| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Department of Research (A.M.D., D.D., E.C.), Saint Francis Hospital and Medical Center, Hartford, Connecticut 06105; and The University of Connecticut School of Medicine (A.M.D., E.C.), Farmington, Connecticut 06030
Address all correspondence and requests for reprints to: Anne M. Delany, Ph.D., Department of Research, Saint Francis Hospital and Medical Center, 114 Woodland Street, Hartford, Connecticut 06105-1299. E-Mail: adelany@stfranciscare.org.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, ß, and 
interact with this sequence, and binding of
CAAT/enhancer binding protein , in particular, was increased in the
presence of cortisol. Northern blot analysis showed that CAAT/enhancer
binding protein and ß transcripts were increased by cortisol in
Ob cells. Further, cortisol increased the transcription of these genes
and increased the stability of CAAT/enhancer binding protein mRNA.
In conclusion, cortisol represses IGF I transcription in osteoblasts,
and CAAT/enhancer binding proteins appear to play a role in this
effect. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Using cultures of osteoblasts derived from the sequential collagenase digestion of fetal rat calvaria (Ob cells), we demonstrated that the glucocorticoid cortisol decreases IGF I mRNA by approximately 50%, an effect mediated by decreasing gene transcription (9). The IGF I gene has two alternative promoters found in exons 1 and 2, and osteoblasts, like other extrahepatic tissues, predominantly express transcripts containing exon 1. The IGF I exon 1 promoter lacks classical eukaryotic promoter elements, such as CAAT or TATA boxes, and it has four transcription initiation sites (10, 11, 12). In osteoblasts, the third transcription start site is the major start site (9, 12). In transiently transfected rat osteoblastic cells, cortisol decreased the activity of rat IGF I exon 1 promoter-luciferase reporter gene constructs by 30%, and deletion analysis showed that the smallest cortisol-responsive fragment tested contained bps +34 to +192, relative to the first start site of transcription, and contained start sites 2 and 3. While further deletion analysis determined that the +34 to +142 region of the promoter was not responsive to cortisol, the exact element responsible for the glucocorticoid effect was not demonstrated (9).
In the present study, we extend our previous observations to determine the IGF I promoter sequences responsible for cortisol regulation in Ob cells, characterize the transcription factors interacting with these sequences, and analyze the regulation of these transcription factors by cortisol.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). There
was increased binding of nuclear proteins from cortisol-treated
osteoblasts to the +132 to +158 probe, and this effect was seen in
extracts from cells treated with cortisol for 2 to 24 h (Fig. 2). In Fig. 2, the solid arrow
indicates the protein-DNA complex increased most prominently in
extracts from cortisol-treated cells.
|
|
). An oligonucleotide containing a consensus
C/EBP binding site also competed for binding of protein to the +132 to
+158 IGF I promoter fragment, while an oligonucleotide in which the
consensus C/EBP binding site was mutated failed to compete. These data
indicate that the C/EBP site is important for binding
glucocorticoid-regulated nuclear factors and suggest that members of
the C/EBP family of transcription factors are involved. In these
competition experiments, we note that the faster migrating complexes
are more abundant and appear to be specific, as they are partially
competed by unlabeled wild-type oligonucleotides, but not by
oligonucleotides containing a mutation in the C/EBP site (Fig. 3).
These faster migrating complexes may contain C/EBP family members that
have a higher affinity for the probe.
|
). In addition, the basal activity of
the mutant +34 to +192 IGF I promoter was higher than that of the
wild-type promoter (P < 0.01), further indicating that
this putative C/EBP binding site is a negative regulator of IGF I gene
transcription. While the +34 to +192 IGF I promoter-luciferase gene
construct does not exhibit strong promoter activity, the level of
repression by glucocorticoid treatment is similar to that observed with
larger fragments of the IGF I exon I promoter (9). As
previously noted, cortisol decreases IGF I rate of transcription and
heterogeneous nuclear RNA abundance in Ob cells by approximately 50%
(9). The less-than-optimal response of the IGF I
promoter-luciferase gene constructs to cortisol could be due to a lack
of appropriate chromatin structure in the transiently transfected
plasmid DNA, or the requirement of additional sequences.
|
). C/EBP , ß, or specific
antibodies caused a supershift in binding reactions containing nuclear
extracts from cortisol-treated cells, while antibodies against C/EBP
, and to a lesser extent, those against C/EBP ß caused a
supershift in binding reactions containing nuclear extracts from
control cells (Fig. 5). These data suggest that C/EBP and ß
interact with the promoter element in the basal state, while C/EBP
interacts with the sequence primarily when cells are treated with
glucocorticoids. C/EBP 
and 
specific antibodies were also tested
in the supershift assay, but they failed to interact with nuclear
proteins from control or cortisol-treated cells (data not shown).
Antibodies against C/EBP 
(CHOP 10) were not tested because they
were unavailable. Overall, these data suggest that at least three
members of the C/EBP family of transcription factors interact with the
+132 to +158 IGF I promoter sequence.
|
). The GR
has been shown to interact with DNA and with C/EBPs, and a potential
half-glucocorticoid response element is adjacent to the C/EBP binding
site (14). However, antibodies against the GR did not
supershift +132 to +158 IGF I promoter-Ob protein complexes. While the
GR has been shown to mediate the cooperative effects of signal
transducer and activator of transcription (STAT) 5 and C/EBP ß,
STAT-5 was not detected in the +132 to +158 IGF I promoter-Ob protein
complex by supershift assay (15). A potential binding site
for the transcription factor Oct-1 abuts the C/EBP binding site in the
+132 to +158 IGF I promoter. Oct 1 has been shown to bind to a negative
glucocorticoid response element in the GnRH promoter and to repress
transcription of the IL-8 promoter (16, 17). However,
antibodies against Oct-1 did not supershift +132 to +158 IGF I
promoter-Ob protein complexes. A potential binding site for the
transcriptional repressor Gfi-1 is also found within the +132 to +158
IGF I promoter fragment, but supershift assays did not demonstrate the
presence of this transcription factor in the Ob protein-DNA complex
(18).
|
). C/EBP mRNA was
detectable in untreated and cortisol-treated cells, and its abundance
was not significantly modified by glucocorticoids. Transcripts for
C/EBP ß were observed in untreated cells and were modestly increased
in cells treated with cortisol for 6 h (fold increase 1.6 ±
0.2, n = 7) or 24 h (fold increase 1.9 ± 0.3, n =
11). In contrast, cortisol rapidly and substantially induced C/EBP
mRNA. C/EBP transcripts were induced 10.6 ± 1.4 (n = 7)
fold as early as 2 h of treatment, and this induction was
sustained for up to 24 h (fold increase 10.3 ± 0.8, n =
8). EMSAs performed with a labeled consensus C/EBP binding site
oligonucleotide probe (data not shown) or with the +132 to +158 IGF I
promoter fragment (Fig. 5
) confirmed that C/EBP ß and C/EBP
proteins were more abundant in extracts from cortisol-treated Ob cells.
Further analysis of Ob cell RNA showed that C/EBP transcripts were
barely detectable, and while Ob cells expressed C/EBP and mRNA,
their abundance was not noticeably altered by treatment with cortisol
for up to 24 h (data not shown).
|
and ß transcripts in Ob cells, the regulation of C/EBP and
ß by cortisol was further characterized. To determine whether
cortisol affects the stability of C/EBP ß or mRNA, Ob cell
cultures were treated with or without cortisol for 15 min, after which
transcription was arrested by the addition of the RNA polymerase II
inhibitor 5,6-dichlorobenzimidazole riboside (DRB) (19).
Total RNA was harvested at various times after DRB addition and
subjected to Northern blot analysis and densitometry. These assays
showed that the half-life of C/EBP ß mRNA in transcriptionally
arrested osteoblasts is approximately 1 h, and that the stability
of the transcript is not affected by cortisol (Fig. 8). In contrast, cortisol caused a
significant stabilization of C/EBP mRNA, increasing its half-life
from about 30 min to approximately 1 h. To determine whether there
was a transcriptional component to C/EBP regulation by cortisol, a
nuclear run off assay was performed using nuclei from Ob cells
treated with or without cortisol for 1 h. This assay showed that
cortisol induced C/EBP transcription by approximately 6-fold and
C/EBP ß transcription by approximately 2-fold (Fig. 9). These data indicate that cortisol induces
C/EBP ß by transcriptional mechanisms, and C/EBP by both
transcriptional and posttranscriptional mechanisms.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Mutagenesis of three conserved bases within the regulated C/EBP binding
site prevented down-regulation of the +34 to +192 IGF I promoter by
cortisol. Further, mutation of the C/EBP binding site caused an
increase in basal promoter activity, confirming that it is an
inhibitory motif. Electrophoretic mobility supershift assays suggest
that C/EBP and, to a lesser extent, C/EBP ß interact with the
glucocorticoid-regulated site in unstimulated Ob cells, while C/EBP
, ß, and interact with the binding site in cortisol-treated Ob
cells. These data correlate with the previously suggested notion that,
in liver and myelo-monocytic cells, C/EBP and ß regulate
constitutive gene expression and C/EBP ß and predominate in
inducible gene expression (21, 22, 23, 24).
C/EBPs bind DNA as homo- or heterodimers, associating with each other
through well conserved leucine zipper motifs in the C-terminal region
of the protein. The DNA binding/nuclear translocation domain, adjacent
to the leucine zipper, is also conserved among C/EBP family members,
which recognize similar DNA sequences (13). The
nonconserved N-terminal portion of the C/EBP molecules contain domains
that can act as transcriptional activators or attenuators. Attenuator
domains, in particular, have been described in C/EBP ß and , and
there is evidence that activation of C/EBP ß occurs through
derepression, mediated by phosphorylation of the protein
(25). The activity of C/EBP is also regulated by
phosphorylation, since dephosphorylation severely inhibits its DNA
binding and transactivation potential (26). In addition,
use of alternate translation initiation sites within the C/EBP ß mRNA
can result in a 32-kDa activator (LAP, liver-enriched activator
protein) or a 16-kDa inhibitory (LIP, liver-enriched inhibitory
protein) isoform of the protein (13). LIP can form
heterodimers and inactivate LAP so that the activity of C/EBP ß is
dependent on the LAP/LIP protein isoform generated.
While most reports describe induction of gene expression by C/EBPs, the
functional and EMSA data indicate that, under the experimental
conditions used, C/EBPs and their cognate binding site are associated
with repression of the IGF I promoter in basal and
glucocorticoid-treated osteoblasts. Interestingly, an atypical C/EBP
binding site in the rat IGF I exon 1 promoter, distal to the
glucocorticoid-responsive site and corresponding to footprint HS3D,
binds C/EBP in response to treatment of osteoblasts with PGs,
leading to a stimulation of gene transcription (27). While
the presence of both C/EBP-repressible and C/EBP-inducible binding
sites within the same promoter seems unusual, it is not unprecedented.
Like the IGF I promoter, the rat 1-acid glycoprotein promoter has a
5'-C/EBP binding site that represses promoter activity and a 3'-C/EBP
binding site responsible for stimulation of transcriptional activity
(28). In the IGF I promoter, the glucocorticoid-responsive
C/EBP binding site is immediately adjacent to the third transcriptional
start site, which is preferentially used in osteoblastic cells. It is
possible that C/EBPs may occlude basal transcriptional machinery or
that the phosphorylation state of the transcription factors may cause
them to have attenuator rather than stimulatory activity (25, 26, 29). In addition, the stoichiometry of the C/EBP isoforms,
either hetero- or homodimers, may affect their activity on a particular
DNA sequence. Osteoblastic cells express six members of the C/EBP
family of transcription factors, and it is likely that appropriate
stoichiometry is necessary for appropriate regulation (our unpublished
data).
Glucocorticoid induction of C/EBP ß and has been shown in
nonskeletal cell systems (30, 31, 32). In fact,
transcriptional induction of C/EBP ß and was reported in a rat
intestinal epithelial crypt cell line (30). However, our
data showing stabilization of C/EBP mRNA by cortisol, in
conjunction with its ability to stimulate transcription of C/EBP ß
and in osteoblasts, is novel. Glucocorticoids stimulate apoptosis
in a number of cell types, including mature osteoblasts, and
glucocorticoids decrease expression of IGF I, which has an
antiapoptotic effect on cells (9, 33, 34, 35). Coincidentally,
C/EBPs have been postulated to play a role in apoptosis (36, 37). However, it is important to note that the effects of
glucocorticoids on osteoblastic apoptosis can be dependent on the state
of cell maturation. As osteoblastic cells mature, they mineralize and
undergo apoptosis, and glucocorticoids can prevent osteoblastic
maturation and the consequent cellular death (38).
The anabolic effect of locally produced IGF I plays a central role in the maintenance of bone mass. The effects of glucocorticoids on bone are opposite to those of IGF I, suggesting that some of the actions of glucocorticoids may be mediated by down-regulation of osteoblastic IGF I expression. Although in vitro studies have limitations, they generate useful data on potential mechanisms of glucocorticoid action in vivo, and our data suggest a role for C/EBPs in cortisol regulation of the IGF I promoter. In conclusion, cortisol decreases IGF I transcription in osteoblastic cells, and the inhibition of IGF I by cortisol may play a central role in the effects of cortisol on bone formation and remodeling.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
50,000
cells/cm2), transferred to serum-free medium for
20–24 h, and exposed to control medium or 1 µM cortisol
in the absence of serum for 2–24 h as indicated in the text and
legends. For the nuclear run-off assay, subconfluent cultures of Ob
cells were treated with trypsin, passaged at a 1:8 dilution, and
allowed to grow to confluence (9). Confluent cultures were
serum-deprived and exposed to control medium or 1 µM
cortisol in the absence of serum for 1 h. Cortisol and DRB
(Sigma, St. Louis, MO) were dissolved in ethanol and
diluted in culture medium. At dilutions less than 1:10,000, an equal
volume of ethanol was added to control cultures.
Transient Transfections
To determine changes in promoter activity, an IGF I exon 1
promoter fragment spanning bp +34 to +192 was subcloned into the
promoterless luciferase reporter vector pGL3-Basic (Promega Corp., Madison, WI) (9, 10). Ob cells were cultured
to approximately 70% confluence and transiently transfected with IGF I
promoter constructs using liposome/nucleic acid complexes (TransFast,
Promega Corp.), according to the manufacturer’s
instructions. Cotransfection with a construct containing the
cytomegalovirus promoter-driven ß-galactosidase gene (CLONTECH Laboratories, Inc., Palo Alto, CA) was used to control for
transfection efficiency. Cells were allowed to recover in
serum-containing medium for 24 h, serum deprived for 20–24 h, and
exposed to control or cortisol-containing medium for 6 h. In
previous studies, this duration of glucocorticoid exposure resulted in
maximal responsiveness of the IGF-I promoter (9). Cells
were washed with PBS and harvested in reporter lysis buffer
(Promega Corp.). Luciferase activity was measured using a
luciferase assay kit (Promega Corp.), and
ß-galactosidase activity was measured using Galacton reagent (Tropix,
Bedford, MA), both in accordance with manufacturer’s instructions.
Luciferase activity was corrected for ß-galactosidase activity.
Site-Directed Mutagenesis
Site-directed mutagenesis of the C/EBP binding site in the bp
+34 to +192 IGF I exon 1 promoter was achieved by overlap extension,
using PCR (40). For this purpose, mutant sense primer
(ATCCCTCTTCTGCTTGATAGCTCTCAC; mutated bases are
underlined) and the corresponding antisense primers were
designed, and the +34 to +192 IGF I promoter in pGL-3 Basic was used as
a template. The identity of the wild-type and mutated constructs was
confirmed by DNA sequence analysis (Sequenase Version 2.0 DNA
sequencing kit, United States Biochemical Corp.,
Cleveland, OH).
EMSA
For gel shift assays, nuclear extracts from control and
cortisol-treated cultures were prepared as described (41).
Cells were washed with PBS, suspended in 10 mM HEPES/KOH,
pH 7.9, 10 mM KCl, 1.5 mM
MgCl2, 0.5 mM dithiothreitol buffer,
allowed to swell on ice for 15 min, and lysed with 10% Nonidet P-40
(Sigma). After centrifugation, the nuclear pellet was
resuspended in a HEPES/KOH buffer in the presence of protease
inhibitors at 4 C, incubated for 30 min and centrifuged, and the
supernatant was stored at -70 C. Protein concentrations were
determined by DC Protein Assay in accordance with manufacturer’s
instructions (Bio-Rad Laboratories, Inc., Hercules, CA).
The IGF I exon I promoter oligonucleotides used had the sense strand
sequence TGCCAGAAGAGGGAGAGAGAGAGAAGGCGAATG corresponding to +34 to +66,
TTCCCCCAGCTGTTTCCTGTCTACAGTGTCTG corresponding to +67 to +98,
TGTTTTGTAGATAAATGTGAGGATTTTCTC corresponding to +99 to +128,
GATTTTCTCTAAATCCCTCCTC corresponding to +120 to +141, and
ATCCCTCTTCGTCTTGCTAAATCTCAC corresponding to +132 to +158. The +132 to
+158 C/EBP mutant oligonucleotide had the sense strand sequence
ATCCCTCTTCTGCTTGATAGCTCTCAC (mutated bases are
underlined) (Life Technologies, Inc.).
Oligonucleotides containing a consensus C/EBP binding site and its
mutant were obtained from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Synthetic oligonucleotides were labeled with
[-32P]-ATP using T4
polynucleotide kinase. Nuclear extracts and labeled oligonucleotides
were incubated for 20 min at room temperature in 10
mM Tris buffer, pH 7.5, containing 1 µg of poly
(dI-dC). The specificity of binding was determined by the addition of
homologous or mutated unlabeled synthetic oligonucleotides in
100-fold excess (41). DNA-protein complexes were resolved
on nondenaturing, nonreducing 4% polyacrylamide gels, and the
complexes were visualized by autoradiography. For gel supershift
assays, labeled oligonucleotides were incubated with nuclear extracts
for 20 min, followed by incubation for 1 h at room temperature
with polyclonal antibodies (all from Santa Cruz Biotechnology, Inc.), before electrophoretic resolution.
Northern Blot Analysis
Total cellular RNA was isolated using a RNeasy kit, following
manufacturer’s instructions (QIAGEN, Chatsworth, CA). RNA
was quantitated by spectrometry, and equal amounts of RNA were
denatured and electrophoresed through formaldehyde agarose gels. Gels
were stained with ethidium bromide to visualize RNA standards and
ribosomal RNA, documenting equal RNA loading of the samples. The RNA
was then blotted onto Gene Screen Plus-charged nylon (DuPont Merck Pharmaceutical Co., Wilmington, DE), and uniformity of
transfer was documented by revisualization of ribosomal RNA.
Restriction fragments of rat C/EBP , ß, and cDNAs (kindly
provided by S. L. McKnight, University of Texas Southwestern
Medical Center, Dallas, TX) and mouse cDNAs for C/EBP and , and
human cDNA for C/EBP (kindly provided by H. P. Koeffler,
University of California, Los Angeles, CA), were purified by agarose
gel electrophoresis (42, 43, 44). cDNAs were labeled with
[-32P] deoxy-CTP (dCTP) and
[-32P] deoxy-ATP (dATP) (50 µCi each,
specific activity 3,000 Ci/mmol; DuPont Merck Pharmaceutical Co.) using the random
hexanucleotide-primed second strand synthesis method
(45). Hybridizations were carried out at 42 C for 16–72
h, and posthybridization washes were performed in 0.5x saline-sodium
citrate at 65 C. The blots were stripped and rehybridized with an
[-32P]-labeled glyceraldehyde-3-phosphate
dehydrogenase (GAPD) cDNA. The bound radioactive material was
visualized by autoradiography on X-AR5 film (Eastman Kodak Co., Rochester, NY) employing Cronex Lightning Plus
(DuPont Merck Pharmaceutical Co.) or Biomax MS
(Eastman Kodak Co.) intensifying screens. Relative
hybridization levels were determined by densitometry. Northern analyses
shown are representative of three or more cultures.
Nuclear Run-Off Assay
Nuclei were isolated by Dounce homogenization in a Tris-HCl
buffer containing 0.5% Igepal (Sigma). Nascent
transcripts were labeled by incubation of nuclei in a reaction buffer
containing 250 µCi 32P-UTP (800
Ci/mM, DuPont Merck Pharmaceutical Co.). RNA
was isolated by treatment with deoxyribonuclease I and proteinase K,
followed by ethanol precipitation (9, 46). Linearized
plasmid DNA containing about 1 µg cDNA was immobilized onto
GeneScreen Plus by slot blotting, according to the manufacturer’s
instructions. Equal counts per minute of 32P-RNA
from each sample were hybridized to cDNA using the same conditions as
those employed for Northern blot analysis and were visualized by
autoradiography.
Statistical Methods
Data are presented as means ± SEM. Statistical
differences were determined by ANOVA and post hoc
examination by the Sheffé test (47). Slopes of RNA
decay curves were analyzed by the method of Sokal and Rohlf
(48).
|
ACKNOWLEDGMENTS |
|---|
, ß, and
cDNAs, H. P. Koeffler for providing C/EBP cDNA, Susan
Bankowski and Susan O’Lone for technical assistance, and Ms. Karen
Berrelli for secretarial help. |
FOOTNOTES |
|---|
Abbreviations: C/EBP, CAAT/enhancer binding protein; DRB, 5,6-dichlorobenzimidazole riboside; GAPD, glyceraldehyde-3-phosphate dehydrogenase; LAP, liver-enriched activator protein; LIP, liver-enriched inhibitory protein; STAT, signal transducer and activator of transcription
Received for publication January 9, 2001. Accepted for publication June 12, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 (I) procollagen mRNA by transcriptional
and post-transcriptional mechanisms. J Cell Biochem 57:488–494[CrossRef][Medline]
1-acid
glycoprotein gene via direct protein-protein interaction. Mol Biol Cell 13:1854–1862
and their activation by phosphorylation. Mol Cell Biol 14:4324–4332 1-acid
glycoprotein in rabbit liver under acute-phase conditions involves
induction and activation of ß and CCAAT-enhancer-binding
proteins. Eur J Biochem 222:891–900[Medline]
1-acid
glycoprotein gene via direct protein-protein interaction. Mol Cell Biol 13:1854–1862This article has been cited by other articles:
 |
|
 |
|
  N. E. Schlabritz-Loutsevitch, J. C. Lopez-Alvarenga, A. G. Comuzzie, M. M. Miller, S. P. Ford, C. Li, G. B. Hubbard, R. J. Ferry Jr, and P. W. Nathanielsz The Prolonged Effect of Repeated Maternal Glucocorticoid Exposure on the Maternal and Fetal Leptin/Insulin-like Growth Factor Axis in Papio species Reproductive Sciences, March 1, 2009; 16(3): 308 - 319. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Giustina, G. Mazziotti, and E. Canalis Growth Hormone, Insulin-Like Growth Factors, and the Skeleton Endocr. Rev., August 1, 2008; 29(5): 535 - 559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wu, W. Zhao, J. Zhao, J. Pan, Q. Wu, Y. Zhang, W. A. Bauman, and C. P. Cardozo Identification of Androgen Response Elements in the Insulin-Like Growth Factor I Upstream Promoter Endocrinology, June 1, 2007; 148(6): 2984 - 2993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass Endocrinology, May 1, 2005; 146(5): 2415 - 2423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-F. Iu, H. Kaji, H. Sowa, J. Naito, T. Sugimoto, and K. Chihara Dexamethasone suppresses Smad3 pathway in osteoblastic cells J. Endocrinol., April 1, 2005; 185(1): 131 - 138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Eijken, M. Hewison, M. S. Cooper, F. H. de Jong, H. Chiba, P. M. Stewart, A. G. Uitterlinden, H. A. P. Pols, and J. P. T. M. van Leeuwen 11{beta}-Hydroxysteroid Dehydrogenase Expression and Glucocorticoid Synthesis Are Directed by a Molecular Switch during Osteoblast Differentiation Mol. Endocrinol., March 1, 2005; 19(3): 621 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase Mol. Cell. Biol., January 1, 2005; 25(1): 472 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Koutsilieris, C. S. Mitsiades, J. Bogdanos, T. Dimopoulos, D. Karamanolakis, C. Milathianakis, and A. Tsintavis Combination of Somatostatin Analog, Dexamethasone, and Standard Androgen Ablation Therapy in Stage D3 Prostate Cancer Patients with Bone Metastases Clin. Cancer Res., July 1, 2004; 10(13): 4398 - 4405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Pereira, A. M. Delany, and E. Canalis CCAAT/Enhancer Binding Protein Homologous Protein (DDIT3) Induces Osteoblastic Cell Differentiation Endocrinology, April 1, 2004; 145(4): 1952 - 1960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sciaudone, E. Gazzerro, L. Priest, A. M. Delany, and E. Canalis Notch 1 Impairs Osteoblastic Cell Differentiation Endocrinology, December 1, 2003; 144(12): 5631 - 5639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Delany, I. Kalajzic, A. D. Bradshaw, E. H. Sage, and E. Canalis Osteonectin-Null Mutation Compromises Osteoblast Formation, Maturation, and Survival Endocrinology, June 1, 2003; 144(6): 2588 - 2596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Canalis, A. N. Economides, and E. Gazzerro Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton Endocr. Rev., April 1, 2003; 24(2): 218 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Canalis and A. Giustina Glucocorticoid-Induced Osteoporosis: Summary of a Workshop J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5681 - 5685. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
