help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Loudig, O.
Right arrow Articles by Petkovich, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Loudig, O.
Right arrow Articles by Petkovich, M.
Molecular Endocrinology 14 (9): 1483-1497
Copyright © 2000 by The Endocrine Society

Cytochrome P450RAI(CYP26) Promoter: A Distinct Composite Retinoic Acid Response Element Underlies the Complex Regulation of Retinoic Acid Metabolism

Olivier Loudig, Charolyn Babichuk, Jay White, Suzan Abu-Abed, Chris Mueller and Martin Petkovich

Cancer Research Laboratories (O.L., C.B., J.W., S.A.-A., C.M., M.P.) Departments of Biochemistry (O.L., C.M., M.P.) and Pathology (J.W., S.A.-A., C.M., M.P.) Queen’s University Kingston, Ontario, Canada K7L 3N6


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The catabolism of retinoic acid (RA) is an essential mechanism for restricting the exposure of specific tissues and cells to RA. We recently reported the identification of a RA-inducible cytochrome P450 [P450RAI(CYP26)], in zebrafish, mouse, and human, which was shown to be responsible for RA catabolism. P450RAI exhibits a complex spatiotemporal pattern of expression during development and is highly inducible by exogenous RA treatment in certain tissues and cell lines. Sequence analysis of the proximal upstream region of the P450RAI promoter revealed a high degree of conservation between zebrafish, mouse, and human. This region of the promoter contains a canonical retinoic acid response element (5'-AGTTCA-(n)5-AGTTCA-3'), embedded within a 32-bp region (designated R1), which is conserved among all three species. Electrophoretic mobility shift assays using this element demonstrated the specific binding of murine retinoic acid receptor-{gamma} (RAR{gamma}) and retinoid X receptor-{alpha} (RXR{alpha}) proteins. Transient transfection experiments with the mouse P450RAI promoter fused to a luciferase reporter gene showed transcriptional activation in the presence of RA in HeLa, Cos-1, and F9 wild-type cells. This activation, as well as basal promoter activity, was abolished upon mutation of the RARE. Deletion and mutational analyses of the P450RAI promoter, as well as DNase I footprinting studies, revealed potential binding sites for several other proteins in conserved regions of the promoter. Also, two conserved 5'-TAAT-3' sequences flanking the RARE were investigated for their potential importance in P450RAI promoter activity. Moreover, these studies revealed an essential requirement for a G-rich element (designated GGRE), located just upstream of the RARE, for RA inducibility. This element was demonstrated to form complexes with Sp1 and Sp3 using nuclear extracts from either murine F9 or P19 cells. Together, these results indicate that the P450RAI-RARE is atypical in that conserved flanking sequences may play a very important role in regulating RA inducibility and expression of P450RAI(CYP26).


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Retinoic Acid (RA), the principal active metabolite of vitamin A, is an essential regulator of pattern formation during embryonic development and is necessary for the maintenance of epithelial tissues in the adult (1, 2, 3). The activity of RA is determined by several parameters including those that influence receptor activity and those that govern ligand availability. In this regard, the effects of RA on gene expression are principally mediated by two families of retinoid nuclear receptors comprised of three subtypes each; retinoic acid receptors (RARs {alpha}, ß, and {gamma}) and, retinoid X receptors (RXRs {alpha}, ß, and {gamma}) (4). RARs and RXRs commonly participate together, in the form of heterodimers, to regulate transcription (5, 6). Most tissues, especially during embryonic development, express one or more of the RAR and RXR subtypes in various combinations possibly giving rise to different responses to RA (7, 8).

Retinoic acid response elements (RAREs) exist in various forms and can also influence receptor activity. Typically, a RARE is comprised of two direct repeats of the motif, 5'-PuGTTCA-3' separated by a 5-bp spacer; however, various other polymorphic forms of RAREs have been characterized, having 1- or 2-bp spacers. Several studies suggest that specific forms of RAREs may preferentially bind different heterodimeric RAR/RXR pairs (9).

The active forms of RA include all-trans RA, and 9-cis RA stereoisomers, which are ligands for these receptors; RARs are activated by both isoforms while RXRs appear to be activated exclusively by 9-cis RA. It is not clear at present how interconversion between the two forms is controlled; however, the balance of all-trans RA and 9-cis RA may be important for RA activity. The distribution of RA is also a critical determinant in the regulation of RA responsive genes, especially in developing tissues. There is growing evidence that tight spatial and temporal control of RA synthesis and catabolism are important in establishing regional distribution patterns of RA (10, 11, 12, 13, 14).

Control of RA tissue distribution is thought to be established by the balanced expression of RA synthesizing and RA catabolizing enzymes. Several retinaldehyde dehydrogenases have already been implicated in the irreversible conversion of retinaldehyde to the active RA (10, 11). Retinaldehyde dehydrogenase type 2 (RALDH-2) is thought to be a key enzyme in localized production of RA during embryogenesis since it exhibits an expression pattern consistent with that of a retinoid-responsive LacZ reporter transgene. Moreover, RALDH-2 knockout mice have severe developmental defects and die at midgestation; however, knockout embryos are rescued when the mother is treated with RA (12, 13, 14).

The metabolism of RA is initiated by hydroxylation (15) mediated by cytochrome P450 activity, as judged by the ability of broad spectrum P450 inhibitors such as ketoconazole and liarozole to block 4-hydroxylation (16, 17, 18, 19, 20). In certain tissues, including testis, skin, and lung and in numerous cell lines, such as NIH3T3 fibroblasts, HL60 myelomonocytic leukemic cells, F9 and P19 murine embryonal carcinoma cells, MCF7 human breast cancer cells, and HeLa human cervix cancer cells, RA metabolism can be induced by RA treatment (20, 21, 22, 23).

P450RAI(CYP26) is a cytochrome P450 enzyme that specifically metabolizes RA and is likely responsible for much of the RA-inducible RA metabolism observed. P450RAI was first isolated from zebrafish as a gene product induced by RA during regeneration of adult caudal fin (24). Subsequently, homologs have been isolated from human (25), mouse (26), chick (27), and Xenopus (28) with all the genes exhibiting a high degree of sequence conservation. P450RAI metabolizes all-trans RA but not the 9-cis or 13-cis RA isomers (24, 29, 30, 31, 32, 33, 34). Previous studies demonstrated that P450RAI expression is strongly induced by RA in early mouse and Xenopus embryos as well as in a number of normal and tumor cell lines. Several studies have examined the spatiotemporal expression of P450RAI during embryonic development (28, 35, 36, 37, 38). Primary sites of P450RAI expression in mouse include neural folds before neural tube closure, and caudal neural epithelium, although most tissues at various stages of morphogenesis transiently express P450RAI (35, 36, 37). Studies in mouse and Xenopus have shown that P450RAI expression generates domains restricting RA exposure (36, 38), possibly resulting in differential rates or timing of differentiation. In several cases it would appear that P450RAI and RALDH-2 expression are complementary, possibly forming boundaries defined by graded retinoic acid distribution between RA synthesizing regions and RA degrading regions (28, 38).

The focus of our work, guided by the sequence conservation between human, mouse, and zebrafish in the upstream proximal promoter, was to characterize elements necessary for RA induction and regulation. We show that a conserved RARE and a Sp1/Sp3 binding site are essential for the RA-regulated induction of P450RAI (39, 40, 41, 42).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Human, Mouse, and Zebrafish Promoter Alignment
Sequences of genomic P450RAI clones isolated from human, mouse, and zebrafish were aligned using GeneWorks 2.0. This analysis revealed extensive conservation in the intron/exon boundaries as well as striking regions of conservation in the 5'-flanking region (25, 42). A particularly high degree of homology was observed between mouse and human promoter sequences with distinct motifs conserved among all three species (Fig. 1AGo). Of particular note, each promoter contains a direct repeat of the sequence TGAACT separated by five spacer nucleotides characteristic of a canonical retinoic acid response element (RARE-DR5). This DR5 is embedded within a 32-bp region that, with the exception of one nucleotide, is perfectly conserved between zebrafish, mouse, and human (designated R1). The P450RAI-RAREs were then aligned with different known RAREs (Fig. 1BGo). It is interesting to note the similarity between P450RAI-RAREs, RARß2-RAREs, and Hoxa-1-RAREs, in particular with respect to the spacer nucleotides. The significance of this conservation is not yet known. In the mouse promoter, 39 bp downstream of this R1 region, is a putative TATA box (represented as a TATAA motif in all three species) which is upstream of the transcription start site, previously identified by S1 nuclease mapping (32). While other regions of the P450RAI promoter are less well conserved, several smaller GC-rich elements can be identified upstream of this R1 region. The closest upstream region is a guanine-guanine-rich element (designated GGRE) perfectly conserved in mouse and human sequences, with the exception of one nucleotide for the zebrafish sequence. This G-rich element in the zebrafish (GGGCGG) can be identified as a putative Sp1 recognition site (Fig. 1AGo) (43).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 1. Comparison of the Human, Mouse, and Zebrafish P450RAI (CYP26) Proximal Upstream Promoter and Their Retinoic Acid Response Elements

A, The starting ATG codon (M for methionine), the putative TATA box, the R1 region, and the G-rich element (GGRE) are boxed. The consensus sequence of the RARs are included in the R1 region, marked by two arrows, indicating their orientation and shadowed in gray to show their conservation between the three species. Bars between human, mouse, and zebrafish sequences indicate identity, 87% for human and mouse, and 51% for mouse and zebrafish. B, RAREs (DR5) from other promoters (gene and organism described) were aligned with the P450RAI-RAREs. All the direct repeats are boxed, and the sequence homology is shown in light gray. The dark gray areas show the homology in the surrounding nucleotides.

 
Characterization of a Retinoic Acid Response Element (RARE) in the P450RAI Promoter
To demonstrate that the putative RARE in the P450RAI promoter is a target for retinoic acid receptors and to confirm our previous findings implicating the involvement of RAR{gamma} and RXR{alpha} (26), we performed bandshift experiments with in vitro transcribed and translated mouse RAR{gamma} and RXR{alpha} proteins. Oligonucleotides (Fig. 2AGo) corresponding to the R1 wild-type (WT) and mutated (MT) region that contains the P450RAI-RARE were analyzed in gel mobility shift assays (Fig. 2BGo). No protein/oligonucleotide complexes are observed in the lysate control lane (lane 1) and the presence of individual RAR{gamma} or RXR{alpha} proteins is insufficient to produce a shift in mobility (lanes 1–3). The addition of both RAR{gamma} and RXR{alpha} proteins in combination produced a strong complex characteristic of a typical RARE (lane 4). Conversely, mutations in the RARE half-sites (lanes 5–8) ablated the formation of this complex in the presence of both in vitro translated RAR{gamma} and RXR{alpha} proteins.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Determination of the Migration Pattern of R1-RARE with in Vitro Translated RAR{gamma} and RXR{alpha}, and Nuclear Extracts

A, The oligonucleotides used in these experiments are shown, and the mutation performed in the direct repeats (in light gray) of the R1-RARE are marked by asterisks. B, Migration of the R1-WT and R1-MT was performed on a 6% nondenaturing polyacrylamide gel (PAGE), without, with one, or with both RAR{gamma} and RXR{alpha} nuclear receptors. C, The experiments using the nuclear extracts of P19 teratocarcinomal, F9 wild-type, and F9 RAR{gamma}-/- RXR{alpha}-/- cells were performed on a 6% nondenaturing PAGE. Different complexes (C1-C4) are distinguishable on the gel and are shown by arrows. The RXR supershifts are indicated on the top right of the F9 wild-type and P19 panels.

 
Similar R1 oligonucleotides were tested using crude nuclear extracts from P19, F9 wild-type teratocarcinoma cells and F9 cells in which the RAR{gamma} and RXR{alpha} genes had been ablated by homologous recombination (Fig. 2CGo). A specific complex (C2) was observed to bind the R1-RARE in extracts from F9 wild-type cells (lanes 3 and 5) but not from F9 RAR{gamma}-/- RXR{alpha}-/- double knockout cells (lane 7). This complex was not present with oligonucleotides carrying two different mutations in the RARE half- sites (MT and MT2; data not shown). Supershift experiments using an anti-RXR antibody demonstrated that the C2 complex was selectively supershifted, confirming that RXR was part of the R1 binding complex. We also observed several other complexes (C1, C3, and C4) formed with this R1 oligonucleotide; however, as yet we do not know the identity of these other components. Together, these results show that the R1-RARE is a target for retinoic receptors in various cell types and that it is specific for the RAR/RXR heterodimer.

Transcriptional Activity of the Proximal Region of the P450RAI Promoter
To investigate the transcriptional activity of the mouse P450RAI promoter and the putative RARE activity, we used cotransfection assays. The mouse P450RAI-RARE and its flanking sequences were mutated as shown in Fig. 3AGo. A 256-bp fragment of the wild-type or mutated mouse P450RAI promoter was amplified and subcloned into a pGL3 basic luciferase reporter vector (Fig. 3AGo). Cells were transfected with the wild-type promoter construct (P450RAI-WT) along with various amounts of expression vectors for mouse RAR{gamma} and RXR{alpha}, encoding receptors previously shown to be necessary for P450RAI induction by RA (26). Depending on the amount of both RAR{gamma} and RXR{alpha} receptors added, the transcriptional activity of P450RAI-WT promoter increased. These analyses allowed for the optimization of the amount of receptors required (0.2 µg of RAR{gamma} and 0.2 µg of RXR{alpha}). Using these promoter constructs we compared proximal promoter activities in the F9 wild-type and F9 RAR{gamma}-/- RXR{alpha}-/- double knockout cell lines. When the P450RAI promoter was transfected alone into F9 wild-type cells, addition of 10-6 M all-trans RA resulted in a 2-fold marked increase in transcriptional activity (See Fig. 3BGo, P450RAI-WT, left panel). While some inducible promoter activity can be measured in the F9 mutant cell line, the absolute levels of activity are much lower (Fig. 3BGo, P450RAI-WT, right panel). By comparison, both wild-type and mutant F9 cell lines support similar levels of transcriptional activity, when the promoter construct was cotransfected with expression plasmids for RAR{gamma} and RXR{alpha} (Fig. 3BGo, P450RAI-WT, compare left and right panels). Similarly, mutations in the R1-RARE abolish RA-inducible activity, and cotransfection of both RAR{gamma} and RXR{alpha} does not compensate for this lost activity (Fig. 3BGo, P450RAI-RARE-mut, left and right panels). Also, transfection of the wild-type promoter construct (P450RAI-WT) in the presence of RA, in Cos-1 and HeLa cells, shows a 3-fold increase in activity in comparison with the nontreated cells (Fig. 3CGo, Cos-1 and HeLa). Addition of RAR{gamma} and RXR{alpha} to the transfection mix increased the transcriptional activity by 2-fold without RA, likely due to residual RA activity in the culture media. In the presence of both receptors and 10-6 M all-trans RA, the transcriptional activity increased by 4-fold in HeLa and 5-fold in Cos-1. The putative RARE located in the R1 region was mutated, to the MT sequence (Fig. 3CGo, P450RAI-RARE-mut). Transient transfection analyses of P450RAI-RARE-mut revealed a complete ablation of the retinoic acid response, in the absence or in the presence of receptors (Fig. 3CGo). This complete loss of retinoic acid induction indicated that the mutation of the direct repeat located in R1 ablated the functional activity of this P450RAI-RARE.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional Analysis of P450RAI-RARE

A, The sequence of the mouse R1 region is enlarged and the conserved motifs are boxed, named 5'-TAAT, RARE (DR5) and 3'-TAAT, respectively, and their orientation is defined by the arrows. The P450RAI-mutant construct motifs are boxed, and the mutations are shown in light gray. B, Transient transfection analyses were performed on F9 wild-type and F9 RAR{gamma}-/- RXR{alpha}-/- cells, using the P450RAI-WT and P450RAI-RARE-mut constructs described above. C, Transient transfection analyses were also performed in HeLa and Cos-1 cells. All transient transfection experiments were normalized with the reporter plasmid containing the renilla luciferase gene and performed in triplicate; error bars indicate the SD.

 
Analysis of TAAT Motif Contributions to P450RAI Transcriptional Activity
The striking degree of conservation around the R1-RARE prompted us to examine the contribution of flanking regions for their influence on the transcriptional activity of this RARE. Inspection of the RARE flanking sequences revealed that the 5'- and the 3'-regions were similar in that they contain conserved 5'-TAAT-3' elements (Fig. 3AGo). This characteristic element has previously been demonstrated to form the core recognition element for homeobox proteins in other promoters (45, 46, 47). Interestingly, introducing a change from 5'-TAAT-3' (or "ATTA" on the upper coding strand) to a 5'-TACT-3' (Fig. 3AGo, P450RAI-5'-TAAT-mut) resulted in a dramatic drop in basal transcriptional activity, as well as a loss of 90% of the RA response upon mutation of the 5'-motif (Fig. 3CGo, P450RAI-5'-TAAT-mut, Cos-1 and HeLa). This would suggest that the conserved 5'-TAAT-3' motif in 5' of the RARE has a positive influence on the RARE activity. In contrast, introducing the same change in the 3'-motif (Fig. 3AGo, P450RAI-3'-TAAT-mut), resulted in an enhanced RA response in the case of HeLa cells transient transfections, approximately 2-fold in the presence of RA, with or without added receptors (Fig. 3CGo, P450RAI-3'-TAAT-mut, HeLa). No significant change in reporter gene activity in comparison with the wild-type promoter was observed in the case of Cos-1 cell transient transfections (Fig. 3CGo, P450RAI-3'-TAAT-mut, Cos-1). These results suggest that there may be cell-specific factors influencing P450RAI transcription through the R1 region.

Determination of Protein/DNA Interactions by DNase I Footprinting Analysis
To visualize protein/DNA contacts around the RARE and the rest of the proximal P450RAI promoter, we performed in vitro DNase I footprinting analyses. We used murine liver extracts for this study since P450RAI was expressed and could be up-regulated by RA treatment (32). Total RNA was extracted from liver tissue obtained from mice treated for 2, 8, and 24 h with 100 mg/kg all-trans retinoic acid and analyzed by Northern blotting. We observed that the P450RAI transcript was expressed at low levels even in untreated animals (Fig. 4AGo, lane 4) and was strongly induced by exposure to exogenous RA (lane 1–3). Fig 4BGo shows the DNase I footprint experiment with increasing concentrations of liver nuclear extracts with the P450RAI coding strand encompassing sequences between -170 and -80. Liver extracts from untreated mice were used since no significant differences in footprint patterns were observed in liver extracts from RA-treated and untreated mice (data not shown). Two major areas of protection from DNase I were evident even at low protein extract concentrations. One region of protection was coincident with the RAR/RXR protein complex binding site between -120 and -95. A second strong area of protection was observed upstream of the R1 element between -156 and -137, surrounding the annotated GGRE. Areas of DNase I hypersensitivity (indicated by arrows) flank both of these protected regions. Figure 4CGo shows the DNase I footprints obtained for both the coding and the noncoding strands of P450RAI from -238 to -60. An additional but less distinct area of protection was observed between -81 and -70 and several areas of hypersensitivity were evident in the proximal promoter region. At present, we do not know the nature of the factors influencing DNase I sensitivity at these sites. Interestingly, areas of protection and hypersensitivity are consistent for both the coding and the noncoding strands (Fig. 4CGo, both panels). Results for both strands are summarized in Fig. 4DGo.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 4. Mouse P450RAI Promoter Expression and Protein Binding Pattern with Liver Nuclear Extracts

A, Northern blot analysis with liver extracts from mice treated (lanes 1–3) or untreated (lane 4) with RA. Location of the mouse P450RAI mRNA is indicated on the gel by the arrow, control gene 36B4 (26 ). B, End-labeled P450RAI promoter fragments (coding strand) were incubated with increasing amounts of liver extracts (lanes 3 and 8) and digested with increasing amounts of DNase I. The cleavage products of naked DNA with various concentrations of DNase I are shown (lanes 1, 2, and 9). Hypersensitive regions are marked with arrows. C, End-labeled P450RAI promoter fragments (coding and noncoding strands) were incubated with 60 µg (lanes 4 and 9) or 90 µg (lanes 5 and 10) of liver extracts and digested with DNase I. The cleavage products of naked DNA (lanes 3 and 8) and G+A and C+T Maxam-Gilbert chemical cleavage reactions (lanes 1, 2, 6, and 7) are included. Cleavage products were separated on a 6%, 6 M urea denaturing polyacrylamide gel. Protected regions are indicted by bars, and hypersensitive regions are marked by arrows. D, Summary of the footprinting data with the nucleotide sequence of the mouse P450RAI promoter in its proximal region. Regions that were protected from DNase I cleavage are indicated with boxes, and arrows indicate hypersensitive nucleotides on either strand. A horizontal arrow indicates the transcription start site. RARE and GGRE arrows as seen in Fig. 1AGo.

 


View larger version (25K):
[in this window]
[in a new window]
 
Figure 4D. Continued

 
An Upstream G-Rich Element Supports RARE Activity
The appearance of a strong DNase I footprint upstream of the R1 element (GGRE) led us to further analyze this region by transient transfection experiments. When nucleotides from -238 to -137 were deleted (Fig. 5AGo, P450RAI-137), the activity of the promoter was reduced by 40% (nontreated) to 85% (RA treated) in HeLa cells when compared with the wild-type promoter (P450RAI-WT) and was negligible in Cos-1 and F9 wild-type cells (Fig. 5BGo). Interestingly, the P450RAI-137 construct, when cotransfected with both retinoic acid receptors RAR{gamma} and RXR{alpha}, in the presence of RA, did not give rise to RA inducibility. An extended construct encompassing the GGRE (Fig. 5AGo, P450RAI-163) restored the RA inducibility of the promoter and approximately 25% (nontreated) to 50% (RA treated) of the transcriptional activity of the wild-type promoter (P450RAI-WT) in all three cell lines (Fig. 5BGo, HeLa, Cos-1, and F9WT). All constructs containing both the GGRE and the RARE had similar levels of inducibility by RA treatment although absolute levels of luciferase activity were different (Fig. 5BGo, HeLa, Cos-1, and F9WT). Inclusion of the sequences between -238 and -163 further increased the activity of the promoter, demonstrating the requirement of upstream regions for the full restoration of the activity of the promoter. These results suggest that the RA response mediated through the P450RAI-RARE is dependent on direct or indirect interactions with upstream sequences, which include the GGRE.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Transcriptional Activity of the R1-RARE in the Presence or Absence of the G-Rich Element

A, The first construct (P450RAI-WT) represents the wild-type proximal promoter. Two different constructs either missing or containing the GGRE are labeled P450RAI-137 and P450RAI-163, respectively. B, The different constructs including the empty vector (pGL3B) were transfected in the absence or presence of receptors (0.2 µg of RAR{gamma} and 0.2 µg of RXR{alpha}), in HeLa, Cos-1, and F9 wild-type cells, with either DMSO or RA/DMSO treatment. Experiments were performed in triplicate, and error bars indicate the SD.

 
Sp1/Sp3 Transcription Factors Interact with the GGRE Element in Vitro
The DNase I footprint analyses and the transient transfection data suggest that the GGRE is an important regulator of the P450RAI promoter activity. Gel mobility shift assays were performed using probes encompassing the nucleotides -163 to -137, named GGRE-WT for the wild-type and GGRE-MT for the mutated form (Fig. 6AGo), with nuclear extracts from the murine F9 (Fig. 6BGo) and P19 (Fig. 6CGo) teratocarcinoma cell lines. Two strong complexes (Fig. 6AGo and 6BGo, complexes A and B) were observed in both cell lines. The G-rich nature of this element and the configuration of the complexes formed implied that this element bound Sp1 and Sp3 proteins. Moreover, very similar complexes were observed using the same extracts, with oligonucleotides containing a Sp1 consensus site (Fig. 6AGo). To determine whether Sp1/Sp3 proteins were involved, Sp1 and Sp3 affinity-purified polyclonal antibodies were used in supershift assays. Anti-Sp1-specific antibodies reduced the appearance of complex A and a supershift was observed (Fig. 6Go, B and C, see Sp1 supershift) with both CSp1 (compare lanes 5 and 8) and GGRE-WT (compare lanes 6 and 9) oligonucleotides. Complex B (Fig. 6Go, B and C) remained unchanged. Conversely, the anti-Sp3 antibodies essentially eliminated complex B and formed a supershift in the case of both probes (CSp1 and GCRE) using either F9 or P19 nuclear extracts. To localize the binding site of both Sp1 and Sp3 on GGRE-WT, we generated a mutation in the core guanine-rich region, from GGGGGG (-154 to -149) to GCATCG (Fig. 6AGo). By mutating the guanine-rich region, we totally ablated Sp1/Sp3 complex formation (Fig. 6Go, B and 6C; lane 15), as expected. A third complex (complex C), however, was not sensitive to the mutation in the GGRE. Together, these results indicate that Sp1/Sp3 proteins are able to complex with the GGRE region, in the guanine-rich region, and participate in the retinoic acid response by interacting directly or indirectly with proteins binding to the R1-RARE.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 6. Analysis and Determination of Putative Transcription Factors Binding to the GGRE

A, Set of oligonucleotides used. The guanine-rich region is boxed in both GGRE-WT and GGRE-MT. Mutations in the GGRE-MT oligonucleotide are shadowed in light gray and localized by asterisks. B, Gel mobility shift assays were performed using radiolabeled oligonucleotides with murine F9 nuclear extracts. Lanes 1–4 show the incubation of CSp1 and GGRE-WT probes with the polyclonal antibodies directed against Sp1 or Sp3. Lanes 5–7 determined the pattern of migration of CSp1, GGRE-WT, and R1-WT probes. Lanes 8–10 are the supershift experiments performed in presence of Sp1 polyclonal antibodies. Lanes 11–13 are the supershift performed in the presence of Sp3 antibodies. Lane 14 represents the competition between radiolabeled 1xGGRE-WT and nonlabeled 10x GGRE-WT. Lane 15 shows the pattern of the GGRE-MT. The different complexes (A, B, and C) observed on the gel are indicated by the arrows to the right of the panel. The Sp1 and Sp3 supershifted probes are indicated to the left of the panel. C, The same gel mobility shift assay was performed with murine P19 nuclear extracts. The presentation of the panel follows the same organization as Fig. 6BGo.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
P450RAI is an important regulator of RA distribution during development. The analysis of its expression in mouse, chick, and Xenopus embryos revealed complex, stage-specific patterns possibly reflecting a role for this enzyme in limiting tissue exposure to RA (28, 35, 36, 37, 38, 48). Moreover, analysis of P450RAI expression in cultured human cells shows that exogenous RA can strongly induce the expression of this gene (34). In our present study, we show that at least some of the RA inducibility of P450RAI is due to regulation at the transcriptional level, mediated by a highly conserved RARE. Furthermore, we determined the presence of other response elements, associated with the P450RAI-RARE, that may be important contributors in establishing complex stage-specific patterns of P450RAI expression.

Analysis of human, mouse, and zebrafish proximal regions of the P450RAI promoter allowed us to determine the presence of a canonical RARE within a conserved 32-bp sequence, which was shown to be recognized by the RAR{gamma}/RXR{alpha} heterodimer, consistent with our previous findings demonstrating that exogenous all-trans RA induction of P450RAI mRNA in F9 cells is mediated by RAR{gamma} and RXR{alpha} (26). A comparison of this P450RAI-RARE with other RAREs such as the murine RARß2-RARE and Hoxa-1-RARE reveals similarity even within the spacer nucleotides (Fig. 3BGo). Whether this reflects a subtle functional role for the spacer region remains to be determined. In addition, transfection experiments with wild-type and mutated promoters confirmed that the RA inducibility was dependent on the presence of the RARE motif. The P450RAI promoter was shown to be responsive to RA in HeLa, Cos-1, and F9 wild-type cells. However, expression of the endogenous P450RAI gene is not detected in Cos-1 cells treated with RA (data not shown), indicating that additional elements in the P450RAI promoter, not included in the constructs used in these experiments, are important in the regulation of its expression. Because the pattern of expression of P450RAI during embryogenesis is highly spatiotemporally regulated, we speculated that homeodomain proteins might be involved in the control of the transcriptional activity of P450RAI. Interestingly, this R1 region also contained two conserved 5'-TAAT-3' motifs flanking the RARE; such motifs are generally found in homeodomain factor DNA binding sites (45, 46, 47). Both DNase I footprint analyses and transient transfections suggest the presence of factor(s) binding either the 5'- or the 3'-conserved TAAT elements. Bandshift assays using 5'- and 3'-TAAT mutants within the R1 region, however, did not reveal obvious differences in DNA binding patterns (data not shown). The importance of these elements in the control of P450RAI activity, and whether or not Hox or related genes interact with this sequence, remains to be determined.

An unexpected observation in these studies came from the apparent dependence of the RARE activity on the presence of upstream regulatory sites, including an Sp1/Sp3 binding site. DNase I footprint analyses revealed the proximity of both sites, and transient transfections confirmed the requirement of the Sp1/Sp3 binding site for RA response. Sp1 activity has been shown previously to be essential for the activity of adjacent response elements in other promoters. For example, cooperativity between the sterol-regulatory element and Sp1 was observed in transcriptional regulation of the low-density lipoprotein (LDL) receptor gene promoter (49). Similarly, apparent physical interactions between the estrogen receptor (ER) and Sp1 appear to be required for the enhanced transactivation of the heat-shock protein 27 (Hsp27) promoter gene (50). Complex interactions between the orphan nuclear receptor {alpha} (ROR{alpha}) and Sp1 were also proposed in the promoter regulation of the murine prosaposin gene (51). Also, multiple Sp1 sites have been identified adjacent to the RARE in the retinoic acid receptor {gamma} isoform 2 (RAR{gamma}2) promoter gene. RAR/Sp1 cotransfection experiments suggest interdependence between Sp1 and RAR/RXR activities (52). While it would appear that Sp1 and RARs could participate together in the regulation of several different promoters, the nature of these interactions remains to be explored.

Murine F9 and P19 cell lines are able to express P450RAI after RA treatment (26). By using nuclear extracts from these cell lines, we also identified the binding to the GGRE of Sp3, another transcription factor member of the C2-H2 zinc-finger family. Mutations in the GGRE ablate the binding of both Sp1 and Sp3 in gel shift mobility assays. Previous studies have demonstrated that Sp1 and Sp3 can bind to the same site with comparable affinity (53). Sp1 and Sp3 have been shown to be bifunctional, acting either as activators or as repressors (39, 41, 44, 54, 55). Considering the expression of Sp1 and Sp3, their degree of phosphorylation, and their potential interaction with other factors, we hypothesize that the regulation of P450RAI may be modulated by signaling pathways that directly affect Sp1/Sp3 abundance and activity.

In vivo, there is a strong overlap between the expression of RALDH-2 and that of a RA reporter gene comprising a RARß-RARE linked to a ß-galactosidase gene (56) These findings imply that where RALDH-2 is expressed, free RA is generated to regulate RA responsive genes such as RARß. Interestingly RALDH-2 and P450RAI domains of expression are often complementary (27, 38). This suggests that the RA responsiveness of P450RAI can be controlled by other factors in a tissue- or a domain-specific manner. Consistent with this, we have previously shown that certain cell lines do not express P450RAI even in the presence of RA, while others express P450RAI in an apparent constitutive manner, possibly indicating the involvement of factors capable of overriding RA control (31).

In summary, analysis of the mouse P450RAI promoter revealed the presence of a highly conserved RARE whose activity depends on an upstream Sp1/Sp3 element. Interestingly, Sp1 is an essential factor for normal embryogenesis (57). Furthermore, the presence of several conserved elements including possible homeodomain protein binding sites may help to explain how the complex spatio-temporal patterns of P450RAI expression are generated during embryogenesis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of the Zebrafish, Mouse, and Human Promoter Sequences
The zebrafish P450RAI(CYP26) gene was first isolated from a zebrafish genomic library (30, 42). Mouse genomic clones were isolated by screening 106 plaques of a mouse genomic library with the mouse P450RAI cDNA probe (mouse genomic library 129SV, generously donated by Dr. Janet Rossant). Sequencing of the 5'-region of the genomic DNA allowed for the identification of the promoter region. Human genomic clones were obtained from the Canadian Genome Analysis and Technology Program by screening a P1-artificial chromosome library with human P450RAI cDNA. Four individual PAC clones (245C7, 48I5, 223I8, and 250L19) encompassing the human P450RAI(CYP26) gene were characterized. PAC 245C7 was selected for analysis of the 5'-promoter region. Sequence analyses were performed using the GeneWorks (Intellegenetics, Inc., Mountain View, CA) software package.

DNA Plasmids
The reporter plasmids contain different segments or mutants of a minimal upstream region of the mouse P450RAI cloned in the pGL3 luciferase reporter vector (Promega Corp., Madison, WI).

The P450RAI-WT, -163, and -137 constructs were generated by PCR amplification (30 cycles) of the upstream region (nucleotides -238 to +18) of the mouse P450RAI promoter, using the forward primers, P450RAI-WT, 5'-CCAGATCTGCGCGCTCAGAGGGAAGCCGC-3'; P450RAI-163, 5'-GATCAGAT CTGCGCCTCGAGGGGGGAGGAGCCAGG-3'; P450RAI-137, 5'-GATCAGATCT GCCCGATCCGCAATTAAAGATGAACTTTGGGTGAACTAATTTGTCTG-3'; and the reverse primer 5'-GAAAGCTTGGCACGCTTCAGCCTCCCGCG-3'. After digestion of the PCR products with BglII and HindIII, the fragments were isolated and ligated into the pGL3 Basic Luciferase reporter vector (Promega Corp.), digested with the same restriction enzymes. The mutant promoter constructs were generated by replacing the ApaI (-139)/HindIII (pGL3B) fragment of the wild-type reporter plasmid with PCR fragments containing the selected mutations. The oligonucleotides used to generate these mutations are the forward primers: P450-RARE-mut, 5'-CAGGGGCCCGATCCGCAATTAAAGAGCTACTTTGGG ACTACTAATTTGTCTG-3'; P450RAI-5'-TAAT-mut, 5'-CAGGGGCCCGATCC GCAAGTAAAGATGAACTTTGGGTGAACTAATTTGTCTGTTGTCTG-3'; P450RAI-3'-TAAT-mut, 5'-CAGGGGCCCGATCCGCAATTAAAGATGAACTT TGGGTGAACTACTTTGTCTG; and the same reverse primer indicated above. All constructs used in transfection experiments were confirmed by sequencing and purified using cesium chloride gradient separation.

Cell Culture and Transient Transfection
The human cervical carcinoma cell line HeLa, the SV40-transformed African green monkey kidney Cos-1 cell line, and the murine embryonical carcinoma F9 wild-type cells and F9 cells in which the RAR{gamma} and RXR{alpha} genes had been ablated by homologous recombination, were cultured in an atmosphere of 5% CO2 at 37 C. HeLa and Cos-1 cells were cultured in MEM, pH 7.3, supplemented with 0.22% sodium hydrogen carbonate,10% FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin, and 0.1% fungizone (Life Technologies, Inc., Gaithersburg, MD). Both F9 cell lines were cultured in DMEM, pH 7.3, supplemented with 0.37% NaHCO3 (sodium hydrogen carbonate), 0.35% dextrose, 10% FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin, and 0.1% fungizone (Life Technologies, Inc.).

F9 wild-type and F9 cells in which the RAR{gamma} and RXR{alpha} genes had been ablated by homologous recombination were generously donated by Dr. Pierre Chambon. One day before transfection, F9 wild-type cells and F9 RAR{gamma}--/- RXR{alpha}-/- double knockout cells, were split and 1–2 x 105 cells were seeded in 24-well plates coated with 0.1% gelatin. Cells were transfected with 2 µg of DNA using the polyethylenimine reagent (PEI; Aldrich Chemical Co., Inc., Milwaukee, WI). We incubated 1 µl of PEI (3.5 µg/µl) in 49 µl of sodium chloride (NaCl) at a concentration of 150 mM, and separately 2 µg of DNA (1 µg/µl) with 48 µl of NaCl 150 mM, for 5 min at room temperature. The PEI/NaCl mix was added to the DNA/NaCl mix and incubated for 15 min at room temperature. Transfections were performed by addition of the 100 µl mix to 200 µl of freshly replaced medium for 5 h. Cells were washed with 1xPBS and 500 µl of medium were added for 19 h. After transfection, cells were treated either with 0.1% of dimethylsulfoxide (DMSO) vehicle or with 10-6 M final all-trans retinoic acid in DMSO (RA, Sigma, St. Louis, MO) for 24 h, and proteins were extracted using the passive lysis buffer (Promega Corp.). To normalize the Firefly luciferase activity, cells were cotransfected with 0.2 µg of pRL-SV40 per well, a vector expressing the Renilla luciferase gene (Promega Corp.). Cell extract (20 µl) was read using both dual luciferase reagents (Promega Corp.) in a 96-well plate in a Berthold Luminometer. All transfections were performed in triplicate, and experiments were repeated three times.

Twenty four hours before transfection, HeLa and Cos-1 cells were split and 3–4 x 105 cells were seeded in each well of a six-well plate in 2 ml of culture medium. Two hours before transfection the culture medium was replaced. Transfections of these two cell lines were performed with the FuGENE transfection reagent, according to the manufacturer’s instructions (Roche Molecular Biochemicals, Indianapolis, IN). Twenty four hours after transfection, cells were treated either with DMSO or with RA. After 24 h of treatment, cells were washed twice in PBS and harvested in 250 µl of passive lysis buffer at 4 C (Promega Corp.). Reading and normalization of the data were performed as described for F9 wild-type cells and F9 RAR{gamma}-/- RXR{alpha}-/- double knockout cells. All transfections were performed in triplicate and repeated three times.

Nuclear Extract Preparation
Nuclear extracts from HeLa cells, Cos-1 cells, F9 wild-type cells, F9 RAR{gamma}-/- RXR{alpha}-/- double knockout cells, and P19 cells were prepared as described by Leggett et al. (43).

Gel Mobility Shift and Supershift Assays
Gel mobility shift assays corresponding to R1 (see oligonucleotides R1-WT and R1-MT, Fig. 2Go, A and B), and for the identification of the Sp1 site, were performed as described by Lichtsteiner et al. (58), except that the binding reactions were incubated for 15 min on ice before separation on a 6% nondenaturing polyacrylamide gel. Oligonucleotides used in the experiments are shown in the corresponding figures. Double-stranded oligonucleotides (100 ng/µl) were separated from single-stranded oligonucleotides by electrophoresis on a 15% nondenaturing polyacrylamide gel. The oligonucleotides corresponding to R1 were end labeled by T4 polynucleotide kinase using 3 µl of 10 µCi/µl ({gamma}-32P) dATP and purified on a G-50 Sephadex column. Oligonucleotides corresponding to GGRE (guanine-guanine-rich element) were annealed and radiolabeled (300 ng) by the fill-in reaction with Klenow DNA polymerase and ({alpha}-32P) dATP (New England Biolabs, Inc., Beverly, MA). The sequence of the CSp1 oligonucleotide corresponds to the Sp1-SV40 consensus described by Leggett et al. (43).

Supershift experiments were carried out using monoclonal RXR (m-{alpha}, ß, {gamma}) (59) and purified polyclonal Sp1 (PEP) and Sp3 (D20)-G rabbit antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). For each reaction, 1 µl of antibody anti-RXR and 1.5 µl of antibody anti-Sp1 and -Sp3 were preincubated with 5 µl of the F9 and P19 protein extracts in the bandshift binding reaction for 20 min on ice. Oligonucleotides (200,000 cpm) were added to the reaction and incubated for 15 min on ice before separation on a nondenaturing 6%, 0.25xTBE polyacrylamide gel.

In Vitro Transcription and Translation
Twenty micrograms of each of the expression plasmids containing RAR{gamma} and RXR{alpha} were linearized by digestion at 37 C using the XhoI restriction enzyme. The DNA was precipitated by addition of 0.3 volumes of 3 M sodium acetate, pH 7.0, and 2 volumes of ethanol. Pellets were dried and resuspended in 20 µl nuclease free water. The in vitro transcription and translation were performed using the TNT T7/T3 Coupled Reticulocyte Lysate System kit (Promega Corp.) according to procedures suggested by the manufacturer.

Northern Blot Analysis
To determine P450RAI inducibility by RA in mouse liver, C-57 black mice were treated with 100 mg/kg RA in a DMSO/corn-oil carrier mixture. Control mice were treated with the DMSO/corn-oil carrier mixture alone. After 2, 8, and 24 h of treatment, mice were killed by cervical dislocation and livers were immediately excised. Livers were first snap-frozen in liquid nitrogen and then homogenized in 15 ml of TRIzol (Life Technologies, Inc.) for 20 min. Samples were spun down at 6,000 rpm for 20 min at 4 C, and the supernatants were then used to extract RNA as described by Abu-Abed et al. (26). Northern blot analyses were also performed using probes for P450RAI and the control probe 36B4 as described by Abu-Abed et al. (26).

DNase I Footprint Analysis
Liver tissue nuclear extracts were prepared from 6- to 12-week-old C-57 black mice as described by Sierra et al. (60). Tissue was homogenized (1.5 g/10 ml) using a machine-driven Teflon pestle homogenizer in 10 mM HEPES, pH 7.6, 12 mM KCl, 0.15 mM spermine, 0.5 mM spermidine, 1 mM EDTA, 2.2 M sucrose, 5% glycerol, 1% skim milk, 0.5 mM dithiothreitol (DTT), 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 14 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A, and 1 mM benzamidine. The homogenate was layered onto 10-ml pads of the same buffer (without milk), and the nuclei were pelleted by centrifugation at 24,000 rpm for 60 min in a SW-28 rotor. The clean nuclei were resuspended in 10 ml nuclear lysis buffer (10 mM HEPES, pH 7.6, 100 mM KCl, 0.1 mM EDTA, 10% glycerol, 3 mM MgCl2, 1 mM DTT, 0.1 mM PMSF, and 14 µg/ml aprotinin). Nuclei were lysed with KCl (0.55 M final) and were centrifuged at 40,000 rpm in a Ti-50 rotor for 60 min. The supernatant was then transferred to a clean tube. Solid (NH4)2SO4 was added to 0.3 g/ml. The mixture was incubated in ice water for 60 min and then centrifuged at 40,000 rpm in a Ti-50 rotor for 20 min. The pellet was resuspended in nuclear dialysis buffer (25 mM HEPES, pH 7.6, 40 mM KCl, 0.1 mM EDTA, 10% glycerol, and 1 mM DTT) and dialyzed twice against the same buffer for 2 h each time. The DNase I footprinting reactions were performed as described by Sierra et al. (61). P450RAI promoter fragment were directionally end labeled after digestion by either AvrII (noncoding strand) or NcoI (coding strand) and filled-in by Klenow DNA polymerase (New England Biolabs, Inc.) with dCTP, dGTP, dTTP, and ({alpha}-32P) dATP. The labeled DNA was digested with second enzymes to generate approximately 300-bp fragments that spanned the proximal promoter region. The binding reactions (in 40 µl) were performed in footprinting buffer (37.5 mM HEPES, pH 7.6, 54 mM KCl, 0.05 mM EDTA, 5% glycerol, 5 mM MgCl2, and 0.5 mM DTT) containing 40,000 cpm of probe, 2 µg poly dI·dC, and between 5 and 90 µg of liver or testes nuclear extracts or 10 µg BSA for control DNA. The reactions were incubated on ice for 15 min. Three microliters of DNase I (Roche Molecular Biochemicals, Indianapolis, IN) were added (1:40 to 1:30 dilution of 3.3 mg/ml stock solution), and the reactions were allowed to digest on ice for 5 min. Five volumes of stop buffer (20 mM Tris-HCl, pH 8.0, 20 mM EDTA, 250 mM NaCl, 0.5% SDS, 1 mg/ml Proteinase K, and 0.0025 mg/ml sheared salmon sperm DNA) were added, and the reactions were incubated at 50 C for 60 min. The DNA was extracted twice with phenol-chloroform and ethanol precipitated. Chemical cleavage reactions were performed as described by Sambrook et al. (62). Products were dissolved in formamide loading buffer, separated on a denaturing 6 M urea 6% polyacrylamide gel, and visualized by autoradiography.


    ACKNOWLEDGMENTS
 
We thank Dr. Barb Beatty for screening and isolation of the human PAC clones and Dr. Janet Rossant for the mouse genomic library. We thank Dr. Pierre Chambon and Dr. Cecile Rochette-Egly for generously sharing their cell lines and antibodies. Thanks also to Luong Luu, Glenn Maclean, and Caroline Wood for critical reading and comments on the manuscript. Thanks also to the Fire Department of the city of Kingston for saving important experiments.


    FOOTNOTES
 
Address requests for reprints to: Dr. Martin Petkovich, Cancer Research Laboratories, Room 355, Botterell Hall, Queen’s University, Kingston, Ontario, Canada, K7L 3N6. E-mail: petkovic{at}post.queensu.ca

Dr. Charolyn Babichuk was supported by fellowships from the Leukemia Research fund of Canada and the Medical Research Council of Canada. This work was supported by grants from the National Cancer Institute of Canada and the Medical Research Council of Canada to Dr. Martin Petkovich.

Received for publication November 16, 1999. Revision received May 4, 2000. Accepted for publication May 30, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Maden M 1995 The participation of retinoic acid in embryonic and postembryonic development. Ontogenez 26:419–429[Medline]
  2. Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
  3. Petkovich M 1992 Regulation of gene expression by vitamin A: the role of nuclear retinoic acid receptors. Annu Rev Nutr 12:443–471[CrossRef][Medline]
  4. Chambon P 1996 A decade of molecular biology of retinoic acid receptors. FASEB J 10:940–954[Abstract]
  5. Leroy P, Nakshatri H, Chambon P 1991 Mouse retinoic acid receptor {alpha}2 isoform is transcribed from a promoter that contains a retinoic response element. Proc Natl Acad Sci USA 88:10138–10142[Abstract/Free Full Text]
  6. Smith W, Nakshatri H, Leroy P, Rees J, Chambon P 1991 A retinoic acid response element is present in the mouse cellular retinol binding protein I (mCRBPI) promoter. EMBO J 10:2223–2230[Medline]
  7. Leid M, Kastner P, Chambon P 1992 Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem Sci 17:427–33[CrossRef][Medline]
  8. Leid M, Kastner P, Durand B, Krust A, Leroy P, Lyons R, Mendelsohn C, Nagpal S, Nakshatri, H, Reibel, C, Saunders M, Chambon P 1993 Retinoic acid signal transduction pathways. Ann NY Acad Sci 684:19–34[Medline]
  9. Gronemeyer H, Laudet V 1995 Nuclear receptors. Protein Profile 2:1173–1236[Medline]
  10. Duester G 1998 Alcohol dehydrogenase is a critical mediator of RA synthesis from vitamin A in the mouse embryo. J Nutr 128:4598–4624
  11. Bhat PV, Poissant L, Falardeau P, Lacroix A 1988 Enzymatic oxidation of all trans retinal to retinoic acid in rat tissues. Biochem Cell Biol 66:735–40[Medline]
  12. Niederreither K, McCaffery P, Drager U, Chambon P, Dolle P 1997 Restricted expression and retinoic acid-induced down-regulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development. Mech Dev 62: 67–78
  13. Sapin V, Ward S, Bronner S, Chambon P, Dolle P 1997 Differential expression of transcripts encoding retinoid binding proteins and retinoic acid receptors during placentation of the mouse. Dev Dynam 208:199–210[CrossRef][Medline]
  14. Zhao D, McCaffery P, Ivins K, Neve R, Hogan P, Chin W, Drager U 1996 Molecular identification of a major retinoic-acid-synthesizing enzyme, a retinaldehyde-specific dehydrogenase. Eur J Biochem 240:15–22[Medline]
  15. Napoli J 1996 Retinoic acid biosynthesis and metabolism. FASEB J 10:993–1001[Abstract]
  16. Williams JB, Napoli J 1985 Metabolism of retinoic acid and retinol during differentiation of F9 embryonal carcinoma cells. Proc Natl Acad Sci USA 82:4658–4662[Abstract/Free Full Text]
  17. Van Wauwe JP, Coene M-C, Goossens J, Van Nijen G, Cools W, Lauwers W 1988 Ketoconazole inhibits the in vitro and in vivo metabolism of all-trans-retinoic acid. J Pharmacol Exp Ther 245:718–722[Abstract/Free Full Text]
  18. Van Wauwe JP, Coene M-C, Goossens J, Cools W, Monbaliu J 1990 Effects of cytochrome P-450 inhibitors on the in vivo metabolism of all-trans-retinoic acid in rats. J Pharmacol Exp Ther 252:365–369[Abstract/Free Full Text]
  19. Van Wauwe J, Van Nyen G, Coene M, Stoppie P, Cools W, Goossens J, Borghgraef P, Janssen PAJ 1992 Liarozole, an inhibitor of retinoic acid metabolism, exerts retinoid-mimetic effects in vivo. J Pharmacol Exp Ther 261:773–779[Abstract/Free Full Text]
  20. Wouters W, van DJ, Dillen A, Coene MC, Cools W, De CR 1992 Effects of liarozole, a new antitumoral compound, on retinoic acid metabolism in MCF-7 human breast cancer cells. Cancer Res 52:2841–2846
  21. Frolik CA, Roberts AB, Tavela TE, Roller PP, Newton DL, Sporn MB 1979 Isolation and identification of 4-hydroxy- and 4-oxoretinoic acid. In vitro metabolites of all-trans-retinoic acid in hamster trachea and liver. Biochemistry 18:2092–2097[CrossRef][Medline]
  22. Roberts AB, Nichols MD, Newton DL, Sporn MB 1979 In vitro metabolism of retinoic acid in hamster intestine and liver. J Biol Chem 254:6296–6302[Free Full Text]
  23. Duell EA, Astrom A, Griffiths CE, Chambon P, Voorhees JJ 1992 Human skin levels of retinoic acid and cytochrome p-450-derived 4-hydroxyretinoic acid after topical application of retinoci acid in vivo compared to concentrations required to stimulate retinoic acid receptor-mediated transcription in vitro. J Clin Invest 90:1269–1274
  24. White JA, Boffa MB, Jones B, Petkovich M 1994 A zebrafish retinoic acid receptor expressed in the regenerating caudal fin. Development 120:1861–1872[Abstract]
  25. White J, Beckett B, Scherer S, Hebrick J, Petkovich M 1998 P450RAI(CYP26A1) maps to human chromosome 10q23–q24 and mouse chromosome 19C2–3. Genomics 48:270–272[CrossRef][Medline]
  26. Abu-Abed SS, Beckett BR, Chiba H, Chithalen JV, Jones G, Metzger D, Chambon P, Petkovich M 1998 Mouse P450RAI (CYP26) expression and retinoic acid-inducible retinoic acid metabolism in F9 cells are regulated by retinoic acid receptor {gamma} and retinoid X receptor {alpha}. J Biol Chem 273:2409–2415[Abstract/Free Full Text]
  27. Swindell EC, Thaller C, Sockanathan S, Petkovich M, Jessell TM, Eichele G 1999 Complementary domains of retinoic acid production and degradation in the early chick embryo. Dev Biol 216:282–296[CrossRef][Medline]
  28. Hollemann T, Chen Y, Grunz H, Pieler T 1998 Regionalized metabolic activity established boundaries of retinoic acid signalling. EMBO J 17:7361–7372[CrossRef][Medline]
  29. White JA, Petkovich M 1996 identification and cloning of RA-regulated genes by mRNA differential display. Met Mol Biol 89:389–404
  30. White JA, Guo Y, Baetz K, Beckett-Jones B, Bonasoro J, Hsu K, Dilworth J, Jones G, Petkovich M 1996 Identification of the retinoic acid-inducible all-trans-retinoic acid 4-hydroxylase. J Biol Chem 271:29922–29927[Abstract/Free Full Text]
  31. White JA, Beckett-Jones B, Guo YD, Dilworth FJ, Bonasoro J, Jones G, Petkovich M 1997 cDNA cloning of human retinoic acid-metabolizing enzyme (hP450RAI) identifies a novel family of cytochromes P450. J Biol Chem 272:18538–18541[Abstract/Free Full Text]
  32. Ray WJ, Bain G, Yao M, Gottlieb DI 1997 CYP26, a novel mammalian cytochrome P450, is induced by retinoic acid and defines a new family. J Biol Chem 272:18702–18708[Abstract/Free Full Text]
  33. Van der Leede B, van den Brink C, Pijnappel W, Sonneveld E, van der Saag P, van der Burg B 1997 Autoinduction of retinoic acid metabolism to polar derivatives with decreased biological activity in retinoic acid-sensitive, but not in retinoic acid resistant human breast cancer cells. J Biol Chem 272:17921–17928[Abstract/Free Full Text]
  34. Sonneveld E, van den Brink C, van der Leede B, Schulkes R, Petkovich M, van der Burg B, van der Saag P 1998 Human retinoic acid (RA) 4-hydroxylase (CYP26) is highly specific for all-trans-RA and can be induced through RA receptors in human breast and colon carcinoma cells. Cell Growth Differ 9:629–637[Abstract]
  35. Fujii H, Sato T, Kaneko S, Gotoh O, Fujii-Kuriyama Y, Osawa K, Kato S, Hamada H 1997 Metabolic inactivation of retinoic acid by a novel P450 differentially expressed in developing mouse embryos. EMBO J 16:4163–4173[CrossRef][Medline]
  36. Iulianella A, Beckett B, Petkovich M, Lohnes D 1999 A molecular basis for retinoic acid-induced axial truncation. Dev Biol 205:33–48[CrossRef][Medline]
  37. De Roos K, Sonneveld E, Compaan B, Ten Berge D, Durston AJ, Van der Saag PT 1999 Expression of retinoic acid 4-hydroxylase (CYP26) during mouse and Xenopus laevis embryogenesis. Mech Dev 82:205–211[CrossRef][Medline]
  38. McCaffery P, Wagner E, O’Neil J, Petkovich M, Drager UC 1999 Dorsal and ventral retinal territories defined by retinoic acid synthesis, breakdown and nuclear receptor expression. Mech Dev 82: 119–130
  39. Kennett S, Udvadia A, Horowitz J 1997 Sp3 encodes multiple proteins that differ in their capacity to stimulate or repress transcription. Nucleic Acids Res 25:3110–3117[Abstract/Free Full Text]
  40. De Luca P, Majello B, Lania L 1996 Sp3 represses transcription when tethered to promote DNA or targeted to promoter proximal RNA. J Biol Chem 271:8533–8536[Abstract/Free Full Text]
  41. Majello B, De Luca P, Lania L 1997 Sp3 is a bifunctional transcription regulator with modular independent activation and repression domains. J Biol Chem 272:4021–4026[Abstract/Free Full Text]
  42. Beckett B 1999 Evolutionary conservation in retinoid signalling and metabolism. Am Zool 39:783–796
  43. Leggett R, Armstrong S, Barry D, Mueller CR 1995 Sp1 is phosphorylated and its DNA binding activity downregulated upon terminal differentiation of the liver. J Biol Chem 270:25879–25884[Abstract/Free Full Text]
  44. Kwon H, Kim M, Edenberg H, Hur M 1999 Sp3 and Sp4 can repress transcription by competing with Sp1 for the core cis-elements on the human ADH5/FDH minimal promoter. J Biol Chem 274:20–28[Abstract/Free Full Text]
  45. Gehring W, Qian Y, Billeter M, Furukubo-Tokunaga K, Schier A, Resendez-Perez D, Affolter M, Otting G, Wuthrich K 1994 Homeodomain-DNA recognition. Cell 78:211–223[CrossRef][Medline]
  46. Gehring W, Affolter M, Burglin T 1994 Homeodomain proteins. Annu Rev Biochem 63:487–526[CrossRef][Medline]
  47. Krumlauf R 1994 Hox genes in vertebrate development. Cell 78:191–201[CrossRef][Medline]
  48. McCaffery P, Drager UC 1995 Retinoic acid synthesizing enzymes in the embryonic and adult vertebrate. Adv Exp Med Biol 372:173–183[Medline]
  49. Sanchez HB, Yieh L, Osborne TF 1995 Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem 270:1161–1169[Abstract/Free Full Text]
  50. Porter W, Saville B, Hoivik D, Safe S 1997 Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol 11:1569–1580[Abstract/Free Full Text]
  51. Jin P, Sun Y, Grabovski GA 1998 Role of Sp proteins and ROR{alpha} in transcription regulation of murine prosaposin. J Biol Chem 273:13208–13216[Abstract/Free Full Text]
  52. Lehman J, Zhang X-K, Pfhal M 1992 RARg2 is regulated through a retinoic acid response element embedded in Sp1 sites. Mol Cell Biol 12:2976–2985[Abstract/Free Full Text]
  53. Hagen G, Müller S, Beato M, Suske G 1994 Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J 13:3843–3851[Medline]
  54. Birnbaum M, van Wijnen A, Odgren P, Last T, Suske G, Stein G, Stein J 1995 Sp1trans-activation of cell cycle regulated promoters is selectively repressed by Sp3. Biochemistry 34:16503–16508[CrossRef][Medline]
  55. Shou Y, Baron S, Poncz M 1998 An Sp1-binding silencer is a critical negative regulator of the megakaryocyte-specific aIIb gene. J Biol Chem 273:5716–5726[Abstract/Free Full Text]
  56. Rossant J, Zirngibl R, Cado D, Shago M, Giguere V 1991 Expression of a retinoic acid response element-hsplacz transgene defines specific domains of transcriptional activity during mouse embryogenesis. Genes Dev 5:1333–1344
  57. Marin M, Karis A, Visser P, Grosveld F, Philipsen S 1997 Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89:619–628[CrossRef][Medline]
  58. Lichtsteiner S, Wuarin J, Schibler U 1987 The interplay of DNA-binding proteins on the promoter of the mouse albumin gene. Cell 51:963–973[CrossRef][Medline]
  59. Bortell R, Owen TA, Shalhoub V, Heinrichs A, Aronow MA, Rochette-Egly C, Lutz Y, Stein JL, Lian JB, Stein GS 1993 Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements. Proc Natl Acad Sci USA 90:2300–2304[Abstract/Free Full Text]
  60. Sierra F, Tamone F, Mueller CR, Schibler U 1990 Differential in vitro transcription from the promoter of a rat {alpha} 2u globulin gene in liver and spleen nuclear extracts. Mol Biol Med 7:131–46[Medline]
  61. Sierra F 1990 A laboratory guide to in vitro transcription. BioMethods 2:1–148
  62. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed 2



This article has been cited by other articles:


Home page
Brief Funct Genomic ProteomicHome page
X. Ye and R. Lotan
Potential misinterpretation of data on differential gene expression in normal and malignant cells in vitro
Brief Funct Genomic Proteomic, July 1, 2008; 7(4): 322 - 326.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. F. Gillespie and L. J. Gudas
Retinoic Acid Receptor Isotype Specificity in F9 Teratocarcinoma Stem Cells Results from the Differential Recruitment of Coregulators to Retinoic Acid Response Elements
J. Biol. Chem., November 16, 2007; 282(46): 33421 - 33434.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Ocaya, A. C. Gidlof, P. S. Olofsson, H. Torma, and A. Sirsjo
CYP26 Inhibitor R115866 Increases Retinoid Signaling in Intimal Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., July 1, 2007; 27(7): 1542 - 1548.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Quere, A. Baudet, B. Cassinat, G. Bertrand, J. Marti, L. Manchon, D. Piquemal, C. Chomienne, and T. Commes
Pharmacogenomic analysis of acute promyelocytic leukemia cells highlights CYP26 cytochrome metabolism in differential all-trans retinoic acid sensitivity
Blood, May 15, 2007; 109(10): 4450 - 4460.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. Zolfaghari, C. J. Cifelli, S. O. Lieu, Q. Chen, N.-q. Li, and A. C. Ross
Lipopolysaccharide opposes the induction of CYP26A1 and CYP26B1 gene expression by retinoic acid in the rat liver in vivo
Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1029 - G1036.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. E. Hernandez, A. P. Putzke, J. P. Myers, L. Margaretha, and C. B. Moens
Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development
Development, January 1, 2007; 134(1): 177 - 187.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
P. Germain, P. Chambon, G. Eichele, R. M. Evans, M. A. Lazar, M. Leid, A. R. De Lera, R. Lotan, D. J. Mangelsdorf, and H. Gronemeyer
International Union of Pharmacology. LX. Retinoic Acid Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 712 - 725.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Roberts, S. Ivins, A. C. Cook, A. Baldini, and P. J. Scambler
Cyp26 genes a1, b1 and c1 are down-regulated in Tbx1 null mice and inhibition of Cyp26 enzyme function produces a phenocopy of DiGeorge Syndrome in the chick
Hum. Mol. Genet., December 1, 2006; 15(23): 3394 - 3410.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Nagano, S. Takehara, M. Takahashi, S. Aizawa, and A. Yamamoto
Shisa2 promotes the maturation of somitic precursors and transition to the segmental fate in Xenopus embryos
Development, December 1, 2006; 133(23): 4643 - 4654.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. N. Shelton, I. T. Sandoval, A. Eisinger, S. Chidester, A. Ratnayake, C. M. Ireland, and D. A. Jones
Up-regulation of CYP26A1 in Adenomatous Polyposis Coli-Deficient Vertebrates via a WNT-Dependent Mechanism: Implications for Intestinal Cell Differentiation and Colon Tumor Development.
Cancer Res., August 1, 2006; 66(15): 7571 - 7577.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. M. Hoffman, K. Garcha, K. Karamboulas, M. F. Cowan, L. M. Drysdale, W. A. Horton, and T. M. Underhill
BMP action in skeletogenesis involves attenuation of retinoid signaling
J. Cell Biol., July 3, 2006; 174(1): 101 - 113.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. R. Chichili, D. Nohr, M. Schaffer, J. von Lintig, and H. K. Biesalski
{beta}-Carotene Conversion into Vitamin A in Human Retinal Pigment Epithelial Cells
Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3562 - 3569.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. S. Williams, J. P. Mear, H.-C. Liang, S. S. Potter, B. J. Aronow, and M. C. Colbert
Large-scale reprogramming of cranial neural crest gene expression by retinoic acid exposure
Physiol Genomics, October 4, 2004; 19(2): 184 - 197.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. G. Villani, V. Appierto, E. Cavadini, M. Valsecchi, S. Sonnino, R. W. Curley, and F. Formelli
Identification of the Fenretinide Metabolite 4-Oxo-Fenretinide Present in Human Plasma and Formed in Human Ovarian Carcinoma Cells through Induction of Cytochrome P450 26A1
Clin. Cancer Res., September 15, 2004; 10(18): 6265 - 6275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Andreola, G. P. Hayhurst, G. Luo, S. S. Ferguson, F. J. Gonzalez, J. A. Goldstein, and L. M. De Luca
Mouse Liver CYP2C39 Is a Novel Retinoic Acid 4-Hydroxylase: ITS DOWN-REGULATION OFFERS A MOLECULAR BASIS FOR LIVER RETINOID ACCUMULATION AND FIBROSIS IN ARYL HYDROCARBON RECEPTOR-NULL MICE
J. Biol. Chem., January 30, 2004; 279(5): 3434 - 3438.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Taimi, C. Helvig, J. Wisniewski, H. Ramshaw, J. White, M.'a. Amad, B. Korczak, and M. Petkovich
A Novel Human Cytochrome P450, CYP26C1, Involved in Metabolism of 9-cis and All-trans Isomers of Retinoic Acid
J. Biol. Chem., January 2, 2004; 279(1): 77 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. C. Ross and R. Zolfaghari
Regulation of Hepatic Retinol Metabolism: Perspectives from Studies on Vitamin A Status
J. Nutr., January 1, 2004; 134(1): 269S - 275.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Costet, F. Lalanne, M. C. Gerbod-Giannone, J. R. Molina, X. Fu, E. G. Lund, L. J. Gudas, and A. R. Tall
Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages
Mol. Cell. Biol., November 1, 2003; 23(21): 7756 - 7766.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Kudoh, S. W. Wilson, and I. B. Dawid
Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm
Development, March 11, 2003; 129(18): 4335 - 4346.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. B. Goodman and A. B. Pardee
Evidence for defective retinoid transport and function in late onset Alzheimer's disease
PNAS, March 4, 2003; 100(5): 2901 - 2905.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
J. M. Spitsbergen and M. L. Kent
The State of the Art of the Zebrafish Model for Toxicology and Toxicologic Pathology Research--Advantages and Current Limitations
Toxicol Pathol, January 1, 2003; 31(1_suppl): 62 - 87.
[Abstract] [PDF]


Home page
J. Nutr.Home page
A. C. Ross
Retinoid Production and Catabolism: Role of Diet in Regulating Retinol Esterification and Retinoic Acid Oxidation
J. Nutr., January 1, 2003; 133(1): 291S - 296.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. V. Chithalen, L. Luu, M. Petkovich, and G. Jones
HPLC-MS/MS analysis of the products generated from all-trans-retinoic acid using recombinant human CYP26A
J. Lipid Res., July 1, 2002; 43(7): 1133 - 1142.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Klaassen, R. H. Brakenhoff, S. J. Smeets, G. B. Snow, and B. J. M. Braakhuis
Enhanced Turnover of all-trans-Retinoic Acid and Increased Formation of Polar Metabolites in Head and Neck Squamous Cell Carcinoma Lines Compared with Normal Oral Keratinocytes
Clin. Cancer Res., April 1, 2001; 7(4): 1017 - 1025.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Loudig, O.
Right arrow Articles by Petkovich, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Loudig, O.
Right arrow Articles by Petkovich, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals