A. R. Brasier, unpublished).

Cell Culture, Transfection, and Reporter Gene Assay
Mouse T-lymphoma P1798 cells were cultured to mid-log phase (31), harvested, and washed once with serum-free RPMI 1640 medium. The cells were suspended in serum-free RPMI 1640 at a concentration of 2 x 107 cells/ml and 1 x 107 cells were transiently transfected by electroporation at 960 µF, 0.35 kV using a Gene Pulser (Bio-Rad Laboratories, Inc., Richmond, CA) with 10 µg CAT constructs, 2 µg pCMVß (CLONTECH Laboratories, Inc.) as an internal control, and 5 µg prGRPECE. Luciferase reporter plasmids (2 µg) were transfected into P1798 by electroporation, as described above, along with 0.5 µg of SV/ß-gal as an internal control and 5 µg of prGRPECE. After electroporation, nonaggregated cells were pooled in 8.5 ml 5%FBS-RPMI 1640 and split into two 4 ml cultures. One culture was treated with 4 µl of 70% ethanol and the other with 4 µl of 70% ethanol containing 0.1 mM dexamethasone (final concentration: 0.1 µM). For CAT assay, the cells were harvested 9–10 h after transfection, at which time both control and glucocorticoid-treated cultures contained the same number of cells and the same amount of total cellular protein. For luciferase, cells were harvested 24 h after transfection. The cells were washed with PBS and lysed by freeze-thaw in 50 ml of 0.25 mM Tris-HCl, pH 7.6 (32).

The cell lysates were used for determination of ß-galactosidase and CAT activity. ß-Galactosidase activity was measured using the Luminescent ß-Galactosidase Genetic Reporter System II (CLONTECH Laboratories, Inc.). CAT activity was analyzed using 5–40 µl (up to 20 µg) of cell lysates in 150 µl (32), incubated at 37 C for 1–1.5 h. CAT reactions were normalized to ß-galactosidase expression in the following manner. When different promoters were compared, the extracts were first assayed for ß-galactosidase. Extracts containing equal amounts of ß-galactosidase activity were assayed for CAT. In this way, we could normalize for transfection assay from one experiment to the next, and therefore compare promoter activity. However, this procedure could not be used to compare activity of a given promoter in control and glucocorticoid-treated cells. Glucocorticoids inhibit the expression of the SV40/ß-galactosidase promoter (as will be shown presently); therefore, ß-galactosidase could not be used as an internal standard. In those experiments in which we wished to compare control and dexamethasone-treated extracts, we pooled all transfected cells to ensure equal efficiency of transfection. The pooled cultures were divided, and one-half received dexamethasone. Extracts were prepared, and equal amounts of protein were assayed for reporter gene activity. TLC was used to separate acetylated chloramphenicol, and labeled product was detected by autoradiography. Each transient transfection experiment was repeated at least three times.

Bacterial Expression of Human Glucocorticoid Receptor DNA Binding Domain (hGRDBD)
The DNA sequence encoding the human glucocorticoid receptor DNA binding domain (hGRDBD, amino acids 409–499) (24) was ligated into a BamHI site of the pRSET-A prokaryotic expression vector (Invitrogen, San Diego, CA) producing an in-frame fusion protein with the His-tag. The hGRDBD pRSET plasmid was transformed into E. coli BL21 DE3 (pLysS), grown in LB containing 50 µg/ml ampicillin and 20 µg/ml chloramphenicol at 37 C, and induced by addition of 1 mM ß-D-thiogalactopyranoside for 4 h. Cell lysate was prepared by suspending cells in TDGN buffer [100 mM NaCl, 10 mM Tris-HCl, 1 mM dithiothreitol, 10% (vol/vol) glycerol, pH 8.0] followed by one cycle of freeze-thaw. Lysates were additionally disrupted by French press (1000 lb/in2) and centrifuged at 150,000 x g for 30 min at 4 C. The bacterial lysate supernatant was then poured over a nickel agarose column (QIAGEN, Chatsworth, CA). The column was washed with 10 column volumes of TDGN buffer containing 50 mM imidazole. The His-tagged hGRDBD was step-eluted with TDGN buffer containing 200 mM imidazole. Fractions containing >90% pure hGRDBD (determined from Coomassie blue stained SDS-PAGE) were pooled. Samples were combined and dialyzed overnight in 1liter of TDGN at 4 C with 3 changes of the buffer. Final protein concentration was between 1–10 mg/ml.

Footprinting and EMSA
The 396-bp probe, corresponding to c-myc promoter region -447 to -52 bp from p5'myc4, was amplified by PCR. The probe was labeled by incorporating one of the primers labeled with ([{alpha}-32P]ATP, DuPont Merck Pharmaceutical Co., 7000 Ci/mmol) at the 5'-end. The probe was then purified on 5% PAGE. P1798 cell nuclear extract was prepared, and footprinting experiments were carried out as previously described (24).

For EMSA, the A/G, AGRE, mAGRE, MMTV GRE, GRB1, GRB1a, and GRB1b oligonucleotides were annealed before labeling with [{alpha}-32P]ATP at both 5'-ends. Binding reactions contained 10 fmol of labeled probes (5 x 103 cpm) (unless otherwise indicated in the figure legends) plus unlabeled oligonucleotide competitors, nuclear proteins, or hGRDBD, as indicated in the figure legends, in 15 µl under the same condition used in footprinting experiments. Samples were separated on 5% PAGE-0.5xTris-borate-EDTA and analyzed by autoradiography.


    FOOTNOTES
 
Address requests for reprints to: E. Aubrey Thompson, Ph.D., Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston, Texas 77555-0645. E-mail: athompso{at}utmb.edu

This work was supported in part by a grant from the National Cancer Institute (CA-24347) to E.A.T.

Received for publication August 30, 1999. Revision received May 31, 2000. Accepted for publication June 1, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sheiness D, Bishop JM 1979 DNA and RNA from uninfected vertebrate cells contain nucleotide sequences related to the putative transforming gene of avian myelocytomatosis virus. J Virol 31:514–521[Abstract/Free Full Text]
  2. Davis AC, Wims M, Spotts GD, Hann SR, Bradley A 1993 A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice. Genes Dev 7:671–682[Abstract/Free Full Text]
  3. Spencer CA, Groudine M 1991 Control of c-myc regulation in normal and neoplastic cells. Adv Cancer Res 56:1–48[Medline]
  4. Marcu KB, Bossone SA, Patel AJ 1992 Myc function and regulation. Annu Rev Biochem 61:809–860[CrossRef][Medline]
  5. Kelly K, Siebenlist U 1986 The regulation and expression of c-myc in normal and malignant cells. Annu Rev Immunol 4:317–338[CrossRef][Medline]
  6. Hiebert SW, Lipp M, Nevins JR 1989 E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor. Proc Natl Acad Sci USA 86:3594–3598[Abstract/Free Full Text]
  7. Postel EH, Berberich SJ, Flint SJ, Ferrone CA 1993 Human c-myc transcription factor PuF identified as nm23–H2 nucleoside diphosphate kinase, a candidate suppressor of tumor metastasis. Science 261:478–480[Abstract/Free Full Text]
  8. Komatsu M, Li H-O, Tsutsui H, Itakura K, Matsumura M, Yokoyama KK 1997 MAZ, a Myc-associated zinc finger protein, is essential for the ME1a1-mediated expression of the c-myc gene during neuroectodermal differentiation of P19 cells. Oncogene 15:1123–1131[CrossRef][Medline]
  9. Lee TC, Ziff EB 1999 Mxi1 is a repressor of the c-myc promoter and reverses activation by USF. J Biol Chem 274:595–606[Abstract/Free Full Text]
  10. Cooney M, Czernuszewicz G, Postel EH, Flint SJ, Hogan ME 1988 Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro. Science 241:456–459[Abstract/Free Full Text]
  11. Reddoch JF, Miller DM 1995 Inhibition of nuclear protein binding to two sites in the murine c-myc promoter by intermolecular triplex formation. Biochemistry 34:7659–7667[CrossRef][Medline]
  12. Kim H-G, Reddoch JF, Mayfield C, Ebbinghaus S, Vigneswaran N, Thomas S, Jones Jr DE, Miller DM 1998 Inhibition of transcription of the human c-myc protooncogene by intermolecular triplex. Biochemistry 37:2299–2304[CrossRef][Medline]
  13. Eastman-Reks SB, Vedeckis WV 1986 Glucocorticoid inhibition of c-myc, c-myb, and c-Ki-ras expression in a mouse lymphoma cell line. Cancer Res 46:2457–2462[Abstract/Free Full Text]
  14. Forsthoefel AM, Thompson EA 1987 Glucocorticoid regulation of transcription of the c-myc cellular protooncogene in P1798 cells. Mol Endocrinol 1:899–907[Abstract/Free Full Text]
  15. Yuh YS, Thompson EB 1989 Glucocorticoid effect on oncogene/growth gene expression in human T lymphoblastic leukemic cell line CCRF-CEM. Specific c-myc mRNA suppression by dexamethasone. J Biol Chem 264:10904–10910[Abstract/Free Full Text]
  16. O’Banion MK, Levenson RM, Brinckmann UG, Young DA 1992 Glucocorticoid modulation of transformed cell proliferation is oncogene specific and correlates with effects on c-myc levels. Mol Endocrinol 6:1371–1380[Abstract/Free Full Text]
  17. Frost GH, Rhee K, Ma T, Thompson EA 1994 Expression of c-myc in glucocorticoid-treated L929 fibroblastic cells. J Steroid Biochem Mol Biol 50:109–119[CrossRef][Medline]
  18. Ma T, Mahajan PD, Thompson EA 1992 Glucocorticoid regulation of c-myc promoter utilization in lymphoid cells. Endocrinology 6:960–968
  19. Beato M 1989 DNA regulatory elements for steroid hormones. J Steroid Biochem 32:737–747[CrossRef][Medline]
  20. Lee W, Mitchell P, Tjian R 1987 Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741–752[CrossRef][Medline]
  21. Takimoto M, Quinn JP, Farina AR, Staudt LM, Levens D 1989 Fos/jun and octamer-binding protein interact with a common site in a negative element of the human c-myc gene. J Biol Chem 264:8992–8999[Abstract/Free Full Text]
  22. Diamond MI, Miner JN, Yoshinaga SK, Yamamoto KR 1990 Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249:1266–1272[Abstract/Free Full Text]
  23. Pearce D, Matsui W, Miner JN, Yamamoto KR 1998 Glucocorticoid receptor transcriptional activity determined by spacing of receptor and nonreceptor DNA sites. J Biol Chem 273:30081–30085[Abstract/Free Full Text]
  24. Hollenberg SM, Giguere V, Segul P, Evans RM 1987 Colocalization of DNA-binding and transcriptional activation functions in the human glucocorticoid receptor. Cell 49:39–46[CrossRef][Medline]
  25. Brasier AR, Tate JE, Ron D, Habener JF 1989 Multiple cis-acting DNA Regulatory elements mediate hepatic angiotensinogen gene expression. Mol Endocrinol 3:1022–1034[Abstract/Free Full Text]
  26. Ing NH, Beekman JM, Tsai SY, Tsai MJ, O’Malley BW 1992 Members of the steroid hormone receptor superfamily interact with TFIIB (S300-II). J Biol Chem 267:17617–17623[Abstract/Free Full Text]
  27. Jacq X, Brou C, Lutz Y, Davidson I, Chambon P, Tora L 1994 Human TAFII30 is present in a distinct TFIID complex and is required for transcriptional activation by the estrogen receptor. Cell 79:107–117[CrossRef][Medline]
  28. Schwerk C, Klotzbucher M, Sachs M, Ulber V, Klein-Hitpass L 1995 Identification of a transactivation function in the progesterone receptor that interacts with the TAFII110 subunit of the TFIID complex. J Biol Chem 270:21331–21338[Abstract/Free Full Text]
  29. Stöcklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  30. Tsai S, Carlstedt-Duke J, Weigel NL, Dahlman K, Gustafsson J-A, Tsai M-J, O’Malley B 1988 Molecular interactions of steroid hormone receptor with its enhancer element: evidence for receptor dimmer formation. Cell 55:361–369[CrossRef][Medline]
  31. Thompson Jr EA 1980 Properties of a cell-culture line derived from lymphosarcoma P1798. Mol Cell Endocrinol 17:95–102[CrossRef][Medline]
  32. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1997 Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, pp 9.7.1–9.7.11
  33. Rhee K, Ma T, Thompson EA 1994 The macromolecular state of the transcription factor E2F and glucocorticoid regulation of c-myc transcription. J Biol Chem 269:17035–17042[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Int ImmunolHome page
H. Igarashi, K. L. Medina, T. Yokota, M. I. D. Rossi, N. Sakaguchi, P. C. Comp, and P. W. Kincade
Early lymphoid progenitors in mouse and man are highly sensitive to glucocorticoids
Int. Immunol., May 1, 2005; 17(5): 501 - 511.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, T.
Right arrow Articles by Thompson, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, T.
Right arrow Articles by Thompson, E. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals