Molecular Endocrinology 15 (10): 1781-1789
Copyright © 2001 by The Endocrine Society
Glucocorticoid Suppression of IGF I Transcription in Osteoblasts
Anne M. Delany,
Deena Durant and
Ernesto Canalis
From the Department of Research (A.M.D., D.D., E.C.), Saint Francis
Hospital and Medical Center, Hartford, Connecticut 06105; and The
University of Connecticut School of Medicine (A.M.D., E.C.),
Farmington, Connecticut 06030
Address all correspondence and requests for reprints to: Anne M. Delany, Ph.D., Department of Research, Saint Francis Hospital and Medical Center, 114 Woodland Street, Hartford, Connecticut 06105-1299. E-Mail: adelany@stfranciscare.org.
 |
ABSTRACT
|
|---|
Glucocorticoids have profound effects on bone formation,
decreasing IGF I transcription in osteoblasts, but the mechanisms
involved are poorly understood. We previously showed that the bp +34 to
+192 region of the rat IGF I exon 1 promoter was responsible for
repression of IGF I transcription by cortisol in cultures of
osteoblasts from fetal rat calvariae (Ob cells). Here, site-directed
mutagenesis was used to show that a binding site for members of the
CAAT/enhancer binding protein family of transcription factors,
within the +132 to +158 region of the promoter, mediates this
glucocorticoid effect. EMSAs demonstrated that cortisol increased
binding of osteoblast nuclear proteins to the +132 to +158 region of
the IGF I promoter. Supershift assays showed that CAAT/enhancer binding
protein
, ß, and
interact with this sequence, and binding of
CAAT/enhancer binding protein
, in particular, was increased in the
presence of cortisol. Northern blot analysis showed that CAAT/enhancer
binding protein
and ß transcripts were increased by cortisol in
Ob cells. Further, cortisol increased the transcription of these genes
and increased the stability of CAAT/enhancer binding protein
mRNA.
In conclusion, cortisol represses IGF I transcription in osteoblasts,
and CAAT/enhancer binding proteins appear to play a role in this
effect.
 |
INTRODUCTION
|
|---|
SKELETAL CELLS SYNTHESIZE growth factors that
can modulate the replication, differentiation, and activity of cells of
the osteoblast and osteoclast lineages, and one of the most prevalent
growth factors in bone is IGF I (1). Secreted primarily by
osteoblasts, IGF I has modest mitogenic activity for cells of the
osteoblastic lineage and enhances the differentiated function of the
osteoblast (1, 2). It stimulates the expression of type I
collagen and decreases the expression of collagenase 3, or matrix
metalloproteinase 13, in osteoblasts (3, 4, 5). Consequently,
IGF I increases bone matrix and decreases its degradation. In contrast,
the effects of glucocorticoids are opposite those of IGF I, and they
decrease osteoblastic cell proliferation, decrease type I collagen
expression, and increase collagenase 3 expression by the osteoblast
(6, 7, 8). In parallel with these actions, glucocorticoids
decrease the expression of IGF I in osteoblasts, resulting in
additional inhibitory effects on bone formation (9).
In vivo, exposure to excessive glucocorticoids
results in bone loss or osteopenia, and it is likely that the
down-regulation of IGF I by these steroid hormones plays a role in this
process.
Using cultures of osteoblasts derived from the sequential
collagenase digestion of fetal rat calvaria (Ob cells), we demonstrated
that the glucocorticoid cortisol decreases IGF I mRNA by approximately
50%, an effect mediated by decreasing gene transcription
(9). The IGF I gene has two alternative promoters found in
exons 1 and 2, and osteoblasts, like other extrahepatic tissues,
predominantly express transcripts containing exon 1. The IGF I exon 1
promoter lacks classical eukaryotic promoter elements, such as CAAT or
TATA boxes, and it has four transcription initiation sites
(10, 11, 12). In osteoblasts, the third transcription start
site is the major start site (9, 12). In transiently
transfected rat osteoblastic cells, cortisol decreased the activity of
rat IGF I exon 1 promoter-luciferase reporter gene constructs by 30%,
and deletion analysis showed that the smallest cortisol-responsive
fragment tested contained bps +34 to +192, relative to the first start
site of transcription, and contained start sites 2 and 3. While further
deletion analysis determined that the +34 to +142 region of the
promoter was not responsive to cortisol, the exact element
responsible for the glucocorticoid effect was not demonstrated
(9).
In the present study, we extend our previous observations to determine
the IGF I promoter sequences responsible for cortisol regulation in Ob
cells, characterize the transcription factors interacting with these
sequences, and analyze the regulation of these transcription factors by
cortisol.
 |
RESULTS
|
|---|
EMSAs were used to screen the bp +34 to +192 fragment of the rat
IGF I exon 1 promoter for cortisol-responsive elements. Sequential
double-stranded 22- to 33-bp oligonucleotide probes spanning the region
of interest were incubated with nuclear extracts from control or
cortisol-treated Ob cells and subjected to electrophoresis on
nondenaturing polyacrylamide gels. While specific binding of nuclear
extract proteins to DNA was particularly noted with the +67 to +98 and
the +120 to +141 probes, specific and cortisol-regulated DNA-protein
complexes were observed only with the probe corresponding to bp +132 to
+158 of the IGF I promoter (Fig. 1
). There
was increased binding of nuclear proteins from cortisol-treated
osteoblasts to the +132 to +158 probe, and this effect was seen in
extracts from cells treated with cortisol for 2 to 24 h (Fig. 2
). In Fig. 2
, the solid arrow
indicates the protein-DNA complex increased most prominently in
extracts from cortisol-treated cells.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 1. Specific and Cortisol-Regulated Binding of Ob Cell
Nuclear Proteins Only to an IGF I Promoter Fragment Containing bp +132
to +158
No extract (0) or nuclear extracts from Ob cells exposed
to control medium (-) or 1 µM cortisol (+) for 6 h
were incubated with [ -32P]-labeled oligonucleotides
corresponding to regions of the IGF I exon 1 promoter, the sequences of
which are provided in Materials and Methods. Excess
(100-fold) unlabeled homologous oligonucleotides were used as
competitors as indicated. DNA-protein complexes were fractionated by
PAGE and visualized by autoradiography.
|
|

View larger version (73K):
[in this window]
[in a new window]
|
Figure 2. Increased Binding of Nuclear Proteins from
Cortisol-Treated Ob cells to an IGF I Promoter Fragment Containing bp
+132 to +158
No extract (0) or nuclear extracts from Ob cells exposed
to control medium (-) or 1 µM cortisol (+) for up to
24 h were incubated with [ -32P]-labeled +132 to
+158 IGF I promoter oligonucleotides, the sequences of which are
provided in Materials and Methods. DNA-protein complexes
were fractionated by PAGE and visualized by autoradiography. The most
prominent glucocorticoid-regulated complex is indicated by the
arrow.
|
|
Analysis of the +132 to +158 sequence showed that it contained a
sequence with identity to a consensus binding site for the
CAAT/enhancer binding protein (C/EBP) family of transcription factors
(MTTNCNNMA) (13). To confirm specificity of the
DNA-protein interactions, a 3-bp mutation within the potential C/EBP
binding site was constructed within the context of the +132 to +158 bp
IGF I promoter fragment. In binding competition experiments this
unlabeled mutant oligonucleotide did not compete for binding of Ob cell
nuclear proteins to the labeled wild-type +132 to +158 bp fragment. In
contrast, unlabeled wild-type +132 to +158 oligonucleotide efficiently
competed for binding, particularly with the slowest migrating
DNA-protein complexes, denoted by the arrow (Fig. 3
). An oligonucleotide containing a consensus
C/EBP binding site also competed for binding of protein to the +132 to
+158 IGF I promoter fragment, while an oligonucleotide in which the
consensus C/EBP binding site was mutated failed to compete. These data
indicate that the C/EBP site is important for binding
glucocorticoid-regulated nuclear factors and suggest that members of
the C/EBP family of transcription factors are involved. In these
competition experiments, we note that the faster migrating complexes
are more abundant and appear to be specific, as they are partially
competed by unlabeled wild-type oligonucleotides, but not by
oligonucleotides containing a mutation in the C/EBP site (Fig. 3
).
These faster migrating complexes may contain C/EBP family members that
have a higher affinity for the probe.

View larger version (100K):
[in this window]
[in a new window]
|
Figure 3. Competition for Binding of Ob Cell Nuclear Proteins
to the +132 to +158 bp IGF I Promoter Fragment by Oligonucleotides
Containing C/EBP Binding Sites
No extract (0) or nuclear extracts from Ob cells exposed
to control medium (-) or 1 µM cortisol (+) for 24 h
were incubated with [ -32P]-labeled +132 to +158 bp IGF
I promoter oligonucleotides. Excess (100-fold) unlabeled +132 to +158
bp IGF I promoter oligonucleotides (WT), a consensus C/EBP binding site
(Cons), or cognate oligonucleotides containing mutations in the C/EBP
binding site (MUT) were used as competitors. DNA-protein complexes were
fractionated by PAGE and visualized by autoradiography. The most
prominent glucocorticoid-regulated complex is indicated by the
arrow. The C/EBP binding sites are
underlined, and mutated bases are indicated in
lowercase italic letters.
|
|
To confirm the functional importance of the +132 to +158 region, the
same mutation that prevented competition in the mobility shift assays
was introduced into the bp +34 to +192 IGF I exon 1 promoter-luciferase
reporter gene construct. Wild-type and C/EBP mutant constructs were
transiently transfected into Ob cells and treated with or without
cortisol for 6 h. While activity of the wild-type +34 to +192 IGF
I promoter was decreased by cortisol treatment (0.77 ± 0.04,
cortisol/control, n = 6), activity of the mutant construct was not
(Fig. 4
). In addition, the basal activity of
the mutant +34 to +192 IGF I promoter was higher than that of the
wild-type promoter (P < 0.01), further indicating that
this putative C/EBP binding site is a negative regulator of IGF I gene
transcription. While the +34 to +192 IGF I promoter-luciferase gene
construct does not exhibit strong promoter activity, the level of
repression by glucocorticoid treatment is similar to that observed with
larger fragments of the IGF I exon I promoter (9). As
previously noted, cortisol decreases IGF I rate of transcription and
heterogeneous nuclear RNA abundance in Ob cells by approximately 50%
(9). The less-than-optimal response of the IGF I
promoter-luciferase gene constructs to cortisol could be due to a lack
of appropriate chromatin structure in the transiently transfected
plasmid DNA, or the requirement of additional sequences.

View larger version (10K):
[in this window]
[in a new window]
|
Figure 4. Mutation of the +144 to +152 C/EBP Binding Site, in
the Context of the +34 to +192 IGF I Promoter, Abolished Repression by
Cortisol
Ob cells were transiently transfected with a luciferase reporter vector
alone (pGL3-Basic) or with a chimeric construct containing a bp +34 to
+192 fragment of the IGF I exon 1 promoter, without (wild type) or with
mutations in the C/EBP binding site. To control for transfection
efficiency, a cytomegalovirus ß-galactosidase expression vector was
cotransfected. Cells were exposed to control medium (black
bars) or cortisol at 1 µM (white
bars) for 6 h and then harvested and assayed for
luciferase and ß-galactosidase activity. Data shown are luciferase
activity/ß-galactosidase activity, and are means ±
SEM for six observations. *, Significantly different from
respective control (P < 0.05).
|
|
There are six known members of the C/EBP family of transcription
factors, and they bind DNA as homo- or heterodimers, interacting
with similar sequence motifs (13). To determine the
identity of the proteins interacting with the +132 to +158 IGF I
probe, electrophoretic mobility supershift assays were performed.
The +132 to +158 IGF I probe was incubated with nuclear extracts from
Ob cells treated with or without cortisol, in the presence or absence
of a C/EBP family pan-specific antibody. This antibody produced a
supershift band in binding reactions containing extracts from cortisol-
treated cells, indicating that members of the C/EBP family of
transcription factors interact with the promoter fragment (Fig. 5
). C/EBP
, ß, or
specific
antibodies caused a supershift in binding reactions containing nuclear
extracts from cortisol-treated cells, while antibodies against C/EBP
, and to a lesser extent, those against C/EBP ß caused a
supershift in binding reactions containing nuclear extracts from
control cells (Fig. 5
). These data suggest that C/EBP
and ß
interact with the promoter element in the basal state, while C/EBP
interacts with the sequence primarily when cells are treated with
glucocorticoids. C/EBP
and
specific antibodies were also tested
in the supershift assay, but they failed to interact with nuclear
proteins from control or cortisol-treated cells (data not shown).
Antibodies against C/EBP
(CHOP 10) were not tested because they
were unavailable. Overall, these data suggest that at least three
members of the C/EBP family of transcription factors interact with the
+132 to +158 IGF I promoter sequence.
Additional EMSAs were performed to determine whether candidate DNA
binding proteins, other than members of the C/EBP family, interacted
with the +132 to +158 region (Fig. 6
). The GR
has been shown to interact with DNA and with C/EBPs, and a potential
half-glucocorticoid response element is adjacent to the C/EBP binding
site (14). However, antibodies against the GR did not
supershift +132 to +158 IGF I promoter-Ob protein complexes. While the
GR has been shown to mediate the cooperative effects of signal
transducer and activator of transcription (STAT) 5 and C/EBP ß,
STAT-5 was not detected in the +132 to +158 IGF I promoter-Ob protein
complex by supershift assay (15). A potential binding site
for the transcription factor Oct-1 abuts the C/EBP binding site in the
+132 to +158 IGF I promoter. Oct 1 has been shown to bind to a negative
glucocorticoid response element in the GnRH promoter and to repress
transcription of the IL-8 promoter (16, 17). However,
antibodies against Oct-1 did not supershift +132 to +158 IGF I
promoter-Ob protein complexes. A potential binding site for the
transcriptional repressor Gfi-1 is also found within the +132 to +158
IGF I promoter fragment, but supershift assays did not demonstrate the
presence of this transcription factor in the Ob protein-DNA complex
(18).

View larger version (116K):
[in this window]
[in a new window]
|
Figure 6. C/EBP Proteins Are Associated with the bp +132 to
+158 IGF I Promoter Fragment, While Other Candidate DNA Binding
Proteins Are Not
No extract (0) or nuclear extracts from Ob cells exposed
to control medium (-) or 1 µM cortisol (+) for 24 h
were incubated with [ -32P]-labeled oligonucleotides in
the absence (-) or presence of nonspecific (IgG) antibodies, a C/EBP
pan-specific antibody (C/EBP), or specific antibodies against GR, STAT
5B, Oct-1, or Gfi-1. DNA-protein complexes were fractionated by PAGE
and visualized by autoradiography. The most prominent
glucocorticoid-regulated complex is indicated by the
arrow.
|
|
To determine whether cortisol regulates the expression of C/EBP
transcripts in osteoblasts, Northern blot analysis of Ob cell RNA was
performed (Fig. 7
). C/EBP
mRNA was
detectable in untreated and cortisol-treated cells, and its abundance
was not significantly modified by glucocorticoids. Transcripts for
C/EBP ß were observed in untreated cells and were modestly increased
in cells treated with cortisol for 6 h (fold increase 1.6 ±
0.2, n = 7) or 24 h (fold increase 1.9 ± 0.3, n =
11). In contrast, cortisol rapidly and substantially induced C/EBP
mRNA. C/EBP
transcripts were induced 10.6 ± 1.4 (n = 7)
fold as early as 2 h of treatment, and this induction was
sustained for up to 24 h (fold increase 10.3 ± 0.8, n =
8). EMSAs performed with a labeled consensus C/EBP binding site
oligonucleotide probe (data not shown) or with the +132 to +158 IGF I
promoter fragment (Fig. 5
) confirmed that C/EBP ß and C/EBP
proteins were more abundant in extracts from cortisol-treated Ob cells.
Further analysis of Ob cell RNA showed that C/EBP
transcripts were
barely detectable, and while Ob cells expressed C/EBP
and
mRNA,
their abundance was not noticeably altered by treatment with cortisol
for up to 24 h (data not shown).
Since cortisol increases the binding of C/EBPs to a C/EBP binding
site within the IGF I promoter, and increases the abundance of C/EBP
and ß transcripts in Ob cells, the regulation of C/EBP
and
ß by cortisol was further characterized. To determine whether
cortisol affects the stability of C/EBP ß or
mRNA, Ob cell
cultures were treated with or without cortisol for 15 min, after which
transcription was arrested by the addition of the RNA polymerase II
inhibitor 5,6-dichlorobenzimidazole riboside (DRB) (19).
Total RNA was harvested at various times after DRB addition and
subjected to Northern blot analysis and densitometry. These assays
showed that the half-life of C/EBP ß mRNA in transcriptionally
arrested osteoblasts is approximately 1 h, and that the stability
of the transcript is not affected by cortisol (Fig. 8
). In contrast, cortisol caused a
significant stabilization of C/EBP
mRNA, increasing its half-life
from about 30 min to approximately 1 h. To determine whether there
was a transcriptional component to C/EBP regulation by cortisol, a
nuclear run off assay was performed using nuclei from Ob cells
treated with or without cortisol for 1 h. This assay showed that
cortisol induced C/EBP
transcription by approximately 6-fold and
C/EBP ß transcription by approximately 2-fold (Fig. 9
). These data indicate that cortisol induces
C/EBP ß by transcriptional mechanisms, and C/EBP
by both
transcriptional and posttranscriptional mechanisms.
 |
DISCUSSION
|
|---|
Our previous studies documented the transcriptional
down-regulation of IGF I by glucocorticoids in osteoblasts, and these
results indicated that the region of the gene responsible for this
effect was within bp +34 to +192 of the exon 1 promoter
(9). In the present study, we used transient transfection
experiments to show that a binding site for the C/EBP family of
transcription factors is responsible for the down-regulation of the IGF
I promoter by the glucocorticoid cortisol under these experimental
conditions. This C/EBP binding site lies between bp +144 and +152 and
has identity to the consensus C/EBP binding sequence MTTNCNNMA
(13). This region of the rat IGF I promoter also binds
nuclear proteins from liver and is contained within a footprint named
HS3C, which has the sense strand sequence
CTTCTGCTTGCTAAATCTC (20).
Mutagenesis of three conserved bases within the regulated C/EBP binding
site prevented down-regulation of the +34 to +192 IGF I promoter by
cortisol. Further, mutation of the C/EBP binding site caused an
increase in basal promoter activity, confirming that it is an
inhibitory motif. Electrophoretic mobility supershift assays suggest
that C/EBP
and, to a lesser extent, C/EBP ß interact with the
glucocorticoid-regulated site in unstimulated Ob cells, while C/EBP
, ß, and
interact with the binding site in cortisol-treated Ob
cells. These data correlate with the previously suggested notion that,
in liver and myelo-monocytic cells, C/EBP
and ß regulate
constitutive gene expression and C/EBP ß and
predominate in
inducible gene expression (21, 22, 23, 24).
C/EBPs bind DNA as homo- or heterodimers, associating with each other
through well conserved leucine zipper motifs in the C-terminal region
of the protein. The DNA binding/nuclear translocation domain, adjacent
to the leucine zipper, is also conserved among C/EBP family members,
which recognize similar DNA sequences (13). The
nonconserved N-terminal portion of the C/EBP molecules contain domains
that can act as transcriptional activators or attenuators. Attenuator
domains, in particular, have been described in C/EBP ß and
, and
there is evidence that activation of C/EBP ß occurs through
derepression, mediated by phosphorylation of the protein
(25). The activity of C/EBP
is also regulated by
phosphorylation, since dephosphorylation severely inhibits its DNA
binding and transactivation potential (26). In addition,
use of alternate translation initiation sites within the C/EBP ß mRNA
can result in a 32-kDa activator (LAP, liver-enriched activator
protein) or a 16-kDa inhibitory (LIP, liver-enriched inhibitory
protein) isoform of the protein (13). LIP can form
heterodimers and inactivate LAP so that the activity of C/EBP ß is
dependent on the LAP/LIP protein isoform generated.
While most reports describe induction of gene expression by C/EBPs, the
functional and EMSA data indicate that, under the experimental
conditions used, C/EBPs and their cognate binding site are associated
with repression of the IGF I promoter in basal and
glucocorticoid-treated osteoblasts. Interestingly, an atypical C/EBP
binding site in the rat IGF I exon 1 promoter, distal to the
glucocorticoid-responsive site and corresponding to footprint HS3D,
binds C/EBP
in response to treatment of osteoblasts with PGs,
leading to a stimulation of gene transcription (27). While
the presence of both C/EBP-repressible and C/EBP-inducible binding
sites within the same promoter seems unusual, it is not unprecedented.
Like the IGF I promoter, the rat
1-acid glycoprotein promoter has a
5'-C/EBP binding site that represses promoter activity and a 3'-C/EBP
binding site responsible for stimulation of transcriptional activity
(28). In the IGF I promoter, the glucocorticoid-responsive
C/EBP binding site is immediately adjacent to the third transcriptional
start site, which is preferentially used in osteoblastic cells. It is
possible that C/EBPs may occlude basal transcriptional machinery or
that the phosphorylation state of the transcription factors may cause
them to have attenuator rather than stimulatory activity (25, 26, 29). In addition, the stoichiometry of the C/EBP isoforms,
either hetero- or homodimers, may affect their activity on a particular
DNA sequence. Osteoblastic cells express six members of the C/EBP
family of transcription factors, and it is likely that appropriate
stoichiometry is necessary for appropriate regulation (our unpublished
data).
Glucocorticoid induction of C/EBP ß and
has been shown in
nonskeletal cell systems (30, 31, 32). In fact,
transcriptional induction of C/EBP ß and
was reported in a rat
intestinal epithelial crypt cell line (30). However, our
data showing stabilization of C/EBP
mRNA by cortisol, in
conjunction with its ability to stimulate transcription of C/EBP ß
and
in osteoblasts, is novel. Glucocorticoids stimulate apoptosis
in a number of cell types, including mature osteoblasts, and
glucocorticoids decrease expression of IGF I, which has an
antiapoptotic effect on cells (9, 33, 34, 35). Coincidentally,
C/EBPs have been postulated to play a role in apoptosis (36, 37). However, it is important to note that the effects of
glucocorticoids on osteoblastic apoptosis can be dependent on the state
of cell maturation. As osteoblastic cells mature, they mineralize and
undergo apoptosis, and glucocorticoids can prevent osteoblastic
maturation and the consequent cellular death (38).
The anabolic effect of locally produced IGF I plays a central role in
the maintenance of bone mass. The effects of glucocorticoids on bone
are opposite to those of IGF I, suggesting that some of the actions of
glucocorticoids may be mediated by down-regulation of osteoblastic IGF
I expression. Although in vitro studies have limitations,
they generate useful data on potential mechanisms of glucocorticoid
action in vivo, and our data suggest a role for C/EBPs in
cortisol regulation of the IGF I promoter. In conclusion, cortisol
decreases IGF I transcription in osteoblastic cells, and the inhibition
of IGF I by cortisol may play a central role in the effects of cortisol
on bone formation and remodeling.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
The culture method used was described in detail previously
(39). Parietal bones were obtained from 22-d-old fetal
rats immediately after the mothers were killed by blunt trauma to the
nuchal area. This project was approved by the Animal Care and Use
Committee of Saint Francis Hospital and Medical Center. Cells were
obtained by five sequential digestions of the parietal bone using
bacterial collagenase (CLS II, Worthington Biochemical Corp., Freehold, NJ). Cell populations harvested from the third
to the fifth digestions were previously shown to express osteoblastic
characteristics and were cultured as a pool (39). Ob cells
were plated at a density of 8,00012,000
cells/cm2 and cultured in a humidified 5%
CO2 incubator at 37 C. Cells were cultured in
DMEM supplemented with nonessential amino acids, 10 mM
HEPES (Life Technologies, Inc., Gaithersburg, MD), and
10% FBS (Summit, Fort Collins, CO). For nuclear protein analysis and
for Northern analysis, cells were grown to confluence (
50,000
cells/cm2), transferred to serum-free medium for
2024 h, and exposed to control medium or 1 µM cortisol
in the absence of serum for 224 h as indicated in the text and
legends. For the nuclear run-off assay, subconfluent cultures of Ob
cells were treated with trypsin, passaged at a 1:8 dilution, and
allowed to grow to confluence (9). Confluent cultures were
serum-deprived and exposed to control medium or 1 µM
cortisol in the absence of serum for 1 h. Cortisol and DRB
(Sigma, St. Louis, MO) were dissolved in ethanol and
diluted in culture medium. At dilutions less than 1:10,000, an equal
volume of ethanol was added to control cultures.
Transient Transfections
To determine changes in promoter activity, an IGF I exon 1
promoter fragment spanning bp +34 to +192 was subcloned into the
promoterless luciferase reporter vector pGL3-Basic (Promega Corp., Madison, WI) (9, 10). Ob cells were cultured
to approximately 70% confluence and transiently transfected with IGF I
promoter constructs using liposome/nucleic acid complexes (TransFast,
Promega Corp.), according to the manufacturers
instructions. Cotransfection with a construct containing the
cytomegalovirus promoter-driven ß-galactosidase gene (CLONTECH Laboratories, Inc., Palo Alto, CA) was used to control for
transfection efficiency. Cells were allowed to recover in
serum-containing medium for 24 h, serum deprived for 2024 h, and
exposed to control or cortisol-containing medium for 6 h. In
previous studies, this duration of glucocorticoid exposure resulted in
maximal responsiveness of the IGF-I promoter (9). Cells
were washed with PBS and harvested in reporter lysis buffer
(Promega Corp.). Luciferase activity was measured using a
luciferase assay kit (Promega Corp.), and
ß-galactosidase activity was measured using Galacton reagent (Tropix,
Bedford, MA), both in accordance with manufacturers instructions.
Luciferase activity was corrected for ß-galactosidase activity.
Site-Directed Mutagenesis
Site-directed mutagenesis of the C/EBP binding site in the bp
+34 to +192 IGF I exon 1 promoter was achieved by overlap extension,
using PCR (40). For this purpose, mutant sense primer
(ATCCCTCTTCTGCTTGATAGCTCTCAC; mutated bases are
underlined) and the corresponding antisense primers were
designed, and the +34 to +192 IGF I promoter in pGL-3 Basic was used as
a template. The identity of the wild-type and mutated constructs was
confirmed by DNA sequence analysis (Sequenase Version 2.0 DNA
sequencing kit, United States Biochemical Corp.,
Cleveland, OH).
EMSA
For gel shift assays, nuclear extracts from control and
cortisol-treated cultures were prepared as described (41).
Cells were washed with PBS, suspended in 10 mM HEPES/KOH,
pH 7.9, 10 mM KCl, 1.5 mM
MgCl2, 0.5 mM dithiothreitol buffer,
allowed to swell on ice for 15 min, and lysed with 10% Nonidet P-40
(Sigma). After centrifugation, the nuclear pellet was
resuspended in a HEPES/KOH buffer in the presence of protease
inhibitors at 4 C, incubated for 30 min and centrifuged, and the
supernatant was stored at -70 C. Protein concentrations were
determined by DC Protein Assay in accordance with manufacturers
instructions (Bio-Rad Laboratories, Inc., Hercules, CA).
The IGF I exon I promoter oligonucleotides used had the sense strand
sequence TGCCAGAAGAGGGAGAGAGAGAGAAGGCGAATG corresponding to +34 to +66,
TTCCCCCAGCTGTTTCCTGTCTACAGTGTCTG corresponding to +67 to +98,
TGTTTTGTAGATAAATGTGAGGATTTTCTC corresponding to +99 to +128,
GATTTTCTCTAAATCCCTCCTC corresponding to +120 to +141, and
ATCCCTCTTCGTCTTGCTAAATCTCAC corresponding to +132 to +158. The +132 to
+158 C/EBP mutant oligonucleotide had the sense strand sequence
ATCCCTCTTCTGCTTGATAGCTCTCAC (mutated bases are
underlined) (Life Technologies, Inc.).
Oligonucleotides containing a consensus C/EBP binding site and its
mutant were obtained from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Synthetic oligonucleotides were labeled with
[
-32P]-ATP using T4
polynucleotide kinase. Nuclear extracts and labeled oligonucleotides
were incubated for 20 min at room temperature in 10
mM Tris buffer, pH 7.5, containing 1 µg of poly
(dI-dC). The specificity of binding was determined by the addition of
homologous or mutated unlabeled synthetic oligonucleotides in
100-fold excess (41). DNA-protein complexes were resolved
on nondenaturing, nonreducing 4% polyacrylamide gels, and the
complexes were visualized by autoradiography. For gel supershift
assays, labeled oligonucleotides were incubated with nuclear extracts
for 20 min, followed by incubation for 1 h at room temperature
with polyclonal antibodies (all from Santa Cruz Biotechnology, Inc.), before electrophoretic resolution.
Northern Blot Analysis
Total cellular RNA was isolated using a RNeasy kit, following
manufacturers instructions (QIAGEN, Chatsworth, CA). RNA
was quantitated by spectrometry, and equal amounts of RNA were
denatured and electrophoresed through formaldehyde agarose gels. Gels
were stained with ethidium bromide to visualize RNA standards and
ribosomal RNA, documenting equal RNA loading of the samples. The RNA
was then blotted onto Gene Screen Plus-charged nylon (DuPont Merck Pharmaceutical Co., Wilmington, DE), and uniformity of
transfer was documented by revisualization of ribosomal RNA.
Restriction fragments of rat C/EBP
, ß, and
cDNAs (kindly
provided by S. L. McKnight, University of Texas Southwestern
Medical Center, Dallas, TX) and mouse cDNAs for C/EBP
and
, and
human cDNA for C/EBP
(kindly provided by H. P. Koeffler,
University of California, Los Angeles, CA), were purified by agarose
gel electrophoresis (42, 43, 44). cDNAs were labeled with
[
-32P] deoxy-CTP (dCTP) and
[
-32P] deoxy-ATP (dATP) (50 µCi each,
specific activity 3,000 Ci/mmol; DuPont Merck Pharmaceutical Co.) using the random
hexanucleotide-primed second strand synthesis method
(45). Hybridizations were carried out at 42 C for 1672
h, and posthybridization washes were performed in 0.5x saline-sodium
citrate at 65 C. The blots were stripped and rehybridized with an
[
-32P]-labeled glyceraldehyde-3-phosphate
dehydrogenase (GAPD) cDNA. The bound radioactive material was
visualized by autoradiography on X-AR5 film (Eastman Kodak Co., Rochester, NY) employing Cronex Lightning Plus
(DuPont Merck Pharmaceutical Co.) or Biomax MS
(Eastman Kodak Co.) intensifying screens. Relative
hybridization levels were determined by densitometry. Northern analyses
shown are representative of three or more cultures.
Nuclear Run-Off Assay
Nuclei were isolated by Dounce homogenization in a Tris-HCl
buffer containing 0.5% Igepal (Sigma). Nascent
transcripts were labeled by incubation of nuclei in a reaction buffer
containing 250 µCi 32P-UTP (800
Ci/mM, DuPont Merck Pharmaceutical Co.). RNA
was isolated by treatment with deoxyribonuclease I and proteinase K,
followed by ethanol precipitation (9, 46). Linearized
plasmid DNA containing about 1 µg cDNA was immobilized onto
GeneScreen Plus by slot blotting, according to the manufacturers
instructions. Equal counts per minute of 32P-RNA
from each sample were hybridized to cDNA using the same conditions as
those employed for Northern blot analysis and were visualized by
autoradiography.
Statistical Methods
Data are presented as means ± SEM. Statistical
differences were determined by ANOVA and post hoc
examination by the Sheffé test (47). Slopes of RNA
decay curves were analyzed by the method of Sokal and Rohlf
(48).
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Dr. D. LeRoith for providing an IGF I promoter
construct, S. L. McKnight for providing C/EBP
, ß, and
cDNAs, H. P. Koeffler for providing C/EBP
cDNA, Susan
Bankowski and Susan OLone for technical assistance, and Ms. Karen
Berrelli for secretarial help.
 |
FOOTNOTES
|
|---|
This work was supported by Grant DK-45227 from the National Institute
of Diabetes and Digestive and Kidney Diseases.
Abbreviations: C/EBP, CAAT/enhancer binding protein; DRB,
5,6-dichlorobenzimidazole riboside; GAPD, glyceraldehyde-3-phosphate
dehydrogenase; LAP, liver-enriched activator protein; LIP,
liver-enriched inhibitory protein; STAT, signal transducer and
activator of transcription
Received for publication January 9, 2001.
Accepted for publication June 12, 2001.
 |
REFERENCES
|
|---|
-
Hock JM, Centrella M, Canalis E 1988 Insulin-like growth
factor I (IGF-I) has independent effects on bone matrix formation and
cell replication. Endocrinology 122:254260[Abstract]
-
Delany AM, Pash JM, Canalis E 1994 Cellular and clinical
perspectives on skeletal insulin-like growth factor I. J Cell
Biochem 55:328333[CrossRef][Medline]
-
McCarthy T, Centrella M, Canalis E 1989 Regulatory effects of
insulin-like growth factor I and II on bone collagen synthesis in rat
calvarial cultures. Endocrinology 124:301309[Abstract]
-
Rydziel S, Delany AM, Canalis E 1997 Insulin-like growth
factor I inhibits the transcription of collagenase 3 in osteoblast
cultures. J Cell Biochem 67:176183[CrossRef][Medline]
-
Canalis E, Rydziel S, Delany AM, Varghese S, Jeffrey JJ 1995 Insulin-like growth factors inhibit interstitial collagenase synthesis
in bone cell cultures. Endocrinology 136:13481354[Abstract]
-
Canalis E 1996 Implications to glucocorticoid-induced
osteoporosis. J Clin Endocrinol Metab 81:34413447[CrossRef][Medline]
-
Delany AM, Gabbitas BY, Canalis E 1995 Cortisol
down-regulates osteoblast
1 (I) procollagen mRNA by transcriptional
and post-transcriptional mechanisms. J Cell Biochem 57:488494[CrossRef][Medline]
-
Delany AM, Jeffrey JJ, Rydziel S, Canalis E 1995 Cortisol
increases interstitial collagenase expression in osteoblasts by
post-transcriptional mechanisms. J Biol Chem 270:2660726612[Abstract/Free Full Text]
-
Delany AM, Canalis E 1995 Transcriptional repression of
insulin-like growth factor I by glucocorticoids in rat bone cells.
Endocrinology 136:47764781[Abstract]
-
Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated regions in mRNAs
encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:89468950[Abstract/Free Full Text]
-
Hall LJ, Kajimoto Y, Bichell D, et al. 1992 Functional
analysis of the rat insulin-like growth factor I gene and
identification of an IGF-I gene promoter. DNA Cell Biol 11:301313[Medline]
-
Pash JM, Delany AM, Adamo ML, Roberts Jr CT, LeRoith D,
Canalis E 1995 Regulation of insulin-like growth factor I transcription
by prostaglandin E2 in osteoblast cells.
Endocrinology 136:3338[Abstract]
-
Wedel A, Ziegler-Heitbrock HW 1995 The C/EBP family of
transcription factors. Immunobiology 193:171185[Medline]
-
Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear
factor for interleukin-6 expression (NF-IL6) and the glucocorticoid
receptor synergistically activate transcription of the rat
1-acid
glycoprotein gene via direct protein-protein interaction. Mol Biol Cell 13:18541862
-
Wyszomierski SL, Rosen JM 2001 Cooperative effects of STAT5
(signal transducer and activator of transcription 5) and C/EBP ß
(CAAT/enhancer-binding protein-ß) on ß-casein gene transcription
are mediated by the glucocorticoid receptor. Mol Endocrinol 15:288240
-
Chandran UR, Attard B, Friedman R, Zheng Z, Roberts JL,
DeFranco DB 1996 Glucocorticoid repression of the mouse
gonadotropin-releasing hormone gene is mediated by promoter elements
that are recognized by heteromeric complexes containing glucocorticoid
receptor. J Biol Chem 271:2041220420[Abstract/Free Full Text]
-
Wu GD, Lai EJ, Huang N, Wen X 1997 Oct-1 and
CAAT/enhnacer-binding protein (C/EBP) bind to overlapping elements
within the interleukin-8 promoter. Role of Oct-1 as a
transcriptional repressor. J Biol Chem 272:23962403[Abstract/Free Full Text]
-
Zweider-McKay PA, Grimes HL, Flubacher MM, Tsichlis PN 1996 Gfi-1 encodes a nuclear zinc finger protein that binds DNA and
functions as a transcriptional repressor. Mol Cell Biol 16:40244034[Abstract]
-
Zandomeni R, Bunick D, Ackerman S, Mittleman B, Weinmann R 1983 Mechanism of action of DRB. III. Effect on specific in
vitro initiation of transcription. J Mol Biol 167:561574[CrossRef][Medline]
-
Thomas MJ, Kikuchi K, Bichell DP, Rotwein P 1994 Rapid
activation of rat insulin-like growth factor-I gene transcription by
growth hormone reveals no alterations in deoxyribonucleic acid-protein
interactions within the major promoter. Endocrinology 135:15841592[Abstract]
-
Ray A, Ray BK 1994 Serum amyloid gene expression under
acute-phase conditions involves participation of inducible C/EBP-ß
and C/EBP-
and their activation by phosphorylation. Mol Cell Biol 14:43244332[Abstract/Free Full Text]
-
Kinoshita S, Akira S, Kishimoto T 1992 A member of the C/EBP
family, NF-IL6 ß, forms a heterodimer and transcriptionally
synergizes with NF-IL6. Proc Natl Acad Sci USA 89:14731476[Abstract/Free Full Text]
-
Sylvester SL, ap Rhys CM, Leuthy-Martindale JD, Holbrook NJ 1994 Induction of GADD153, a CCAAT/enhancer-binding protein
(C/EBP)-related gene during the acute phase response in rats. Evidence
for the involvement of C/EBPs in regulating its expression. J Biol
Chem 269:2011920125[Abstract/Free Full Text]
-
Lin FT, Lane MD 1992 Antisense CCAAT/enhancer-binding protein
RNA suppresses coordinate gene expression and triglyceride accumulation
during differentiation of 3T3L1 preadipocytes. Genes Dev 6:533544[Abstract/Free Full Text]
-
Kowenz-Leutz E, Twamley G, Ansieau S, Leutz A 1994 Novel
mechanism of C/EBP ß (NF-M) transcriptional control: activation
through derepression. Genes Dev 8:27812791[Abstract/Free Full Text]
-
Ray BK, Ray A 1994 Expression of the gene encoding
1-acid
glycoprotein in rabbit liver under acute-phase conditions involves
induction and activation of ß and
CCAAT-enhancer-binding
proteins. Eur J Biochem 222:891900[Medline]
-
Umayahara Y, Ji C, Centrella M, Rotwein P, McCarthy TL 1997 CCAAT/enhancer binding protein-delta activates insulin-like growth
factor-I gene transcription in osteoblasts. Identification of a novel
cyclic AMP signaling pathway in bone. J Biol Chem 272:3179331800[Abstract/Free Full Text]
-
Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear
factor for interleukin-6 expression (NF-IL6) and the glucocorticoid
receptor synergistically activate transcription of the rat
1-acid
glycoprotein gene via direct protein-protein interaction. Mol Cell Biol 13:18541862[Abstract/Free Full Text]
-
Ray A, LaForge KS, Sehgal PB 1990 On the mechanism for
efficient repression of the interleukin-6 promoter by glucocorticoids:
enhancer, TATA box, and RNA start site (Inr motif) occlusion. Mol Cell
Biol 10:57365746[Abstract/Free Full Text]
-
Boudreau F, Blais S, Asselin C 1996 Regulation of
CCAAT/enhancer binding protein isoforms by serum and glucocorticoids in
the rat intestinal epithelial crypt cell line IEC-6. Exp Cell Res 222:19[CrossRef][Medline]
-
Gotoh T, Chowdhury S, Takiguchi M, Mori M 1997 The
glucocorticoid-responsive gene cascade. Activation of the rat arginase
gene through induction of C/EBP ß. J Biol Chem 272:36943698[Abstract/Free Full Text]
-
Matsuno F, Chowdhury S, Gotoh T, et al. 1996 Induction of the
C/EBP ß gene by dexamethasone and glucagon in primary-cultured rat
hepatocytes. J Biochem 119:524532[Abstract/Free Full Text]
-
Hill PA, Tumber A, Meikle MC 1997 Multiple extracellular
signals promote osteoblast survival and apoptosis. Endocrinology 138:38493858[Abstract/Free Full Text]
-
McColl KS, He H, Zhong H, Whitacre CM, Berger NA, Distelhorst
CW 1998 Apoptosis induction by the glucocorticoid hormone dexamethasone
and the calcium-ATPase inhibitor thapsigargin involves Bc12 regulated
caspase activation. Mol Cell Endocrinol 139:229238[CrossRef][Medline]
-
Weinstein RS, Jilka RL, Parfitt AM, Manolagas SC 1998 Inhibition of osteoblastogenesis and promotion of apoptosis of
osteoblasts and osteocytes by glucocorticoids. Potential mechanisms of
their deleterious effects on bone. J Clin Invest 102:274282[Medline]
-
Zhu MS, Liu DG, Cheng HQ, Xu XY, Li ZP 1997 Expression of
exogenous NF-IL6 induces apoptosis in Sp2/0-Ag14 myeloma cells. DNA
Cell Biol 16:127135[Medline]
-
Gigliotti AP, DeWille JW 1998 Lactation status influences
expression of CCAAT/enhancer binding protein isoform mRNA in the mouse
mammary gland. J Cell Physiol 174:232239[CrossRef][Medline]
-
Pereira RMR, Delany AM, Canalis E 2001 Cortisol inhibits the
differentiation and apoptosis of osteoblasts in culture. Bone 28:484490[Medline]
-
McCarthy TL, Centrella M, Canalis E 1988 Further biochemical
and molecular characterization of primary rat parietal bone cell
cultures. J Bone Miner Res 3:401408[Medline]
-
Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site
directed mutagenesis by overlap extension using the polymerase chain
reaction. Gene 77:5159[CrossRef][Medline]
-
Scott V, Clark AR, Docherty K 1994 The gel retardation assay.
In: Harwood AJ, ed. Protocols for gene analysis, vol 31. Totowa, NJ:
Humana Press, Inc.; 339347
-
Cao Z, Umek RM, McKnight SL 1991 Regulated expression of three
C/EBP isoforms during adipose conversion of 3T3L1 cells. Genes Dev 5:15381552[Abstract/Free Full Text]
-
Chumakov AM, Grillier I, Chumakova E, Chih D, Slater J,
Koeffler HP 1997 Cloning of the novel human myeloid-cell-specific
C/EBP-epsilon transcription factor. Mol Cell Biol 17:13751386[Abstract]
-
Lennon G, Auffray C, Polymeropoulos M, Soares MB 1996 The
I.M.A.G.E. consortium: an integrated molecular analysis on genomes and
their expression. Genomics 33:151152[CrossRef][Medline]
-
Feinberg AP, Vogelstein B 1984 A technique for radiolabeling
DNA restriction endonuclease fragments to high specific activity. Anal
Biochem 137:266267[CrossRef][Medline]
-
Greenberg ME, Ziff EB 1984 Stimulation of 3T3 cells induces
transcription of the c-fos proto-oncogene. Nature 311:433438[CrossRef][Medline]
-
Wall FJ 1986 Statistical data analysis handbook,
1st ed. New York: McGraw-Hill
-
Sokal RR, Rohlf FJ 1981 Biometry, 2nd
ed. San Francisco, CA: Freeman
This article has been cited by other articles:

|
 |

|
 |
 
A. Giustina, G. Mazziotti, and E. Canalis
Growth Hormone, Insulin-Like Growth Factors, and the Skeleton
Endocr. Rev.,
August 1, 2008;
29(5):
535 - 559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, W. Zhao, J. Zhao, J. Pan, Q. Wu, Y. Zhang, W. A. Bauman, and C. P. Cardozo
Identification of Androgen Response Elements in the Insulin-Like Growth Factor I Upstream Promoter
Endocrinology,
June 1, 2007;
148(6):
2984 - 2993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang
Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass
Endocrinology,
May 1, 2005;
146(5):
2415 - 2423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-F. Iu, H. Kaji, H. Sowa, J. Naito, T. Sugimoto, and K. Chihara
Dexamethasone suppresses Smad3 pathway in osteoblastic cells
J. Endocrinol.,
April 1, 2005;
185(1):
131 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Eijken, M. Hewison, M. S. Cooper, F. H. de Jong, H. Chiba, P. M. Stewart, A. G. Uitterlinden, H. A. P. Pols, and J. P. T. M. van Leeuwen
11{beta}-Hydroxysteroid Dehydrogenase Expression and Glucocorticoid Synthesis Are Directed by a Molecular Switch during Osteoblast Differentiation
Mol. Endocrinol.,
March 1, 2005;
19(3):
621 - 631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol.,
January 1, 2005;
25(1):
472 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koutsilieris, C. S. Mitsiades, J. Bogdanos, T. Dimopoulos, D. Karamanolakis, C. Milathianakis, and A. Tsintavis
Combination of Somatostatin Analog, Dexamethasone, and Standard Androgen Ablation Therapy in Stage D3 Prostate Cancer Patients with Bone Metastases
Clin. Cancer Res.,
July 1, 2004;
10(13):
4398 - 4405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Pereira, A. M. Delany, and E. Canalis
CCAAT/Enhancer Binding Protein Homologous Protein (DDIT3) Induces Osteoblastic Cell Differentiation
Endocrinology,
April 1, 2004;
145(4):
1952 - 1960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sciaudone, E. Gazzerro, L. Priest, A. M. Delany, and E. Canalis
Notch 1 Impairs Osteoblastic Cell Differentiation
Endocrinology,
December 1, 2003;
144(12):
5631 - 5639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Delany, I. Kalajzic, A. D. Bradshaw, E. H. Sage, and E. Canalis
Osteonectin-Null Mutation Compromises Osteoblast Formation, Maturation, and Survival
Endocrinology,
June 1, 2003;
144(6):
2588 - 2596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev.,
April 1, 2003;
24(2):
218 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Canalis and A. Giustina
Glucocorticoid-Induced Osteoporosis: Summary of a Workshop
J. Clin. Endocrinol. Metab.,
December 1, 2001;
86(12):
5681 - 5685.
[Full Text]
[PDF]
|
 |
|