help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delany, A. M.
Right arrow Articles by Canalis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delany, A. M.
Right arrow Articles by Canalis, E.
Molecular Endocrinology 15 (10): 1781-1789
Copyright © 2001 by The Endocrine Society

Glucocorticoid Suppression of IGF I Transcription in Osteoblasts

Anne M. Delany, Deena Durant and Ernesto Canalis

From the Department of Research (A.M.D., D.D., E.C.), Saint Francis Hospital and Medical Center, Hartford, Connecticut 06105; and The University of Connecticut School of Medicine (A.M.D., E.C.), Farmington, Connecticut 06030

Address all correspondence and requests for reprints to: Anne M. Delany, Ph.D., Department of Research, Saint Francis Hospital and Medical Center, 114 Woodland Street, Hartford, Connecticut 06105-1299. E-Mail: adelany@stfranciscare.org.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Glucocorticoids have profound effects on bone formation, decreasing IGF I transcription in osteoblasts, but the mechanisms involved are poorly understood. We previously showed that the bp +34 to +192 region of the rat IGF I exon 1 promoter was responsible for repression of IGF I transcription by cortisol in cultures of osteoblasts from fetal rat calvariae (Ob cells). Here, site-directed mutagenesis was used to show that a binding site for members of the CAAT/enhancer binding protein family of transcription factors, within the +132 to +158 region of the promoter, mediates this glucocorticoid effect. EMSAs demonstrated that cortisol increased binding of osteoblast nuclear proteins to the +132 to +158 region of the IGF I promoter. Supershift assays showed that CAAT/enhancer binding protein {alpha}, ß, and {delta} interact with this sequence, and binding of CAAT/enhancer binding protein {delta}, in particular, was increased in the presence of cortisol. Northern blot analysis showed that CAAT/enhancer binding protein {delta} and ß transcripts were increased by cortisol in Ob cells. Further, cortisol increased the transcription of these genes and increased the stability of CAAT/enhancer binding protein {delta} mRNA. In conclusion, cortisol represses IGF I transcription in osteoblasts, and CAAT/enhancer binding proteins appear to play a role in this effect.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
SKELETAL CELLS SYNTHESIZE growth factors that can modulate the replication, differentiation, and activity of cells of the osteoblast and osteoclast lineages, and one of the most prevalent growth factors in bone is IGF I (1). Secreted primarily by osteoblasts, IGF I has modest mitogenic activity for cells of the osteoblastic lineage and enhances the differentiated function of the osteoblast (1, 2). It stimulates the expression of type I collagen and decreases the expression of collagenase 3, or matrix metalloproteinase 13, in osteoblasts (3, 4, 5). Consequently, IGF I increases bone matrix and decreases its degradation. In contrast, the effects of glucocorticoids are opposite those of IGF I, and they decrease osteoblastic cell proliferation, decrease type I collagen expression, and increase collagenase 3 expression by the osteoblast (6, 7, 8). In parallel with these actions, glucocorticoids decrease the expression of IGF I in osteoblasts, resulting in additional inhibitory effects on bone formation (9). In vivo, exposure to excessive glucocorticoids results in bone loss or osteopenia, and it is likely that the down-regulation of IGF I by these steroid hormones plays a role in this process.

Using cultures of osteoblasts derived from the sequential collagenase digestion of fetal rat calvaria (Ob cells), we demonstrated that the glucocorticoid cortisol decreases IGF I mRNA by approximately 50%, an effect mediated by decreasing gene transcription (9). The IGF I gene has two alternative promoters found in exons 1 and 2, and osteoblasts, like other extrahepatic tissues, predominantly express transcripts containing exon 1. The IGF I exon 1 promoter lacks classical eukaryotic promoter elements, such as CAAT or TATA boxes, and it has four transcription initiation sites (10, 11, 12). In osteoblasts, the third transcription start site is the major start site (9, 12). In transiently transfected rat osteoblastic cells, cortisol decreased the activity of rat IGF I exon 1 promoter-luciferase reporter gene constructs by 30%, and deletion analysis showed that the smallest cortisol-responsive fragment tested contained bps +34 to +192, relative to the first start site of transcription, and contained start sites 2 and 3. While further deletion analysis determined that the +34 to +142 region of the promoter was not responsive to cortisol, the exact element responsible for the glucocorticoid effect was not demonstrated (9).

In the present study, we extend our previous observations to determine the IGF I promoter sequences responsible for cortisol regulation in Ob cells, characterize the transcription factors interacting with these sequences, and analyze the regulation of these transcription factors by cortisol.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
EMSAs were used to screen the bp +34 to +192 fragment of the rat IGF I exon 1 promoter for cortisol-responsive elements. Sequential double-stranded 22- to 33-bp oligonucleotide probes spanning the region of interest were incubated with nuclear extracts from control or cortisol-treated Ob cells and subjected to electrophoresis on nondenaturing polyacrylamide gels. While specific binding of nuclear extract proteins to DNA was particularly noted with the +67 to +98 and the +120 to +141 probes, specific and cortisol-regulated DNA-protein complexes were observed only with the probe corresponding to bp +132 to +158 of the IGF I promoter (Fig. 1Go). There was increased binding of nuclear proteins from cortisol-treated osteoblasts to the +132 to +158 probe, and this effect was seen in extracts from cells treated with cortisol for 2 to 24 h (Fig. 2Go). In Fig. 2Go, the solid arrow indicates the protein-DNA complex increased most prominently in extracts from cortisol-treated cells.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 1. Specific and Cortisol-Regulated Binding of Ob Cell Nuclear Proteins Only to an IGF I Promoter Fragment Containing bp +132 to +158

No extract (0) or nuclear extracts from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for 6 h were incubated with [{gamma}-32P]-labeled oligonucleotides corresponding to regions of the IGF I exon 1 promoter, the sequences of which are provided in Materials and Methods. Excess (100-fold) unlabeled homologous oligonucleotides were used as competitors as indicated. DNA-protein complexes were fractionated by PAGE and visualized by autoradiography.

 


View larger version (73K):
[in this window]
[in a new window]
 
Figure 2. Increased Binding of Nuclear Proteins from Cortisol-Treated Ob cells to an IGF I Promoter Fragment Containing bp +132 to +158

No extract (0) or nuclear extracts from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for up to 24 h were incubated with [{gamma}-32P]-labeled +132 to +158 IGF I promoter oligonucleotides, the sequences of which are provided in Materials and Methods. DNA-protein complexes were fractionated by PAGE and visualized by autoradiography. The most prominent glucocorticoid-regulated complex is indicated by the arrow.

 
Analysis of the +132 to +158 sequence showed that it contained a sequence with identity to a consensus binding site for the CAAT/enhancer binding protein (C/EBP) family of transcription factors (MTTNCNNMA) (13). To confirm specificity of the DNA-protein interactions, a 3-bp mutation within the potential C/EBP binding site was constructed within the context of the +132 to +158 bp IGF I promoter fragment. In binding competition experiments this unlabeled mutant oligonucleotide did not compete for binding of Ob cell nuclear proteins to the labeled wild-type +132 to +158 bp fragment. In contrast, unlabeled wild-type +132 to +158 oligonucleotide efficiently competed for binding, particularly with the slowest migrating DNA-protein complexes, denoted by the arrow (Fig. 3Go). An oligonucleotide containing a consensus C/EBP binding site also competed for binding of protein to the +132 to +158 IGF I promoter fragment, while an oligonucleotide in which the consensus C/EBP binding site was mutated failed to compete. These data indicate that the C/EBP site is important for binding glucocorticoid-regulated nuclear factors and suggest that members of the C/EBP family of transcription factors are involved. In these competition experiments, we note that the faster migrating complexes are more abundant and appear to be specific, as they are partially competed by unlabeled wild-type oligonucleotides, but not by oligonucleotides containing a mutation in the C/EBP site (Fig. 3Go). These faster migrating complexes may contain C/EBP family members that have a higher affinity for the probe.



View larger version (100K):
[in this window]
[in a new window]
 
Figure 3. Competition for Binding of Ob Cell Nuclear Proteins to the +132 to +158 bp IGF I Promoter Fragment by Oligonucleotides Containing C/EBP Binding Sites

No extract (0) or nuclear extracts from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for 24 h were incubated with [{gamma}-32P]-labeled +132 to +158 bp IGF I promoter oligonucleotides. Excess (100-fold) unlabeled +132 to +158 bp IGF I promoter oligonucleotides (WT), a consensus C/EBP binding site (Cons), or cognate oligonucleotides containing mutations in the C/EBP binding site (MUT) were used as competitors. DNA-protein complexes were fractionated by PAGE and visualized by autoradiography. The most prominent glucocorticoid-regulated complex is indicated by the arrow. The C/EBP binding sites are underlined, and mutated bases are indicated in lowercase italic letters.

 
To confirm the functional importance of the +132 to +158 region, the same mutation that prevented competition in the mobility shift assays was introduced into the bp +34 to +192 IGF I exon 1 promoter-luciferase reporter gene construct. Wild-type and C/EBP mutant constructs were transiently transfected into Ob cells and treated with or without cortisol for 6 h. While activity of the wild-type +34 to +192 IGF I promoter was decreased by cortisol treatment (0.77 ± 0.04, cortisol/control, n = 6), activity of the mutant construct was not (Fig. 4Go). In addition, the basal activity of the mutant +34 to +192 IGF I promoter was higher than that of the wild-type promoter (P < 0.01), further indicating that this putative C/EBP binding site is a negative regulator of IGF I gene transcription. While the +34 to +192 IGF I promoter-luciferase gene construct does not exhibit strong promoter activity, the level of repression by glucocorticoid treatment is similar to that observed with larger fragments of the IGF I exon I promoter (9). As previously noted, cortisol decreases IGF I rate of transcription and heterogeneous nuclear RNA abundance in Ob cells by approximately 50% (9). The less-than-optimal response of the IGF I promoter-luciferase gene constructs to cortisol could be due to a lack of appropriate chromatin structure in the transiently transfected plasmid DNA, or the requirement of additional sequences.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Mutation of the +144 to +152 C/EBP Binding Site, in the Context of the +34 to +192 IGF I Promoter, Abolished Repression by Cortisol

Ob cells were transiently transfected with a luciferase reporter vector alone (pGL3-Basic) or with a chimeric construct containing a bp +34 to +192 fragment of the IGF I exon 1 promoter, without (wild type) or with mutations in the C/EBP binding site. To control for transfection efficiency, a cytomegalovirus ß-galactosidase expression vector was cotransfected. Cells were exposed to control medium (black bars) or cortisol at 1 µM (white bars) for 6 h and then harvested and assayed for luciferase and ß-galactosidase activity. Data shown are luciferase activity/ß-galactosidase activity, and are means ± SEM for six observations. *, Significantly different from respective control (P < 0.05).

 
There are six known members of the C/EBP family of transcription factors, and they bind DNA as homo- or heterodimers, interacting with similar sequence motifs (13). To determine the identity of the proteins interacting with the +132 to +158 IGF I probe, electrophoretic mobility supershift assays were performed. The +132 to +158 IGF I probe was incubated with nuclear extracts from Ob cells treated with or without cortisol, in the presence or absence of a C/EBP family pan-specific antibody. This antibody produced a supershift band in binding reactions containing extracts from cortisol- treated cells, indicating that members of the C/EBP family of transcription factors interact with the promoter fragment (Fig. 5Go). C/EBP {alpha}, ß, or {delta} specific antibodies caused a supershift in binding reactions containing nuclear extracts from cortisol-treated cells, while antibodies against C/EBP {alpha}, and to a lesser extent, those against C/EBP ß caused a supershift in binding reactions containing nuclear extracts from control cells (Fig. 5Go). These data suggest that C/EBP {alpha} and ß interact with the promoter element in the basal state, while C/EBP {delta} interacts with the sequence primarily when cells are treated with glucocorticoids. C/EBP {gamma} and {epsilon} specific antibodies were also tested in the supershift assay, but they failed to interact with nuclear proteins from control or cortisol-treated cells (data not shown). Antibodies against C/EBP {zeta} (CHOP 10) were not tested because they were unavailable. Overall, these data suggest that at least three members of the C/EBP family of transcription factors interact with the +132 to +158 IGF I promoter sequence.



View larger version (129K):
[in this window]
[in a new window]
 
Figure 5. C/EBP Proteins Associate with the bp +132 to +158 IGF I Promoter Fragment

No extract (0) or nuclear extracts from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for 24 h were incubated with [{gamma}-32P]-labeled oligonucleotides in the absence (-) or presence of nonspecific (IgG) antibodies, a C/EBP pan-specific antibody (pan), or specific antibodies against C/EBP {alpha}, ß, and {delta}. DNA-protein complexes were fractionated by PAGE and visualized by autoradiography. The most prominent glucocorticoid-regulated complex is indicated by the arrow.

 
Additional EMSAs were performed to determine whether candidate DNA binding proteins, other than members of the C/EBP family, interacted with the +132 to +158 region (Fig. 6Go). The GR has been shown to interact with DNA and with C/EBPs, and a potential half-glucocorticoid response element is adjacent to the C/EBP binding site (14). However, antibodies against the GR did not supershift +132 to +158 IGF I promoter-Ob protein complexes. While the GR has been shown to mediate the cooperative effects of signal transducer and activator of transcription (STAT) 5 and C/EBP ß, STAT-5 was not detected in the +132 to +158 IGF I promoter-Ob protein complex by supershift assay (15). A potential binding site for the transcription factor Oct-1 abuts the C/EBP binding site in the +132 to +158 IGF I promoter. Oct 1 has been shown to bind to a negative glucocorticoid response element in the GnRH promoter and to repress transcription of the IL-8 promoter (16, 17). However, antibodies against Oct-1 did not supershift +132 to +158 IGF I promoter-Ob protein complexes. A potential binding site for the transcriptional repressor Gfi-1 is also found within the +132 to +158 IGF I promoter fragment, but supershift assays did not demonstrate the presence of this transcription factor in the Ob protein-DNA complex (18).



View larger version (116K):
[in this window]
[in a new window]
 
Figure 6. C/EBP Proteins Are Associated with the bp +132 to +158 IGF I Promoter Fragment, While Other Candidate DNA Binding Proteins Are Not

No extract (0) or nuclear extracts from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for 24 h were incubated with [{gamma}-32P]-labeled oligonucleotides in the absence (-) or presence of nonspecific (IgG) antibodies, a C/EBP pan-specific antibody (C/EBP), or specific antibodies against GR, STAT 5B, Oct-1, or Gfi-1. DNA-protein complexes were fractionated by PAGE and visualized by autoradiography. The most prominent glucocorticoid-regulated complex is indicated by the arrow.

 
To determine whether cortisol regulates the expression of C/EBP transcripts in osteoblasts, Northern blot analysis of Ob cell RNA was performed (Fig. 7Go). C/EBP {alpha} mRNA was detectable in untreated and cortisol-treated cells, and its abundance was not significantly modified by glucocorticoids. Transcripts for C/EBP ß were observed in untreated cells and were modestly increased in cells treated with cortisol for 6 h (fold increase 1.6 ± 0.2, n = 7) or 24 h (fold increase 1.9 ± 0.3, n = 11). In contrast, cortisol rapidly and substantially induced C/EBP {delta} mRNA. C/EBP {delta} transcripts were induced 10.6 ± 1.4 (n = 7) fold as early as 2 h of treatment, and this induction was sustained for up to 24 h (fold increase 10.3 ± 0.8, n = 8). EMSAs performed with a labeled consensus C/EBP binding site oligonucleotide probe (data not shown) or with the +132 to +158 IGF I promoter fragment (Fig. 5Go) confirmed that C/EBP ß and C/EBP {delta} proteins were more abundant in extracts from cortisol-treated Ob cells. Further analysis of Ob cell RNA showed that C/EBP {epsilon} transcripts were barely detectable, and while Ob cells expressed C/EBP {gamma} and {zeta} mRNA, their abundance was not noticeably altered by treatment with cortisol for up to 24 h (data not shown).



View larger version (95K):
[in this window]
[in a new window]
 
Figure 7. Cortisol Regulates C/EBP mRNA Expression in Cultures of Ob Cells

Total RNA was isolated from Ob cells treated for up to 24 h with control medium (-) or with 1 µM cortisol (+). RNA was subjected to Northern blot analysis and hybridized with an [{alpha}32P]-labeled C/EBP {alpha}, ß, {delta} or GAPD cDNA, and visualized by autoradiography.

 
Since cortisol increases the binding of C/EBPs to a C/EBP binding site within the IGF I promoter, and increases the abundance of C/EBP {delta} and ß transcripts in Ob cells, the regulation of C/EBP {delta} and ß by cortisol was further characterized. To determine whether cortisol affects the stability of C/EBP ß or {delta} mRNA, Ob cell cultures were treated with or without cortisol for 15 min, after which transcription was arrested by the addition of the RNA polymerase II inhibitor 5,6-dichlorobenzimidazole riboside (DRB) (19). Total RNA was harvested at various times after DRB addition and subjected to Northern blot analysis and densitometry. These assays showed that the half-life of C/EBP ß mRNA in transcriptionally arrested osteoblasts is approximately 1 h, and that the stability of the transcript is not affected by cortisol (Fig. 8Go). In contrast, cortisol caused a significant stabilization of C/EBP {delta} mRNA, increasing its half-life from about 30 min to approximately 1 h. To determine whether there was a transcriptional component to C/EBP regulation by cortisol, a nuclear run off assay was performed using nuclei from Ob cells treated with or without cortisol for 1 h. This assay showed that cortisol induced C/EBP {delta} transcription by approximately 6-fold and C/EBP ß transcription by approximately 2-fold (Fig. 9Go). These data indicate that cortisol induces C/EBP ß by transcriptional mechanisms, and C/EBP {delta} by both transcriptional and posttranscriptional mechanisms.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 8. Cortisol Increases the Stability of C/EBP {delta} mRNA, Without Affecting the Stability of C/EBP ß mRNA

Ob cell cultures were treated with or without 1 µM cortisol for 15 min, after which transcription was arrested by the addition of 75 µM DRB. Total RNA was harvested at various times after DRB addition and subjected to Northern blot using [{alpha}32P]-labeled C/EBP ß or {delta} cDNA. Data were visualized by autoradiography and quantitated by densitometry. Data points represent the percent of C/EBP mRNA remaining after DRB addition and are the mean ± SEM of triplicate cultures. The slopes of the decay curves are not significantly different for C/EBP ß, while there is a significant difference between the decay curves for C/EBP {delta} (P < 0.01).

 


View larger version (62K):
[in this window]
[in a new window]
 
Figure 9. Cortisol Increases Transcription of C/EBP ß and {delta} in Cultures of Ob Cells

Nuclei were isolated from Ob cells exposed to control medium (-) or 1 µM cortisol (+) for 1 h. Nascent transcripts were labeled in vitro with [32P]-UTP, and labeled RNA was hybridized to immobilized cDNA for GAPD, C/EBP {alpha}, ß, and {delta}. pBluescript vector DNA was used as a control for nonspecific hybridization. Transcripts were visualized by autoadiography.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Our previous studies documented the transcriptional down-regulation of IGF I by glucocorticoids in osteoblasts, and these results indicated that the region of the gene responsible for this effect was within bp +34 to +192 of the exon 1 promoter (9). In the present study, we used transient transfection experiments to show that a binding site for the C/EBP family of transcription factors is responsible for the down-regulation of the IGF I promoter by the glucocorticoid cortisol under these experimental conditions. This C/EBP binding site lies between bp +144 and +152 and has identity to the consensus C/EBP binding sequence MTTNCNNMA (13). This region of the rat IGF I promoter also binds nuclear proteins from liver and is contained within a footprint named HS3C, which has the sense strand sequence CTTCTGCTTGCTAAATCTC (20).

Mutagenesis of three conserved bases within the regulated C/EBP binding site prevented down-regulation of the +34 to +192 IGF I promoter by cortisol. Further, mutation of the C/EBP binding site caused an increase in basal promoter activity, confirming that it is an inhibitory motif. Electrophoretic mobility supershift assays suggest that C/EBP {alpha} and, to a lesser extent, C/EBP ß interact with the glucocorticoid-regulated site in unstimulated Ob cells, while C/EBP {alpha}, ß, and {delta} interact with the binding site in cortisol-treated Ob cells. These data correlate with the previously suggested notion that, in liver and myelo-monocytic cells, C/EBP {alpha} and ß regulate constitutive gene expression and C/EBP ß and {delta} predominate in inducible gene expression (21, 22, 23, 24).

C/EBPs bind DNA as homo- or heterodimers, associating with each other through well conserved leucine zipper motifs in the C-terminal region of the protein. The DNA binding/nuclear translocation domain, adjacent to the leucine zipper, is also conserved among C/EBP family members, which recognize similar DNA sequences (13). The nonconserved N-terminal portion of the C/EBP molecules contain domains that can act as transcriptional activators or attenuators. Attenuator domains, in particular, have been described in C/EBP ß and {alpha}, and there is evidence that activation of C/EBP ß occurs through derepression, mediated by phosphorylation of the protein (25). The activity of C/EBP {delta} is also regulated by phosphorylation, since dephosphorylation severely inhibits its DNA binding and transactivation potential (26). In addition, use of alternate translation initiation sites within the C/EBP ß mRNA can result in a 32-kDa activator (LAP, liver-enriched activator protein) or a 16-kDa inhibitory (LIP, liver-enriched inhibitory protein) isoform of the protein (13). LIP can form heterodimers and inactivate LAP so that the activity of C/EBP ß is dependent on the LAP/LIP protein isoform generated.

While most reports describe induction of gene expression by C/EBPs, the functional and EMSA data indicate that, under the experimental conditions used, C/EBPs and their cognate binding site are associated with repression of the IGF I promoter in basal and glucocorticoid-treated osteoblasts. Interestingly, an atypical C/EBP binding site in the rat IGF I exon 1 promoter, distal to the glucocorticoid-responsive site and corresponding to footprint HS3D, binds C/EBP {delta} in response to treatment of osteoblasts with PGs, leading to a stimulation of gene transcription (27). While the presence of both C/EBP-repressible and C/EBP-inducible binding sites within the same promoter seems unusual, it is not unprecedented. Like the IGF I promoter, the rat {alpha}1-acid glycoprotein promoter has a 5'-C/EBP binding site that represses promoter activity and a 3'-C/EBP binding site responsible for stimulation of transcriptional activity (28). In the IGF I promoter, the glucocorticoid-responsive C/EBP binding site is immediately adjacent to the third transcriptional start site, which is preferentially used in osteoblastic cells. It is possible that C/EBPs may occlude basal transcriptional machinery or that the phosphorylation state of the transcription factors may cause them to have attenuator rather than stimulatory activity (25, 26, 29). In addition, the stoichiometry of the C/EBP isoforms, either hetero- or homodimers, may affect their activity on a particular DNA sequence. Osteoblastic cells express six members of the C/EBP family of transcription factors, and it is likely that appropriate stoichiometry is necessary for appropriate regulation (our unpublished data).

Glucocorticoid induction of C/EBP ß and {delta} has been shown in nonskeletal cell systems (30, 31, 32). In fact, transcriptional induction of C/EBP ß and {delta} was reported in a rat intestinal epithelial crypt cell line (30). However, our data showing stabilization of C/EBP {delta} mRNA by cortisol, in conjunction with its ability to stimulate transcription of C/EBP ß and {delta} in osteoblasts, is novel. Glucocorticoids stimulate apoptosis in a number of cell types, including mature osteoblasts, and glucocorticoids decrease expression of IGF I, which has an antiapoptotic effect on cells (9, 33, 34, 35). Coincidentally, C/EBPs have been postulated to play a role in apoptosis (36, 37). However, it is important to note that the effects of glucocorticoids on osteoblastic apoptosis can be dependent on the state of cell maturation. As osteoblastic cells mature, they mineralize and undergo apoptosis, and glucocorticoids can prevent osteoblastic maturation and the consequent cellular death (38).

The anabolic effect of locally produced IGF I plays a central role in the maintenance of bone mass. The effects of glucocorticoids on bone are opposite to those of IGF I, suggesting that some of the actions of glucocorticoids may be mediated by down-regulation of osteoblastic IGF I expression. Although in vitro studies have limitations, they generate useful data on potential mechanisms of glucocorticoid action in vivo, and our data suggest a role for C/EBPs in cortisol regulation of the IGF I promoter. In conclusion, cortisol decreases IGF I transcription in osteoblastic cells, and the inhibition of IGF I by cortisol may play a central role in the effects of cortisol on bone formation and remodeling.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
The culture method used was described in detail previously (39). Parietal bones were obtained from 22-d-old fetal rats immediately after the mothers were killed by blunt trauma to the nuchal area. This project was approved by the Animal Care and Use Committee of Saint Francis Hospital and Medical Center. Cells were obtained by five sequential digestions of the parietal bone using bacterial collagenase (CLS II, Worthington Biochemical Corp., Freehold, NJ). Cell populations harvested from the third to the fifth digestions were previously shown to express osteoblastic characteristics and were cultured as a pool (39). Ob cells were plated at a density of 8,000–12,000 cells/cm2 and cultured in a humidified 5% CO2 incubator at 37 C. Cells were cultured in DMEM supplemented with nonessential amino acids, 10 mM HEPES (Life Technologies, Inc., Gaithersburg, MD), and 10% FBS (Summit, Fort Collins, CO). For nuclear protein analysis and for Northern analysis, cells were grown to confluence (~50,000 cells/cm2), transferred to serum-free medium for 20–24 h, and exposed to control medium or 1 µM cortisol in the absence of serum for 2–24 h as indicated in the text and legends. For the nuclear run-off assay, subconfluent cultures of Ob cells were treated with trypsin, passaged at a 1:8 dilution, and allowed to grow to confluence (9). Confluent cultures were serum-deprived and exposed to control medium or 1 µM cortisol in the absence of serum for 1 h. Cortisol and DRB (Sigma, St. Louis, MO) were dissolved in ethanol and diluted in culture medium. At dilutions less than 1:10,000, an equal volume of ethanol was added to control cultures.

Transient Transfections
To determine changes in promoter activity, an IGF I exon 1 promoter fragment spanning bp +34 to +192 was subcloned into the promoterless luciferase reporter vector pGL3-Basic (Promega Corp., Madison, WI) (9, 10). Ob cells were cultured to approximately 70% confluence and transiently transfected with IGF I promoter constructs using liposome/nucleic acid complexes (TransFast, Promega Corp.), according to the manufacturer’s instructions. Cotransfection with a construct containing the cytomegalovirus promoter-driven ß-galactosidase gene (CLONTECH Laboratories, Inc., Palo Alto, CA) was used to control for transfection efficiency. Cells were allowed to recover in serum-containing medium for 24 h, serum deprived for 20–24 h, and exposed to control or cortisol-containing medium for 6 h. In previous studies, this duration of glucocorticoid exposure resulted in maximal responsiveness of the IGF-I promoter (9). Cells were washed with PBS and harvested in reporter lysis buffer (Promega Corp.). Luciferase activity was measured using a luciferase assay kit (Promega Corp.), and ß-galactosidase activity was measured using Galacton reagent (Tropix, Bedford, MA), both in accordance with manufacturer’s instructions. Luciferase activity was corrected for ß-galactosidase activity.

Site-Directed Mutagenesis
Site-directed mutagenesis of the C/EBP binding site in the bp +34 to +192 IGF I exon 1 promoter was achieved by overlap extension, using PCR (40). For this purpose, mutant sense primer (ATCCCTCTTCTGCTTGATAGCTCTCAC; mutated bases are underlined) and the corresponding antisense primers were designed, and the +34 to +192 IGF I promoter in pGL-3 Basic was used as a template. The identity of the wild-type and mutated constructs was confirmed by DNA sequence analysis (Sequenase Version 2.0 DNA sequencing kit, United States Biochemical Corp., Cleveland, OH).

EMSA
For gel shift assays, nuclear extracts from control and cortisol-treated cultures were prepared as described (41). Cells were washed with PBS, suspended in 10 mM HEPES/KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol buffer, allowed to swell on ice for 15 min, and lysed with 10% Nonidet P-40 (Sigma). After centrifugation, the nuclear pellet was resuspended in a HEPES/KOH buffer in the presence of protease inhibitors at 4 C, incubated for 30 min and centrifuged, and the supernatant was stored at -70 C. Protein concentrations were determined by DC Protein Assay in accordance with manufacturer’s instructions (Bio-Rad Laboratories, Inc., Hercules, CA). The IGF I exon I promoter oligonucleotides used had the sense strand sequence TGCCAGAAGAGGGAGAGAGAGAGAAGGCGAATG corresponding to +34 to +66, TTCCCCCAGCTGTTTCCTGTCTACAGTGTCTG corresponding to +67 to +98, TGTTTTGTAGATAAATGTGAGGATTTTCTC corresponding to +99 to +128, GATTTTCTCTAAATCCCTCCTC corresponding to +120 to +141, and ATCCCTCTTCGTCTTGCTAAATCTCAC corresponding to +132 to +158. The +132 to +158 C/EBP mutant oligonucleotide had the sense strand sequence ATCCCTCTTCTGCTTGATAGCTCTCAC (mutated bases are underlined) (Life Technologies, Inc.). Oligonucleotides containing a consensus C/EBP binding site and its mutant were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Synthetic oligonucleotides were labeled with [{gamma}-32P]-ATP using T4 polynucleotide kinase. Nuclear extracts and labeled oligonucleotides were incubated for 20 min at room temperature in 10 mM Tris buffer, pH 7.5, containing 1 µg of poly (dI-dC). The specificity of binding was determined by the addition of homologous or mutated unlabeled synthetic oligonucleotides in 100-fold excess (41). DNA-protein complexes were resolved on nondenaturing, nonreducing 4% polyacrylamide gels, and the complexes were visualized by autoradiography. For gel supershift assays, labeled oligonucleotides were incubated with nuclear extracts for 20 min, followed by incubation for 1 h at room temperature with polyclonal antibodies (all from Santa Cruz Biotechnology, Inc.), before electrophoretic resolution.

Northern Blot Analysis
Total cellular RNA was isolated using a RNeasy kit, following manufacturer’s instructions (QIAGEN, Chatsworth, CA). RNA was quantitated by spectrometry, and equal amounts of RNA were denatured and electrophoresed through formaldehyde agarose gels. Gels were stained with ethidium bromide to visualize RNA standards and ribosomal RNA, documenting equal RNA loading of the samples. The RNA was then blotted onto Gene Screen Plus-charged nylon (DuPont Merck Pharmaceutical Co., Wilmington, DE), and uniformity of transfer was documented by revisualization of ribosomal RNA. Restriction fragments of rat C/EBP {alpha}, ß, and {delta} cDNAs (kindly provided by S. L. McKnight, University of Texas Southwestern Medical Center, Dallas, TX) and mouse cDNAs for C/EBP {gamma} and {zeta}, and human cDNA for C/EBP {epsilon} (kindly provided by H. P. Koeffler, University of California, Los Angeles, CA), were purified by agarose gel electrophoresis (42, 43, 44). cDNAs were labeled with [{alpha}-32P] deoxy-CTP (dCTP) and [{alpha}-32P] deoxy-ATP (dATP) (50 µCi each, specific activity 3,000 Ci/mmol; DuPont Merck Pharmaceutical Co.) using the random hexanucleotide-primed second strand synthesis method (45). Hybridizations were carried out at 42 C for 16–72 h, and posthybridization washes were performed in 0.5x saline-sodium citrate at 65 C. The blots were stripped and rehybridized with an [{alpha}-32P]-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA. The bound radioactive material was visualized by autoradiography on X-AR5 film (Eastman Kodak Co., Rochester, NY) employing Cronex Lightning Plus (DuPont Merck Pharmaceutical Co.) or Biomax MS (Eastman Kodak Co.) intensifying screens. Relative hybridization levels were determined by densitometry. Northern analyses shown are representative of three or more cultures.

Nuclear Run-Off Assay
Nuclei were isolated by Dounce homogenization in a Tris-HCl buffer containing 0.5% Igepal (Sigma). Nascent transcripts were labeled by incubation of nuclei in a reaction buffer containing 250 µCi 32P-UTP (800 Ci/mM, DuPont Merck Pharmaceutical Co.). RNA was isolated by treatment with deoxyribonuclease I and proteinase K, followed by ethanol precipitation (9, 46). Linearized plasmid DNA containing about 1 µg cDNA was immobilized onto GeneScreen Plus by slot blotting, according to the manufacturer’s instructions. Equal counts per minute of 32P-RNA from each sample were hybridized to cDNA using the same conditions as those employed for Northern blot analysis and were visualized by autoradiography.

Statistical Methods
Data are presented as means ± SEM. Statistical differences were determined by ANOVA and post hoc examination by the Sheffé test (47). Slopes of RNA decay curves were analyzed by the method of Sokal and Rohlf (48).


    ACKNOWLEDGMENTS
 
The authors thank Dr. D. LeRoith for providing an IGF I promoter construct, S. L. McKnight for providing C/EBP {alpha}, ß, and {delta} cDNAs, H. P. Koeffler for providing C/EBP {epsilon} cDNA, Susan Bankowski and Susan O’Lone for technical assistance, and Ms. Karen Berrelli for secretarial help.


    FOOTNOTES
 
This work was supported by Grant DK-45227 from the National Institute of Diabetes and Digestive and Kidney Diseases.

Abbreviations: C/EBP, CAAT/enhancer binding protein; DRB, 5,6-dichlorobenzimidazole riboside; GAPD, glyceraldehyde-3-phosphate dehydrogenase; LAP, liver-enriched activator protein; LIP, liver-enriched inhibitory protein; STAT, signal transducer and activator of transcription

Received for publication January 9, 2001. Accepted for publication June 12, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Hock JM, Centrella M, Canalis E 1988 Insulin-like growth factor I (IGF-I) has independent effects on bone matrix formation and cell replication. Endocrinology 122:254–260[Abstract/Free Full Text]
  2. Delany AM, Pash JM, Canalis E 1994 Cellular and clinical perspectives on skeletal insulin-like growth factor I. J Cell Biochem 55:328–333[CrossRef][Medline]
  3. McCarthy T, Centrella M, Canalis E 1989 Regulatory effects of insulin-like growth factor I and II on bone collagen synthesis in rat calvarial cultures. Endocrinology 124:301–309[Abstract/Free Full Text]
  4. Rydziel S, Delany AM, Canalis E 1997 Insulin-like growth factor I inhibits the transcription of collagenase 3 in osteoblast cultures. J Cell Biochem 67:176–183[CrossRef][Medline]
  5. Canalis E, Rydziel S, Delany AM, Varghese S, Jeffrey JJ 1995 Insulin-like growth factors inhibit interstitial collagenase synthesis in bone cell cultures. Endocrinology 136:1348–1354[Abstract]
  6. Canalis E 1996 Implications to glucocorticoid-induced osteoporosis. J Clin Endocrinol Metab 81:3441–3447[CrossRef][Medline]
  7. Delany AM, Gabbitas BY, Canalis E 1995 Cortisol down-regulates osteoblast {alpha}1 (I) procollagen mRNA by transcriptional and post-transcriptional mechanisms. J Cell Biochem 57:488–494[CrossRef][Medline]
  8. Delany AM, Jeffrey JJ, Rydziel S, Canalis E 1995 Cortisol increases interstitial collagenase expression in osteoblasts by post-transcriptional mechanisms. J Biol Chem 270:26607–26612[Abstract/Free Full Text]
  9. Delany AM, Canalis E 1995 Transcriptional repression of insulin-like growth factor I by glucocorticoids in rat bone cells. Endocrinology 136:4776–4781[Abstract]
  10. Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated regions in mRNAs encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:8946–8950[Abstract/Free Full Text]
  11. Hall LJ, Kajimoto Y, Bichell D, et al. 1992 Functional analysis of the rat insulin-like growth factor I gene and identification of an IGF-I gene promoter. DNA Cell Biol 11:301–313[Medline]
  12. Pash JM, Delany AM, Adamo ML, Roberts Jr CT, LeRoith D, Canalis E 1995 Regulation of insulin-like growth factor I transcription by prostaglandin E2 in osteoblast cells. Endocrinology 136:33–38[Abstract]
  13. Wedel A, Ziegler-Heitbrock HW 1995 The C/EBP family of transcription factors. Immunobiology 193:171–185[Medline]
  14. Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat {alpha} 1-acid glycoprotein gene via direct protein-protein interaction. Mol Biol Cell 13:1854–1862
  15. Wyszomierski SL, Rosen JM 2001 Cooperative effects of STAT5 (signal transducer and activator of transcription 5) and C/EBP ß (CAAT/enhancer-binding protein-ß) on ß-casein gene transcription are mediated by the glucocorticoid receptor. Mol Endocrinol 15:288–240
  16. Chandran UR, Attard B, Friedman R, Zheng Z, Roberts JL, DeFranco DB 1996 Glucocorticoid repression of the mouse gonadotropin-releasing hormone gene is mediated by promoter elements that are recognized by heteromeric complexes containing glucocorticoid receptor. J Biol Chem 271:20412–20420[Abstract/Free Full Text]
  17. Wu GD, Lai EJ, Huang N, Wen X 1997 Oct-1 and CAAT/enhnacer-binding protein (C/EBP) bind to overlapping elements within the interleukin-8 promoter. Role of Oct-1 as a transcriptional repressor. J Biol Chem 272:2396–2403[Abstract/Free Full Text]
  18. Zweider-McKay PA, Grimes HL, Flubacher MM, Tsichlis PN 1996 Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor. Mol Cell Biol 16:4024–4034[Abstract/Free Full Text]
  19. Zandomeni R, Bunick D, Ackerman S, Mittleman B, Weinmann R 1983 Mechanism of action of DRB. III. Effect on specific in vitro initiation of transcription. J Mol Biol 167:561–574[CrossRef][Medline]
  20. Thomas MJ, Kikuchi K, Bichell DP, Rotwein P 1994 Rapid activation of rat insulin-like growth factor-I gene transcription by growth hormone reveals no alterations in deoxyribonucleic acid-protein interactions within the major promoter. Endocrinology 135:1584–1592[Abstract]
  21. Ray A, Ray BK 1994 Serum amyloid gene expression under acute-phase conditions involves participation of inducible C/EBP-ß and C/EBP-{delta} and their activation by phosphorylation. Mol Cell Biol 14:4324–4332[Abstract/Free Full Text]
  22. Kinoshita S, Akira S, Kishimoto T 1992 A member of the C/EBP family, NF-IL6 ß, forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc Natl Acad Sci USA 89:1473–1476[Abstract/Free Full Text]
  23. Sylvester SL, ap Rhys CM, Leuthy-Martindale JD, Holbrook NJ 1994 Induction of GADD153, a CCAAT/enhancer-binding protein (C/EBP)-related gene during the acute phase response in rats. Evidence for the involvement of C/EBPs in regulating its expression. J Biol Chem 269:20119–20125[Abstract/Free Full Text]
  24. Lin FT, Lane MD 1992 Antisense CCAAT/enhancer-binding protein RNA suppresses coordinate gene expression and triglyceride accumulation during differentiation of 3T3–L1 preadipocytes. Genes Dev 6:533–544[Abstract/Free Full Text]
  25. Kowenz-Leutz E, Twamley G, Ansieau S, Leutz A 1994 Novel mechanism of C/EBP ß (NF-M) transcriptional control: activation through derepression. Genes Dev 8:2781–2791[Abstract/Free Full Text]
  26. Ray BK, Ray A 1994 Expression of the gene encoding {alpha} 1-acid glycoprotein in rabbit liver under acute-phase conditions involves induction and activation of ß and {delta} CCAAT-enhancer-binding proteins. Eur J Biochem 222:891–900[Medline]
  27. Umayahara Y, Ji C, Centrella M, Rotwein P, McCarthy TL 1997 CCAAT/enhancer binding protein-delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone. J Biol Chem 272:31793–31800[Abstract/Free Full Text]
  28. Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat {alpha} 1-acid glycoprotein gene via direct protein-protein interaction. Mol Cell Biol 13:1854–1862[Abstract/Free Full Text]
  29. Ray A, LaForge KS, Sehgal PB 1990 On the mechanism for efficient repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box, and RNA start site (Inr motif) occlusion. Mol Cell Biol 10:5736–5746[Abstract/Free Full Text]
  30. Boudreau F, Blais S, Asselin C 1996 Regulation of CCAAT/enhancer binding protein isoforms by serum and glucocorticoids in the rat intestinal epithelial crypt cell line IEC-6. Exp Cell Res 222:1–9[CrossRef][Medline]
  31. Gotoh T, Chowdhury S, Takiguchi M, Mori M 1997 The glucocorticoid-responsive gene cascade. Activation of the rat arginase gene through induction of C/EBP ß. J Biol Chem 272:3694–3698[Abstract/Free Full Text]
  32. Matsuno F, Chowdhury S, Gotoh T, et al. 1996 Induction of the C/EBP ß gene by dexamethasone and glucagon in primary-cultured rat hepatocytes. J Biochem 119:524–532[Abstract/Free Full Text]
  33. Hill PA, Tumber A, Meikle MC 1997 Multiple extracellular signals promote osteoblast survival and apoptosis. Endocrinology 138:3849–3858[Abstract/Free Full Text]
  34. McColl KS, He H, Zhong H, Whitacre CM, Berger NA, Distelhorst CW 1998 Apoptosis induction by the glucocorticoid hormone dexamethasone and the calcium-ATPase inhibitor thapsigargin involves Bc1–2 regulated caspase activation. Mol Cell Endocrinol 139:229–238[CrossRef][Medline]
  35. Weinstein RS, Jilka RL, Parfitt AM, Manolagas SC 1998 Inhibition of osteoblastogenesis and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids. Potential mechanisms of their deleterious effects on bone. J Clin Invest 102:274–282[Medline]
  36. Zhu MS, Liu DG, Cheng HQ, Xu XY, Li ZP 1997 Expression of exogenous NF-IL6 induces apoptosis in Sp2/0-Ag14 myeloma cells. DNA Cell Biol 16:127–135[Medline]
  37. Gigliotti AP, DeWille JW 1998 Lactation status influences expression of CCAAT/enhancer binding protein isoform mRNA in the mouse mammary gland. J Cell Physiol 174:232–239[CrossRef][Medline]
  38. Pereira RMR, Delany AM, Canalis E 2001 Cortisol inhibits the differentiation and apoptosis of osteoblasts in culture. Bone 28:484–490[Medline]
  39. McCarthy TL, Centrella M, Canalis E 1988 Further biochemical and molecular characterization of primary rat parietal bone cell cultures. J Bone Miner Res 3:401–408[Medline]
  40. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  41. Scott V, Clark AR, Docherty K 1994 The gel retardation assay. In: Harwood AJ, ed. Protocols for gene analysis, vol 31. Totowa, NJ: Humana Press, Inc.; 339–347
  42. Cao Z, Umek RM, McKnight SL 1991 Regulated expression of three C/EBP isoforms during adipose conversion of 3T3–L1 cells. Genes Dev 5:1538–1552[Abstract/Free Full Text]
  43. Chumakov AM, Grillier I, Chumakova E, Chih D, Slater J, Koeffler HP 1997 Cloning of the novel human myeloid-cell-specific C/EBP-epsilon transcription factor. Mol Cell Biol 17:1375–1386[Abstract/Free Full Text]
  44. Lennon G, Auffray C, Polymeropoulos M, Soares MB 1996 The I.M.A.G.E. consortium: an integrated molecular analysis on genomes and their expression. Genomics 33:151–152[CrossRef][Medline]
  45. Feinberg AP, Vogelstein B 1984 A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 137:266–267[CrossRef][Medline]
  46. Greenberg ME, Ziff EB 1984 Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 311:433–438[CrossRef][Medline]
  47. Wall FJ 1986 Statistical data analysis handbook, 1st ed. New York: McGraw-Hill
  48. Sokal RR, Rohlf FJ 1981 Biometry, 2nd ed. San Francisco, CA: Freeman



This article has been cited by other articles:


Home page
Reproductive SciencesHome page
N. E. Schlabritz-Loutsevitch, J. C. Lopez-Alvarenga, A. G. Comuzzie, M. M. Miller, S. P. Ford, C. Li, G. B. Hubbard, R. J. Ferry Jr, and P. W. Nathanielsz
The Prolonged Effect of Repeated Maternal Glucocorticoid Exposure on the Maternal and Fetal Leptin/Insulin-like Growth Factor Axis in Papio species
Reproductive Sciences, March 1, 2009; 16(3): 308 - 319.
[Abstract] [PDF]


Home page
Endocr. Rev.Home page
A. Giustina, G. Mazziotti, and E. Canalis
Growth Hormone, Insulin-Like Growth Factors, and the Skeleton
Endocr. Rev., August 1, 2008; 29(5): 535 - 559.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Wu, W. Zhao, J. Zhao, J. Pan, Q. Wu, Y. Zhang, W. A. Bauman, and C. P. Cardozo
Identification of Androgen Response Elements in the Insulin-Like Growth Factor I Upstream Promoter
Endocrinology, June 1, 2007; 148(6): 2984 - 2993.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang
Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass
Endocrinology, May 1, 2005; 146(5): 2415 - 2423.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M.-F. Iu, H. Kaji, H. Sowa, J. Naito, T. Sugimoto, and K. Chihara
Dexamethasone suppresses Smad3 pathway in osteoblastic cells
J. Endocrinol., April 1, 2005; 185(1): 131 - 138.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Eijken, M. Hewison, M. S. Cooper, F. H. de Jong, H. Chiba, P. M. Stewart, A. G. Uitterlinden, H. A. P. Pols, and J. P. T. M. van Leeuwen
11{beta}-Hydroxysteroid Dehydrogenase Expression and Glucocorticoid Synthesis Are Directed by a Molecular Switch during Osteoblast Differentiation
Mol. Endocrinol., March 1, 2005; 19(3): 621 - 631.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol., January 1, 2005; 25(1): 472 - 487.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Koutsilieris, C. S. Mitsiades, J. Bogdanos, T. Dimopoulos, D. Karamanolakis, C. Milathianakis, and A. Tsintavis
Combination of Somatostatin Analog, Dexamethasone, and Standard Androgen Ablation Therapy in Stage D3 Prostate Cancer Patients with Bone Metastases
Clin. Cancer Res., July 1, 2004; 10(13): 4398 - 4405.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. C. Pereira, A. M. Delany, and E. Canalis
CCAAT/Enhancer Binding Protein Homologous Protein (DDIT3) Induces Osteoblastic Cell Differentiation
Endocrinology, April 1, 2004; 145(4): 1952 - 1960.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Sciaudone, E. Gazzerro, L. Priest, A. M. Delany, and E. Canalis
Notch 1 Impairs Osteoblastic Cell Differentiation
Endocrinology, December 1, 2003; 144(12): 5631 - 5639.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Delany, I. Kalajzic, A. D. Bradshaw, E. H. Sage, and E. Canalis
Osteonectin-Null Mutation Compromises Osteoblast Formation, Maturation, and Survival
Endocrinology, June 1, 2003; 144(6): 2588 - 2596.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev., April 1, 2003; 24(2): 218 - 235.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Canalis and A. Giustina
Glucocorticoid-Induced Osteoporosis: Summary of a Workshop
J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5681 - 5685.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delany, A. M.
Right arrow Articles by Canalis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delany, A. M.
Right arrow Articles by Canalis, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals