help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, K. W.
Right arrow Articles by Leung, P. C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, K. W.
Right arrow Articles by Leung, P. C. K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE
*PROGESTERONE
*RU-486
Molecular Endocrinology 15 (12): 2078-2092
Copyright © 2001 by The Endocrine Society

Differential Role of PR-A and -B Isoforms in Transcription Regulation of Human GnRH Receptor Gene

Kwai Wa Cheng, Chi-Keung Cheng and Peter C. K. Leung

Department of Obstetrics and Gynaecology, The University of British Columbia, Vancouver, British Columbia, Canada, V6H 3V5

Address all correspondence and requests for reprints to: Dr. Peter C. K. Leung, Department of Obstetrics and Gynaecology, The University of British Columbia, 2H30-4490 Oak Street, British Columbia Women’s Hospital, Vancouver, British Columbia, Canada, V6H 3V5. E-mail: peleung{at}interchange ubc.ca.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The presence of progesterone response element (PRE) in the 5'-flanking region of the human GnRH receptor (GnRHR) suggests the possible regulation of this gene by progesterone (P). In the present study, we examined the effects of P in transcriptional regulation of human GnRHR gene expression at the pituitary and placenta levels since the GnRHR has been detected in both tissues. By the use of transient transfection assays, a differential regulation of human GnRHR promoter activity by P was observed. P treatment resulted in a decrease in promoter activity in the pituitary {alpha}T3–1 cells, suggesting a P-mediated inhibitory action. Interestingly, P is found to have a stimulatory role at the placental expression of this gene. Addition of RU486 to, or inhibition of endogenous P production by, the placental JEG-3 cells leads to a decrease in promoter activity, which is reversed by the replacement of P. Further studies have identified a putative PRE, namely human GR-PRE (located between -535 and -521, related to translation start site), that may be responsible for the P action since the mutation of these motifs reversed the P-mediated effects. The binding of PR to this element is confirmed by antibody supershift assays. The physiological effects of P are mediated through two PR isoforms, namely PR-A and PR-B. In the present study, overexpression of human PR-A resulted in a decrease in human promoter activity in both pituitary and placental cells. Interestingly, overexpression of PR-B exhibits a cell-dependent transcriptional activity, whereby it functions as a transcription activator in the placenta but as a transcription repressor in the pituitary. In summary, our results demonstrated a differential usage of PR-A and PR-B in transcriptional regulation of human GnRHR gene expression by P at the pituitary and placenta levels.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
IT IS WELL established that hypothalamic GnRH (1) plays a major role in controlling reproductive function. It regulates the biosynthesis and secretion of gonadotropin after binding to its receptor (GnRHR) at the level of the pituitary gonadotrope cells (1). In addition to the hypothalamic-pituitary axis, GnRH and GnRHR have been detected in other reproductive tissue, including the human placenta. Placental GnRH is biochemically and structurally identical to hypothalamic GnRH (2, 3, 4). Functionally, GnRH has been demonstrated to regulate human CG (hCG) secretion (5). This stimulatory effect was inhibited by treatment with a GnRH antagonist (6), suggesting a receptor-mediated process. Recently, we have reported the isolation of full-length GnRHR from human placental cells, including choriocarcinoma JEG-3 cells, immortalized extravillous trophoblast, and primary culture of trophoblast cells (7). The colocalization of GnRH and its receptor and the effect of exogenous GnRH on hCG secretion strongly suggest that the placenta may possess its own GnRH system, analogous to the hypothalamus-pituitary system. We and others (8, 9, 10) have demonstrated that the regulation of GnRHR number is mediated, at least in part, at the transcriptional level of GnRHR gene expression. Therefore, regulation of GnRHR expression has been implicated as one of the important mechanisms in controlling GnRH action.

The change in GnRHR numbers and its mRNA levels on the pituitary gonadotropes throughout the estrous cycle (11, 12, 13) and after gonadectomy (14, 15) suggests a role of gonadal steroids in regulating the expression of the GnRHR gene. It has also been shown that progesterone (P) negatively regulated the hypothalamic- pituitary functions through a negative feedback mechanism in animals (16, 17) and in humans (18, 19, 20). The physiological effects of P are mediated through a specific nuclear receptor protein, PR. Two major isoforms of PR, namely PR-A and PR-B, have been described. The large PR-B form contains an additional 164 amino acids at the N terminus that are missing in the truncated PR-A form (21). Hormonal binding to PRs results in the dissociation of heat shock proteins, thereby allowing receptors to form dimers and bind specific nucleotide sequences known as progesterone response elements (PREs) (22, 23). Receptor interaction with PREs can result in either an increase or decrease in gene transcription. In cell transfection systems, the two PR isoforms have distinct transcriptional properties. In general, PR-B acts as a stronger transcriptional activator, whereas the transcriptional activity of PR-A was cell- and gene-specific dependent. Interestingly, PR-A also functions as a transcriptional inhibitor of PR-B as well as of other steroid receptor families when PR-A itself is transcriptionally inactive (24, 25, 26, 27, 28).

There is evidence that P inhibits expression of ovine GnRHR gene expression. Using primary cultures of ovine pituitary cells, P reduced the binding of GnRH (29) and decreased the amount of GnRHR mRNA (15, 30, 31). Other than these findings, no information is available on the role of P in regulating human GnRHR gene expression. In addition, the exact role of P in regulating GnRHR gene expression at the transcriptional level remains unknown. We have previously isolated the human GnRHR gene (32), and DNA analysis of the human GnRHR 5'-flanking region revealed the presence of a putative PRE (32). In light of these studies, it is reasonable to believe that the P can directly regulate the expression of the human GnRHR. As the GnRHR mRNA was detected in both pituitary and placenta, and the placenta is a major site of P secretion, the goal of the present study was to understand the molecular mechanism underlying the regulatory role of P on GnRHR gene transcription.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
P Regulates Human GnRHR Promoter Activity
To examine the transcriptional regulation of human GnRHR gene expression by P in the pituitary and placenta, full-length human GnRHR promoter-luciferase construct (p2300F-Luc) was transiently transfected into {alpha}T3-1 and JEG-3 cells, respectively, and treated with increasing concentrations of P for 24 h. Although a slight decrease (14%, P > 0.05) in promoter activity in {alpha}T3-1 cells was observed with 10 nM P treatment, a statistically significant decrease of promoter activity was achieved after treatment with 1 µM P (28%, P < 0.01) and 10 µM P (59%, P < 0.001), respectively (Fig. 1AGo). In addition, this inhibitory effect was shown to be time dependent since the degree of inhibition increased with time of treatment (Fig. 1BGo). These results suggested an inhibitory effect of P on human GnRHR gene transcription at the pituitary level. In contrast, no change in GnRHR promoter activity was observed in JEG-3 cells (data not shown). As JEG-3 cells produce a high level of P endogenously, we next used a P antagonist, RU486, to indirectly examine the effects of P on human GnRHR promoter activity in JEG-3 cells. Interestingly, a dose- and time-dependent decrease in GnRHR promoter activity was observed after addition of RU486 (Fig. 2Go, A and B), suggesting that P was important in maintaining the expression of human GnRHR gene expression in the placenta. To further confirm the stimulatory role of P in the placental expression of human GnRHR, the endogenous production of P from JEG-3 was inhibited by the addition of aminoglutethimide (AGT) (38). A dose-dependent inhibition of P production was observed and the maximal inhibition was achieved at 0.1 mM AGT (Fig. 3AGo). Furthermore, inhibition of P production by ATG resulted in a 30% decrease (P < 0.001) in human GnRHR promoter activity, and this decrease in promoter activity was reversed by the replacement of P (Fig. 3BGo). These results strongly implicate a stimulatory role of P in the expression of human GnRHR gene in the placenta.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Dose- and Time-Dependent Regulation of Human GnRHR-Luciferase Vector (p2300-LucF) Activity in {alpha}T3-1 Cells Treated with P

A, The p2300-LucF transfected cells were treated with varying concentration of P (1 nM to 10 µM) for 24 h. The RSV-lacZ vector was cotransfected to normalize for varying transfection efficiencies. Luciferase units were calculated as luciferase activity/ß-galactosidase activity. B, The p2300-LucF transfected cells were treated with 10 µM P for the indicated time points. Relative promoter activity is shown as percentage of control. Values represent mean ± SE from triplicate assays in three separate experiments. a, P < 0.01 compared with control; b, P < 0.01 vs. the immediately adjacent group on the left.

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Dose- and Time-Dependent Regulation of Human GnRHR-Luciferase Vector (p2300-LucF) Activity in JEG-3 Cells Treated with RU486

A, The p2300-LucF transfected cells were treated with varying concentrations of RU486 (1 nM to 10 µM) for 24 h. The RSV-lacZ vector was cotransfected to normalize for varying transfection efficiencies. Luciferase units were calculated as luciferase activity/ß-galactosidase activity. B, The p2300-LucF transfected cells were treated with 10 µM RU486 for the indicated time points. Relative promoter activity is shown as percentage of control. Values represent mean ± SE from triplicate assays in three separate experiments. a, P < 0.01 compared with control; b, P < 0.01 vs. the immediately adjacent group on the left.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Effects of P in Human GnRHR-Luciferase Vector (p2300-LucF) Activity in JEG-3 Cells

A, Human choriocarcinoma JEG-3 cells were treated with varying concentration (1 pM to 0.1 mM) of DL-aminoglutethimide (AGT) for 24 h. The production of P was measured by RIA and shown as percentage of control. Values represent mean ± SE from triplicate assays in two separate experiments. a, P < 0.01 from control; b, P < 0.001 vs. the immediately adjacent group on the left. B, The production of P from JEG-3 cells was inhibited with 0.1 mM AGT treatment during transfection. After transfection, the cells were incubated for an additional 24 h in the presence of 0.1 mM AGT and increasing concentrations of P (0.1 nM to 0.1 µM). Relative promoter activity is shown as percentage of control after being normalized to ß-galactosidase activity. Values represent mean ± SE from triplicate assays in three separate experiments. a, P < 0.01 compared with control.

 
Localization of P Response Region in Human GnRHR 5'-Flanking Region
To localize a specific region that mediates the P effects on the 2.3-kb 5'-flanking region of the human GnRHR gene, a series of 5'-deletion mutants were analyzed in {alpha}T3-1 and JEG-3 cells and treated with 10 µM P and 10 µM RU486, respectively. Transient transfection studies showed similar results for both cell lines (Fig. 4Go). The results revealed that a region between -577 to -227 (relative to translation start site) was involved in P-mediated action. Progressive 5'-deletion up to -577 did not affect the P- and RU486-induced inhibition of the human GnRHR promoter activity in {alpha}T3-1 and JEG-3 cells, respectively (Fig. 4Go, B and C). Further deleting the sequence from -577 to -227 (relative to translation start site) resulted in a loss of the response in P- and RU486-induced inhibition in both cells. Although we have demonstrated that an upstream promoter was predominantly used in JEG-3 cells (39), no RU486-induced decrease in promoter activity was observed in this upstream promoter in JEG-3 cells (data not shown). Taken together, these data suggest that the 350-bp region (located between -577 and -227) containing the putative transcription factor(s) binding site was important in mediating the P-mediated effects on human GnRHR promoter activity in both pituitary and placenta.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Localization of the P-Responsive Region in the Human GnRHR Gene

A, Diagrammatic representation of progressive 5'-deletion constructs of p2300-LucF. Deletion mutants were transiently transfected into {alpha}T3-1 (panel B) and JEG-3 (panel C) cells by the calcium precipitation method and treated with 10 µM P and 10 µM RU486, respectively, for 24 h. The RSV-lacZ vector was cotransfected to normalize for varying transfection efficiencies. Relative promoter activity of each construct is shown as fold increase over a promoterless luciferase control pGL2-Basic, the activity of which is set to be 1, after being normalized to ß-galactosidase activity. Values represent mean ± SE of triplicate assays in three separate experiments. a, P < 0.01 compared with pGL2-Basic.

 
It has been demonstrated that RU486 binds both GR and PR (40). To eliminate the possible role of GR in mediating the RU486 action in placental cells, JEG-3 cells were transiently transfected with Sty-HLuc (-707 to +1; human GnRHR promoter-luciferase construct) and treated with increasing concentrations of dexamethasone (DEX) or P in the presence of 10 µM RU486 (Fig. 5Go). As expected, addition of 10 µM RU486 resulted in a significant decrease in promoter activity, and P (0.1 µM and 10 µM) replacement reversed this inhibitory effect. In contrast, addition of DEX did not reverse the RU486-induced decrease in promoter activity.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Blocking of P Action by RU486 in JEG-3 Cells

The JEG-3 cells were transiently transfected with Sty-HLuc. Cells were harvested 24 h post transfection and were treated with vehicle (control), 10 µM RU486, 0.1 nM, 10 nM, or 1 µM DEX in the presence of 10 µM RU486, or 0.1 µM or 10 µM P in the presence of 10 µM RU486. The RSV-lacZvector was cotransfected to normalize for varying transfection efficiencies. Luciferase units were calculated as luciferase activity/ß-galactosidase activity. Values represent mean ± SE from duplicate assays in three separate experiments. a, P < 0.01 compared with control; b, P < 0.01 compared with RU486.

 
Identification of Transcription Binding Sites
DNA analysis of the DNA region between -577 and -227 identified one putative PRE binding site, namely hGR-PRE (5'-TCAACAGTGTGTTTG-3' located at -535 to -521; with 75% homology to the consensus PRE site) and a half-PRE binding site, namely hGR-hPRE (5'-AGAACA-3' located at -402 to -397; with 100% homology to the half-consensus PRE site). To examine the role of these putative PRE motifs in controlling the expression of GnRHR gene, the two putative PRE motifs were mutated in Sty-HLuc, as the highest promoter activity was obtained from this construct (Fig. 4Go). Mutation of the putative hGR-PRE resulted not only in reducing the P-induced inhibition but also increased the basal luciferase activity in {alpha}T3-1 cells (Fig. 6AGo). A 60% increase (P < 0.001) in basal promoter activity was observed after site-directed mutation of the hGR-PRE but not in mutated hGR-hPRE. Although the mutation of hGR-PRE significantly reduced the P-induced decrease in promoter activity from 54% to 19%, it did not completely eliminate the P-induced inhibition of promoter activity. Mutation of hGR-hPRE did not affect the basal promoter activity or eliminate the P-mediated action in transfected {alpha}T3-1 cells.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 6. Functional Analysis of Putative PRE in Human GnRHR Promoter

Mutations were introduced by three-step PCR mutagenesis as described in Materials and Methods. The wild-type and mutated promoter constructs were cotransfected with RSV-lacZvector, to normalize for varying transfection efficiencies, into {alpha}T3-1 and JEG-3 cells. A, The transfected {alpha}T3-1 cells were treated with 10 µM P for 24 h. B, the PRE mutant-transfected JEG-3 cells were treated with 10 µM RU486 for 24 h. The relative basal activity of each promoter mutant is shown as percentage of vehicle treated (control) Sty-HLuc, the activity of which is taken as 100%, after being normalized to ß-galactosidase activity. The percentage of inhibition is calculated by comparison with individual control. Values represent mean ± SE of triplicate assays in three separate experiments. The names and the relative position of the putative transcription factor binding sites are given, and the mutated element is shown as bars with diagonal lines. The relative change in promoter activity after treatment was indicated. a, P < 0.05 compared with control.

 
In JEG-3 cells, mutation of hGR-PRE led to a 35% decrease (P < 0.001) in basal promoter activity (Fig. 6BGo). Again, no such reduction in promoter activity was observed in mutated hGR-hPRE. In addition, mutation of hGR-PRE completely abolished the RU486-induced decrease in promoter activity in placental cells (Fig. 6BGo). Taken together, these results suggest that the hGR-PRE located at -535 to -521 plays an important role in mediating the effect of P on GnRHR transcription.

Effects of Cotransfection of PR on Human GnRHR Promoter Activity in {alpha}T3-1 and JEG-3 Cells
The expression of PRs in JEG-3 and {alpha}T3-1 cells was examined by Western blot analysis. Aliquots of protein (50 µg), isolated from JEG-3 or {alpha}T3-1 cells, were separated in SDS-PAGE and detected with antibody against PR. As seen in Fig. 7AGo, both PR-A and PR-B were expressed in JEG-3 and {alpha}T3-1 cells. The molecular masses of the detected human PR-A (95 kDa) and human PR-B (114–120 kDa), and mouse PR-A (85 kDa) and mouse PR-B (115 kDa) from JEG-3 and {alpha}T3-1 cells, respectively, were similar to those reported previously (25, 41). Interestingly, the levels of PR-A in JEG-3 cells were very low when compared with PR-B levels. Although both PR-A and PR-B isoforms were detected in {alpha}T3-1 cells, a relative high concentration of P was required to induce the decrease in hGnRHR promoter activity. This may due to the different ability of human and mouse PRs to transactivate a human gene. To further evaluate the role of human PR-A and PR-B in mediating the P action at the pituitary and placenta levels, the human PR-A and PR-B expression constructs were cotransfected into {alpha}T3-1 and JEG-3 cells. Cotransfection of human PR-A and PR-B expression vectors into JEG-3 and {alpha}T3-1 cells resulted in an increase in human PR-A and PR-B levels (Fig. 7Go, B and C).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 7. Western Blot Analysis of PR

A, Basal expression of PR. Total cellular protein isolated from JEG-3 or {alpha}T3-1 cells was separated and immunoblotted with PR antibody as described in Materials and Methods. Overexpression of human PR in JEG-3 cells (panel B) and {alpha}T3-1 cells (panel C). Total cellular protein was isolated from JEG-3 or {alpha}T3-1 cells 8 h after transfection with 1 µg of human PR-A (lane 2) or PR-B (lane 3) expression vector. The estimated molecular masses of the human PR (hPR-A and hPR-B) and mouse PR (mPR-A and mPR-B) are indicated.

 
As expected, no significant change in promoter activity was observed after treatment with 0.1 µM P for 24 h at the Sty-HLuc-transfected {alpha}T3-1 cells (Fig. 8Go). However, overexpression of human PRs in {alpha}T3-1 cells increased the sensitivity toward P treatment. A significant decrease (52%, P < 0.001) in promoter activity was achieved in 0.1 µM P treatment after cotransfection with 1 µg of PR-B expression vector (Fig. 8AGo). Similarly, cotransfection with 1 µg of PR-A expression vector resulted in a slight decrease (20%, P < 0.05) in the promoter activity after treatment with 0.1 µM P. Nevertheless, these data suggest that PR-B may play a more active role than PR-A in mediating P-induced inhibitory effects on the pituitary, since a higher inhibition in promoter activity was observed in PR-B cotransfected cells after P treatment. The functional role of the PRE in mediating the P-induced decrease in promoter activity at the pituitary was also examined in the hGR-PRE and hGR-hPRE-mutated constructs. Again, an increase in basal promoter activity was observed after the mutation of hGR-PRE, and this mutation eliminated and reduced the degree of inhibition induced by 0.1 µM P after overexpression of human PR-A and PR-B (from 52% to 17%), respectively (Fig. 8AGo).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 8. Effects of Overexpression of Human PR-A and PR-B in Promoter Activity on PRE Intact or Mutated Constructs

A, The wild-type or PRE mutated construct-transfected {alpha}T3-1 cells were treated with 0.1 µM P for 24 h with or without cotransfection of human PR-A or PR-B expression vector. B, The wild-type or PRE mutated construct-transfected JEG-3 cells were cotransfected with human PR-A and/or PR-B expression vector. The relative basal activity of each promoter mutants is shown as percentage of vehicle-treated (control) Sty-HLuc, the activity of which is taken as 100%, after being normalized to ß-galactosidase activity. The percentage change in promoter activity is calculated by comparison with individual control. Values represent mean ± SE of triplicate assays in three separate experiments. The names and the relative positions of the putative transcription factor binding sites are given, and the mutated element is shown as bars with diagonal lines. The percentage change in promoter activity is indicated. *, P < 0.05 compared with control.

 
In the placenta JEG-3, overexpression of hPR-A resulted in a 51% decrease (P < 0.001) in basal promoter activity (Fig. 8BGo). In contrast, overexpression of hPR-B led to an increase (39%, P < 0.001) in promoter activity (Fig. 8BGo). In addition, coexpression of hPR-A and hPR-B counteract each other’s function in regulating the promoter activity. These results suggested that the balance between PR-A and PR-B expression in the placenta plays an important role in controlling the expression of this gene, whereas PR-B stimulates and PR-A inhibits the promoter activity. Further studies have shown that the hGR-PRE solely mediated the hPR-B-stimulated increase in human GnRHR promoter activity as the mutation of this binding site eliminated the increase in luciferase activity (Fig. 8BGo). Although the mutation of hGR-PRE decreased the inhibitory effect of overexpression of hPR-A (from 51% to 23%), it did not completely eliminate this effect, suggesting that an additional regulatory mechanism is involved in mediating the PR-A action.

The Binding of PR to the Putative hGR-PRE
To confirm the identity of the transcription factor bound to the hGR-PRE, gel mobility shift assay was preformed with a synthetic oligodeoxynucleotide containing the putative hGR-PRE binding site in the presence of consensus and mutated PRE, hGR-PRE, nonrelated oligodeoxynucleotide, or antibody against the PR. Very weak DNA-protein complexes were obtained from nuclear extracts isolated from {alpha}T3-1 cells without transfection with human PR expression vectors (Fig. 9AGo, lane 1). In contrast, strong specific DNA-protein complexes were observed using the nuclear extract isolated from {alpha}T3-1 cells, after cotransfection with both human PR-A and PR-B expression vectors (Fig. 9AGo, lanes 2 and 3: indicated as arrows 1, 2, and 3). These complexes were eliminated with the addition of increasing competitor DNA fragment (200-fold in excess) containing a consensus PRE (lane 5) and hGR-PRE (lane 7) but not with a competitor containing mutated PRE (lane 4), mutated hGR-PRE (lane 6), or nonrelated sequence nuclear factor-{kappa}B (NF-{kappa}B) (lane 8) or transcription factor IID (TFIID) (lane 9). Furthermore, the addition of an antibody against the PR supershifted the DNA-protein complexes, further supporting the binding of the PR to this binding site (Fig. 9BGo, lane 11). Similarly, specific DNA-protein complexes were obtained using nuclear extract isolated from JEG-3 cells (Fig. 10AGo, indicated as arrows 4 and 5). These complexes were also eliminated with the addition of increasing competitor DNA fragment (200-fold in excess) containing a consensus PRE (lane 3) and hGR-PRE (lane 5) but not with a competitor containing mutated PRE (lane 2), mutated hGR-PRE (lane 4), or nonrelated sequence NF-{kappa}B (lane 6) or TFIID (lane 7). As expected, the addition of an antibody against the PR supershifted the DNA-protein complexes (Fig. 10BGo, lane 9).



View larger version (62K):
[in this window]
[in a new window]
 
Figure 9. Identification of PR Binding to the Putative hGR-PRE Binding Sites in the Human GnRHR Gene by GMSA Using Nuclear Extract Isolated from Human PR-Transfected {alpha}T3-1 Cells

A, Synthetic deoxyribonucleotide containing the putative PRE sequences (hGR-PRE) in the human GnRHR gene was 32P labeled and incubated with nuclear extract isolated from human PR-A and PR-B cotransfected, P-treated {alpha}T3-1 cells in the presence of 200-fold excess specific competitor oligonucleotide. Specific DNA-protein complexes formed to the hGR-PRE (indicated as arrows 1, 2, and 3) were eliminated in the presence of competitor oligonucleotide (lane 3, no competitor; lane 4, mutated consensus PRE; lane 5, consensus PRE; lane 6, mutated hGR-PRE; lane 7, hGR-PRE; lane 8, consensus NF-{kappa}B and lane 9, consensus TFIID). B, GMSA studies were performed in the presence of antibodies specific to PR, Oct-1, and GATA-2. Antibodies were incubated with nuclear extract isolated from human PR-A and PR-B cotransfected, P-treated {alpha}T3-1 cells for 1 h before the addition of the 32P-labeled hGR-PRE probe. DNA-protein complexes were supershifted by the addition of antibody against PR (lane 11, indicated as arrow labeled "Shifted") but not by antibodies against IgG (lane 10), Oct-1 (lane 12), and GATA-2 (lane 13).

 


View larger version (63K):
[in this window]
[in a new window]
 
Figure 10. Identification of PR Binding to the Putative hGR-PRE Binding Sites in the Human GnRHR Gene by GMSA Using Nuclear Extract Isolated from Human Placental JEG-3 Cells

A, Synthetic deoxyribonucleotide containing the putative PRE sequences (hGR-PRE) in human GnRHR gene was 32P labeled and incubated with nuclear extract isolated from human placental JEG-3 cells in the presence of a 200-fold excess of the indicated specific competitor oligonucleotide. Specific DNA-protein complexes formed to the hGR-PRE (indicated as arrows 4 and 5) were eliminated in the presence of competitor oligonucleotide (lane 1, no competitor; lane 2, mutated consensus PRE; lane 3, consensus PRE; lane 4, mutated hGR-PRE; lane 5, hGR-PRE; lane 6, consensus NF-{kappa}B and lane 7, consensus TFIID). B, Gel mobility assay studies were performed in the presence of antibodies specific to PR, Oct-1, and GATA-2. Antibodies were incubated with nuclear extract isolated from human placental JEG-3 cells for 1 h before the addition of the 32P-labeled hGR-PRE probe. DNA-protein complexes were supershifted by the addition of antibody against PR (lane 9, indicated as arrow labeled "Shifted") but not by antibodies against IgG (lane 8), Oct-1 (lane 10), and GATA-2 (lane 11).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
While P is the dominant steroid present in the circulation during human gestation, pituitary responsiveness to GnRH is reduced during this period (42, 43, 44, 45). Recent studies in the ovine have demonstrated that the numbers of GnRHR were relatively lower during the luteal phase of the estrous cycle (46), and induction of luteolysis by PGF2{alpha} resulted in an increase in both GnRHR numbers and mRNA levels in vivo (47). These data suggested a negative regulatory effect of P in GnRHR expression. In subsequent studies using primary culture of ovine pituitaries, a decrease in GnRHR mRNA levels was observed after P treatment (15, 30, 31), further supporting the negative role of P in regulating the ovine GnRHR gene expression. In spite of these observations, little is known about the role of P in regulating human GnRHR gene expression. Furthermore, the molecular mechanism of P action in mediating the expression of the GnRHR gene remains unknown. In the present study, we have examined the effects of P in controlling the transcription of the human GnRHR gene at the pituitary and placental levels. Because human pituitary gonadotrope cells were unavailable to us, we used the mouse {alpha}T3-1 pituitary tumor cell line as an experimental model to study the transcription regulation of the human GnRHR gene (9, 33, 35). The expression of GnRHR mRNA from the JEG-3 cells indicated the feasibility of using these cells to study the regulation of the human GnRHR gene (7).

We have observed a P-induced decrease in human GnRHR promoter activity in pituitary cells. This observation was in agreement with the results obtained from the studies in the ovine showing that P negatively regulates the expression of the GnRHR gene. Interestingly, this P-induced inhibition of human GnRHR promoter activity could not be observed in the placental JEG-3 cells, which also possess the GnRH-GnRHR system (7, 48). Instead, using RU486 to block endogenous P action and AGT to inhibit P production resulted in a decrease in human GnRHR promoter activity, suggesting the importance of P in maintaining the expression of GnRHR at the placenta. GnRH has been shown to stimulate the secretion of hCG from the placenta (5), which is important in maintaining early pregnancy by stimulating P production from the corpus luteum (49). The lack of the negative regulatory system in the expression of placental GnRHR by P may help sustain the GnRH-stimulated hCG production through pregnancy.

Progressive 5'-deletion of the human GnRHR 5'-flanking region and mutational studies have identified a putative PRE, namely hGR-PRE located at -535 to -521, that participates in P-mediated action. Our data showed that the very same region mediated the P-induced inhibition and stimulation actions on pituitary and placental cells, respectively. Identity of the transcription factor that bound to this region has been demonstrated containing PR by gel mobility shift assay (GMSA) and supershift assay. P mediates its biological activity after its interaction with a specific receptor within the nuclei of the target cells. PRs are ligand-inducible transcriptional regulators that control gene expression upon binding at the PRE in the vicinity of target promoters or influence gene expression by interaction with other transcription factors independently of PRE (50). The expression of PR-A and PR-B isoforms in the JEG-3 and {alpha}T3-1 cells was examined by the use of Western blot analysis. The expression levels of PR-A and PR-B were similar in the {alpha}T3-1 cells, whereas PR-B in the JEG-3 cells is much higher than PR-A. The requirement of a relatively higher concentration (1 µM) of P to achieve the statistically significant decrease in human GnRHR promoter activity in {alpha}T3-1 cells may be due to the use of mouse PRs in studying the regulation of the human GnRHR gene, or the different transcription activity of human and mouse PRs in the human gene. This explanation is supported by the result of GMSA. As seen in Fig. 9AGo, the endogenous mouse PR formed very weak DNA-protein complexes with the putative human hGR-PRE. To examine the role of human PR in controlling the expression of the human GnRHR gene, {alpha}T3-1 cells were cotransfected with human PR-A or PR-B expression vector. Overexpression of human PRs in {alpha}T3-1 cells increased the sensitivity toward P treatment and resulted in a decrease in GnRHR promoter activity after 0.1 µM P treatment. The similar results obtained from untransfected and human PRs cotransfected {alpha}T3-1 cells after P treatment further implicate the potential role of PRs in regulating the GnRHR gene transcription and the value of these cells in studying the P-induced regulation of human GnRHR gene. Although overexpression of both human PR-A and PR-B isoforms resulted in increased sensitivity toward P treatment, it appears that PR-B plays a more important role in mediating the P-induced inhibitory action. This postulation was based on the observations that 1) a higher degree of P-induced decrease in the human GnRHR promoter was obtained from PR-B-cotransfected cells, and 2) mutation of hGR-PRE completely eliminated the PR-A-mediated inhibitory effects but not PR-B-mediated action. Although the presence and distribution of steroid receptors in the normal human pituitary have not been reported, recent studies have demonstrated the expression of PR in human pituitary adenomas and supported the direct action of P in the human pituitary (51).

In agreement with our Western blot results in PR expression in JEG-3 cells, expression of PRs in the human placenta has also been demonstrated (52, 53, 54). Thus, human placenta is very likely a target tissue for the action of P. In fact, recent reports describing the effects of P on expression of CG {alpha}- and ß-subunit genes in the human placenta (55) and CRH gene in human trophoblast cell cultures (56) provide evidence that placenta itself can be a target tissue for the action of P. To further study the role of these receptors in mediating the P-induced effect in placenta, human PR-A and PR-B expression vectors were cotransfected into JEG-3 cells. Interestingly, our results showed that PR-A and PR-B have a differential function in regulating the expression of the human GnRHR gene in placenta cells. Similar to the data obtained from the pituitary cells, overexpression of PR-A resulted in a decrease in human GnRHR promoter activity. However, overexpression of PR-B increased the human GnRHR promoter activity in placental cells, while this overexpression led to a decrease in promoter activity in pituitary cells. These results support the P-stimulatory role of GnRHR gene expression in the placenta, since a much higher level of PR-B was detected in the JEG-3 cells endogenously. Taken together, these results indicate that PR-A is mainly involved in down-regulation, while PR-B up-regulates, the transcription of human GnRHR in the placenta.

Inasmuch as the PR-A and PR-B isoforms arise by transcription of the same gene with the use of different promoter regions (57), it is possible that independent regulation of these promoters may occur (58). It is now clear that their relative levels are under hormonal control (59). Thus, different hormonal input in the pituitary and placenta may affect the expression levels of PRs. As both PR-A and PR-B are capable of binding P, dimerizing and interacting with PRE, the level of PRs as well as the stoichiometric ratio of PR-A and PR-B within a target cell under specific physiological conditions would be expected to alter the relative complement of dimeric complex and exert a significant impact on the overall cellular response to P. To add to the complexity of the PR regulatory system, a third PR isoform has recently been identified in T47D human breast cancer cells and named PR-C (60). This N-terminally truncated PR-C isoform arises from the use of translation start site downstream of the translation site for PR-A and PR-B at the same gene. The PR-C contains the second zinc finger of the DNA-binding domain but is lacking the first one. Alone, PR-C is transcriptionally inactive but able to regulate the PR-A and PR-B transcriptional activity when coexpressed (61). Recent studies have also demonstrated that transactivation by PRs might involve additional cofactors including coactivator or corepressor (62, 63, 64). It is possible that different coactivators or repressors existed in the pituitary and placenta cells, which resulted in a different response in PR-B-mediated action. In addition, there is evidence for the interaction between steroid hormone receptors, including PR, and other transcription factors, such as octamer transcription factor 1 (Oct-1), activating protein-1, and signal transducer and activator of transcription, in controlling gene expression at the transcriptional level (62, 65, 66, 67). Hence, the incomplete elimination of the PR-B- and PR-A-mediated decrease in promoter activity in the mutated hGR-PRE construct in {alpha}T3-1 and JEG-3 cells, respectively, may be due to fact that an additional transcription-regulatory mechanism(s) is used. However, the exact role of these PR-C isoforms, activating protein-1/CREB motifs, and/or other possible mechanism(s) in mediating the PR-A and PR-B action in placental and pituitary cells has yet to be determined.

In summary, we have demonstrated a direct action of P in regulating the human GnRHR gene expression at transcriptional levels through binding to a putative hGR-PRE motif. Overexpression of human PR-A shows a transcriptional inhibition action in GnRHR gene expression. In contrast, PR-B exhibits a cell-dependent differential transcriptional activity in which it acts as transcriptional activator in placenta cells but a transcriptional repressor in pituitary cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cells and Cell Culture
Mouse pituitary gonadotrope-derived {alpha}T3-1 cells and human choriocarcinoma JEG-3 cells were maintained in DMEM, with 4.5 mg/ml glucose (Life Technologies, Inc., Burlington, Ontario, Canada) and RPMI 1640, respectively, supplemented with 10% FBS (Life Technologies, Inc.) in a humidified atmosphere of 5% CO2 in air. Cells were passaged when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.53 mM EDTA).

Preparation of Human GnRHR Promoter- Luciferase Constructs
Human GnRHR-luciferase construct (p2300-LucF) and progressive 5'- or 3'-deletion constructs were prepared as previously described (9, 33, 39). Human PR-A and PR-B expression vector was provided by Dr. P. Chambon (INSERM, Universite Louis Pasteur, Paris, France). Plasmid DNA for transfection studies was prepared using QIAGEN Plasmid Maxi Kits (QIAGEN, Chatsworth, CA) following the manufacturer’s suggested procedure. The concentration and integrity of DNA were determined by measuring absorbance at 260 nm and agarose gel electrophoresis, respectively. Purified plasmid DNA was then dissolved in 0.1x TE (1 mM Tris-Cl; pH 7.5, 0.1 mM EDTA) to a final concentration of 1 µg/ml.

Site-Directed Mutagenesis
Human GnRHR 5'-flanking region -707 to +1 (related to translation start site) subcloned into pBSK II (+) vector (Stratagene, La Jolla, CA) was used as a template for the mutagenesis reaction. Mutations were introduced by a three-step PCR mutagenesis method as described previously (9), using universal primers UP-T3F (5'-GTGCCTCTCCTGAACAGGCCTCAAGCAATTAACCCTCACTAAAGG-3'), UP (5'-GTGCCTCTCCTGAACAGGCCTCAA-3'), T7R (5'-CGTAATACGAC- TCACTATAGG-3') and mutagenic primers for mP-PRE (5'-GTTTTCCTTTTCAAAGCGGCCGCTGAGCACTCGAACACT- GGAC-3') and mP-hPRE (5'AAACTATTAGTGTTAGTCGGCCGTCCAACATACAGATGTA3'). Mutation was confirmed by restriction enzyme and sequence analysis.

Transient Transfections and Reporter Assay
Transfections were carried out using the calcium precipitation methodology as previously described (7). To correct for different transfection efficiencies of various luciferase constructs, the Rous sarcoma virus (RSV)-lacZ plasmid was cotransfected into cells. Briefly, 5 x 105 {alpha}T3-1 cells or 1.5 x 105 JEG-3 cells were seeded into six-well tissue culture plates before the day of transfection in 2 ml culture medium containing 1% charcoal-dextran-treated FBS (HyClone Laboratories, Inc., Logan, UT). Before the transfection, the cells were washed once and cultured in 1 ml of fresh medium (containing 1% charcoal-dextran-treated FBS). Two micrograms of the GnRHR promoter-luciferase construct and 0.5 µg RSV-lacZ were dissolved in 50 µl 0.1x TE containing 0.25 M CaCl2 and mixed with 50 µl 2x BES (50 mM N,N-bis-(2-hydroxyethyl)-2-aminoethanesulforic acid, 280 mM NaCl, and 1.5 mM Na2HPO4, pH 6.95). The DNA mixture was incubated for 20 min at room temperature and then applied to the cells. Incubation of the cells with transfection medium was continued for approximately 16 h at 37 C in 3% CO2. After transfection, the cells were washed twice with culture medium and incubated with for an additional 24 h with normal culture medium containing 10% charcoal-dextran-treated FBS. Cellular lysates were collected with 200 µl cell lysis buffer and assayed for luciferase activity immediately with the Enhanced Luciferase Assay Kit (PharMingen, Mississauga, Ontario, Canada). Luminescence was measured using Lumat LB 9507 luminometer (EG&G, Berthold, Germany). ß-Galactosidase activity was also measured and used to normalize for varying transfection efficiencies. Promoter activity was calculated as luciferase activity/ß-galactosidase activity. A promoterless pGL2-Basic vector was included as a control in the transfection experiments.

Pharmacological Treatments
Progesterone (P), mifepristone (RU486), DEX, and DL-AGT were purchased from Sigma (Sigma-Aldrich Corp. Ltd., Oakville, Ontario, Canada). In experiments in which the effects of P, DEX, and RU486 on luciferase activity were studied, the cells were treated with corresponding drugs for 24 h before luciferase and ß-galactosidase activities were measured. P production in JEG-3 was inhibited by addition of AGT during transfection, and the secreted P levels were measured by RIA as previously described (34).

GMSA
Oligodeoxynucleotides corresponding to the putative hGR-PRE (5'-GAGTGCTCAACAGTGTGTTTGAAAAGG-3') and mutated hGR-PRE (mhG-GR-PRE; 5'GAGTGCTCAGCGGCCGCTTTGAAAAGG-3') elements at the human GnRHR 5'-flanking region and its complements were synthesized by the Oligonucleotide Synthesis Laboratory (University of British Columbia, Vancouver, British Columbia, Canada), and annealed to form a double-stranded DNA. Consensus and mutated PRE oligonucleotides DNA and antibodies for PR (catalog no. sc-538x), Oct-1 (catalog no. sc-232x), and GATA-2 (catalog no. sc-267x) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Oligonucleotides DNA for NF-{kappa}B (catalog no. E3291), and TFIID (catalog no. E3221) were purchased from Promega Corp. (Nepean, Ontario, Canada). Probes for GMSA were end-labeled with [P32]-ATP by T4 polynucleotide kinase (Life Technologies, Inc., Gaithersburg, MD), and separated from unincorporated radionucleotides by passage over Sephadex G-25 column. Nuclear extracts were prepared according to the method described previously (35). Protein concentrations were determined by a modified Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA). GMSAs were carried out in 20 µl containing 20 mM HEPES (pH 7.5), 20 mM KCl, 20 mM NaCl, 1.5 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 10% glycerol, 2 µg poly dI:dC, 5 µg nuclear proteins, 2 mg/ml of BSA, and radiolabeled probe.

For the competition assays, the unlabeled DNA was added simultaneously with the labeled probe. Antibodies used in supershift experiments were added to the nuclear extract at room temperature for 1 h before the addition of labeled probe. The binding mixture was incubated at room temperature for 20 min and separated in 6% polyacrylamide gel containing 1x TBE (Tris-borate-EDTA: 0.09 M Tris-borate and 2 mM EDTA, pH 8.0). Before loading of samples, the gel was prerun for 90 min at 100 V at 4 C. Electrophoresis was carried out at 30 mA at 4 C. The gel was then dried under vacuum and exposed to x-ray film (Kodak X-OMAT AR film; Eastman Kodak Co., Rochester, NY) at -70 C.

Western Blot Analysis
For Western blot analysis, approximately 1 x 106 cells were incubated in 100 µl of cell lysis RIPA (containing 1 x PBS (pH 7.4), 1% NP 40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/ml phenylmethylsulfonyl fluoride, 30 mg/ml aprotinin, and 10 mg/ml leupeptin) for 15 min on ice. The cellular debris was removed by centrifugation and the protein concentration in the cell lysates was determined using a modified Bradford assay (Bio-Rad Laboratories, Inc.). Aliquots of protein from JEG-3 and {alpha}T3-1 cells were taken from the total cell lysates and subjected to SDS-PAGE under reducing conditions. The separated proteins were then electrophoretically transferred onto nitrocellulose paper (Hybond-C, Amersham Pharmacia Biotech, Morgan, Ontario, Canada). The membranes were blocked with 5% (wt/vol) nonfat milk in Tris buffered saline, containing 20 mM Tris-Cl (pH 8.0), 140 mM NaCl, and 0.05% (wt/vol) Tween 20, for at least 1 h before the addition of PR antibody (catalog no. sc-538x, Santa Cruz Biotechnology, Inc.) in 1:2,000 dilution. This antibody reacts with both PR-A and PR-B of mouse, rat, and human origin (product information, Santa Cruz Biotechnology, Inc.. All antibody incubation and washing were performed in Tris buffered saline with 0.05\% Tween 20. The Amersham Pharmacia Biotech enhanced chemiluminescence system (ECL) was used for detection. Membranes were visualized by exposure to Kodak X-Omat film.

Data Analysis
Data are shown as the means ± SD of triplicate assays in at least two independent experiments with triplicate at each experiment. All data were analyzed by one-way ANOVA followed by Dunnett’s or Tukey’s multiple comparison test using the computer software PRISM GraphPad version 2 (GraphPad Software, Inc., San Diego, CA). Data were considered significantly different from each other when P < 0.05.


    ACKNOWLEDGMENTS
 
We thank Dr. P. Chambon for providing human PR-A and PR-B expression vectors.


    FOOTNOTES
 
This work was supported by grants from the Canadian Institutes of Health Research. P.K.C.L. is a career investigator of the British Columbia Research Institute for Children’s and Women’s Health.

Abbreviations: AMG, Aminoglutethimide; DEX, dexamethasone; GMSA, gel mobility shift assay; GnRHR, GnRH receptor; NF-{kappa}B, nuclear factor-{kappa}B; Oct-1, octamer transcription factor-1; P, progesterone; PRE, progesterone response element; RSV, Rous sarcoma virus; Sty-HLuc (-707 to +1), human GnRHR promoter luciferase construct; TFIID, transcription factor IID.

Received for publication August 23, 2000. Accepted for publication August 16, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Gharib SD, Wierman ME, Shupnik MA, Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocr Rev 11:177–199[Abstract/Free Full Text]
  2. Khodr GS, Siler-Khodr TM 1980 Placental LRF and its synthesis. Science 207:315–317[Abstract/Free Full Text]
  3. Tan L, Rousseau P 1982 The chemical identity of the immunoreactive LHRH-like peptide biosynthesized in the placenta. Biochem Biophys Res Commun 109:1061–1071[CrossRef][Medline]
  4. Seeburg PH, Adelman JP 1984 Characterization of cDNA for precursor of human luteinizing hormone releasing hormone. Nature 311:666–668[CrossRef][Medline]
  5. Merz WE, Erlewein C, Licht P, Harbarth P 1991 The secretion of human chorionic gonadotropin as well as the {alpha}- and ß-messenger ribonucleic acid levels are stimulated by exogenous gonadoliberin pulse applied to first trimester placenta in a superfusion culture system. J Clin Endocrinol Metab 73:84–92[Abstract/Free Full Text]
  6. Siler-Khodr TM, Khodr GS, Rhode J, Vichery BH, Nestor Jr JJ 1987 Gestational age-related inhibition of placental hCG, {alpha}hCG and steroid hormone release in vitro by a GnRH antagonist. Placenta 8:1–14[Medline]
  7. Cheng KW, Nathwani PS, Leung PCK 2000 Regulation of human gonadotropin-releasing hormone receptor gene expression in placental cells. Endocrinology 141:2340–2349[Abstract/Free Full Text]
  8. Duval DL, Nelson SE, Clay CM 1997 The tripartite basal enhancer of the gonadotropin-releasing hormone (GnRH) receptor gene promoter regulates cell-specific expression through a novel GnRH receptor activating sequence. Mol Endocrinol 11:1814–1821[Abstract/Free Full Text]
  9. Ngan ESW, Cheng PKW, Leung PCK, Chow BKC 1999 Steroidogenic factor-1 interact with a gonadotrope- specific element with the first exon of the human gonadotropin-releasing hormone gene to mediate gonadotrope-specific expression. Endocrinology 140:2452–2462[Abstract/Free Full Text]
  10. Norwitz ER, Cardona GR, Jeong KH, Chin WW 1999 Identification and characterization of the gonadotropin-releasing hormone response elements in the mouse gonadotropin-releasing hormone receptor gene. J Biol Chem 274:867–888[Abstract/Free Full Text]
  11. Bauer-Dantoin AC, Hollenberg AN, Jameson JL1993 Dynamic regulation of gonadotropin-releasing hormone receptor mRNA levels in the anterior pituitary gland during the rat estrous cycle. Endocrinology 133:1911–1914
  12. Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers WJ, McNeilly AS 1993 Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Mol Cell Endocrinol 94:R23–R27
  13. Funabashi T, Brooks PJ, Weesner GD, Pfaff DW 1994 Luteinizing hormone-releasing hormone receptor messenger ribonucleic acid expression in the rat during lactation and the estrous cycle. J Neuroendocrinol 6:261–266[Medline]
  14. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1993 Regulation of rat pituitary gonadotropin-releasing hormone receptor mRNA levels in vivo and in vitro. Endocrinology 133:931–934[Abstract/Free Full Text]
  15. Sakurai H, Adams BM, Adems TE 1997 Concentrations of GnRH receptor and GnRH receptor mRNA in pituitary tissue of orchidectomized sheep: effect of oestradiol, progesterone, and progesterone withdrawal. J Endocrinol 152:91–98[Abstract/Free Full Text]
  16. Sagrillo CA, Grattan DR, McCarthy MM, Selmanoff M 1996 Hormonal and neurotransmitter regulation of GnRH gene expression and related reproductive behaviors. Behav Genet 26:241–277[CrossRef][Medline]
  17. Schumacher M, Coirini H, Robert F, Guennoun R, El-Etr M 1999 Genomic and membrane actions of progesterone: implications for reproductive physiology and behavior. Behav Brain Res 105:37–52[CrossRef][Medline]
  18. Schweiger U, Tuschl R, Broocks A, Pirke KM 1990 Gonadotrophin secretion in the second half of the menstrual cycle: a comparison of women with normal cycles, luteal phase defects and disturbed follicular development. Clin Endocrinol (Oxf) 32:25–32[Medline]
  19. Poindexter AN, Dildy GA, Brodyand SA, Snabes MC 1993 The effects of a long-acting progestin on the hypothalamic-pituitary-ovarian axis in women with normal menstrual cycles. Contraception 48:37–45[CrossRef][Medline]
  20. Alexandris E, Millingos S, Kollios G Seferiadis K, Lolis D, Messinis IE 1997 Changes in gonadotropin response to gonadotropin-releasing hormone in normal women following bilateral ovariectomy. Clin Endocrinol (Oxf) 47:721–726[CrossRef][Medline]
  21. Clemm DL, Macy BL, Santiso-mere D, McDonnell DP 1995 Definition of the critical cellular components which distinguish between hormone and antihormone activated progesterone receptor. J Steriod Biochem Mol Biol 53:487–495[CrossRef][Medline]
  22. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  23. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  24. Tora L, Gronrmeyer H, Turcotte B, Gaub MP, Chambon P 1988 The N-terminal region of the chicken progesterone specifies target gene activation. Nature 333:185–188[CrossRef][Medline]
  25. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol 7:1244–1255[Abstract/Free Full Text]
  26. McDonnell DP, Goldman ME 1994 RU 486 exerts antiestrogenic activities through a novel progesterone receptor A form-mediated mechanism. J Biol Chem 269:11945–11949[Abstract/Free Full Text]
  27. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB 1994 A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol 8:1347–1360[Abstract/Free Full Text]
  28. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 14:8356–8364[Abstract/Free Full Text]
  29. Laws SC, Beggs JM, Webster JC, Miller WL 1990 Inhibin increases and progesterone decrease receptor for gonadotropin-releasing hormone in ovine pituitary cultures. Endocrinology 127:373–380[Abstract/Free Full Text]
  30. Wu JC, Sealfon SC, Miller WL 1994 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134:1846–1850[Abstract/Free Full Text]
  31. Kirkpatrick BL, Esquivel E, Moss GE, Hamernik DL, Wise ME 1998 Estradiol and gonadotropin-releasing hormone (GnRH) interact to increase GnRH receptor expression in ovariectomized ewes after hypothalamic-pituitary disconnection. Endocrine 8:225–229[CrossRef][Medline]
  32. Fan NC, Peng C, Krisinger J, Leung PCK 1995 The human gonadotropin-releasing hormone receptor gene: complete structure including multiple promoters, transcription initiation sites, and polyadenylation signals. Mol Cell Endocrinol 107:R1–R8
  33. Kang SK, Cheng KW, Ngan ESW, Chow BKC, Choi KC, Leung PCK 2000 Differential expression of human gonadotropin-releasing hormone receptor gene in pituitary and ovarian cells. Mol Cell Endocrinol 162:157–166[CrossRef][Medline]
  34. Vaananen JE, Lee S, Vaananen CCM, Ho Yuen B, Leung, PCK 1998 Stepwise activation of the gonadotropic signal transduction pathway, and the ability of prostaglandin F2{alpha} to inhibit this activated pathway. Endocrine 8:301–307[CrossRef][Medline]
  35. Cheng KW, Ngan ESW, Kang SK, Chow BKC, Leung PKC 2000 Transcriptional down-regulation of human gonadotropin-releasing hormone (GnRH) receptor gene by GnRH: role of protein kinase C and activating protein 1. Endocrinology 141:3611–3622[Abstract/Free Full Text]
  36. Harvell DME, Strecker TE, Tochacek M, Xie B, Pennington KL, McComb RD, Roy SK, Shull JD 2000 Rat strain-specific actions of 17ß-estradiol in the mammary gland: correlation between estrogen-induced lobuloalceolar hyperplasia and susceptibility to estrogen-induced mammary cancers. Proc Natl Acad Sci USA 97:2779–2784[Abstract/Free Full Text]
  37. Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M, Gustafsson JA 2000 Estrogen receptor (ER) ß, a modulator of ER {alpha} in the uterus. Proc Natl Acad Sci USA 97:5936–5941[Abstract/Free Full Text]
  38. El-Hefnawy T, Huhtaniemi I 1998 Progesterone can participate in down-regulation of the luteinizing hormone receptor gene expression and function in cultured murine leydig cells. Mol Cell Endocrinol 137:127–138[CrossRef][Medline]
  39. Cheng KW, Chow BKC, Leung PCK 2001 Functional mapping of a placental specific upstream promoter for human gonadotropin-releasing hormone receptor gene. Endocrinology 142:1506–1516[Abstract/Free Full Text]
  40. Mao J, Regelson W, Kalimi M 1992 Molecular mechanism of RU 486 action: a review. Mol Cell Biochem 109:1–8[Medline]
  41. Schott DR, Shyamala G, Schneider W, Parry G 1991 Molecular cloning, sequence analyses, and expression of complementary DNA encoding murine progesterone receptor. Biochem 30:7014–7020[CrossRef][Medline]
  42. Reyes FI, Winter JS, Faiman C 1976 Pituitary gonadotropin function during human pregnancy: serum FSH and LH levels before and after LHRH administration. J Clin Endocrinol Metab 42:590–592[Abstract/Free Full Text]
  43. Rubinstein LM, Parlow AF, Derzko C, Hershman J 1978 Pituitary gonadotropin response to LHRH in human pregnancy. Obstet Gynecol 52:172–175[Medline]
  44. Sowers JR, Colantino M, Fayez J, Jonas H 1978 Pituitary response to LHRH in midtrimester pregnancy. Obstet Gynecol 52:685–688[Medline]
  45. Marrs RP, Kletzky OA, Mishell Jr DR 1981 Functional capacity if the gonadotrophs during pregnancy and the puerperium. Am J Obstet Gynecol 141:658–661[Medline]
  46. Crowder ME, Nett TM 1984 Pituitary content of gonadotropins and receptors for gonadotropin-releasing hormone (GnRH) and hypothalamic content of GnRH during the periovulatory period of the ewe. Endocrinology 114:234–239[Abstract/Free Full Text]
  47. Turizillo AM, Campion CE, Clay CM, Nett TM 1994 Regulation of gonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic acid and GnRH receptor during the early preovulatory period in the ewe. Endocrinology 135:1353–1358[Abstract]
  48. Yin H, Cheng, KW, Hwa HL, Peng C, Auersperg N, Leung PCK 1998 Expression of the messenger RNA for gonadotropin-releasing hormone and its receptor in human cancer cell lines. Life Sci 62:2015–2023[CrossRef][Medline]
  49. Fritz MA, Speroff L 1982 The endocrinology of the menstrual cycle: the interaction of folliculogenesis and neuroendocrine mechanisms. Fertil Steril 38:509–529[Medline]
  50. Truss M, Beato M 1993 Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459–479[Abstract/Free Full Text]
  51. Jaffrain-Rea ML, Petrangeli E, Ortolani F, Fraioli B, Lise A, Esposito V, Spagnoli LG, Tamburrano G, Gulino A 1996 Cellular receptors for sex steroids in human pituitary adenomas. J Endocrinol 151:175–184[Abstract/Free Full Text]
  52. Rossmanith WG, Wolfahrt S, Ecker A, Eberhardt E 1997 The demonstration of progesterone, but not of estrogen, receptor in the developing human placenta. Horm Metab Res 29:604–610[Medline]
  53. Shanker YG, Sharma SC, Rao AJ 1997 Expression of progesterone receptor mRNA in the first trimester human placenta. Biochem Mol Biol Int 42:1235–1240[Medline]
  54. Cudeville C, Mondon F, Robert B, Rebourcet R, Mignot TM, Benassayag C, Freer F 2000 Evidence for progesterone receptors in the human fetoplacental vascular tree. Biol Reprod 62:759–765[Abstract/Free Full Text]
  55. Rao AJ, Prasad KS, Sharma SC, Subbraryan VS 1995 Role of 17 ß-estradiol and progesterone in the regulation of synthesis and secretion of chorionic gonadotropin by the first trimester human placenta. J Steroid Biochem Mol Biol 53:233–239[CrossRef][Medline]
  56. Karalis K, Majzoub JA 1996 Regulation of placental corticotropin-releasing hormone by steroids, Possible implications in labor initiation. Ann NY Acad Sci 771:551–555[CrossRef]
  57. Kastner P, Krust A, Turocotte B, Stropp U, Tora L, Gronemeyer M, Chambon P 1990 Two distinct estrogen- regulated promoter generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:1603–1614[Medline]
  58. Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel, MT, Granemeyer H 1992 A limiting factor mediate the differential activation of promoter by the human progesterone receptor isoforms. J Biol Chem 267:10882–10887[Abstract/Free Full Text]
  59. Numan M, Roach JK, Del Cerro MC, Guillamon A, Segovia S, Sheehanm TP, Numan MJ 1999 Expression of intracellular progesterone receptors in rat brain during different reproductive states, and involvement in maternal behavior. Brain Res 830:358–371[CrossRef][Medline]
  60. Wei LL, Miner R 1994 Evidence for the existence of a third progesterone receptor protein in human breast cancer cell line T47D. Cancer Res 54:340–343[Abstract/Free Full Text]
  61. Wei LL, Hawkins P, Baker C, Norris B, Sheridan PL, Quinn PG 1996 An amino-terminal truncated progesterone receptor isoform, PRC, enhances progestin-induced transcriptional activity. Mol Endocrinol 10:1379–1387[Abstract/Free Full Text]
  62. Beato M, Candau R, Chavez S, Mows C, Truss M 1996 Interaction of steroid hormone receptors with transcription factors involves chromatin remodeling. J Steroid Biochem Mol Biol 56:47–59[CrossRef][Medline]
  63. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor coactivators. Curr Opion Cell Biol 9:222–232[CrossRef][Medline]
  64. Robyr D, Wolffe AP, Wahli W 2000 Nuclear hormone receptor coregulators in action: diversity for shared tasks. Mol Endcroinol 14:329–347
  65. Bruggemeier U, Kalff M, Franks S, Scheidereit C, Beato M 1991 Ubiquitous transcription factor OTF-1 mediates induction of the mouse mammary tumors virus promoter through synergistic interaction with hormone receptors. Cell 64:565–572[CrossRef][Medline]
  66. Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:6169–6174[Abstract/Free Full Text]
  67. Stoecklin E, Wissler M, Schaetzle D, Pfitzner E, Groner B 1999 Interaction in the transcriptional regulation exerted by Stst5 and by members of the steroid hormone receptor family. J Steroid Biochem Mol Biol 69:195–204[CrossRef][Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
B.-S. An, S. L. Poon, W.-K. So, G. L. Hammond, and P. C.K. Leung
Rapid Effect of GNRH1 on Follicle-Stimulating Hormone Beta Gene Expression in LbetaT2 Mouse Pituitary Cells Requires the Progesterone Receptor
Biol Reprod, August 1, 2009; 81(2): 243 - 249.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. M. Jacobsen, P. Jambal, S. A. Schittone, and K. B. Horwitz
ALU Repeats in Promoters Are Position-Dependent Co-Response Elements (coRE) that Enhance or Repress Transcription by Dimeric and Monomeric Progesterone Receptors
Mol. Endocrinol., July 1, 2009; 23(7): 989 - 1000.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. Wang, E.-W. Lee, L. Zhou, P. C. K. Leung, D. D. Ross, J. D. Unadkat, and Q. Mao
Progesterone Receptor (PR) Isoforms PRA and PRB Differentially Regulate Expression of the Breast Cancer Resistance Protein in Human Placental Choriocarcinoma BeWo Cells
Mol. Pharmacol., March 1, 2008; 73(3): 845 - 854.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
F. M. Horne and D. L. Blithe
Progesterone receptor modulators and the endometrium: changes and consequences
Hum. Reprod. Update, November 1, 2007; 13(6): 567 - 580.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C M. Luetjens, A. Didolkar, S. Kliesch, W. Paulus, A. Jeibmann, W. Bocker, E. Nieschlag, and M. Simoni
Tissue expression of the nuclear progesterone receptor in male non-human primates and men.
J. Endocrinol., June 1, 2006; 189(3): 529 - 539.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
C.-M. Yeung, B.-S. An, C. K. Cheng, B. K.C. Chow, and P. C.K. Leung
Expression and transcriptional regulation of the GnRH receptor gene in human neuronal cells
Mol. Hum. Reprod., November 1, 2005; 11(11): 837 - 842.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev., April 1, 2005; 26(2): 283 - 306.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B.-S. An, J.-H. Choi, K.-C. Choi, and P. C. K. Leung
Differential Role of Progesterone Receptor Isoforms in the Transcriptional Regulation of Human Gonadotropin-Releasing Hormone I (GnRH I) Receptor, GnRH I, and GnRH II
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1106 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. K. Cheng, B. K. C. Chow, and P. C. K. Leung
An Activator Protein 1-Like Motif Mediates 17{beta}-Estradiol Repression of Gonadotropin-Releasing Hormone Receptor Promoter via an Estrogen Receptor {alpha}-Dependent Mechanism in Ovarian and Breast Cancer Cells
Mol. Endocrinol., December 1, 2003; 17(12): 2613 - 2629.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-L. Zhang, D. Zhang, F. J. Michel, J. L. Blum, F. A. Simmen, and R. C. M. Simmen
Selective Interactions of Kruppel-like Factor 9/Basic Transcription Element-binding Protein with Progesterone Receptor Isoforms A and B Determine Transcriptional Activity of Progesterone-responsive Genes in Endometrial Epithelial Cells
J. Biol. Chem., June 6, 2003; 278(24): 21474 - 21482.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Ozisik, G. Mantovani, J. C. Achermann, L. Persani, A. Spada, J. Weiss, P. Beck-Peccoz, and J. L. Jameson
An Alternate Translation Initiation Site Circumvents an Amino-Terminal DAX1 Nonsense Mutation Leading to a Mild Form of X-Linked Adrenal Hypoplasia Congenita
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 417 - 423.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
X. Fang, S. Wong, and B. F. Mitchell
Messenger RNA for progesterone receptor isoforms in the late-gestation rat uterus
Am J Physiol Endocrinol Metab, December 1, 2002; 283(6): E1167 - E1172.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, K. W.
Right arrow Articles by Leung, P. C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, K. W.
Right arrow Articles by Leung, P. C. K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE
*PROGESTERONE
*RU-486


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals