Molecular Endocrinology 15 (10): 1739-1747
Copyright © 2001 by The Endocrine Society
Targeted Disruption of the Pituitary Adenylate Cyclase-Activating Polypeptide Gene Results in Early Postnatal Death Associated with Dysfunction of Lipid and Carbohydrate Metabolism
Sarah L. Gray1,
Kevin J. Cummings1,
Frank R. Jirik2 and
Nancy M. Sherwood
Department of Biology (S.L.G., K.J.C., N.M.S.), University of
Victoria, Victoria, British Columbia, V8W 3N5 Canada; Centre for
Molecular Medicine and Therapeutics (F.R.J.), British Columbia Research
Institute for Childrens and Womens Health, and Department of
Medicine, University of British Columbia, Vancouver, British Columbia,
V5Z 4H4 Canada
Address all correspondence and requests for reprints to: N. M. Sherwood, Department of Biology, University of Victoria, Victoria, British Columbia, Canada V8W 3N5. E-mail: nsherwoo{at}uvic.ca
 |
ABSTRACT
|
|---|
Pituitary adenylate cyclase-activating polypeptide (PACAP) is a
hormone belonging to the glucagon superfamily of hormones. These
hormones are known to play important roles in metabolism and growth.
PACAP is a neuropeptide that causes accumulation of cAMP in a number of
tissues and affects the secretion of other hormones, vasodilation,
neural and immune functions, as well as the cell cycle. To determine
whether PACAP is essential for survival and to evaluate its
function(s), we have generated mice lacking the PACAP gene via
homologous recombination. We found that most PACAP null mice died in
the second postnatal week in a wasted state with microvesicular fat
accumulation in liver, skeletal muscle, and heart. Gas
chromatography-mass spectrometry showed that fatty acid ß-oxidation
in liver mitochondria of PACAP-/- mice was not blocked
based on the distribution of 3-hydroxy-fatty acids (C616) in the
plasma. Instead, increased metabolic flux through the ß-oxidation
pathway was suggested by the presence of ketosis. Also, serum
triglycerides and cholesterol were significantly higher (2- to 3-fold)
in PACAP null mice than littermates. In the fed state, both serum
insulin and blood glucose were normal in 5-d-old null mice compared
with their littermates. In contrast, fasted PACAP null pups had a
significant increase in insulin, but a decrease in blood glucose
compared with littermates. Glycogen in the liver was reduced. These
results suggest PACAP is a critical hormonal regulator of lipid and
carbohydrate metabolism.
 |
INTRODUCTION
|
|---|
PITUITARY ADENYLATE cyclase-activating
polypeptide (PACAP) is the most highly conserved member of the
glucagon superfamily (1), a group of hormones that are
located primarily in the brain and gut with an important role in growth
and metabolism. PACAP is found in two forms, PACAP-27 (2)
and PACAP-38 (3); the latter is a C-terminally extended
form of PACAP-27. Both forms are able to stimulate cAMP accumulation in
many tissues. PACAP has been reported to release a number of hormones
from different endocrine glands. In the pancreas, PACAP releases both
insulin (4, 5, 6, 7, 8, 9) and glucagon (10). In the
adrenal gland, PACAP releases catecholamines (4) and,
depending on the species, glucocorticoids (11, 12, 13). In the
pituitary gland, the release of several hormones is enhanced, which
makes PACAP distinct from most other neuropeptide-releasing factors at
physiological levels (14). In other functions PACAP has
been shown to be a vasodilator (1), to regulate the cell
cycle in tissue culture (15, 16), and to have
immunoregulatory properties (4, 17, 18). Brain development
is thought to be affected by PACAP, and early expression of the genes
for both PACAP and its specific receptor (PAC1-R) occurs at
embryonic day 9.5 in mice (19). However, it is not clear
whether the physiological effects of PACAP are a coordinated response
to one specific stimulus or to many different types of stimuli. Whether
all of the above effects are relevant in vivo remains to be
shown.
The single gene encoding PACAP in mice is a suitable candidate for
targeted deletion. In contrast, complete deletion of the receptors
would be more difficult because at least three genes encode the
receptors for PACAP, and two of the receptor types are shared with
another hormone. The three receptor types are a subset of the G-coupled
seven-transmembrane family (20). One receptor is a
PACAP-specific receptor (PAC1-R) with eight
isoforms. Alternative splicing in the N-terminal region results in one
isoform (21); splicing in the third intracellular loop
with insertion of different cassettes results in an additional five
isoforms (22), and changes in transmembrane regions 2 or 4
result in two more isoforms (23). The other two types of
receptors (VPAC1-R and
VPAC2-R) are shared between PACAP and VIP
(24). VIP, like PACAP, is also a member of the glucagon
superfamily, and the two peptides have some overlap of function. Thus,
to separate the functions of PACAP and VIP, it is important to disrupt
the single-copy PACAP gene. A recent study reported that deletion of
one PACAP receptor type (PACAP-specific) resulted in glucose
insensitivity (25).
The question that we address in this study is whether PACAP is
essential for survival and which functions can be ascribed only to
PACAP. In evolution, PACAPs importance is shown by its high degree of
conservation (26, 27, 28): across 600 million years of
evolution, PACAP-27 has remained 96% identical to human PACAP
(29). By use of gene targeting to generate mice lacking
the PACAP gene, we analyze the physiological role of PACAP in an
in vivo mammalian model. To determine the underlying
mechanism for the striking phenotype observed in PACAP null mice, we
have used 1) gas chromatography-mass spectrometry to examine fatty acid
ß-oxidation in liver mitochondria; 2) histology of a number of
tissues to examine morphology and intracellular lipid accumulation; 3)
electron microscopy to study liver mitochondria and lipid accumulation;
4) biochemical techniques to measure the serum levels of triglycerides,
FFA, cholesterol, ketone bodies, glucose, and liver glycogen; and 5)
RIAs to measure insulin and corticosterone.
 |
RESULTS AND DISCUSSION
|
|---|
Our interest in generating a mouse that is devoid of PACAP was to
determine whether PACAP is critical to development and/or function of
the neural, endocrine, and peripheral organ systems. Also, the
PACAP-/- mice are useful to tease
apart overlapping functions for PACAP and VIP, which are both
pleiotropic and share a network of target sites. This unusual situation
stems from the sharing of two receptors by PACAP and VIP
(24). In addition, PACAP uses a specific
seven-transmembrane receptor (22). The other
question is whether the responses initiated by PACAP are triggered by a
specific physiological event(s) as occurs for many hormones. For
example, high blood glucose is important for insulin release; high
blood calcium for calcitonin release; and excitement or stress for
adrenalin release.
Generation of PACAP-/- Mice
A targeted disruption of PACAP was generated through homologous
recombination in embryonic stem (ES) cells (Fig. 1
, A and B). The PACAP knockout mouse lines
were generated from two Cre recombinant clones, which were derived from
one homologously recombined ES cell clone. PCR for mRNA and Western
blot for protein were used to show that PACAP was not expressed in the
brain of the PACAP-/- mice (Fig. 1
, C and D). Genotyping of 270 offspring from heterozygous crosses showed
the expected mendelian ratio of 1:2:1 (21% wild type, 52%
heterozygotes, and 27% homozygotes), indicating that
PACAP-/- mice did not die in
utero. PACAP null mice appeared normal at birth with no obvious
signs of neuropathology or overt developmental abnormalities. In the
second postnatal week, most PACAP-/- mice died.
In the first group of homozygotes (n = 73) the pups died or were
used for the collection of serum samples after they became moribund. In
the second group of homozygotes (n = 86), 9% lived. A C57/Bl6
backcrossed line (eight backcrosses) of PACAP null mice has been
generated, and these PACAP null mice exhibit the same phenotype as the
original genetically mixed PACAP null mice. This evidence supports the
conclusion that the PACAP null mouse is free of nonlinked
mutations.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 1. Targeted Disruption of Mouse PACAP Gene
A, Organization of the mouse PACAP gene and the cre-loxP targeting
vector used for disruption. Coding exons are represented by
shaded rectangles, lox sites by
arrowheads, and the selection region containing neomycin
resistance and the thymidine kinase gene by open
rectangles. The primers used in PCR are depicted by
arrows. Cut sites (vertical lines) and
probes (diagonal lines in rectangles) used for Southern
blots are shown. B, Southern blot analysis of
PACAP+/+, PACAP+/-, and
PACAP-/- mouse genomic DNA cut with
NsiI and hybridized with probe 2. The 1.5-kb fragment
corresponds to the mutant allele. C, PACAP mRNA expression in brain and
liver tissue of PACAP+/+,
PACAP+/-, and PACAP-/-
mice. PACAP+/+ and
PACAP+/- mice express PACAP mRNA in brain tissue
but PACAP-/- mice do not, confirming that
PACAP-/- mice do not express PACAP mRNA. D,
Western blot analysis of protein isolated from the brain of
PACAP+/+, PACAP+/-, and
PACAP-/- mice using a rabbit anti-PACAP38 polyclonal
antiserum.
|
|
Two Distinct Modes of Death (Sudden or Wasting) in
PACAP-/- Mice
Homozygous mice were born the same size as heterozygous and
wild-type littermates, and the three genotypes remained matched in
weight for several days. Thereafter, a few of the
PACAP-/- pups died suddenly without losing
weight, whereas most died after several days in which they failed to
gain weight and finally lost weight (Fig. 2
, a and b). Although PACAP is a releaser
of GH (14), the rapid weight loss in the PACAP null mice
suggests that wasting rather than lack of GH is involved. Also, it is
known that GH deficiency does not obviously affect growth until 2 wk of
age in mice (30), although it would be difficult to assess
the role of GH in the PACAP null mice because of lethality. No
significant difference in weight or longevity was noted by 35 d of
age in the PACAP+/- or
PACAP+/+ mice (Fig. 2b
), which were weaned at
19 d. All pups continued to nurse and had milk in their stomachs
at or near the time of death.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2. Weight Differences Among Genotypes
a, Difference between PACAP+/+ and wasted
PACAP-/- littermates at postnatal day 10. b, Mean
weights of PACAP+/+ (n = 3), PACAP+/-
(n = 11), and PACAP-/- (n = 9) mice from two
litters.
|
|
Although most PACAP null mice died a slow wasting death, a few mice
demonstrated sudden death before wasting. Literature on PACAPs role
in the cardiovascular system suggests the PACAP null mice might present
with hypertension and decreased cardiac contractility due to a lack of
PACAP-mediated vasorelaxation (31) and cardiac positive
inotropic effect (32). Histological examination of Oil Red
O-stained heart muscle sections showed intracellular lipid accumulation
in the cardiac cells of PACAP null mice (Fig. 3a
). Lipid accumulation in cardiac cells
has been shown in animal models of diabetes and human diabetics and may
contribute to the cardiomyopathy associated with diabetes mellitus
(33, 34). In addition, null mice had elevated levels of
serum FFA compared with wild-type littermates (Fig. 4B
). These findings, along with the
observed sudden death, are suggestive of a cardiovascular event.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 3. Heart Tissue and Skeletal Muscle Stained with Oil
Red O
a, Microvesicular fat in the PACAP-/- heart cells. b,
Microvesicular fat in PACAP-/- skeletal muscle cells. Fat
was not observed in PACAP+/+ or PACAP+/- heart
or muscle cells.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. Measurement of Serum or Liver Components for
PACAP-/- Mice in Relation to Heterozygous and Wild-Type
Littermates
Error bars represent SEM; * indicates a
significant difference (P < 0.05) between the
values obtained from the PACAP-/- mice and both the
PACAP+/- and PACAP+/+ mice (Tukey-Kramer
Multiple Comparison Test). A, Level of ß-hydroxybutyrate (a ketone
body) in the serum of PACAP+/+ (n = 11),
PACAP+/- (n = 13), and PACAP-/- (n
= 16) mice. B, Level of FFA in the serum of PACAP+/+
(n = 4), PACAP+/- (n = 4), and
PACAP-/- (n = 4) mice. C, Serum triglycerides in
PACAP+/+ (n = 4), PACAP+/- (n = 5),
and PACAP-/- (n = 5) mice. D, Level of cholesterol
in the serum of PACAP+/+ (n = 11),
PACAP+/- (n = 12), and PACAP-/- (n
= 16) mice. E, Serum corticosterone concentration in
PACAP+/+ (n = 9), PACAP+/- (n = 10),
and PACAP-/- (n = 9) mice. The
histogram shows the average corticosterone concentration
for each genotype, while the scatter plot shows
individual corticosterone levels. F, Percentage of glycogen in the
livers of PACAP+/+ (n = 4),
PACAP+/- (n = 4), and
PACAP-/- (n = 4) mice.
|
|
Carbohydrate Metabolism in PACAP-/- Mice
PACAP is known to stimulate insulin release in a
glucose-dependent manner (4, 5, 6, 7, 8, 9). Thus,
hyperglycemia might be predicted in the PACAP null mice due to reduced
insulin levels. However, our PACAP-/- mice do
not show high blood glucose (Fig. 5A
).
When fasted, PACAP null mice had significantly lower blood glucose
compared with littermates. In the fed state, blood glucose levels of
PACAP null mice were no different than littermates. Significantly
reduced levels of glycogen in the liver (Fig. 4F
) of PACAP null mice
were measured at day 7, suggesting either an increased demand for
glucose or an impairment of glycogen synthesis and/or gluconeogenesis.
Similar to our findings, mice lacking the PACAP-specific receptor (with
intact VIP-shared receptors) had normal blood glucose levels
(25), although a reduction in glucose tolerance and
insulin secretion were reported after glucose was administered by
either an iv or gastric route. In the present experiment, the
concentration of insulin was measured in serum of fed and fasted
wild-type, heterozygous, and null mice at postnatal day 5 (Fig. 5B
). In
wild-type mice insulin concentration increased in the fed compared with
the fasted state as expected. In the fed state insulin levels of PACAP
null mice were not significantly different from levels seen in
wild-type and heterozygous mice. However, insulin serum concentration
was significantly elevated in fasted PACAP null mice compared with
littermate controls. Because the 5-d-old mice pups have a small blood
volume, only one serum sample of less than 100 µl could be obtained
from an individual by cardiac puncture. Therefore, continuous
assessment of insulin and glucose levels in a single mouse could not be
performed. Instead, groups of mice at several early postnatal ages need
to be sampled to develop a pattern of insulin concentration throughout
their short lives. Nevertheless, these initial data indicate abnormal
insulin regulation in the PACAP null mice, suggesting insulin
resistance or elevated insulin in response to lipid abnormalities in
these null mice compared with littermates (Fig. 4
, B, C, and D).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5. Measurement of Blood Glucose and Serum Insulin in
PACAP-/- Mice in Relation to Heterozygous and Wild-Type
Littermates
Error bars represent SEM; * indicates a
significant difference (P < 0.05) between the
values obtained from the PACAP-/- mice and both the
PACAP+/- and PACAP+/+ mice (Tukey-Kramer
Multiple Comparison Test). A, Blood glucose levels in postnatal day 5
(P5) fasted PACAP+/+(n = 10), PACAP+/-
(n = 10) and PACAP-/- (n = 10) mice and fed
PACAP+/+(n = 8), PACAP+/- (n = 15)
and PACAP-/- (n = 6) mice. B, Levels of serum
insulin in postnatal day 5 (P5) fasted PACAP+/+(n =
19), PACAP+/- (n = 20), and PACAP-/-
(n = 17) mice and fed PACAP+/+(n = 10),
PACAP+/- (n = 10), and PACAP-/- (n
= 10) mice.
|
|
Altered Lipid Metabolism in Liver, Heart, Skeletal Muscle, and
Adipose Tissue of PACAP-/- Mice
Necropsies, performed at 68 d of age or at death, revealed that
the livers of PACAP-/- mice were buff colored.
Histological examination of 15 tissues showed that at least four were
affected. Hepatic microvesicular steatosis was present (Fig. 6
, iii). The lipid
accumulation was confirmed by Oil Red O staining (Fig. 6
, v)
and by electron microscopy (data not shown). In addition, both heart
(Fig. 3a
) and skeletal muscle (Fig. 3b
) showed intracellular fat
accumulation in Oil Red O-stained sections. Subcutaneous white fat
deposits were depleted totally in wasted
PACAP-/- mice at the time of death.

View larger version (87K):
[in this window]
[in a new window]
|
Figure 6. Morphology of Hepatocytes from
PACAP+/+, PACAP+/-, and PACAP-/-
Mice
Microvesicular fat in the hepatocytes of PACAP-/- mice
(iii), but not in the PACAP+/+ and PACAP+/-
hepatocytes (i and ii). Fat is shown in PACAP-/-
hepatocytes by Oil Red O staining of frozen sections (v), but is not
shown in PACAP+/- mice (iv).
|
|
One possible cause of microvesicular fat accumulation in liver cells is
a defect in hepatic fat metabolism associated with mitochondrial
dysfunction (35, 36). To determine whether the
mitochondria were involved, electron micrographs of the livers were
examined. However, mitochondria of PACAP-/-
mice appeared to be morphologically normal (data not shown). To
evaluate whether the fatty acid ß-oxidation pathway in mitochondria
was defective, a blood sample from each genotype was analyzed for
3-hydroxy-fatty acids (C6 to C16) by gas chromatography-mass
spectrometry (GC-MS) (37). The similar distribution of
3-hydroxy-fatty acids for the different chain lengths among the
mice genotypes suggested that an enzymatic defect in fatty acid
ß-oxidation was not present in the PACAP null mice (Table 1
).
Adrenal Function in the PACAP-/- Mice
The wasted appearance of the PACAP null mice resembles Addisons
disease, whereby glucocorticoids are not produced from a lack of ACTH
or due to adrenal cortex destruction. To assess adrenal cortical
function in the PACAP null mice, we performed histology of the adrenal
gland and measured levels of corticosterone in pups at postnatal day 7.
Hematoxylin/eosin staining did not reveal any difference in morphology
of the adrenal glands of the three genotypes. Serum for the steroid
measurement was collected at the same time each day, and animals were
handled in the same manner to avoid variations in corticosterone
levels. Results indicate PACAP null mice have significantly elevated
levels of corticosterone compared with littermates (Fig. 4E
). A scatter
plot of the data shows two distinct populations within the PACAP null
mice in relation to corticosterone production (Fig. 4E
). Some mice have
normal corticosterone levels, whereas others have extremely high
levels, suggesting a change in corticosterone production as the pups
progress toward death. These data indicate that the PACAP null mice are
able to produce and release corticosterone from the adrenal cortex and
the phenotype observed can not be attributed to lack of this
steroid.
Elevated Triglycerides, Cholesterol, FFA, and Ketone Bodies in
PACAP-/- Mice
Significantly elevated serum levels of triglycerides (Fig. 4C
) and
cholesterol (Fig. 4D
) were present in PACAP-/-
mice compared with the other genotypes. This result suggests that the
liver is capable of synthesizing and releasing very low density
lipoprotein (VLDL) particles into the blood. At the same time FFA in
the serum of the PACAP null mice were significantly higher than those
of wild-type mice (but not significantly higher than heterozygotes)
suggesting an increased mobilization of fatty acids from adipose tissue
in the null mice (Fig. 4B
).
Despite the abnormal fat storage in the hepatocytes, entry of fatty
acids into the mitochondria was unlikely to be reduced because ketosis
was present in the PACAP null mice (Fig. 4A
). This suggests that
metabolic flux in the mitochondria was increased, in turn resulting in
the formation of ketone bodies that are released into the blood. These
findings, along with the GC-MS data from above, indicate that the
defect seen in the PACAP null mice is not necessarily attributable to
hepatic dysfunction. Instead, the liver, skeletal muscle, and heart may
simply be responding to an increased mobilization of fatty acids from
adipose tissue in PACAP null mice. The stimuli and precise site(s) of
action of PACAP in this process remain to be defined. One hypothesis is
that the activity of lipoprotein lipase and/or hormone-sensitive lipase
are affected by the absence of PACAP and may be responsible for the
metabolic dysfunction seen in the PACAP null mice. An alternate
hypothesis is that PACAP null mice are incapable of using or obtaining
intracellular glucose, and the mobilized FFA compensate as an energy
source inside the cells.
This is the first report that PACAP has a role in lipid metabolism. The
early death after birth associated with wasting and the accumulation of
fat in the liver, heart and skeletal muscle were striking results that
were not predictable from previous literature. Our data show that PACAP
may be a critical regulator of lipid and/or carbohydrate
metabolism.
 |
MATERIALS AND METHODS
|
|---|
Gene Targeting
A clone containing 18 kb of the PACAP gene was isolated from a
129SvJ mouse genomic library (Stratagene, La Jolla, CA),
restriction mapped, and sequenced. A Cre-loxP targeting vector was
constructed (38, 39) containing approximately 10 kb of
5'-flanking, 1 kb of 3'-flanking, and a 5-kb region to be deleted (Fig. 1A
). Linearized vector was electroporated into R1 embryonic stem (ES)
cells (40), which were growing in log phase. Cell clones
that had incorporated the construct were obtained by G418 (180 µg/ml)
selection. Clones containing homologous recombination events were
identified by PCR and confirmed by Southern blot. These homologously
recombined clones were identified from more than 1,000 clones screened,
but only one clone contained the entire targeting vector inserted
correctly, as shown by Southern blot. Using electroporation, we
transiently transfected the ES cell clone with a vector (pEGFP-Cre)
expressing Cre recombinase. Four days after transfection, recombined ES
cells were obtained using gancyclovir (1 µM) selection.
Clones that had undergone type I recombination (PACAP gene deleted,
Fig. 1A
) were identified by PCR and confirmed by Southern blot. ES
cells heterozygous for the PACAP deletion were expanded and
microinjected into C57/Bl6 blastocysts. Germline transmission of the
PACAP deletion was achieved from two male chimeras. Heterozygous
littermates were crossed to produce mice homozygous for the PACAP
deletion. Mice were genotyped using a PCR strategy that was confirmed
by Southern blot (Fig. 1B
). The mice used in this study were housed and
handled in compliance with the guidelines of the University of
Victorias Animal Care Committee and with the University of British
Columbias Animal Ethics Committee.
Detection of mRNA in Brain and Liver Tissue
Liver and brain tissues were collected from
PACAP+/+, PACAP+/-,
and PACAP-/- mice and frozen
immediately in liquid nitrogen. Tissue was ground using a chilled
mortar and pestle. RNA was isolated using TRIzol (Life Technologies, Inc., Gaithersburg, MD). mRNA (5 µg) was reverse
transcribed with Superscript II reverse transcriptase (Life Technologies, Inc.) using oligo-dT. The cDNA generated from the
above reaction was added to a 50 µl reaction containing 2.5 U
Taq polymerase (Life Technologies, Inc.), 1x
Taq buffer (Life Technologies, Inc.), 2.5
mM MgCl2, 200
mM deoxynucleoside triphosphates, and 20
pmol of primer E (ATGTGTAGCGGAGCAAGGCTGG) and primer G
(GAACACGAGTGATGACTGGTCAGTC). PCR was carried out under the following
conditions: denaturation at 94 C for 30 sec; annealing at 61 C for 30
sec; extension at 72 C for 45 sec for 33 cycles and a long extension of
7 min. Products produced by the PCR reaction were separated on a 1.5%
agarose gel and visualized by ethidium bromide staining.
Western Blot
Protein was extracted from PACAP+/+,
PACAP+/-, and
PACAP-/- mice using NP-40 lysis
buffer with protease inhibitors. Protein (100 µg) was run through a
16.5% Tris-tricine gel (Bio-Rad Laboratories, Inc.,
Hercules, CA, catalog no. 161-1107). The protein was transferred onto a
PVDF membrane (Bio-Rad Laboratories, Inc.) and blocked
overnight at 4 C in Tris-buffered saline with Tween 20 (TBST) and 5%
BSA. The membrane was then probed with rabbit anti-PACAP38
(Peninsula Laboratories, Inc., Belmont, CA, catalog no.
IHC8920), diluted 1:2000 in TBST with 1% BSA overnight at 4 C, washed
three times with TBST and incubated with secondary goat antirabbit
antibody (DAKO Corp., Carpinteria, CA) diluted
1:10,000 in TBST with 1% BSA for 45 min at room temperature. The blot
was washed four times with TBST detected by enhanced chemiluminescence
(Amersham Pharmacia Biotech, Buckinghamshire, UK, catalog
no. RPN2106) and exposed to film.
Light Microscopy
Tissues (brain, heart, lung, thymus, stomach, liver, pancreas,
spleen, intestine, kidney, adrenal gland, skin, skeletal muscle, and
bone) from PACAP+/+,
PACAP+/-, and
PACAP-/- mice were collected and
fixed in 4% paraformaldehyde in PBS. Routine processing, paraffin
embedding, and sectioning (10 µm) were performed. All sections were
stained with hematoxylin and eosin. Frozen sections of liver, heart,
and skeletal muscle were stained with Oil Red O to identify the
presence of lipids.
Electron Microscopy
Livers of wasted PACAP-/-
mice and littermates (PACAP+/+ and
PACAP+/-) were fixed with a 2.5%
glutaraldehyde primary fixative by cardiac perfusion. The tissue was
rinsed with phosphate buffer and postfixed in osmium tetroxide for
1 h at 4 C. The sections were rinsed in
ddH20, and then dehydrated in an ethanol series
and embedded in epon. Ultrathin sections were cut, collected on grids,
and stained with lead citrate. Sections were examined using an H-7000
transmission electron microscope (Hitachi, Naka City,
Japan).
Measurement of Serum and Liver Components
Serum was collected from anesthetized mice by cardiac puncture.
Serum ß- hydroxybutyrate (ketone body) was measured using
Sigma (St. Louis, MO) kit no. 310-A. Fatty acids were
measured with a kit from Roche Diagnostics (Indianapolis,
IN, no. 1 383 175). Serum triglycerides were measured at the Vancouver
General Hospital core laboratory facility. Also measured were serum
cholesterol (Sigma kit no. 35220), blood glucose (Elite
glucometer, Bayer Corp., Toronto, Ontario, Canada),
and liver glycogen (Sigma kit STA-20). Serum
corticosterone concentration was measured in duplicate by RIA (Double
Antibody Corticosterone 125I RIA kit no.
07120102, ICN, Orangeburg, NY) as was serum insulin concentration
(Sensitive Rat Insulin RIA kit, no. SRI-13K, Linco Research, Inc.). In the measurement of insulin, serum was collected from
both fed and fasted mice. Fed mice were allowed to nurse ad
libitum before serum collection, whereas fasted mice were removed
from their mothers and did not feed for 4 h before serum
collection. Statistical analysis was done with the Tukey-Kramer
Multiple Comparison Test. Level of significance was P
< 0.05. In the insulin RIA, several samples (7 of 86) contained very
low levels of insulin and were undetected by the assay. For statistical
purposes a conservative value of 0.02 ng/ml, the lowest detectable
concentration for Lincos Sensitive Rat Insulin RIA Kit, was assigned
to these samples.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Michael Bennett and Patricia Jones for the GC-MS
data, Anita Borowski for invaluable help with the ES cells and
blastocyst injections, and Joanne Fox for the gift of pEGFP-Cre vector.
We thank Drs. Scott Pownall, John McRory, and David Parker for advice
during the early stages of gene isolation or vector preparation and Dr.
Grant Mitchell for helpful discussions.
 |
FOOTNOTES
|
|---|
This work was supported by the British Columbia Health Research
Foundation and Medical Research Council of Canada.
1 These authors contributed equally to this work. 
2 Present address: Department of Biochemistry and Molecular Biology,
Heritage Medical Research Building, University of Calgary, Calgary,
Alberta, Canada T2N 4N1. 
Abbreviations: ES cell, Embryonic stem cell; GC-MS, gas
chromatography-mass spectrophotometry; PACAP, pituitary adenylate
cyclase-activating polypeptide; TBST, Tris-buffered saline with Tween
20.
Received for publication October 17, 2000.
Accepted for publication June 12, 2001.
 |
REFERENCES
|
|---|
-
Sherwood NM, Krueckl SL, McRory JE 2000 The origin and
function of the PACAP/glucagon superfamily. Endocr Rev 21:619670[Abstract/Free Full Text]
-
Miyata A, Jiang L, Dahl RR, et al. 1990 Isolation of
a neuropeptide corresponding to the N-terminal 27 residues of
the pituitary adenylate cyclase activating polypeptide with 38
residues (PACAP 38). Biochem Biophys Res Commun 170:643648[CrossRef][Medline]
-
Miyata A, Arimura A, Dahl RR, et al. 1989 Isolation of a
novel 38 residue-hypothalamic polypeptide which stimulates adenylate
cyclase in pituitary cells. Biochem Biophys Res Commun 164:567574[CrossRef][Medline]
-
Arimura A 1998 Perspectives on pituitary adenylate cyclase
activating polypeptide (PACAP) in the neuroendocrine, endocrine, and
nervous systems. Jpn J Physiol 48:301331[CrossRef][Medline]
-
Yada T, Sakurada M, Ihida K, et al. 1994 Pituitary adenylate
cyclase activating polypeptide is an extraordinarily potent
intra-pancreatic regulator of insulin secretion from islet ß-cells.
J Biol Chem 269:12901293[Abstract/Free Full Text]
-
Filipsson K, Pacini G, Scheurink AJW, Ahrén B 1998 PACAP stimulates insulin secretion but inhibits insulin sensitivity in
mice. Am J Physiol 274:E834E842
-
Filipsson K, Sundler F, Hannibal J, Ahrén B 1998 PACAP
and PACAP receptors in insulin producing tissues: localization and
effects. Regul Pept 74:167175[CrossRef][Medline]
-
Borboni P, Porzio O, Pierucci D, et al. 1999 Molecular and
functional characterization of pituitary adenylate
cyclase-activating polypeptide (PACAP-38)/vasoactive intestinal
polypeptide receptors in pancreatic ß-cells and effects of PACAP-38
on components of the insulin secretory system. Endocrinology 140:55305537[Abstract/Free Full Text]
-
Filipsson K, Sundler F, Ahrén B 1999 PACAP is an islet
neuropeptide which contributes to glucose-stimulated insulin secretion.
Biochem Biophys Res Commun 256:664667[CrossRef][Medline]
-
Fridolf T, Sundler F, Ahren B 1992 Pituitary adenylate
cyclase-activating polypeptide (PACAP): occurrence in rodent pancreas
and effects on insulin and glucagon secretion in the mouse. Cell Tissue
Res 269:275279[CrossRef][Medline]
-
Breault L, Yon L, Montero M, et al. 1998 Presence of PACAP and
PACAP receptors in the human adrenal gland: possible role in fetal
development. Endocr Res 24:961962[Medline]
-
Andreis PG, Malendowicz LK, Belloni AS, Nussdorfer GG 1995 Effects of pituitary adenylate-cyclase activating peptide (PACAP) on
the rat adrenal secretory activity: preliminary in-vitro studies. Life
Sci 56:135142[CrossRef][Medline]
-
Yon L, Chartrel N, Feuilloley M, et al. 1994 Pituitary
adenylate cyclase-activating polypeptide stimulates both adrenocortical
cells and chromaffin cells in the frog adrenal gland. Endocrinology 135:27492758[Abstract]
-
Rawlings SR, Hezareh M 1996 Pituitary adenylate
cyclase-activating polypeptide (PACAP) and PACAP/vasoactive intestinal
polypeptide receptors: action on the anterior pituitary gland. Endocr
Rev 17:429[Abstract/Free Full Text]
-
Gonzalez BJ, Basille M, Vaudry D, Fournier A, Vaudry H 1997 Pituitary adenylate cyclase-activating polypeptide promotes cell
survival and neurite outgrowth in rat cerebellar neuroblasts.
Neuroscience 78:419430[CrossRef][Medline]
-
Lu N, DiCicco-Bloom E 1997 Pituitary adenylate
cyclase-activating polypeptide is an autocrine inhibitor of mitosis in
cultured cortical precursor cells. Proc Natl Acad Sci USA 94:33573362[Abstract/Free Full Text]
-
Delgado M, Ganea D 1999 Vasoactive intestinal peptide and
pituitary adenylate cyclase-activating polypeptide inhibit
interleukin-12 transcription by regulating nuclear factor
B and Ets
activation. J Biol Chem 274:3193031940[Abstract/Free Full Text]
-
Delgado M, Munoz-Elias EJ, Kan Y, et al. 1998 Vasoactive
intestinal peptide and pituitary adenylate cyclase-activating
polypeptide inhibit tumor necrosis factor
transcriptional
activation by regulating nuclear factor-
B and cAMP response
element-binding protein/c-jun. J Biol Chem 273:3142731436[Abstract/Free Full Text]
-
Sheward WJ, Lutz EM, Copp AJ, Harmar AJ 1998 Expression of
PACAP, and PACAP type 1 (PAC1) receptor mRNA
during development of the mouse embryo. Dev Brain Res 109:245253[Medline]
-
Laburthe M, Couvineau A, Gaudin P, Maoret J-J, Rouyer-Fessard
C, Nicole P 1996 Receptors for VIP, PACAP, secretin, GRF, glucagon,
GLP-1, and other members of their new family of G protein-linked
receptors: structure-function relationship with special reference to
the human VIP-1 receptor. Ann NY Acad Sci 805:94109[Medline]
-
Pantaloni C, Brabet P, Bilanges B, et al. 1996 Alternative
splicing in the N-terminal extracellular domain of the
pituitary adenylate cyclase-activating polypeptide (PACAP)
receptor modulates receptor selectivity and relative potencies of
PACAP-27 and PACAP-38 in phospholipase C activation. J Biol Chem 271:2214622151[Abstract/Free Full Text]
-
Spengler D, Waeber C, Pantaloni C, et al. 1993 Differential
signal transduction by five splice variants of the PACAP receptor.
Nature 365:170175[CrossRef][Medline]
-
Chatterjee TK, Sharma RV, Fisher RA 1996 Molecular cloning of
a novel variant of the pituitary adenylate cyclase-activating
polypeptide (PACAP) receptor that stimulates calcium influx by
activation of L-type calcium channels. J Biol Chem 271:3222632232[Abstract/Free Full Text]
-
Usdin TB, Bonner TI, Mezey E 1994 Two receptors for vasoactive
intestinal polypeptide with similar specificity and complementary
distributions. Endocrinology 135:26622680[Abstract]
-
Jamen F, Persson K, Bertrand G, et al. 2000 PAC1 receptor-deficient mice display impaired
insulinotropic response to glucose and reduced glucose tolerance.
J Clin Invest 105:13071315[Medline]
-
McRory JE, Parker RL, Sherwood NM 1997 Expression and
alternative processing of a chicken gene encoding both growth
hormone-releasing hormone (GRF) and pituitary adenylate
cyclase-activating polypeptide (PACAP). DNA Cell Biol 16:95102[Medline]
-
Chartrel N, Tonon M-C, Vaudry H, Conlon JM 1991 Primary
structure of frog pituitary adenylate cyclase-activating polypeptide
(PACAP) and effects of ovine PACAP on frog pituitary. Endocrinology 129:33673371[Abstract/Free Full Text]
-
Parker DB, Power ME, Swanson P, Rivier J, Sherwood NM 1997 Exon skipping in the gene encoding pituitary adenylate
cyclase-activating polypeptide (PACAP) in salmon alters the expression
of two hormones that stimulate growth hormone release. Endocrinology 138:414423[Abstract/Free Full Text]
-
McRory JE, Sherwood NM 1997 Two protochordate genes encode
pituitary adenylate cyclase-activating polypeptide and related family
members. Endocrinology 138:23802390[Abstract/Free Full Text]
-
Baker J, Liu JP, Robertson EJ, Efstratiadis A 1993 Role of
insulin-like growth factors in embryonic and postnatal growth. Cell 75:7382[CrossRef][Medline]
-
Huang M, Shirahase H, Rorstad OP 1993 Comparative study of
vascular relaxation and receptor binding by PACAP and VIP. Peptides 14:755762[CrossRef][Medline]
-
Suzuki Y, Kasai K, Takekoshi K, et al. 1993 Effects of
pituitary adenylate cyclase activating polypeptide (PACAP) on the
cardiovascular system. Regul Pept 47:213220[CrossRef][Medline]
-
Regan TJ, Ettinger PO, Khan MI, et al. 1974 Altered myocardial
function and metabolism in chronic diabetes mellitus without ischemia
in dogs. Circ Res 35:222237[Abstract/Free Full Text]
-
Regan TJ, Lyons MM, Ahmed SS, et al. 1977 Evidence for
cardiomyopathy in familial diabetes mellitus. J Clin Invest 60:885899[CrossRef]
-
Rinaldo P, Yoon H-R, Yu C, Raymond K, Tiozzo C, Giordano G 1999 Sudden and unexpected neonatal death: a protocol for the
postmortem diagnosis of fatty acid oxidation disorders. Semin Perinatol 23:204210[CrossRef][Medline]
-
Hautekeete ML, Degott C, Benhamou J-P 1990 Microvesicular
steatosis of the liver. Acta Clin Belg 45:311326[Medline]
-
Jones PM, Quinn R, Fennessey PV, et al. 2000 Improved stable
isotope dilution-gas chromatography-mass spectrometry method for serum
or plasma free 3-hydroxy-fatty acids and its utility for the study of
disorders of mitochondrial fatty acid ß-oxidation. Clin Chem 46:149155[Abstract/Free Full Text]
-
Kühn R, Schwenk F, Aguet M, Rajewsky K 1995 Inducible
gene targeting in mice. Science 269:14271429[Abstract/Free Full Text]
-
Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K 1994 Deletion
of a DNA polymerase ß gene segment in T cells using cell
type-specific gene targeting. Science 265:103106[Abstract/Free Full Text]
-
Nagy A, Rossant J, Nagy R, Abramow-Newerly W, Roder JC 1993 Derivation of completely cell culture-derived mice from early-passage
embryonic stem cells. Proc Natl Acad Sci USA 90:84248428[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. Vaudry, A. Falluel-Morel, S. Bourgault, M. Basille, D. Burel, O. Wurtz, A. Fournier, B. K. C. Chow, H. Hashimoto, L. Galas, et al.
Pituitary Adenylate Cyclase-Activating Polypeptide and Its Receptors: 20 Years after the Discovery
Pharmacol. Rev.,
September 1, 2009;
61(3):
283 - 357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gyamera-Acheampong and M. Mbikay
Proprotein convertase subtilisin/kexin type 4 in mammalian fertility: a review
Hum. Reprod. Update,
March 1, 2009;
15(2):
237 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Adams, S. L. Gray, E. R. Isaac, A. C. Bianco, A. J. Vidal-Puig, and N. M. Sherwood
Feeding and Metabolism in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide
Endocrinology,
April 1, 2008;
149(4):
1571 - 1580.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Cummings, C. Willie, and R. J. A. Wilson
Pituitary adenylate cyclase-activating polypeptide maintains neonatal breathing but not metabolism during mild reductions in ambient temperature
Am J Physiol Regulatory Integrative Comp Physiol,
March 1, 2008;
294(3):
R956 - R965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tanaka, N. Shintani, H. Hashimoto, N. Kawagishi, Y. Ago, T. Matsuda, R. Hashimoto, H. Kunugi, A. Yamamoto, C. Kawaguchi, et al.
Psychostimulant-induced attenuation of hyperactivity and prepulse inhibition deficits in Adcyap1-deficient mice.
J. Neurosci.,
May 10, 2006;
26(19):
5091 - 5097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lacombe, V. Lelievre, C. E. Roselli, W. Salameh, Y.-h. Lue, G. Lawson, J.-M. Muller, J. A. Waschek, and E. Vilain
Delayed testicular aging in pituitary adenylate cyclase-activating peptide (PACAP) null mice
PNAS,
March 7, 2006;
103(10):
3793 - 3798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Macdonald, M. Weerapura, M. A. Beazely, L. Martin, W. Czerwinski, J. C. Roder, B. A. Orser, and J. F. MacDonald
Modulation of NMDA Receptors by Pituitary Adenylate Cyclase Activating Peptide in CA1 Neurons Requires G{alpha}q, Protein Kinase C, and Activation of Src
J. Neurosci.,
December 7, 2005;
25(49):
11374 - 11384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Apostolakis, D. N. Riherd, and B. W. O'Malley
PAC1 Receptors Mediate Pituitary Adenylate Cyclase-Activating Polypeptide- and Progesterone-Facilitated Receptivity in Female Rats
Mol. Endocrinol.,
November 1, 2005;
19(11):
2798 - 2811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Segal, N. R. Stallings, C. E. Lee, L. Zhao, N. Socci, A. Viale, T. M. Harris, M. B. Soares, G. Childs, J. K. Elmquist, et al.
Use of Laser-Capture Microdissection for the Identification of Marker Genes for the Ventromedial Hypothalamic Nucleus
J. Neurosci.,
April 20, 2005;
25(16):
4181 - 4188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. T. Hinkle, E. Donnelly, D. B. Cody, R. J. Sheldon, and R. J. Isfort
Activation of the vasoactive intestinal peptide 2 receptor modulates normal and atrophying skeletal muscle mass and force
J Appl Physiol,
February 1, 2005;
98(2):
655 - 662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Akesson, B. Ahren, G. Edgren, and E. Degerman
VPAC2-R Mediates the Lipolytic Effects of Pituitary Adenylate Cyclase-Activating Polypeptide/Vasoactive Intestinal Polypeptide in Primary Rat Adipocytes
Endocrinology,
February 1, 2005;
146(2):
744 - 750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Otto, L. Hein, M. Brede, R. Jahns, S. Engelhardt, H.-J. Grone, and G. Schutz
Pulmonary Hypertension and Right Heart Failure in Pituitary Adenylate Cyclase-Activating Polypeptide Type I Receptor-Deficient Mice
Circulation,
November 16, 2004;
110(20):
3245 - 3251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Chen, M. Haluzik, N. J. Wolf, J. Lorenzo, K. R. Dietz, M. L. Reitman, and L. S. Weinstein
Increased Insulin Sensitivity in Paternal Gnas Knockout Mice Is Associated with Increased Lipid Clearance
Endocrinology,
September 1, 2004;
145(9):
4094 - 4102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tomimoto, H. Hashimoto, N. Shintani, K. Yamamoto, Y. Kawabata, K.-I. Hamagami, K. Yamagata, J.-I. Miyagawa, and A. Baba
Overexpression of Pituitary Adenylate Cyclase-Activating Polypeptide in Islets Inhibits Hyperinsulinemia and Islet Hyperplasia in Agouti Yellow Mice
J. Pharmacol. Exp. Ther.,
May 1, 2004;
309(2):
796 - 803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Cummings, J. D. Pendlebury, N. M. Sherwood, and R. J. A. Wilson
Sudden neonatal death in PACAP-deficient mice is associated with reduced respiratory chemoresponse and susceptibility to apnoea
J. Physiol.,
February 15, 2004;
555(1):
15 - 26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Akesson, B. Ahren, V. C. Manganiello, L. S. Holst, G. Edgren, and E. Degerman
Dual Effects of Pituitary Adenylate Cyclase-Activating Polypeptide and Isoproterenol on Lipid Metabolism and Signaling in Primary Rat Adipocytes
Endocrinology,
December 1, 2003;
144(12):
5293 - 5299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhu, C. Tamvakopoulos, D. Xie, J. Dragovic, X. Shen, J. E. Fenyk-Melody, K. Schmidt, A. Bagchi, P. R. Griffin, N. A. Thornberry, et al.
The Role of Dipeptidyl Peptidase IV in the Cleavage of Glucagon Family Peptides: IN VIVO METABOLISM OF PITUITARY ADENYLATE CYCLASE-ACTIVATING POLYPEPTIDE-(1-38)
J. Biol. Chem.,
June 13, 2003;
278(25):
22418 - 22423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yamamoto, H. Hashimoto, S. Tomimoto, N. Shintani, J.-i. Miyazaki, F. Tashiro, H. Aihara, T. Nammo, M. Li, K. Yamagata, et al.
Overexpression of PACAP in Transgenic Mouse Pancreatic {beta}-Cells Enhances Insulin Secretion and Ameliorates Streptozotocin-induced Diabetes
Diabetes,
May 1, 2003;
52(5):
1155 - 1162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Arimura
Editorial: Impaired Adaptive Thermogenesis in Pituitary Adenylate Cyclase-Activating Polypeptide-Deficient Mice
Endocrinology,
October 1, 2002;
143(10):
3715 - 3716.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Gray, N. Yamaguchi, P. Vencova, and N. M. Sherwood
Temperature-Sensitive Phenotype in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide
Endocrinology,
October 1, 2002;
143(10):
3946 - 3954.
[Abstract]
[Full Text]
[PDF]
|
 |
|