| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Agonists Is Maintained in Cells Expressing a PPAR
Dominant-Negative Mutant: Evidence for Selectivity in the Downstream Responses to PPAR
Activation
Departments of Clinical Biochemistry and Medicine, University of Cambridge, Addenbrookes Hospital, Cambridge, United Kingdom, CB2 2QR
Address all correspondence and requests for reprints to: Stephen ORahilly, Department of Medicine, University of Cambridge, Addenbrookes Hospital, Cambridge, United Kingdom, CB2 2QR. E-mail: sorahill{at}hgmp.mrc.ac.uk
| ABSTRACT |
|---|
|
|
|---|
enhance
glucose disposal in a variety of insulin-resistant states in humans and
animals. The precise mechanisms whereby activation of PPAR
leads to
increased glucose uptake in metabolically active cells remain to be
determined. Notably, certain novel, synthetic PPAR
ligands appear to
antagonize thiazolidinedione-induced adipogenesis yet stimulate
cellular glucose uptake. We have explored the molecular mechanisms
underlying the enhancement of glucose uptake produced by PPAR
agonists in 3T3-L1 adipocytes. Rosiglitazone treatment for 48 h
significantly increased basal and insulin-stimulated glucose uptake and
markedly increased the cellular expression of GLUT1 but not GLUT4.
Rosiglitazone increased plasma membrane levels of GLUT1, but not GLUT4,
both basally and after insulin stimulation. Surprisingly,
adenoviral expression of a dominant-negative mutant PPAR
, which was
demonstrated to strongly inhibit adipogenesis, completely failed to
inhibit rosiglitazone-stimulated glucose uptake. Similar findings were
obtained with the non-thiazolidinedione PPAR
agonists, GW1929 and
GW7845. The insensitivity of PPAR
agonist-stimulated glucose uptake
to expression of a dominant-negative mutant, compared with the
latters marked inhibitory effects on preadipocyte differentiation,
suggests that, as is the case for other nuclear receptors, the precise
molecular mechanisms linking PPAR
activation to downstream events
may differ depending on the nature of the biological response. The
growing evidence that the effects of PPAR
on adipogenesis and
glucose uptake can be dissociated may have important implications for
the development of improved antidiabetic drug treatments. | INTRODUCTION |
|---|
|
|
|---|
was the molecular
target for their antidiabetic activity. The TZDs were shown to function
as selective PPAR
ligands (2, 3) whose rank order of
potency in activating PPAR
in vitro correlated closely
with their glucose lowering activity in rodents (4, 5).
More recently, further evidence has emerged to strengthen the link
between PPAR
and systemic insulin action. First, loss of function
mutations in human PPAR
(hPPAR
) have been identified which result
in extreme insulin resistance and type 2 diabetes (6).
Second, a series of non-TZD, tyrosine-derived PPAR
agonists,
optimized for potency on hPPAR
, have been described, the in
vitro activity of which closely matches their ability to reduce
glucose levels in rodent models of type 2 diabetes (7, 8).
In addition to its role in the control of insulin sensitivity,
PPAR
has also been shown to play a crucial role in adipocyte
differentiation. Retroviral expression of PPAR
in fibroblasts in the
presence of weak PPAR
activators resulted in their efficient
differentiation to adipocytes, as measured by lipid accumulation,
changes in cell morphology, and the expression of an adipocyte-specific
pattern of genes (9). Adipogenesis has since been shown to
involve a complex interplay between PPAR
and other families of
transcription factors, notably the CAAT/enhancer binding proteins
(C/EBPs) and adipocyte determination and differentiation factor 1
(ADD1)/sterol regulatory element-binding protein 1 (SREBP1)
(10). Furthermore, recent gene knockout studies
demonstrated conclusively that PPAR
is essential for adipocyte
differentiation in vivo (11, 12).
It is unclear how activation of a transcription factor that is
predominantly expressed in adipose tissue can improve insulin
sensitization and glucose utilization in muscle, the primary site of
glucose disposal. One explanation for this apparent paradox is that
PPAR
agonists may regulate the storage or secretion of
adipocyte-derived signaling factors that influence glucose metabolism
in muscle. Candidate molecules include FFA, TNF
, and leptin
(13). Alternatively, despite low levels of PPAR
expression in muscle, agonists may directly induce expression of genes
involved in glucose homeostasis in this tissue. Several studies have
demonstrated an enhancement of glucose uptake and glucose transporter
expression in adipocytes treated with TZDs, and there is evidence to
suggest that a similar effect may occur in muscle
(14).
Mukherjee et al. recently reported a novel PPAR
-specific
ligand that blocks TZD-induced adipogenesis but stimulates
insulin-mediated glucose uptake in 3T3-L1 adipocytes (15).
This finding raises the possibility that, as with other nuclear
receptors, the biological response to receptor occupation may depend on
the precise nature of the ligand involved (16, 17). Herein
we report further evidence for the dissociation of downstream
biological responses to PPAR
activation, on this occasion from the
use of genetic, rather than solely pharmacological, tools.
| RESULTS |
|---|
|
|
|---|
|
|
Mutant
1 mutant has previously been described in which
the highly conserved hydrophobic and charged residues, Leu
(468) and Glu (471), in helix 12 of the
ligand-binding domain were mutated to alanine (19). This
mutant receptor retains ligand and DNA binding, but exhibits reduced
transactivation due to impaired coactivator recruitment. In addition,
it silences basal transcription, recruits corepressors more avidly than
wild-type PPAR
, and exhibits delayed ligand-dependent corepressor
release. The L468A/E471A hPPAR
1 mutant is also a potent
dominant-negative inhibitor of wild-type PPAR
action, markedly
inhibiting the effects of TZDs on human preadipocyte differentiation
and aP2 expression (19). We first established that
Ad
m [an adenovirus expressing the PPAR
1
mutant receptor and green fluorescent protein (GFP)] could infect the
3T3-L1 cell line, resulting in a similar marked inhibition of
differentiation induced by the standard differentiation cocktail (Fig. 3A
m infection of the 3T3-L1 cell line resulted
in a marked increase in levels of PPAR
1 expression (Fig. 3B
(data not shown). Expression of the dominant-negative PPAR
in 3T3-L1
preadipocytes significantly inhibited the induction of the
differentiation marker, aP2, by rosiglitazone (P <
0.05 compared with both Ad-GFP and nil virus controls) (Fig. 3C
m significantly inhibited
adipocyte differentiation in response to the conventional
differentiation cocktail (P < 0.05 compared with both
Ad-GFP and nil virus controls) (Fig. 3D
mutant receptor can block
endogenous PPAR
activity in a murine preadipocyte cell line.
|
on the Potentiation of Glucose
Uptake by Rosiglitazone
m. Infectivity was assessed
48 h later by fluorescence microscopy and Western blotting with
anti-PPAR
antibody (Fig. 4A
m-infected cells exhibited an
increased PPAR
1 protein expression compared with Ad-GFP-infected and
uninfected cells. Again, adenoviral infection had no effect on
endogenous levels of PPAR
. To assess the effect of the
Ad
m on the potentiation of glucose uptake by
rosiglitazone, cells were infected overnight and the 48 h
incubation with rosiglitazone was subsequently commenced. Rosiglitazone
was observed to enhance basal glucose uptake in the Ad-GFP-infected
cells and there was also a trend for it to increase insulin-stimulated
glucose uptake. Contrary to expectations, Ad
m
did not inhibit this rosiglitazone-mediated potentiation of either
basal or insulin-stimulated glucose uptake (Fig. 4B
m to reduce basal
and insulin-stimulated glucose uptake in the absence of rosiglitazone,
while maintaining a similar fold insulin stimulation over basal, and to
reduce insulin-stimulated glucose uptake in the presence of
rosiglitazone. Nevertheless, Ad
m-infected
cells treated with rosiglitazone still exhibited an enhanced basal and
insulin-stimulated glucose uptake compared with untreated cells.
|
Agonists on Glucose Uptake
ligands has
recently been developed (7). Two such ligands, optimized
for potency on human (h) PPAR
, are GW1929 and GW7845 (8, 20). GW1929 has been shown to be 2 orders of magnitude more
potent than the TZD, troglitazone, in both in
vitro and in vivo assays (8). It both
lowered plasma glucose levels in Zucker diabetic fatty rats and
transactivated hPPAR
and mouse PPAR
in reporter gene assays more
potently than troglitazone. Similarly, GW7845 was shown to
be significantly more potent than either rosiglitazone or
troglitazone when assayed for induction of adipogenesis in
the 3T3-L1 cell line (20). 3T3-L1 adipocytes were
supplemented for 48 h with 10-7
M rosiglitazone, GW1929, or GW7845 and glucose
uptake was measured (Fig. 5
agonists act to
increase glucose uptake to a similar extent to the TZD rosiglitazone,
we investigated the effect of the dominant-negative PPAR
mutant in
this system. As before, adipocytes were infected with Ad-GFP or
Ad
m overnight and subsequently supplemented
with the GW compounds for 48 h. As with rosiglitazone, the
tendency of the GW compounds to increase basal and insulin-stimulated
glucose uptake was similar in Ad-GFP and
Ad
m-infected cells (Fig. 6
m on ligand-stimulated glucose uptake, the
mutant PPAR
inhibited the effects of these ligands on GLUT1
expression (Fig. 7
|
|
|
| DISCUSSION |
|---|
|
|
|---|
activation on adipogenesis and glucose
uptake can be dissociated (15), we now present evidence
that a dominant-negative PPAR
mutant has inhibitory effects on
ligand-stimulated adipogenesis while having no effects on
ligand-stimulated glucose uptake. Thus, a body of data is accumulating
to suggest that, as is well established with other well studied nuclear
receptors (17, 16), selective modulation of the downstream
biological responses to PPAR
activation may be possible. Several in vivo studies have demonstrated an increase in adipose tissue glucose transport activity and GLUT4 expression after treatment with TZDs (14). Studies in the 3T3-L1 and 3T3-F442A cell lines have similarly reported TZD-induced increases in glucose transport, although effects on glucose transporters appear to be dependent on the differentiation state (21, 22, 23, 24, 25, 26). Hence, increases in both GLUT1 and GLUT4 expression have been reported in cells supplemented with TZDs during the differentiation process (21, 22, 23), whereas only GLUT1 expression has been shown to be increased in fully differentiated cells (26). In our study, differentiated cells were used to eliminate confounding effects of rosiglitazone on the adipogenic process itself. In agreement with previous TZD studies (24, 25, 26), we demonstrated an increase in basal glucose uptake and cellular GLUT1 expression, with no effect on GLUT4 expression, following rosiglitazone treatment of 3T3-L1 adipocytes. In addition to the effects of rosiglitazone on the total cellular expression of GLUT1, we show, for the first time, that this agent increases plasma membrane levels of GLUT1 in both the basal and insulin-stimulated state while having no effects on GLUT4 cellular localization. The marked effects of rosiglitazone on glucose uptake, GLUT1 expression, and GLUT1 translocation occurring in the absence of insulin suggests that the frequently used term "insulin sensitizer" may not fully reflect the molecular mechanisms underlying the effects of this compound on glucose disposal.
The in vivo importance of PPAR
in the regulation of
glucose disposal and insulin sensitivity in the whole organism is
becoming increasingly apparent. In addition to the large body of
evidence derived from the efficacy of TZD and non-TZD PPAR
agonists
in insulin-resistant and diabetic states in rodents, primates, and
humans (1, 7, 8), genetic studies have recently provided
compelling evidence for a direct link between PPAR
and systemic
insulin action. Thus, two independent naturally occurring
dominant-negative mutations in hPPAR
have been reported in subjects
with severe insulin resistance and type 2 diabetes (6).
PPAR
gene knockout studies in mice, however, were unable to
substantiate this result due to embryonic lethality (11, 12). Surprisingly, mice heterozygous for PPAR
deficiency
exhibited an improved insulin sensitivity and were protected from
high-fat diet-induced insulin resistance (27, 28).
While direct effects of TZDs on glucose uptake have been demonstrated
in cell lines, it is still unclear whether their in vivo
effects on glucose disposal can be attributed to direct or indirect
mechanisms. Thus, TZDs have effects on suppression of the
adipocyte-derived signaling molecules, TNF
and leptin, and on FFA
partitioning between adipose and muscle tissues (29, 30),
all of which may secondarily improve whole organism insulin
sensitivity.
To investigate whether the potentiating effects of rosiglitazone on
glucose uptake in 3T3-L1 adipocytes were mediated via PPAR
, the
experiment was repeated in cells expressing a dominant-negative
hPPAR
mutant receptor. This mutant form of hPPAR
has
previously been shown to powerfully inhibit cotransfected wild-type
receptor action and to inhibit the TZD-induced differentiation of human
preadipocytes (19). We demonstrated that the
transduced hPPAR
mutant receptor was highly expressed in murine
3T3-L1 preadipocytes and adipocytes and that it inhibited 3T3-L1
differentiation induced by both the standard differentiation cocktail
and rosiglitazone. However, there was no discernible effect on
rosiglitazone-induced enhancement of glucose uptake, either basal or
insulin-stimulated, in cells transduced with the mutant receptor. There
have been previous suggestions that TZDs, particularly
troglitazone (31), may have
PPAR
-independent metabolic effects. However, the observation that
the potentiating effects of two structurally distinct, non-TZD PPAR
agonists on glucose uptake were also completely unaffected by the
mutant receptor, would imply that a PPAR
-independent effect on
glucose uptake by all three compounds is unlikely. The ability of
Ad
m to block the PPAR
agonist-induced
increases in total cellular levels of GLUT1 implies that the
potentiation of glucose uptake is mediated via a mechanism independent
of the increase in total cellular GLUT1 protein. Such mechanisms might
include increasing the translocation of GLUT1 to the plasma membrane,
as described above, and/or an increase in the intrinsic activity of the
glucose transporters.
There are several potential explanations to account for the
insensitivity of the PPAR
agonist-induced potentiation of glucose
uptake to the presence of the mutant receptor. A failure to express the
mutant adequately is possible, but we demonstrated that the adenoviral
expression system consistently led to more than 70% infectivity in
preadipocytes and adipocytes, while Western blotting indicated a more
than 30-fold increase of PPAR
expression in the transduced cells.
Another possibility is that PPAR
ligands may exert their effects on
glucose uptake via a nongenomic mechanism, something that has been
established to occur with ligands for other nuclear hormone receptors
(32). However, our time course studies indicated that
rosiglitazone had its maximal effects after 48 h of exposure, a
finding much more consistent with a transcriptional mechanism than with
the expected rapid nature of the nongenomic responses to steroids and
other lipophilic ligands (32). While we did not undertake
formal tests of the dependence of the enhancement of glucose uptake on
new protein synthesis, Kreutter et al. (25)
reported previously that the enhancement of basal glucose uptake by CP
68722 (racemic englitazone) in 3T3-L1 adipocytes can be inhibited by
cycloheximide.
Perhaps the most compelling model to explain our data relates to the
fact that the occupancy of nuclear receptors by ligands may lead to the
activation of selective sets of downstream biological responses that
depend on the precise nature of the activating ligand. Thus, tamoxifen
and raloxifene, both highaffinity agonists for the ER, mimic the
natural ligand in preventing postmenopausal osteoporosis but inhibit
the estrogen-dependent proliferation of breast carcinomas
(17). The possibility that such selective receptor
modulation might occur with PPAR
was recently reported by Mukherjee
et al. (15). A synthetic high-affinity PPAR
agonist, LG100641, was shown to block both TZD-induced differentiation
and target gene activation and repression in 3T3-L1 cells, yet it also
enhanced basal and insulin-stimulated glucose uptake in fully mature
cells.
Selective receptor modulation is thought to relate to the fact that the
pattern of receptor interaction with the complex of coactivator and
corepressor proteins is dependent on the precise conformation of the
particular ligand-receptor complex (16). Compared with
other nuclear receptors, PPAR
has a particularly large
ligand-binding pocket, and there is already strong evidence that
different ligands make distinct structural contacts with receptor
(33, 34). Thus the a priori possibility of
selective receptor modulation is particularly strong for PPAR
. The
growing evidence for the dissociability of biological responses
downstream from nuclear hormone receptors has come largely from
pharmacological rather than genetic studies. Our studies suggest that a
mutant form of PPAR
, which acts as powerful dominant-negative
repressor of adipogenesis, may have no effect on the stimulation of
glucose uptake, providing further support for the idea that the
repertoire of coactivators and corepressors involved in the promotion
of adipogenesis and glucose uptake may be distinct. The existing
structural model of PPAR
would predict that mutating both L468 and
E471 would grossly interfere with the interaction of the AF2 helix with
both ligand and coactivator (19, 35). This suggests that
other areas of the PPAR
molecule, e.g. the N-terminal
activation domain, may be more intimately involved with transcriptional
responses relevant to glucose uptake. Indeed, the coactivators PGC1 and
PGC2 are not thought to require the AF2 helix for binding to PPAR
(36, 37).
In summary, we have demonstrated that PPAR
agonists potentiate basal
and insulin-stimulated glucose uptake in 3T3-L1 adipocytes and increase
total cellular and plasma membrane expression of GLUT1. The
potentiation of glucose uptake is maintained in cells expressing a
PPAR
mutant that inhibits adipogenesis, thus providing further
evidence for selectivity in the downstream responses to PPAR
activation. If such selective modulation of receptor function could be
achieved with PPAR
, drugs might be developed that could improve
insulin sensitivity without promoting fat accumulation. In this regard,
a PPAR
agonist, GW0072, which lowers plasma insulin and
triglycerides in insulin-resistant Zucker rats without causing weight
gain, has recently been described (T. M. Willson, personal
communication).
| MATERIALS AND METHODS |
|---|
|
|
|---|
was a gift
from Dr. M. Lazar (University of Pennsylvania School of Medicine,
Philadelphia, PA). The RNeasy total RNA kit was from
QIAGEN (Valencia, CA). Reverse transcription reagents
were obtained from Promega Corp. (Madison, WI) and TaqMan
reagents were from PE Applied Biosystems (Foster City,
CA). All other reagents were from Sigma (St. Louis,
MO).
Tissue Culture
3T3-L1 fibroblasts (ATCC, Manassas, VA) were
maintained at no higher than 70% confluence in DMEM containing 10%
newborn calf serum (NBCS), 25 mM glucose, 2 mM
glutamine, and antibiotics (DMEM/NBCS). For differentiation they were
grown 2 d post confluence in DMEM/NBCS and then for 2 d in
medium containing FBS (DMEM/FBS) supplemented with 0.83
µM insulin, 0.25 µM dexamethasone, and 0.5
mM isobutylmethylxanthine. The medium was then changed to
DMEM/FBS supplemented only with 0.83 µM insulin for
2 d and then to DMEM/FBS alone for an additional 35 d.
Differentiated cells were only used when at least 95% of the cells
showed an adipocyte phenotype by accumulation of lipid droplets.
PPAR
Agonist Solutions
Solutions (10-4 M) of
rosiglitazone, GW1929, and GW7845 were prepared in dimethylsulfoxide.
These were diluted 1:1,000 into serum-free DMEM for studies requiring
an incubation time
6 h, or into DMEM/FBS for studies with an
incubation time
6 h, to give a final concentration of
10-7 M.
Glucose Uptake
Adipocytes (at day 79 after initiation of differentiation) in
6 (or 24)-well plates were incubated in medium containing
10-7 M PPAR
agonist for the
specified length of time. In the time course experiment, rosiglitazone
incubations were terminated simultaneously on day 9. Cells that had
been supplemented for 24 h and 48 h were serum starved in
DMEM for 2 h before the assay. Glucose uptake assays were
performed as described previously (18).
Western Blotting
Treated cells (adipocytes/preadipocytes) were solubilized by
scraping and passing 10 times through a 25G needle in lysis buffer as
described previously (18). The lysate was clarified by
centrifugation at 13,500 x g for 10 min at 4 C. Crude
cell extracts were resolved by SDS-PAGE before electroblotting to
polyvinylidene difluoride membranes (Millipore Corp.,
Bedford, MA). Membranes were blocked in 1% BSA, and specific proteins
were detected by incubation with appropriate primary and secondary
(horseradish peroxidase-conjugated) antibodies in 150
mM NaCl, 50 mM Tris, 0.1%
Tween 20. Proteins were then visualized using an enhanced
chemiluminescence kit.
Plasma Membrane Lawn Assay
3T3-L1 adipocytes (day 7), grown on collagen-coated glass
coverslips, were treated for 48 h with 10-7
M rosiglitazone in DMEM/FBS. Cells were serum
starved for 2 h and incubated with and without 10 nM
insulin for 30 min, and a modified version of the plasma membrane lawn
assay (18) was performed. Cells were washed twice in
ice-cold buffer A (50 mM HEPES, 10 mM NaCl, pH
7.2), twice in ice-cold buffer B (20 mM HEPES, 10
mM KCl, 2 mM CaCl2, 1
mM MgCl2, pH 7.2), and sonicated
using a probe sonicator (Kontes, Vineland, NJ) to generate a lawn of
plasma membrane fragments attached to the coverslip. The membranes were
washed twice again in ice-cold buffer B and fixed to the coverslips for
15 min using freshly prepared 3% paraformaldehyde. Membranes were then
serially washed: x3 PBS, x3 50 mM
NH4Cl in PBS over 10 min, x3 PBS, x3
PBS-gelatin (PBS containing 0.2% gelatin and 1 µl/ml goat serum)
over 5 min, and finally x3 PBS. Membranes were incubated in either
anti-GLUT4 or anti-GLUT1 antibody (1:100 dilution in PBS-gelatin) for
1 h at room temperature. After washing x3 PBS-gelatin and x3
PBS, the coverslips were incubated with the secondary antibody,
fluorescein isothiocyanate-conjugated donkey antirabbit IgG, for 1
h at room temperature, washed x3 PBS-gelatin and x3 PBS and mounted
on glass slides. Coverslips were viewed using a 60x objective lens on
a Optiphot-2/Biorad MRC-1000 microscope (Nikon, Melville,
NY) operated in laser scanning confocal mode. Samples were illuminated
at 488 nm, and images were collected at 510 nm. Duplicate coverslips
were prepared at each experimental condition, and eight random images
of plasma membrane lawn were collected from each. The images were
quantified using MRC-1000 confocal microscope operating software
[CoMOS, version 6.05.8 (Bio-Rad Laboratories, Inc.,
Hercules, CA)], on an AST premmia SE P/60 personal
computer.
Adenovirus Expression
Recombinant adenoviruses were generated as described previously
(19), expressing GFP (Ad-GFP) or GFP and full-length
L468A/E471A hPPAR
1 (Ad
m). 3T3-L1
preadipocyte (2 d post confluence) or day 7 adipocyte cultures in
24-well plates were infected with recombinant virus by addition of
1 x 109 plaque-forming units/well. Twelve
hours later medium containing free virus was removed, and appropriate
experimental medium was added. Comparable viral infection efficiency
was verified by microscopy using an axiovert 135 inverted fluorescence
microscope (Carl Zeiss, Thornwood, NY). Only cells with
more than 70% infectivity were used in experiments.
Oil Red O Staining
3T3-L1 adipocytes were fixed with 0.5% glutaraldehyde and
stained with Oil Red O for visualization of lipid droplets, according
to conventional methods (38). Differentiation efficiency
was assessed macroscopically and microscopically using a
Nikon Eclipse TE300 inverted microscope.
RNA Extraction/Quantitative RT-PCR
Virally infected preadipocytes/day 2 adipocytes were scraped and
total RNA was extracted using the RNeasy mini kit from
QIAGEN. Adipocyte P2 (aP2) gene expression was then
quantified using real time quantitative RT-PCR. Briefly, cDNA was
prepared from 100 ng of RNA using 200 U Moloney-murine leukaemia virus
reverse transcriptase (Promega Corp.). Real time
quantitative PCR was performed using an ABI-PRISM 7700 Sequence
Detection System instrument and software (PE Applied Biosystems, Inc., Foster City, CA) as described previously
(39). The primers and probes for aP2 were as follows:
Forward, CACCGCAGACGACAGGAAG; Reverse, GCACCTGCACCAGGG; Probe,
TGAAGAGCATCAAACCCTAGATGGCGG (all 5'-3'). Results were normalized to the
endogenous control, glyceraldehyde-3-phosphate dehydrogenase.
Statistical Analysis
Data are presented as mean ± SE. Statistical
significance of treatments was determined using the paired t
test (*, P < 0.05; **, P < 0.01; ***,
P < 0.001).
| FOOTNOTES |
|---|
C.N. was the recipient of a studentship from Diabetes UK. S.O.R., J.B.P., J.P.W., J.M.W., D.S., and V.K.K.C. are supported by the Wellcome Trust.
Abbreviations: Ad-GFP, An adenovirus expressing GFP alone;
Ad
m, adenovirus expressing the PPAR
1 mutant receptor
and GFP; aP2, adipocyte P2; GFP, green fluorescent protein; NBCS,
newborn calf serum; TZD, thiazolidinedione.
Received for publication January 8, 2001. Accepted for publication June 28, 2001.
| REFERENCES |
|---|
|
|
|---|
(PPAR
). J Biol Chem 270:1295312956
12,14-prostaglandin
J2 is a ligand for the adipocyte determination
factor PPAR
. Cell 83:803812[CrossRef][Medline]
agonism and the antihyperglycemic
activity of thiazolidinediones. J Med Chem 39:665668[CrossRef][Medline]
: binding and activation correlate with antidiabetic
actions in db/db mice. Endocrinology 137:41894195[Abstract]
associated with severe insulin
resistance, diabetes mellitus and hypertension. Nature 402:880883[Medline]
agonists. 1. Discovery of a
novel series of potent antihyperglycemic and antihyperlipidemic agents.
J Med Chem 41:50205036[CrossRef][Medline]
reverses the diabetic phenotype of the Zucker diabetic fatty rat.
Diabetes 48:14151424[Abstract]
2, a lipid-activated
transcription factor. Cell 79:11471156[CrossRef][Medline]
: an essential regulator of adipogenesis
and modulator of fat cell function. Cell 99:239242[CrossRef][Medline]
is required
for placental, cardiac, and adipose tissue development. Mol Cell 4:585595[CrossRef][Medline]
is required
for the differentiation of adipose tissue in vivo and
in vitro. Mol Cell 4:611617[CrossRef][Medline]
: adipogenic regulator and
thiazolidinedione receptor. Diabetes 47:507514[Abstract]
(PPAR
) modulator
blocks adipocyte differentiation but stimulates glucose uptake in
3T3L1 adipocytes. Mol Endocrinol 14:14251433
(PPAR
) mutant is a constitutive repressor and inhibits
PPAR
-mediated adipogenesis. J Biol Chem 275:57545759
(PPAR
), GW7845,
inhibits rat mammary carcinogenesis. Cancer Res 59:56715673
deficiency. J
Clin Invest 105:287292[Medline]
mediates
high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol
Cell 4:597609[CrossRef][Medline]
activators improve glucose homeostasis by stimulating fatty acid uptake
in the adipocytes. Atherosclerosis 137:S7580
/RXR
crystal structure reveals the molecular basis of
heterodimerization among nuclear receptors. Mol Cell 5:545555[CrossRef][Medline]
ligand inhibits adipocyte
differentiation. Proc Natl Acad Sci USA 96:61026106
. Nature 395:137143[CrossRef][Medline]
coactivator-1 through transcription factor docking. Science 286:13681371
. EMBO J 18:36763687[CrossRef][Medline]
This article has been cited by other articles:
![]() |
P. J. Oort, T. A. Knotts, M. Grino, N. Naour, J.-P. Bastard, K. Clement, N. Ninkina, V. L. Buchman, P. A. Permana, X. Luo, et al. {gamma}-Synuclein Is an Adipocyte-Neuron Gene Coordinately Expressed with Leptin and Increased in Human Obesity J. Nutr., May 1, 2008; 138(5): 841 - 848. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Horovitz-Fried, T. Brutman-Barazani, D. Kesten, and S. R. Sampson Insulin Increases Nuclear Protein Kinase C{delta} in L6 Skeletal Muscle Cells Endocrinology, April 1, 2008; 149(4): 1718 - 1727. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liao, M. T. A. Nguyen, T. Yoshizaki, S. Favelyukis, D. Patsouris, T. Imamura, I. M. Verma, and J. M. Olefsky Suppression of PPAR-{gamma} attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E219 - E227. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Aerts, R. Ottenhoff, A. S. Powlson, A. Grefhorst, M. van Eijk, P. F. Dubbelhuis, J. Aten, F. Kuipers, M. J. Serlie, T. Wennekes, et al. Pharmacological Inhibition of Glucosylceramide Synthase Enhances Insulin Sensitivity Diabetes, May 1, 2007; 56(5): 1341 - 1349. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Christodoulides, M. Laudes, W. P. Cawthorn, S. Schinner, M. Soos, S. O'Rahilly, J. K. Sethi, and A. Vidal-Puig The Wnt antagonist Dickkopf-1 and its receptors are coordinately regulated during early human adipogenesis J. Cell Sci., June 15, 2006; 119(12): 2613 - 2620. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lopez-Soriano, C. Chiellini, M. Maffei, P. A. Grimaldi, and J. M. Argiles Roles of Skeletal Muscle and Peroxisome Proliferator-Activated Receptors in the Development and Treatment of Obesity Endocr. Rev., May 1, 2006; 27(3): 318 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. M. Viljanen, K. A. Virtanen, M. J. Jarvisalo, K. Hallsten, R. Parkkola, T. Ronnemaa, F. Lonnqvist, P. Iozzo, E. Ferrannini, and P. Nuutila Rosiglitazone Treatment Increases Subcutaneous Adipose Tissue Glucose Uptake in Parallel with Perfusion in Patients with Type 2 Diabetes: A Double-Blind, Randomized Study with Metformin J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6523 - 6528. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Lin, T. Gurlo, L. Haataja, W. A. Hsueh, and P. C. Butler Activation of Peroxisome Proliferator-Activated Receptor-{gamma} by Rosiglitazone Protects Human Islet Cells against Human Islet Amyloid Polypeptide Toxicity by a Phosphatidylinositol 3'-Kinase-Dependent Pathway J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6678 - 6686. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gonzalez-Yanes, A. Serrano, F. J. Bermudez-Silva, M. Hernandez-Dominguez, M. A. Paez-Ochoa, F. R. de Fonseca, and V. Sanchez-Margalet Oleylethanolamide impairs glucose tolerance and inhibits insulin-stimulated glucose uptake in rat adipocytes through p38 and JNK MAPK pathways Am J Physiol Endocrinol Metab, November 1, 2005; 289(5): E923 - E929. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Jones, C. Barrick, K.-A. Kim, J. Lindner, B. Blondeau, Y. Fujimoto, M. Shiota, R. A. Kesterson, B. B. Kahn, and M. A. Magnuson Deletion of PPAR{gamma} in adipose tissues of mice protects against high fat diet-induced obesity and insulin resistance PNAS, April 26, 2005; 102(17): 6207 - 6212. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Knouff and J. Auwerx Peroxisome Proliferator-Activated Receptor-{gamma} Calls for Activation in Moderation: Lessons from Genetics and Pharmacology Endocr. Rev., December 1, 2004; 25(6): 899 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sutinen, K. Kannisto, E. Korsheninnikova, R. M. Fisher, E. Ehrenborg, T. Nyman, A. Virkamaki, T. Funahashi, Y. Matsuzawa, H. Vidal, et al. Effects of rosiglitazone on gene expression in subcutaneous adipose tissue in highly active antiretroviral therapy-associated lipodystrophy Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E941 - E949. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Laudes, C. Christodoulides, C. Sewter, J. J. Rochford, R. V. Considine, J. K. Sethi, A. Vidal-Puig, and S. O'Rahilly Role of the POZ Zinc Finger Transcription Factor FBI-1 in Human and Murine Adipogenesis J. Biol. Chem., March 19, 2004; 279(12): 11711 - 11718. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. S. Gardner, B. J. Dewar, H. S. Earp, J. M. Samet, and L. M. Graves Dependence of Peroxisome Proliferator-activated Receptor Ligand-induced Mitogen-activated Protein Kinase Signaling on Epidermal Growth Factor Receptor Transactivation J. Biol. Chem., November 21, 2003; 278(47): 46261 - 46269. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kalderon, N. Mayorek, L. Ben-Yaacov, and J. Bar-Tana Adipose tissue sensitization to insulin induced by troglitazone and MEDICA 16 in obese Zucker rats in vivo Am J Physiol Endocrinol Metab, April 1, 2003; 284(4): E795 - E803. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dello Russo, V. Gavrilyuk, G. Weinberg, A. Almeida, J. P. Bolanos, J. Palmer, D. Pelligrino, E. Galea, and D. L. Feinstein Peroxisome Proliferator-activated Receptor gamma Thiazolidinedione Agonists Increase Glucose Metabolism in Astrocytes J. Biol. Chem., February 14, 2003; 278(8): 5828 - 5836. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wilson-Fritch, A. Burkart, G. Bell, K. Mendelson, J. Leszyk, S. Nicoloro, M. Czech, and S. Corvera Mitochondrial Biogenesis and Remodeling during Adipogenesis and in Response to the Insulin Sensitizer Rosiglitazone Mol. Cell. Biol., February 1, 2003; 23(3): 1085 - 1094. [Abstract] [Full Text] |
||||
![]() |
K. A. Virtanen, K. Hallsten, R. Parkkola, T. Janatuinen, F. Lonnqvist, T. Viljanen, T. Ronnemaa, J. Knuuti, R. Huupponen, P. Lonnroth, et al. Differential Effects of Rosiglitazone and Metformin on Adipose Tissue Distribution and Glucose Uptake in Type 2 Diabetic Subjects Diabetes, February 1, 2003; 52(2): 283 - 290. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |