| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cancer Research Laboratories (O.L., C.B., J.W., S.A.-A., C.M., M.P.) Departments of Biochemistry (O.L., C.M., M.P.) and Pathology (J.W., S.A.-A., C.M., M.P.) Queens University Kingston, Ontario, Canada K7L 3N6
| ABSTRACT |
|---|
|
|
|---|
(RAR
) and retinoid X receptor-
(RXR
) proteins. Transient
transfection experiments with the mouse P450RAI promoter fused to a
luciferase reporter gene showed transcriptional activation in the
presence of RA in HeLa, Cos-1, and F9 wild-type cells. This activation,
as well as basal promoter activity, was abolished upon mutation of the
RARE. Deletion and mutational analyses of the P450RAI promoter, as well
as DNase I footprinting studies, revealed potential binding sites for
several other proteins in conserved regions of the promoter. Also, two
conserved 5'-TAAT-3' sequences flanking the RARE were investigated for
their potential importance in P450RAI promoter activity. Moreover,
these studies revealed an essential requirement for a G-rich element
(designated GGRE), located just upstream of the RARE, for RA
inducibility. This element was demonstrated to form complexes with Sp1
and Sp3 using nuclear extracts from either murine F9 or P19 cells.
Together, these results indicate that the P450RAI-RARE is atypical in
that conserved flanking sequences may play a very important role in
regulating RA inducibility and expression of P450RAI(CYP26). | INTRODUCTION |
|---|
|
|
|---|
, ß, and
) and, retinoid X receptors (RXRs
,
ß, and
) (4). RARs and RXRs commonly participate together, in the
form of heterodimers, to regulate transcription (5, 6). Most tissues,
especially during embryonic development, express one or more of the RAR
and RXR subtypes in various combinations possibly giving rise to
different responses to RA (7, 8). Retinoic acid response elements (RAREs) exist in various forms and can also influence receptor activity. Typically, a RARE is comprised of two direct repeats of the motif, 5'-PuGTTCA-3' separated by a 5-bp spacer; however, various other polymorphic forms of RAREs have been characterized, having 1- or 2-bp spacers. Several studies suggest that specific forms of RAREs may preferentially bind different heterodimeric RAR/RXR pairs (9).
The active forms of RA include all-trans RA, and 9-cis RA stereoisomers, which are ligands for these receptors; RARs are activated by both isoforms while RXRs appear to be activated exclusively by 9-cis RA. It is not clear at present how interconversion between the two forms is controlled; however, the balance of all-trans RA and 9-cis RA may be important for RA activity. The distribution of RA is also a critical determinant in the regulation of RA responsive genes, especially in developing tissues. There is growing evidence that tight spatial and temporal control of RA synthesis and catabolism are important in establishing regional distribution patterns of RA (10, 11, 12, 13, 14).
Control of RA tissue distribution is thought to be established by the balanced expression of RA synthesizing and RA catabolizing enzymes. Several retinaldehyde dehydrogenases have already been implicated in the irreversible conversion of retinaldehyde to the active RA (10, 11). Retinaldehyde dehydrogenase type 2 (RALDH-2) is thought to be a key enzyme in localized production of RA during embryogenesis since it exhibits an expression pattern consistent with that of a retinoid-responsive LacZ reporter transgene. Moreover, RALDH-2 knockout mice have severe developmental defects and die at midgestation; however, knockout embryos are rescued when the mother is treated with RA (12, 13, 14).
The metabolism of RA is initiated by hydroxylation (15) mediated by cytochrome P450 activity, as judged by the ability of broad spectrum P450 inhibitors such as ketoconazole and liarozole to block 4-hydroxylation (16, 17, 18, 19, 20). In certain tissues, including testis, skin, and lung and in numerous cell lines, such as NIH3T3 fibroblasts, HL60 myelomonocytic leukemic cells, F9 and P19 murine embryonal carcinoma cells, MCF7 human breast cancer cells, and HeLa human cervix cancer cells, RA metabolism can be induced by RA treatment (20, 21, 22, 23).
P450RAI(CYP26) is a cytochrome P450 enzyme that specifically metabolizes RA and is likely responsible for much of the RA-inducible RA metabolism observed. P450RAI was first isolated from zebrafish as a gene product induced by RA during regeneration of adult caudal fin (24). Subsequently, homologs have been isolated from human (25), mouse (26), chick (27), and Xenopus (28) with all the genes exhibiting a high degree of sequence conservation. P450RAI metabolizes all-trans RA but not the 9-cis or 13-cis RA isomers (24, 29, 30, 31, 32, 33, 34). Previous studies demonstrated that P450RAI expression is strongly induced by RA in early mouse and Xenopus embryos as well as in a number of normal and tumor cell lines. Several studies have examined the spatiotemporal expression of P450RAI during embryonic development (28, 35, 36, 37, 38). Primary sites of P450RAI expression in mouse include neural folds before neural tube closure, and caudal neural epithelium, although most tissues at various stages of morphogenesis transiently express P450RAI (35, 36, 37). Studies in mouse and Xenopus have shown that P450RAI expression generates domains restricting RA exposure (36, 38), possibly resulting in differential rates or timing of differentiation. In several cases it would appear that P450RAI and RALDH-2 expression are complementary, possibly forming boundaries defined by graded retinoic acid distribution between RA synthesizing regions and RA degrading regions (28, 38).
The focus of our work, guided by the sequence conservation between human, mouse, and zebrafish in the upstream proximal promoter, was to characterize elements necessary for RA induction and regulation. We show that a conserved RARE and a Sp1/Sp3 binding site are essential for the RA-regulated induction of P450RAI (39, 40, 41, 42).
| RESULTS |
|---|
|
|
|---|
|
and RXR
(26), we performed
bandshift experiments with in vitro transcribed and
translated mouse RAR
and RXR
proteins. Oligonucleotides (Fig. 2A
or RXR
proteins
is insufficient to produce a shift in mobility (lanes 13). The
addition of both RAR
and RXR
proteins in combination produced a
strong complex characteristic of a typical RARE (lane 4). Conversely,
mutations in the RARE half-sites (lanes 58) ablated the formation of
this complex in the presence of both in vitro translated
RAR
and RXR
proteins.
|
and RXR
genes had been ablated by homologous recombination
(Fig. 2C
-/- RXR
-/-
double knockout cells (lane 7). This complex was not present with
oligonucleotides carrying two different mutations in the RARE half-
sites (MT and MT2; data not shown). Supershift experiments using an
anti-RXR antibody demonstrated that the C2 complex was selectively
supershifted, confirming that RXR was part of the R1 binding complex.
We also observed several other complexes (C1, C3, and C4) formed with
this R1 oligonucleotide; however, as yet we do not know the identity of
these other components. Together, these results show that the R1-RARE
is a target for retinoic receptors in various cell types and that it is
specific for the RAR/RXR heterodimer.
Transcriptional Activity of the Proximal Region of the P450RAI
Promoter
To investigate the transcriptional activity of the mouse P450RAI
promoter and the putative RARE activity, we used cotransfection assays.
The mouse P450RAI-RARE and its flanking sequences were mutated as shown
in Fig. 3A
. A 256-bp fragment of the
wild-type or mutated mouse P450RAI promoter was amplified and subcloned
into a pGL3 basic luciferase reporter vector (Fig. 3A
). Cells were
transfected with the wild-type promoter construct (P450RAI-WT) along
with various amounts of expression vectors for mouse RAR
and RXR
,
encoding receptors previously shown to be necessary for P450RAI
induction by RA (26). Depending on the amount of both RAR
and RXR
receptors added, the transcriptional activity of P450RAI-WT promoter
increased. These analyses allowed for the optimization of the amount of
receptors required (0.2 µg of RAR
and 0.2 µg of RXR
). Using
these promoter constructs we compared proximal promoter activities in
the F9 wild-type and F9 RAR
-/-
RXR
-/- double knockout cell lines. When the
P450RAI promoter was transfected alone into F9 wild-type cells,
addition of 10-6 M
all-trans RA resulted in a 2-fold marked increase in
transcriptional activity (See Fig. 3B
, P450RAI-WT, left
panel). While some inducible promoter activity can be measured in
the F9 mutant cell line, the absolute levels of activity are much lower
(Fig. 3B
, P450RAI-WT, right panel). By comparison, both
wild-type and mutant F9 cell lines support similar levels of
transcriptional activity, when the promoter construct was cotransfected
with expression plasmids for RAR
and RXR
(Fig. 3B
, P450RAI-WT,
compare left and right panels). Similarly,
mutations in the R1-RARE abolish RA-inducible activity, and
cotransfection of both RAR
and RXR
does not compensate for this
lost activity (Fig. 3B
, P450RAI-RARE-mut, left and
right panels). Also, transfection of the wild-type promoter
construct (P450RAI-WT) in the presence of RA, in Cos-1 and HeLa cells,
shows a 3-fold increase in activity in comparison with the nontreated
cells (Fig. 3C
, Cos-1 and HeLa). Addition of RAR
and RXR
to the
transfection mix increased the transcriptional activity by 2-fold
without RA, likely due to residual RA activity in the culture media. In
the presence of both receptors and 10-6 M
all-trans RA, the transcriptional activity increased by
4-fold in HeLa and 5-fold in Cos-1. The putative RARE located in the R1
region was mutated, to the MT sequence (Fig. 3C
,
P450RAI-RARE-mut). Transient transfection analyses of P450RAI-RARE-mut
revealed a complete ablation of the retinoic acid response, in the
absence or in the presence of receptors (Fig. 3C
). This complete loss
of retinoic acid induction indicated that the mutation of the direct
repeat located in R1 ablated the functional activity of this
P450RAI-RARE.
|
Determination of Protein/DNA Interactions by DNase I Footprinting
Analysis
To visualize protein/DNA contacts around the RARE and the rest of
the proximal P450RAI promoter, we performed in vitro DNase I
footprinting analyses. We used murine liver extracts for this study
since P450RAI was expressed and could be up-regulated by RA treatment
(32). Total RNA was extracted from liver tissue obtained from mice
treated for 2, 8, and 24 h with 100 mg/kg all-trans
retinoic acid and analyzed by Northern blotting. We observed that the
P450RAI transcript was expressed at low levels even in untreated
animals (Fig. 4A
, lane 4) and was
strongly induced by exposure to exogenous RA (lane
13). Fig 4B
shows the DNase I
footprint experiment with increasing concentrations of liver nuclear
extracts with the P450RAI coding strand encompassing sequences between
-170 and -80. Liver extracts from untreated mice were used since no
significant differences in footprint patterns were observed in liver
extracts from RA-treated and untreated mice (data not shown). Two major
areas of protection from DNase I were evident even at low protein
extract concentrations. One region of protection was coincident with
the RAR/RXR protein complex binding site between -120 and -95. A
second strong area of protection was observed upstream of the R1
element between -156 and -137, surrounding the annotated GGRE. Areas
of DNase I hypersensitivity (indicated by arrows) flank both
of these protected regions. Figure 4C
shows the DNase I footprints
obtained for both the coding and the noncoding strands of P450RAI from
-238 to -60. An additional but less distinct area of protection was
observed between -81 and -70 and several areas of hypersensitivity
were evident in the proximal promoter region. At present, we do not
know the nature of the factors influencing DNase I sensitivity at these
sites. Interestingly, areas of protection and hypersensitivity are
consistent for both the coding and the noncoding strands (Fig. 4C
, both
panels). Results for both strands are summarized in Fig. 4D
.
|
|
and RXR
, in the presence of RA,
did not give rise to RA inducibility. An extended construct
encompassing the GGRE (Fig. 5A
|
|
| DISCUSSION |
|---|
|
|
|---|
Analysis of human, mouse, and zebrafish proximal regions of the P450RAI
promoter allowed us to determine the presence of a canonical RARE
within a conserved 32-bp sequence, which was shown to be recognized by
the RAR
/RXR
heterodimer, consistent with our previous findings
demonstrating that exogenous all-trans RA induction of
P450RAI mRNA in F9 cells is mediated by RAR
and RXR
(26). A
comparison of this P450RAI-RARE with other RAREs such as the murine
RARß2-RARE and Hoxa-1-RARE reveals similarity even within the spacer
nucleotides (Fig. 3B
). Whether this reflects a subtle functional role
for the spacer region remains to be determined. In addition,
transfection experiments with wild-type and mutated promoters confirmed
that the RA inducibility was dependent on the presence of the RARE
motif. The P450RAI promoter was shown to be responsive to RA in HeLa,
Cos-1, and F9 wild-type cells. However, expression of the endogenous
P450RAI gene is not detected in Cos-1 cells treated with RA (data not
shown), indicating that additional elements in the P450RAI promoter,
not included in the constructs used in these experiments, are important
in the regulation of its expression. Because the pattern of expression
of P450RAI during embryogenesis is highly spatiotemporally
regulated, we speculated that homeodomain proteins might be involved in
the control of the transcriptional activity of P450RAI. Interestingly,
this R1 region also contained two conserved 5'-TAAT-3' motifs flanking
the RARE; such motifs are generally found in homeodomain factor DNA
binding sites (45, 46, 47). Both DNase I footprint analyses and transient
transfections suggest the presence of factor(s) binding either the 5'-
or the 3'-conserved TAAT elements. Bandshift assays using 5'- and
3'-TAAT mutants within the R1 region, however, did not reveal obvious
differences in DNA binding patterns (data not shown). The importance of
these elements in the control of P450RAI activity, and whether or not
Hox or related genes interact with this sequence, remains to be
determined.
An unexpected observation in these studies came from the apparent
dependence of the RARE activity on the presence of upstream regulatory
sites, including an Sp1/Sp3 binding site. DNase I footprint analyses
revealed the proximity of both sites, and transient transfections
confirmed the requirement of the Sp1/Sp3 binding site for RA response.
Sp1 activity has been shown previously to be essential for the activity
of adjacent response elements in other promoters. For example,
cooperativity between the sterol-regulatory element and Sp1 was
observed in transcriptional regulation of the low-density lipoprotein
(LDL) receptor gene promoter (49). Similarly, apparent physical
interactions between the estrogen receptor (ER) and Sp1 appear to be
required for the enhanced transactivation of the heat-shock protein 27
(Hsp27) promoter gene (50). Complex interactions between the orphan
nuclear receptor
(ROR
) and Sp1 were also proposed in the
promoter regulation of the murine prosaposin gene (51). Also, multiple
Sp1 sites have been identified adjacent to the RARE in the retinoic
acid receptor
isoform 2 (RAR
2) promoter gene. RAR/Sp1
cotransfection experiments suggest interdependence between Sp1 and
RAR/RXR activities (52). While it would appear that Sp1 and RARs could
participate together in the regulation of several different promoters,
the nature of these interactions remains to be explored.
Murine F9 and P19 cell lines are able to express P450RAI after RA treatment (26). By using nuclear extracts from these cell lines, we also identified the binding to the GGRE of Sp3, another transcription factor member of the C2-H2 zinc-finger family. Mutations in the GGRE ablate the binding of both Sp1 and Sp3 in gel shift mobility assays. Previous studies have demonstrated that Sp1 and Sp3 can bind to the same site with comparable affinity (53). Sp1 and Sp3 have been shown to be bifunctional, acting either as activators or as repressors (39, 41, 44, 54, 55). Considering the expression of Sp1 and Sp3, their degree of phosphorylation, and their potential interaction with other factors, we hypothesize that the regulation of P450RAI may be modulated by signaling pathways that directly affect Sp1/Sp3 abundance and activity.
In vivo, there is a strong overlap between the expression of RALDH-2 and that of a RA reporter gene comprising a RARß-RARE linked to a ß-galactosidase gene (56) These findings imply that where RALDH-2 is expressed, free RA is generated to regulate RA responsive genes such as RARß. Interestingly RALDH-2 and P450RAI domains of expression are often complementary (27, 38). This suggests that the RA responsiveness of P450RAI can be controlled by other factors in a tissue- or a domain-specific manner. Consistent with this, we have previously shown that certain cell lines do not express P450RAI even in the presence of RA, while others express P450RAI in an apparent constitutive manner, possibly indicating the involvement of factors capable of overriding RA control (31).
In summary, analysis of the mouse P450RAI promoter revealed the presence of a highly conserved RARE whose activity depends on an upstream Sp1/Sp3 element. Interestingly, Sp1 is an essential factor for normal embryogenesis (57). Furthermore, the presence of several conserved elements including possible homeodomain protein binding sites may help to explain how the complex spatio-temporal patterns of P450RAI expression are generated during embryogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Plasmids
The reporter plasmids contain different segments or mutants of a
minimal upstream region of the mouse P450RAI cloned in the pGL3
luciferase reporter vector (Promega Corp., Madison,
WI).
The P450RAI-WT, -163, and -137 constructs were generated by PCR amplification (30 cycles) of the upstream region (nucleotides -238 to +18) of the mouse P450RAI promoter, using the forward primers, P450RAI-WT, 5'-CCAGATCTGCGCGCTCAGAGGGAAGCCGC-3'; P450RAI-163, 5'-GATCAGAT CTGCGCCTCGAGGGGGGAGGAGCCAGG-3'; P450RAI-137, 5'-GATCAGATCT GCCCGATCCGCAATTAAAGATGAACTTTGGGTGAACTAATTTGTCTG-3'; and the reverse primer 5'-GAAAGCTTGGCACGCTTCAGCCTCCCGCG-3'. After digestion of the PCR products with BglII and HindIII, the fragments were isolated and ligated into the pGL3 Basic Luciferase reporter vector (Promega Corp.), digested with the same restriction enzymes. The mutant promoter constructs were generated by replacing the ApaI (-139)/HindIII (pGL3B) fragment of the wild-type reporter plasmid with PCR fragments containing the selected mutations. The oligonucleotides used to generate these mutations are the forward primers: P450-RARE-mut, 5'-CAGGGGCCCGATCCGCAATTAAAGAGCTACTTTGGG ACTACTAATTTGTCTG-3'; P450RAI-5'-TAAT-mut, 5'-CAGGGGCCCGATCC GCAAGTAAAGATGAACTTTGGGTGAACTAATTTGTCTGTTGTCTG-3'; P450RAI-3'-TAAT-mut, 5'-CAGGGGCCCGATCCGCAATTAAAGATGAACTT TGGGTGAACTACTTTGTCTG; and the same reverse primer indicated above. All constructs used in transfection experiments were confirmed by sequencing and purified using cesium chloride gradient separation.
Cell Culture and Transient Transfection
The human cervical carcinoma cell line HeLa, the
SV40-transformed African green monkey kidney Cos-1 cell line, and the
murine embryonical carcinoma F9 wild-type cells and F9 cells in which
the RAR
and RXR
genes had been ablated by homologous
recombination, were cultured in an atmosphere of 5%
CO2 at 37 C. HeLa and Cos-1 cells were cultured
in MEM, pH 7.3, supplemented with 0.22% sodium hydrogen carbonate,10%
FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin, and 0.1%
fungizone (Life Technologies, Inc., Gaithersburg, MD).
Both F9 cell lines were cultured in DMEM, pH 7.3, supplemented with
0.37% NaHCO3 (sodium hydrogen carbonate), 0.35%
dextrose, 10% FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin,
and 0.1% fungizone (Life Technologies, Inc.).
F9 wild-type and F9 cells in which the RAR
and RXR
genes had been
ablated by homologous recombination were generously donated by Dr.
Pierre Chambon. One day before transfection, F9 wild-type cells and F9
RAR
--/- RXR
-/- double
knockout cells, were split and 12 x 105
cells were seeded in 24-well plates coated with 0.1% gelatin. Cells
were transfected with 2 µg of DNA using the polyethylenimine reagent
(PEI; Aldrich Chemical Co., Inc., Milwaukee, WI). We
incubated 1 µl of PEI (3.5 µg/µl) in 49 µl of sodium chloride
(NaCl) at a concentration of 150 mM, and separately 2 µg
of DNA (1 µg/µl) with 48 µl of NaCl 150 mM, for 5 min
at room temperature. The PEI/NaCl mix was added to the DNA/NaCl mix and
incubated for 15 min at room temperature. Transfections were performed
by addition of the 100 µl mix to 200 µl of freshly replaced medium
for 5 h. Cells were washed with 1xPBS and 500 µl of medium were
added for 19 h. After transfection, cells were treated either with
0.1% of dimethylsulfoxide (DMSO) vehicle or with
10-6 M final all-trans
retinoic acid in DMSO (RA, Sigma, St. Louis, MO) for
24 h, and proteins were extracted using the passive lysis buffer
(Promega Corp.). To normalize the Firefly
luciferase activity, cells were cotransfected with 0.2 µg of pRL-SV40
per well, a vector expressing the Renilla luciferase gene
(Promega Corp.). Cell extract (20 µl) was read using
both dual luciferase reagents (Promega Corp.) in a 96-well
plate in a Berthold Luminometer. All transfections were performed in
triplicate, and experiments were repeated three times.
Twenty four hours before transfection, HeLa and Cos-1 cells were split
and 34 x 105 cells were seeded in each
well of a six-well plate in 2 ml of culture medium. Two hours before
transfection the culture medium was replaced. Transfections of these
two cell lines were performed with the FuGENE transfection reagent,
according to the manufacturers instructions (Roche Molecular Biochemicals, Indianapolis, IN). Twenty four hours after
transfection, cells were treated either with DMSO or with RA. After
24 h of treatment, cells were washed twice in PBS and harvested in
250 µl of passive lysis buffer at 4 C (Promega Corp.).
Reading and normalization of the data were performed as described for
F9 wild-type cells and F9 RAR
-/-
RXR
-/- double knockout cells. All
transfections were performed in triplicate and repeated three
times.
Nuclear Extract Preparation
Nuclear extracts from HeLa cells, Cos-1 cells, F9 wild-type
cells, F9 RAR
-/-
RXR
-/- double knockout cells, and P19 cells
were prepared as described by Leggett et al. (43).
Gel Mobility Shift and Supershift Assays
Gel mobility shift assays corresponding to R1 (see
oligonucleotides R1-WT and R1-MT, Fig. 2
, A and B), and for the
identification of the Sp1 site, were performed as described by
Lichtsteiner et al. (58), except that the binding reactions
were incubated for 15 min on ice before separation on a 6%
nondenaturing polyacrylamide gel. Oligonucleotides used in the
experiments are shown in the corresponding figures. Double-stranded
oligonucleotides (100 ng/µl) were separated from single-stranded
oligonucleotides by electrophoresis on a 15% nondenaturing
polyacrylamide gel. The oligonucleotides corresponding to R1 were end
labeled by T4 polynucleotide kinase using 3 µl of 10 µCi/µl
(
-32P) dATP and purified on a G-50 Sephadex
column. Oligonucleotides corresponding to GGRE (guanine-guanine-rich
element) were annealed and radiolabeled (300 ng) by the fill-in
reaction with Klenow DNA polymerase and
(
-32P) dATP (New England Biolabs, Inc., Beverly, MA). The sequence of the CSp1 oligonucleotide
corresponds to the Sp1-SV40 consensus described by Leggett et
al. (43).
Supershift experiments were carried out using monoclonal RXR (m-
,
ß,
) (59) and purified polyclonal Sp1 (PEP) and Sp3 (D20)-G rabbit
antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz,
CA). For each reaction, 1 µl of antibody anti-RXR and 1.5 µl of
antibody anti-Sp1 and -Sp3 were preincubated with 5 µl of the F9 and
P19 protein extracts in the bandshift binding reaction for 20 min on
ice. Oligonucleotides (200,000 cpm) were added to the reaction and
incubated for 15 min on ice before separation on a nondenaturing 6%,
0.25xTBE polyacrylamide gel.
In Vitro Transcription and Translation
Twenty micrograms of each of the expression plasmids containing
RAR
and RXR
were linearized by digestion at 37 C using the
XhoI restriction enzyme. The DNA was precipitated by
addition of 0.3 volumes of 3 M sodium acetate, pH
7.0, and 2 volumes of ethanol. Pellets were dried and resuspended in 20
µl nuclease free water. The in vitro transcription and
translation were performed using the TNT T7/T3 Coupled Reticulocyte
Lysate System kit (Promega Corp.) according to procedures
suggested by the manufacturer.
Northern Blot Analysis
To determine P450RAI inducibility by RA in mouse liver, C-57
black mice were treated with 100 mg/kg RA in a DMSO/corn-oil carrier
mixture. Control mice were treated with the DMSO/corn-oil carrier
mixture alone. After 2, 8, and 24 h of treatment, mice were killed
by cervical dislocation and livers were immediately excised. Livers
were first snap-frozen in liquid nitrogen and then homogenized in 15 ml
of TRIzol (Life Technologies, Inc.) for 20 min. Samples
were spun down at 6,000 rpm for 20 min at 4 C, and the supernatants
were then used to extract RNA as described by Abu-Abed et
al. (26). Northern blot analyses were also performed using probes
for P450RAI and the control probe 36B4 as described by Abu-Abed
et al. (26).
DNase I Footprint Analysis
Liver tissue nuclear extracts were prepared from 6- to
12-week-old C-57 black mice as described by Sierra et al.
(60). Tissue was homogenized (1.5 g/10 ml) using a machine-driven
Teflon pestle homogenizer in 10 mM HEPES, pH 7.6,
12 mM KCl, 0.15 mM
spermine, 0.5 mM spermidine, 1
mM EDTA, 2.2 M sucrose, 5%
glycerol, 1% skim milk, 0.5 mM dithiothreitol
(DTT), 0.1 mM phenylmethylsulfonyl fluoride
(PMSF), 14 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin
A, and 1 mM benzamidine. The homogenate was
layered onto 10-ml pads of the same buffer (without milk), and the
nuclei were pelleted by centrifugation at 24,000 rpm for 60 min in a
SW-28 rotor. The clean nuclei were resuspended in 10 ml nuclear lysis
buffer (10 mM HEPES, pH 7.6, 100
mM KCl, 0.1 mM EDTA, 10%
glycerol, 3 mM MgCl2, 1
mM DTT, 0.1 mM PMSF, and 14
µg/ml aprotinin). Nuclei were lysed with KCl (0.55
M final) and were centrifuged at 40,000 rpm in a
Ti-50 rotor for 60 min. The supernatant was then transferred to a clean
tube. Solid
(NH4)2SO4
was added to 0.3 g/ml. The mixture was incubated in ice water for 60
min and then centrifuged at 40,000 rpm in a Ti-50 rotor for 20 min. The
pellet was resuspended in nuclear dialysis buffer (25
mM HEPES, pH 7.6, 40 mM
KCl, 0.1 mM EDTA, 10% glycerol, and 1
mM DTT) and dialyzed twice against the same
buffer for 2 h each time. The DNase I footprinting
reactions were performed as described by Sierra et al. (61).
P450RAI promoter fragment were directionally end labeled after
digestion by either AvrII (noncoding strand) or
NcoI (coding strand) and filled-in by Klenow DNA polymerase
(New England Biolabs, Inc.) with dCTP, dGTP, dTTP, and
(
-32P) dATP. The labeled DNA was digested
with second enzymes to generate approximately 300-bp fragments that
spanned the proximal promoter region. The binding reactions (in 40
µl) were performed in footprinting buffer (37.5
mM HEPES, pH 7.6, 54 mM
KCl, 0.05 mM EDTA, 5% glycerol, 5
mM MgCl2, and 0.5
mM DTT) containing 40,000 cpm of probe, 2 µg
poly dI·dC, and between 5 and 90 µg of liver or testes nuclear
extracts or 10 µg BSA for control DNA. The reactions were incubated
on ice for 15 min. Three microliters of DNase I (Roche Molecular Biochemicals, Indianapolis, IN) were added (1:40 to 1:30
dilution of 3.3 mg/ml stock solution), and the reactions were allowed
to digest on ice for 5 min. Five volumes of stop buffer (20
mM Tris-HCl, pH 8.0, 20 mM
EDTA, 250 mM NaCl, 0.5% SDS, 1 mg/ml Proteinase
K, and 0.0025 mg/ml sheared salmon sperm DNA) were added, and the
reactions were incubated at 50 C for 60 min. The DNA was extracted
twice with phenol-chloroform and ethanol precipitated. Chemical
cleavage reactions were performed as described by Sambrook et
al. (62). Products were dissolved in formamide loading buffer,
separated on a denaturing 6 M urea 6%
polyacrylamide gel, and visualized by autoradiography.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Dr. Charolyn Babichuk was supported by fellowships from the Leukemia Research fund of Canada and the Medical Research Council of Canada. This work was supported by grants from the National Cancer Institute of Canada and the Medical Research Council of Canada to Dr. Martin Petkovich.
Received for publication November 16, 1999. Revision received May 4, 2000. Accepted for publication May 30, 2000.
| REFERENCES |
|---|
|
|
|---|
2 isoform is transcribed from a promoter that contains a
retinoic response element. Proc Natl Acad Sci USA 88:1013810142
and retinoid X receptor
.
J Biol Chem 273:24092415
in transcription regulation of murine prosaposin. J Biol Chem 273:1320813216
2u
globulin gene in liver and spleen nuclear extracts. Mol Biol Med 7:13146[Medline]
This article has been cited by other articles:
![]() |
X. Ye and R. Lotan Potential misinterpretation of data on differential gene expression in normal and malignant cells in vitro Brief Funct Genomic Proteomic, July 1, 2008; 7(4): 322 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Gillespie and L. J. Gudas Retinoic Acid Receptor Isotype Specificity in F9 Teratocarcinoma Stem Cells Results from the Differential Recruitment of Coregulators to Retinoic Acid Response Elements J. Biol. Chem., November 16, 2007; 282(46): 33421 - 33434. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ocaya, A. C. Gidlof, P. S. Olofsson, H. Torma, and A. Sirsjo CYP26 Inhibitor R115866 Increases Retinoid Signaling in Intimal Smooth Muscle Cells Arterioscler Thromb Vasc Biol, July 1, 2007; 27(7): 1542 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Quere, A. Baudet, B. Cassinat, G. Bertrand, J. Marti, L. Manchon, D. Piquemal, C. Chomienne, and T. Commes Pharmacogenomic analysis of acute promyelocytic leukemia cells highlights CYP26 cytochrome metabolism in differential all-trans retinoic acid sensitivity Blood, May 15, 2007; 109(10): 4450 - 4460. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zolfaghari, C. J. Cifelli, S. O. Lieu, Q. Chen, N.-q. Li, and A. C. Ross Lipopolysaccharide opposes the induction of CYP26A1 and CYP26B1 gene expression by retinoic acid in the rat liver in vivo Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1029 - G1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Hernandez, A. P. Putzke, J. P. Myers, L. Margaretha, and C. B. Moens Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development Development, January 1, 2007; 134(1): 177 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Germain, P. Chambon, G. Eichele, R. M. Evans, M. A. Lazar, M. Leid, A. R. De Lera, R. Lotan, D. J. Mangelsdorf, and H. Gronemeyer International Union of Pharmacology. LX. Retinoic Acid Receptors Pharmacol. Rev., December 1, 2006; 58(4): 712 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roberts, S. Ivins, A. C. Cook, A. Baldini, and P. J. Scambler Cyp26 genes a1, b1 and c1 are down-regulated in Tbx1 null mice and inhibition of Cyp26 enzyme function produces a phenocopy of DiGeorge Syndrome in the chick Hum. Mol. Genet., December 1, 2006; 15(23): 3394 - 3410. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nagano, S. Takehara, M. Takahashi, S. Aizawa, and A. Yamamoto Shisa2 promotes the maturation of somitic precursors and transition to the segmental fate in Xenopus embryos Development, December 1, 2006; 133(23): 4643 - 4654. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Shelton, I. T. Sandoval, A. Eisinger, S. Chidester, A. Ratnayake, C. M. Ireland, and D. A. Jones Up-regulation of CYP26A1 in Adenomatous Polyposis Coli-Deficient Vertebrates via a WNT-Dependent Mechanism: Implications for Intestinal Cell Differentiation and Colon Tumor Development. Cancer Res., August 1, 2006; 66(15): 7571 - 7577. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Hoffman, K. Garcha, K. Karamboulas, M. F. Cowan, L. M. Drysdale, W. A. Horton, and T. M. Underhill BMP action in skeletogenesis involves attenuation of retinoid signaling J. Cell Biol., July 3, 2006; 174(1): 101 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Chichili, D. Nohr, M. Schaffer, J. von Lintig, and H. K. Biesalski {beta}-Carotene Conversion into Vitamin A in Human Retinal Pigment Epithelial Cells Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3562 - 3569. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Williams, J. P. Mear, H.-C. Liang, S. S. Potter, B. J. Aronow, and M. C. Colbert Large-scale reprogramming of cranial neural crest gene expression by retinoic acid exposure Physiol Genomics, October 4, 2004; 19(2): 184 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Villani, V. Appierto, E. Cavadini, M. Valsecchi, S. Sonnino, R. W. Curley, and F. Formelli Identification of the Fenretinide Metabolite 4-Oxo-Fenretinide Present in Human Plasma and Formed in Human Ovarian Carcinoma Cells through Induction of Cytochrome P450 26A1 Clin. Cancer Res., September 15, 2004; 10(18): 6265 - 6275. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Andreola, G. P. Hayhurst, G. Luo, S. S. Ferguson, F. J. Gonzalez, J. A. Goldstein, and L. M. De Luca Mouse Liver CYP2C39 Is a Novel Retinoic Acid 4-Hydroxylase: ITS DOWN-REGULATION OFFERS A MOLECULAR BASIS FOR LIVER RETINOID ACCUMULATION AND FIBROSIS IN ARYL HYDROCARBON RECEPTOR-NULL MICE J. Biol. Chem., January 30, 2004; 279(5): 3434 - 3438. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Taimi, C. Helvig, J. Wisniewski, H. Ramshaw, J. White, M.'a. Amad, B. Korczak, and M. Petkovich A Novel Human Cytochrome P450, CYP26C1, Involved in Metabolism of 9-cis and All-trans Isomers of Retinoic Acid J. Biol. Chem., January 2, 2004; 279(1): 77 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Ross and R. Zolfaghari Regulation of Hepatic Retinol Metabolism: Perspectives from Studies on Vitamin A Status J. Nutr., January 1, 2004; 134(1): 269S - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Costet, F. Lalanne, M. C. Gerbod-Giannone, J. R. Molina, X. Fu, E. G. Lund, L. J. Gudas, and A. R. Tall Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages Mol. Cell. Biol., November 1, 2003; 23(21): 7756 - 7766. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudoh, S. W. Wilson, and I. B. Dawid Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm Development, March 11, 2003; 129(18): 4335 - 4346. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Goodman and A. B. Pardee Evidence for defective retinoid transport and function in late onset Alzheimer's disease PNAS, March 4, 2003; 100(5): 2901 - 2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Spitsbergen and M. L. Kent The State of the Art of the Zebrafish Model for Toxicology and Toxicologic Pathology Research--Advantages and Current Limitations Toxicol Pathol, January 1, 2003; 31(1_suppl): 62 - 87. [Abstract] [PDF] |
||||
![]() |
A. C. Ross Retinoid Production and Catabolism: Role of Diet in Regulating Retinol Esterification and Retinoic Acid Oxidation J. Nutr., January 1, 2003; 133(1): 291S - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Chithalen, L. Luu, M. Petkovich, and G. Jones HPLC-MS/MS analysis of the products generated from all-trans-retinoic acid using recombinant human CYP26A J. Lipid Res., July 1, 2002; 43(7): 1133 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Klaassen, R. H. Brakenhoff, S. J. Smeets, G. B. Snow, and B. J. M. Braakhuis Enhanced Turnover of all-trans-Retinoic Acid and Increased Formation of Polar Metabolites in Head and Neck Squamous Cell Carcinoma Lines Compared with Normal Oral Keratinocytes Clin. Cancer Res., April 1, 2001; 7(4): 1017 - 1025. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |