Molecular Endocrinology 15 (12): 2078-2092
Copyright © 2001 by The Endocrine Society
Differential Role of PR-A and -B Isoforms in Transcription Regulation of Human GnRH Receptor Gene
Kwai Wa Cheng,
Chi-Keung Cheng and
Peter C. K. Leung
Department of Obstetrics and Gynaecology, The University of British
Columbia, Vancouver, British Columbia, Canada, V6H 3V5
Address all correspondence and requests for reprints to: Dr. Peter C. K. Leung, Department of Obstetrics and Gynaecology, The University of British Columbia, 2H30-4490 Oak Street, British Columbia Womens Hospital, Vancouver, British Columbia, Canada, V6H 3V5. E-mail: peleung{at}interchange ubc.ca.
 |
ABSTRACT
|
|---|
The presence of progesterone response element (PRE) in the
5'-flanking region of the human GnRH receptor (GnRHR) suggests the
possible regulation of this gene by progesterone (P). In the present
study, we examined the effects of P in transcriptional regulation of
human GnRHR gene expression at the pituitary and placenta levels since
the GnRHR has been detected in both tissues. By the use of transient
transfection assays, a differential regulation of human GnRHR promoter
activity by P was observed. P treatment resulted in a decrease in
promoter activity in the pituitary
T31 cells, suggesting a
P-mediated inhibitory action. Interestingly, P is found to have a
stimulatory role at the placental expression of this gene. Addition of
RU486 to, or inhibition of endogenous P production by, the
placental JEG-3 cells leads to a decrease in promoter activity, which
is reversed by the replacement of P. Further studies have identified a
putative PRE, namely human GR-PRE (located between -535 and
-521, related to translation start site), that may be responsible for
the P action since the mutation of these motifs reversed the P-mediated
effects. The binding of PR to this element is confirmed by antibody
supershift assays. The physiological effects of P are mediated through
two PR isoforms, namely PR-A and PR-B. In the present study,
overexpression of human PR-A resulted in a decrease in human promoter
activity in both pituitary and placental cells. Interestingly,
overexpression of PR-B exhibits a cell-dependent transcriptional
activity, whereby it functions as a transcription activator in the
placenta but as a transcription repressor in the pituitary. In summary,
our results demonstrated a differential usage of PR-A and PR-B in
transcriptional regulation of human GnRHR gene expression by P at the
pituitary and placenta levels.
 |
INTRODUCTION
|
|---|
IT IS WELL established that hypothalamic
GnRH (1) plays a major role in controlling reproductive
function. It regulates the biosynthesis and secretion of gonadotropin
after binding to its receptor (GnRHR) at the level of the pituitary
gonadotrope cells (1). In addition to the
hypothalamic-pituitary axis, GnRH and GnRHR have been detected in other
reproductive tissue, including the human placenta. Placental GnRH is
biochemically and structurally identical to hypothalamic GnRH
(2, 3, 4). Functionally, GnRH has been demonstrated to
regulate human CG (hCG) secretion (5). This stimulatory
effect was inhibited by treatment with a GnRH antagonist
(6), suggesting a receptor-mediated process. Recently, we
have reported the isolation of full-length GnRHR from human placental
cells, including choriocarcinoma JEG-3 cells, immortalized extravillous
trophoblast, and primary culture of trophoblast cells (7).
The colocalization of GnRH and its receptor and the effect of exogenous
GnRH on hCG secretion strongly suggest that the placenta may possess
its own GnRH system, analogous to the hypothalamus-pituitary system. We
and others (8, 9, 10) have demonstrated that the regulation
of GnRHR number is mediated, at least in part, at the transcriptional
level of GnRHR gene expression. Therefore, regulation of GnRHR
expression has been implicated as one of the important mechanisms in
controlling GnRH action.
The change in GnRHR numbers and its mRNA levels on the pituitary
gonadotropes throughout the estrous cycle (11, 12, 13) and
after gonadectomy (14, 15) suggests a role of gonadal
steroids in regulating the expression of the GnRHR gene. It has
also been shown that progesterone (P) negatively regulated the
hypothalamic- pituitary functions through a negative feedback
mechanism in animals (16, 17) and in humans
(18, 19, 20). The physiological effects of P are mediated
through a specific nuclear receptor protein, PR. Two major isoforms of
PR, namely PR-A and PR-B, have been described. The large PR-B form
contains an additional 164 amino acids at the N terminus that are
missing in the truncated PR-A form (21). Hormonal binding
to PRs results in the dissociation of heat shock proteins, thereby
allowing receptors to form dimers and bind specific nucleotide
sequences known as progesterone response elements (PREs) (22, 23). Receptor interaction with PREs can result in either an
increase or decrease in gene transcription. In cell transfection
systems, the two PR isoforms have distinct transcriptional properties.
In general, PR-B acts as a stronger transcriptional activator, whereas
the transcriptional activity of PR-A was cell- and gene-specific
dependent. Interestingly, PR-A also functions as a transcriptional
inhibitor of PR-B as well as of other steroid receptor families when
PR-A itself is transcriptionally inactive
(24, 25, 26, 27, 28).
There is evidence that P inhibits expression of ovine GnRHR gene
expression. Using primary cultures of ovine pituitary cells, P reduced
the binding of GnRH (29) and decreased the amount of GnRHR
mRNA (15, 30, 31). Other than these findings, no
information is available on the role of P in regulating human GnRHR
gene expression. In addition, the exact role of P in regulating
GnRHR gene expression at the transcriptional level remains unknown. We
have previously isolated the human GnRHR gene (32), and
DNA analysis of the human GnRHR 5'-flanking region revealed the
presence of a putative PRE (32). In light of these
studies, it is reasonable to believe that the P can directly regulate
the expression of the human GnRHR. As the GnRHR mRNA was detected in
both pituitary and placenta, and the placenta is a major site of P
secretion, the goal of the present study was to understand the
molecular mechanism underlying the regulatory role of P on GnRHR gene
transcription.
 |
RESULTS
|
|---|
P Regulates Human GnRHR Promoter Activity
To examine the transcriptional regulation of human GnRHR gene
expression by P in the pituitary and placenta, full-length human GnRHR
promoter-luciferase construct (p2300F-Luc) was transiently transfected
into
T3-1 and JEG-3 cells, respectively, and treated with increasing
concentrations of P for 24 h. Although a slight decrease (14%,
P > 0.05) in promoter activity in
T3-1 cells was
observed with 10 nM P treatment, a statistically
significant decrease of promoter activity was achieved after treatment
with 1 µM P (28%, P < 0.01)
and 10 µM P (59%, P < 0.001),
respectively (Fig. 1A
). In addition, this
inhibitory effect was shown to be time dependent since the degree of
inhibition increased with time of treatment (Fig. 1B
). These results
suggested an inhibitory effect of P on human GnRHR gene transcription
at the pituitary level. In contrast, no change in GnRHR promoter
activity was observed in JEG-3 cells (data not shown). As JEG-3 cells
produce a high level of P endogenously, we next used a P antagonist,
RU486, to indirectly examine the effects of P on human GnRHR promoter
activity in JEG-3 cells. Interestingly, a dose- and time-dependent
decrease in GnRHR promoter activity was observed after addition of
RU486 (Fig. 2
, A and B), suggesting that
P was important in maintaining the expression of human GnRHR gene
expression in the placenta. To further confirm the stimulatory role of
P in the placental expression of human GnRHR, the endogenous production
of P from JEG-3 was inhibited by the addition of aminoglutethimide
(AGT) (38). A dose-dependent inhibition of P production
was observed and the maximal inhibition was achieved at 0.1
mM AGT (Fig. 3A
).
Furthermore, inhibition of P production by ATG resulted in a 30%
decrease (P < 0.001) in human GnRHR promoter activity,
and this decrease in promoter activity was reversed by the replacement
of P (Fig. 3B
). These results strongly implicate a stimulatory role of
P in the expression of human GnRHR gene in the placenta.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Dose- and Time-Dependent Regulation of Human
GnRHR-Luciferase Vector (p2300-LucF) Activity in T3-1 Cells Treated
with P
A, The p2300-LucF transfected cells were treated with varying
concentration of P (1 nM to 10 µM) for
24 h. The RSV-lacZ vector was cotransfected to
normalize for varying transfection efficiencies. Luciferase units were
calculated as luciferase activity/ß-galactosidase activity. B, The
p2300-LucF transfected cells were treated with 10 µM P
for the indicated time points. Relative promoter activity is shown as
percentage of control. Values represent mean ± SE
from triplicate assays in three separate experiments. a,
P < 0.01 compared with control; b,
P < 0.01 vs. the immediately
adjacent group on the left.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Figure 2. Dose- and Time-Dependent Regulation of Human
GnRHR-Luciferase Vector (p2300-LucF) Activity in JEG-3 Cells Treated
with RU486
A, The p2300-LucF transfected cells were treated with varying
concentrations of RU486 (1 nM to 10 µM) for
24 h. The RSV-lacZ vector was cotransfected to
normalize for varying transfection efficiencies. Luciferase units were
calculated as luciferase activity/ß-galactosidase activity. B, The
p2300-LucF transfected cells were treated with 10 µM
RU486 for the indicated time points. Relative promoter activity is
shown as percentage of control. Values represent mean ±
SE from triplicate assays in three separate experiments. a,
P < 0.01 compared with control; b,
P < 0.01 vs. the immediately
adjacent group on the left.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. Effects of P in Human GnRHR-Luciferase Vector
(p2300-LucF) Activity in JEG-3 Cells
A, Human choriocarcinoma JEG-3 cells were treated with varying
concentration (1 pM to 0.1 mM) of
DL-aminoglutethimide (AGT) for 24 h. The production of
P was measured by RIA and shown as percentage of control. Values
represent mean ± SE from triplicate assays in two
separate experiments. a, P < 0.01 from control; b,
P < 0.001 vs. the immediately
adjacent group on the left. B, The production of P from
JEG-3 cells was inhibited with 0.1 mM AGT treatment during
transfection. After transfection, the cells were incubated for an
additional 24 h in the presence of 0.1 mM AGT and
increasing concentrations of P (0.1 nM to 0.1
µM). Relative promoter activity is shown as percentage of
control after being normalized to ß-galactosidase activity. Values
represent mean ± SE from triplicate assays in three
separate experiments. a, P < 0.01 compared with
control.
|
|
Localization of P Response Region in Human GnRHR 5'-Flanking
Region
To localize a specific region that mediates the P effects on the
2.3-kb 5'-flanking region of the human GnRHR gene, a series of
5'-deletion mutants were analyzed in
T3-1 and JEG-3 cells and
treated with 10 µM P and 10 µM RU486,
respectively. Transient transfection studies showed similar results for
both cell lines (Fig. 4
). The results
revealed that a region between -577 to -227 (relative to translation
start site) was involved in P-mediated action. Progressive
5'-deletion up to -577 did not affect the P- and RU486-induced
inhibition of the human GnRHR promoter activity in
T3-1 and JEG-3
cells, respectively (Fig. 4
, B and C). Further deleting the sequence
from -577 to -227 (relative to translation start site) resulted in a
loss of the response in P- and RU486-induced inhibition in both cells.
Although we have demonstrated that an upstream promoter was
predominantly used in JEG-3 cells (39), no
RU486-induced decrease in promoter activity was observed in this
upstream promoter in JEG-3 cells (data not shown). Taken together,
these data suggest that the 350-bp region (located between -577 and
-227) containing the putative transcription factor(s) binding site was
important in mediating the P-mediated effects on human GnRHR promoter
activity in both pituitary and placenta.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4. Localization of the P-Responsive Region in the
Human GnRHR Gene
A, Diagrammatic representation of progressive 5'-deletion constructs of
p2300-LucF. Deletion mutants were transiently transfected into T3-1
(panel B) and JEG-3 (panel C) cells by the calcium precipitation method
and treated with 10 µM P and 10 µM RU486,
respectively, for 24 h. The RSV-lacZ vector was
cotransfected to normalize for varying transfection efficiencies.
Relative promoter activity of each construct is shown as fold increase
over a promoterless luciferase control pGL2-Basic, the activity of
which is set to be 1, after being normalized to ß-galactosidase
activity. Values represent mean ± SE of triplicate
assays in three separate experiments. a, P < 0.01
compared with pGL2-Basic.
|
|
It has been demonstrated that RU486 binds both GR and PR
(40). To eliminate the possible role of GR in mediating
the RU486 action in placental cells, JEG-3 cells were transiently
transfected with Sty-HLuc (-707 to +1; human GnRHR promoter-luciferase
construct) and treated with increasing concentrations of
dexamethasone (DEX) or P in the presence of 10 µM RU486
(Fig. 5
). As expected, addition of 10
µM RU486 resulted in a significant decrease in promoter
activity, and P (0.1 µM and 10 µM)
replacement reversed this inhibitory effect. In contrast, addition of
DEX did not reverse the RU486-induced decrease in promoter
activity.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5. Blocking of P Action by RU486 in JEG-3 Cells
The JEG-3 cells were transiently transfected with Sty-HLuc. Cells were
harvested 24 h post transfection and were treated with vehicle
(control), 10 µM RU486, 0.1 nM, 10
nM, or 1 µM DEX in the presence of 10
µM RU486, or 0.1 µM or 10 µM
P in the presence of 10 µM RU486. The RSV-lacZvector was cotransfected to normalize for varying transfection
efficiencies. Luciferase units were calculated as luciferase
activity/ß-galactosidase activity. Values represent mean ±
SE from duplicate assays in three separate experiments. a,
P < 0.01 compared with control; b,
P < 0.01 compared with RU486.
|
|
Identification of Transcription Binding Sites
DNA analysis of the DNA region between -577 and -227 identified
one putative PRE binding site, namely hGR-PRE (5'-TCAACAGTGTGTTTG-3'
located at -535 to -521; with 75% homology to the consensus PRE
site) and a half-PRE binding site, namely hGR-hPRE (5'-AGAACA-3'
located at -402 to -397; with 100% homology to the half-consensus
PRE site). To examine the role of these putative PRE motifs in
controlling the expression of GnRHR gene, the two putative PRE motifs
were mutated in Sty-HLuc, as the highest promoter activity was obtained
from this construct (Fig. 4
). Mutation of the putative hGR-PRE resulted
not only in reducing the P-induced inhibition but also increased the
basal luciferase activity in
T3-1 cells (Fig. 6A
). A 60% increase (P
< 0.001) in basal promoter activity was observed after site-directed
mutation of the hGR-PRE but not in mutated hGR-hPRE. Although the
mutation of hGR-PRE significantly reduced the P-induced decrease in
promoter activity from 54% to 19%, it did not completely eliminate
the P-induced inhibition of promoter activity. Mutation of hGR-hPRE did
not affect the basal promoter activity or eliminate the P-mediated
action in transfected
T3-1 cells.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 6. Functional Analysis of Putative PRE in Human GnRHR
Promoter
Mutations were introduced by three-step PCR mutagenesis as
described in Materials and Methods. The wild-type and
mutated promoter constructs were cotransfected with RSV-lacZvector, to normalize for varying transfection efficiencies, into
T3-1 and JEG-3 cells. A, The transfected T3-1 cells were treated
with 10 µM P for 24 h. B, the PRE mutant-transfected
JEG-3 cells were treated with 10 µM RU486 for 24 h.
The relative basal activity of each promoter mutant is shown as
percentage of vehicle treated (control) Sty-HLuc, the activity of which
is taken as 100%, after being normalized to ß-galactosidase
activity. The percentage of inhibition is calculated by comparison with
individual control. Values represent mean ± SE of
triplicate assays in three separate experiments. The names and the
relative position of the putative transcription factor binding sites
are given, and the mutated element is shown as bars with
diagonal lines. The relative change in promoter activity after
treatment was indicated. a, P < 0.05 compared with
control.
|
|
In JEG-3 cells, mutation of hGR-PRE led to a 35% decrease
(P < 0.001) in basal promoter activity (Fig. 6B
).
Again, no such reduction in promoter activity was observed in mutated
hGR-hPRE. In addition, mutation of hGR-PRE completely abolished the
RU486-induced decrease in promoter activity in placental cells (Fig. 6B
). Taken together, these results suggest that the hGR-PRE located at
-535 to -521 plays an important role in mediating the effect of
P on GnRHR transcription.
Effects of Cotransfection of PR on Human GnRHR Promoter Activity in
T3-1 and JEG-3 Cells
The expression of PRs in JEG-3 and
T3-1 cells was examined by
Western blot analysis. Aliquots of protein (50 µg), isolated from
JEG-3 or
T3-1 cells, were separated in SDS-PAGE and detected with
antibody against PR. As seen in Fig. 7A
, both PR-A and PR-B were expressed in JEG-3 and
T3-1 cells. The
molecular masses of the detected human PR-A (95 kDa) and human PR-B
(114120 kDa), and mouse PR-A (85 kDa) and mouse PR-B (115 kDa) from
JEG-3 and
T3-1 cells, respectively, were similar to those reported
previously (25, 41). Interestingly, the levels of PR-A in
JEG-3 cells were very low when compared with PR-B levels. Although both
PR-A and PR-B isoforms were detected in
T3-1 cells, a relative high
concentration of P was required to induce the decrease in hGnRHR
promoter activity. This may due to the different ability of human and
mouse PRs to transactivate a human gene. To further evaluate the role
of human PR-A and PR-B in mediating the P action at the pituitary and
placenta levels, the human PR-A and PR-B expression constructs were
cotransfected into
T3-1 and JEG-3 cells. Cotransfection of human
PR-A and PR-B expression vectors into JEG-3 and
T3-1 cells resulted
in an increase in human PR-A and PR-B levels (Fig. 7
, B and C).
As expected, no significant change in promoter activity was observed
after treatment with 0.1 µM P for 24 h at the
Sty-HLuc-transfected
T3-1 cells (Fig. 8
). However, overexpression of human PRs
in
T3-1 cells increased the sensitivity toward P treatment. A
significant decrease (52%, P < 0.001) in promoter
activity was achieved in 0.1 µM P treatment
after cotransfection with 1 µg of PR-B expression vector (Fig. 8A
).
Similarly, cotransfection with 1 µg of PR-A expression vector
resulted in a slight decrease (20%, P < 0.05) in
the promoter activity after treatment with 0.1
µM P. Nevertheless, these data suggest
that PR-B may play a more active role than PR-A in mediating
P-induced inhibitory effects on the pituitary, since a higher
inhibition in promoter activity was observed in PR-B cotransfected
cells after P treatment. The functional role of the PRE in
mediating the P-induced decrease in promoter activity at the
pituitary was also examined in the hGR-PRE and hGR-hPRE-mutated
constructs. Again, an increase in basal promoter activity was
observed after the mutation of hGR-PRE, and this mutation eliminated
and reduced the degree of inhibition induced by 0.1
µM P after overexpression of human PR-A and
PR-B (from 52% to 17%), respectively (Fig. 8A
).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 8. Effects of Overexpression of Human PR-A and PR-B in
Promoter Activity on PRE Intact or Mutated Constructs
A, The wild-type or PRE mutated construct-transfected T3-1 cells
were treated with 0.1 µM P for 24 h with or without
cotransfection of human PR-A or PR-B expression vector. B, The
wild-type or PRE mutated construct-transfected JEG-3 cells were
cotransfected with human PR-A and/or PR-B expression vector. The
relative basal activity of each promoter mutants is shown as percentage
of vehicle-treated (control) Sty-HLuc, the activity of which is taken
as 100%, after being normalized to ß-galactosidase activity. The
percentage change in promoter activity is calculated by comparison with
individual control. Values represent mean ± SE of
triplicate assays in three separate experiments. The names and the
relative positions of the putative transcription factor binding sites
are given, and the mutated element is shown as bars with
diagonal lines. The percentage change in promoter activity is
indicated. *, P < 0.05 compared with control.
|
|
In the placenta JEG-3, overexpression of hPR-A resulted in a 51%
decrease (P < 0.001) in basal promoter activity
(Fig. 8B
). In contrast, overexpression of hPR-B led to an increase
(39%, P < 0.001) in promoter activity (Fig. 8B
). In
addition, coexpression of hPR-A and hPR-B counteract each others
function in regulating the promoter activity. These results suggested
that the balance between PR-A and PR-B expression in the placenta plays
an important role in controlling the expression of this gene, whereas
PR-B stimulates and PR-A inhibits the promoter activity. Further
studies have shown that the hGR-PRE solely mediated the
hPR-B-stimulated increase in human GnRHR promoter activity as the
mutation of this binding site eliminated the increase in luciferase
activity (Fig. 8B
). Although the mutation of hGR-PRE decreased the
inhibitory effect of overexpression of hPR-A (from 51% to 23%), it
did not completely eliminate this effect, suggesting that an additional
regulatory mechanism is involved in mediating the PR-A action.
The Binding of PR to the Putative hGR-PRE
To confirm the identity of the transcription factor bound to the
hGR-PRE, gel mobility shift assay was preformed with a synthetic
oligodeoxynucleotide containing the putative hGR-PRE binding site
in the presence of consensus and mutated PRE, hGR-PRE, nonrelated
oligodeoxynucleotide, or antibody against the PR. Very weak DNA-protein
complexes were obtained from nuclear extracts isolated from
T3-1
cells without transfection with human PR expression vectors (Fig. 9A
, lane 1). In contrast, strong specific
DNA-protein complexes were observed using the nuclear extract isolated
from
T3-1 cells, after cotransfection with both human PR-A and PR-B
expression vectors (Fig. 9A
, lanes 2 and 3: indicated as
arrows 1, 2, and 3). These complexes were eliminated with
the addition of increasing competitor DNA fragment (200-fold in excess)
containing a consensus PRE (lane 5) and hGR-PRE (lane 7) but not with a
competitor containing mutated PRE (lane 4), mutated hGR-PRE (lane 6),
or nonrelated sequence nuclear factor-
B (NF-
B) (lane 8) or
transcription factor IID (TFIID) (lane 9). Furthermore, the addition of
an antibody against the PR supershifted the DNA-protein complexes,
further supporting the binding of the PR to this binding site (Fig. 9B
, lane 11). Similarly, specific DNA-protein complexes were obtained
using nuclear extract isolated from JEG-3 cells (Fig. 10A
, indicated as arrows 4
and 5). These complexes were also eliminated with the addition of
increasing competitor DNA fragment (200-fold in excess) containing a
consensus PRE (lane 3) and hGR-PRE (lane 5) but not with a competitor
containing mutated PRE (lane 2), mutated hGR-PRE (lane 4), or
nonrelated sequence NF-
B (lane 6) or TFIID (lane 7). As expected,
the addition of an antibody against the PR supershifted the DNA-protein
complexes (Fig. 10B
, lane 9).

View larger version (62K):
[in this window]
[in a new window]
|
Figure 9. Identification of PR Binding to the Putative
hGR-PRE Binding Sites in the Human GnRHR Gene by GMSA Using Nuclear
Extract Isolated from Human PR-Transfected T3-1 Cells
A, Synthetic deoxyribonucleotide containing the putative PRE sequences
(hGR-PRE) in the human GnRHR gene was 32P labeled and
incubated with nuclear extract isolated from human PR-A and PR-B
cotransfected, P-treated T3-1 cells in the presence of 200-fold
excess specific competitor oligonucleotide. Specific DNA-protein
complexes formed to the hGR-PRE (indicated as arrows 1,
2, and 3) were eliminated in the presence of
competitor oligonucleotide (lane 3, no competitor; lane 4, mutated
consensus PRE; lane 5, consensus PRE; lane 6, mutated hGR-PRE; lane 7,
hGR-PRE; lane 8, consensus NF- B and lane 9, consensus TFIID). B,
GMSA studies were performed in the presence of antibodies specific to
PR, Oct-1, and GATA-2. Antibodies were incubated with nuclear extract
isolated from human PR-A and PR-B cotransfected, P-treated T3-1
cells for 1 h before the addition of the 32P-labeled
hGR-PRE probe. DNA-protein complexes were supershifted by the addition
of antibody against PR (lane 11, indicated as arrow
labeled "Shifted") but not by antibodies against IgG (lane 10),
Oct-1 (lane 12), and GATA-2 (lane 13).
|
|

View larger version (63K):
[in this window]
[in a new window]
|
Figure 10. Identification of PR Binding to the Putative
hGR-PRE Binding Sites in the Human GnRHR Gene by GMSA Using Nuclear
Extract Isolated from Human Placental JEG-3 Cells
A, Synthetic deoxyribonucleotide containing the putative PRE sequences
(hGR-PRE) in human GnRHR gene was 32P labeled and incubated
with nuclear extract isolated from human placental JEG-3 cells in the
presence of a 200-fold excess of the indicated specific competitor
oligonucleotide. Specific DNA-protein complexes formed to the hGR-PRE
(indicated as arrows 4 and 5) were
eliminated in the presence of competitor oligonucleotide (lane 1, no
competitor; lane 2, mutated consensus PRE; lane 3, consensus PRE; lane
4, mutated hGR-PRE; lane 5, hGR-PRE; lane 6, consensus NF- B and lane
7, consensus TFIID). B, Gel mobility assay studies were performed in
the presence of antibodies specific to PR, Oct-1, and GATA-2.
Antibodies were incubated with nuclear extract isolated from human
placental JEG-3 cells for 1 h before the addition of the
32P-labeled hGR-PRE probe. DNA-protein complexes were
supershifted by the addition of antibody against PR (lane 9, indicated
as arrow labeled "Shifted") but not by antibodies
against IgG (lane 8), Oct-1 (lane 10), and GATA-2 (lane 11).
|
|
 |
DISCUSSION
|
|---|
While P is the dominant steroid present in the circulation during
human gestation, pituitary responsiveness to GnRH is reduced during
this period (42, 43, 44, 45). Recent studies in the ovine have
demonstrated that the numbers of GnRHR were relatively lower during the
luteal phase of the estrous cycle (46), and induction of
luteolysis by PGF2
resulted in an increase in both GnRHR numbers and
mRNA levels in vivo (47). These data suggested
a negative regulatory effect of P in GnRHR expression. In subsequent
studies using primary culture of ovine pituitaries, a decrease in
GnRHR mRNA levels was observed after P treatment (15, 30, 31), further supporting the negative role of P in regulating the
ovine GnRHR gene expression. In spite of these observations, little is
known about the role of P in regulating human GnRHR gene expression.
Furthermore, the molecular mechanism of P action in mediating the
expression of the GnRHR gene remains unknown. In the present study, we
have examined the effects of P in controlling the transcription of the
human GnRHR gene at the pituitary and placental levels. Because human
pituitary gonadotrope cells were unavailable to us, we used the mouse
T3-1 pituitary tumor cell line as an experimental model to study the
transcription regulation of the human GnRHR gene (9, 33, 35). The expression of GnRHR mRNA from the JEG-3 cells indicated
the feasibility of using these cells to study the regulation of the
human GnRHR gene (7).
We have observed a P-induced decrease in human GnRHR promoter activity
in pituitary cells. This observation was in agreement with the results
obtained from the studies in the ovine showing that P negatively
regulates the expression of the GnRHR gene. Interestingly, this
P-induced inhibition of human GnRHR promoter activity could not be
observed in the placental JEG-3 cells, which also possess the
GnRH-GnRHR system (7, 48). Instead, using RU486 to block
endogenous P action and AGT to inhibit P production resulted in a
decrease in human GnRHR promoter activity, suggesting the importance of
P in maintaining the expression of GnRHR at the placenta. GnRH has been
shown to stimulate the secretion of hCG from the placenta
(5), which is important in maintaining early pregnancy by
stimulating P production from the corpus luteum (49). The
lack of the negative regulatory system in the expression of placental
GnRHR by P may help sustain the GnRH-stimulated hCG production through
pregnancy.
Progressive 5'-deletion of the human GnRHR 5'-flanking region and
mutational studies have identified a putative PRE, namely hGR-PRE
located at -535 to -521, that participates in P-mediated action. Our
data showed that the very same region mediated the P-induced
inhibition and stimulation actions on pituitary and placental cells,
respectively. Identity of the transcription factor that bound to this
region has been demonstrated containing PR by gel mobility shift assay
(GMSA) and supershift assay. P mediates its biological activity
after its interaction with a specific receptor within the nuclei of the
target cells. PRs are ligand-inducible transcriptional regulators that
control gene expression upon binding at the PRE in the vicinity of
target promoters or influence gene expression by interaction with other
transcription factors independently of PRE (50). The
expression of PR-A and PR-B isoforms in the JEG-3 and
T3-1 cells was
examined by the use of Western blot analysis. The expression levels of
PR-A and PR-B were similar in the
T3-1 cells, whereas PR-B in the
JEG-3 cells is much higher than PR-A. The requirement of a relatively
higher concentration (1 µM) of P to achieve the
statistically significant decrease in human GnRHR promoter activity in
T3-1 cells may be due to the use of mouse PRs in studying the
regulation of the human GnRHR gene, or the different transcription
activity of human and mouse PRs in the human gene. This explanation is
supported by the result of GMSA. As seen in Fig. 9A
, the endogenous
mouse PR formed very weak DNA-protein complexes with the putative human
hGR-PRE. To examine the role of human PR in controlling the expression
of the human GnRHR gene,
T3-1 cells were cotransfected with human
PR-A or PR-B expression vector. Overexpression of human PRs in
T3-1
cells increased the sensitivity toward P treatment and resulted in a
decrease in GnRHR promoter activity after 0.1 µM P
treatment. The similar results obtained from untransfected and human
PRs cotransfected
T3-1 cells after P treatment further implicate the
potential role of PRs in regulating the GnRHR gene transcription and
the value of these cells in studying the P-induced regulation of human
GnRHR gene. Although overexpression of both human PR-A and PR-B
isoforms resulted in increased sensitivity toward P treatment, it
appears that PR-B plays a more important role in mediating the
P-induced inhibitory action. This postulation was based on the
observations that 1) a higher degree of P-induced decrease in the human
GnRHR promoter was obtained from PR-B-cotransfected cells, and 2)
mutation of hGR-PRE completely eliminated the PR-A-mediated inhibitory
effects but not PR-B-mediated action. Although the presence and
distribution of steroid receptors in the normal human pituitary have
not been reported, recent studies have demonstrated the expression of
PR in human pituitary adenomas and supported the direct action of P in
the human pituitary (51).
In agreement with our Western blot results in PR expression in JEG-3
cells, expression of PRs in the human placenta has also been
demonstrated (52, 53, 54). Thus, human placenta is very likely
a target tissue for the action of P. In fact, recent reports describing
the effects of P on expression of CG
- and ß-subunit genes in the
human placenta (55) and CRH gene in human trophoblast cell
cultures (56) provide evidence that placenta itself can be
a target tissue for the action of P. To further study the role of these
receptors in mediating the P-induced effect in placenta, human PR-A and
PR-B expression vectors were cotransfected into JEG-3 cells.
Interestingly, our results showed that PR-A and PR-B have a
differential function in regulating the expression of the human GnRHR
gene in placenta cells. Similar to the data obtained from the pituitary
cells, overexpression of PR-A resulted in a decrease in human GnRHR
promoter activity. However, overexpression of PR-B increased the human
GnRHR promoter activity in placental cells, while this overexpression
led to a decrease in promoter activity in pituitary cells. These
results support the P-stimulatory role of GnRHR gene expression in the
placenta, since a much higher level of PR-B was detected in the JEG-3
cells endogenously. Taken together, these results indicate that PR-A is
mainly involved in down-regulation, while PR-B up-regulates, the
transcription of human GnRHR in the placenta.
Inasmuch as the PR-A and PR-B isoforms arise by transcription of the
same gene with the use of different promoter regions (57),
it is possible that independent regulation of these promoters may occur
(58). It is now clear that their relative levels
are under hormonal control (59). Thus, different hormonal
input in the pituitary and placenta may affect the expression levels of
PRs. As both PR-A and PR-B are capable of binding P, dimerizing and
interacting with PRE, the level of PRs as well as the stoichiometric
ratio of PR-A and PR-B within a target cell under specific
physiological conditions would be expected to alter the relative
complement of dimeric complex and exert a significant impact on the
overall cellular response to P. To add to the complexity of the PR
regulatory system, a third PR isoform has recently been identified in
T47D human breast cancer cells and named PR-C (60). This
N-terminally truncated PR-C isoform arises from the use of translation
start site downstream of the translation site for PR-A and PR-B at the
same gene. The PR-C contains the second zinc finger of the DNA-binding
domain but is lacking the first one. Alone, PR-C is transcriptionally
inactive but able to regulate the PR-A and PR-B transcriptional
activity when coexpressed (61). Recent studies have also
demonstrated that transactivation by PRs might involve additional
cofactors including coactivator or corepressor (62, 63, 64).
It is possible that different coactivators or repressors existed in the
pituitary and placenta cells, which resulted in a different response in
PR-B-mediated action. In addition, there is evidence for the
interaction between steroid hormone receptors, including PR, and other
transcription factors, such as octamer transcription factor 1 (Oct-1),
activating protein-1, and signal transducer and activator of
transcription, in controlling gene expression at the transcriptional
level (62, 65, 66, 67). Hence, the incomplete
elimination of the PR-B- and PR-A-mediated decrease in promoter
activity in the mutated hGR-PRE construct in
T3-1 and JEG-3 cells,
respectively, may be due to fact that an additional
transcription-regulatory mechanism(s) is used. However, the exact role
of these PR-C isoforms, activating protein-1/CREB motifs, and/or other
possible mechanism(s) in mediating the PR-A and PR-B action in
placental and pituitary cells has yet to be determined.
In summary, we have demonstrated a direct action of P in regulating the
human GnRHR gene expression at transcriptional levels through binding
to a putative hGR-PRE motif. Overexpression of human PR-A shows a
transcriptional inhibition action in GnRHR gene expression. In
contrast, PR-B exhibits a cell-dependent differential transcriptional
activity in which it acts as transcriptional activator in placenta
cells but a transcriptional repressor in pituitary cells.
 |
MATERIALS AND METHODS
|
|---|
Cells and Cell Culture
Mouse pituitary gonadotrope-derived
T3-1 cells and human
choriocarcinoma JEG-3 cells were maintained in DMEM, with 4.5 mg/ml
glucose (Life Technologies, Inc., Burlington, Ontario,
Canada) and RPMI 1640, respectively, supplemented with 10% FBS
(Life Technologies, Inc.) in a humidified atmosphere of
5% CO2 in air. Cells were passaged when they
reached about 90% confluence using a trypsin/EDTA solution (0.05%
trypsin, 0.53 mM EDTA).
Preparation of Human GnRHR Promoter- Luciferase
Constructs
Human GnRHR-luciferase construct (p2300-LucF) and progressive
5'- or 3'-deletion constructs were prepared as previously described
(9, 33, 39). Human PR-A and PR-B expression vector was
provided by Dr. P. Chambon (INSERM, Universite Louis Pasteur, Paris,
France). Plasmid DNA for transfection studies was prepared using
QIAGEN Plasmid Maxi Kits (QIAGEN, Chatsworth,
CA) following the manufacturers suggested procedure. The
concentration and integrity of DNA were determined by measuring
absorbance at 260 nm and agarose gel electrophoresis, respectively.
Purified plasmid DNA was then dissolved in 0.1x TE (1 mM
Tris-Cl; pH 7.5, 0.1 mM EDTA) to a final concentration of 1
µg/ml.
Site-Directed Mutagenesis
Human GnRHR 5'-flanking region -707 to +1 (related to
translation start site) subcloned into pBSK II (+) vector
(Stratagene, La Jolla, CA) was used as a template for the
mutagenesis reaction. Mutations were introduced by a three-step PCR
mutagenesis method as described previously (9), using
universal primers UP-T3F
(5'-GTGCCTCTCCTGAACAGGCCTCAAGCAATTAACCCTCACTAAAGG-3'), UP
(5'-GTGCCTCTCCTGAACAGGCCTCAA-3'), T7R (5'-CGTAATACGAC-
TCACTATAGG-3') and mutagenic primers for mP-PRE
(5'-GTTTTCCTTTTCAAAGCGGCCGCTGAGCACTCGAACACT-
GGAC-3') and mP-hPRE
(5'AAACTATTAGTGTTAGTCGGCCGTCCAACATACAGATGTA3'). Mutation
was confirmed by restriction enzyme and sequence analysis.
Transient Transfections and Reporter Assay
Transfections were carried out using the calcium precipitation
methodology as previously described (7). To correct for
different transfection efficiencies of various luciferase constructs,
the Rous sarcoma virus (RSV)-lacZ plasmid was cotransfected
into cells. Briefly, 5 x 105
T3-1 cells
or 1.5 x 105 JEG-3 cells were seeded into
six-well tissue culture plates before the day of transfection in 2 ml
culture medium containing 1% charcoal-dextran-treated FBS
(HyClone Laboratories, Inc., Logan, UT). Before the
transfection, the cells were washed once and cultured in 1 ml of fresh
medium (containing 1% charcoal-dextran-treated FBS). Two micrograms of
the GnRHR promoter-luciferase construct and 0.5 µg
RSV-lacZ were dissolved in 50 µl 0.1x TE containing 0.25
M CaCl2 and mixed with 50
µl 2x BES (50 mM
N,N-bis-(2-hydroxyethyl)-2-aminoethanesulforic acid, 280
mM NaCl, and 1.5 mM
Na2HPO4, pH 6.95). The DNA
mixture was incubated for 20 min at room temperature and then applied
to the cells. Incubation of the cells with transfection medium was
continued for approximately 16 h at 37 C in 3%
CO2. After transfection, the cells were washed
twice with culture medium and incubated with for an additional 24
h with normal culture medium containing 10% charcoal-dextran-treated
FBS. Cellular lysates were collected with 200 µl cell lysis buffer
and assayed for luciferase activity immediately with the Enhanced
Luciferase Assay Kit (PharMingen, Mississauga, Ontario,
Canada). Luminescence was measured using Lumat LB 9507
luminometer (EG&G, Berthold, Germany). ß-Galactosidase activity was
also measured and used to normalize for varying transfection
efficiencies. Promoter activity was calculated as luciferase
activity/ß-galactosidase activity. A promoterless pGL2-Basic vector
was included as a control in the transfection experiments.
Pharmacological Treatments
Progesterone (P), mifepristone (RU486), DEX, and
DL-AGT were purchased from Sigma
(Sigma-Aldrich Corp. Ltd., Oakville, Ontario,
Canada). In experiments in which the effects of P, DEX, and
RU486 on luciferase activity were studied, the cells were treated with
corresponding drugs for 24 h before luciferase and
ß-galactosidase activities were measured. P production in JEG-3 was
inhibited by addition of AGT during transfection, and the secreted P
levels were measured by RIA as previously described
(34).
GMSA
Oligodeoxynucleotides corresponding to the putative
hGR-PRE (5'-GAGTGCTCAACAGTGTGTTTGAAAAGG-3') and
mutated hGR-PRE (mhG-GR-PRE;
5'GAGTGCTCAGCGGCCGCTTTGAAAAGG-3') elements at the human
GnRHR 5'-flanking region and its complements were synthesized by the
Oligonucleotide Synthesis Laboratory (University of British Columbia,
Vancouver, British Columbia, Canada), and annealed to form a
double-stranded DNA. Consensus and mutated PRE oligonucleotides DNA and
antibodies for PR (catalog no. sc-538x), Oct-1 (catalog no. sc-232x),
and GATA-2 (catalog no. sc-267x) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Oligonucleotides DNA for
NF-
B (catalog no. E3291), and TFIID (catalog no. E3221) were
purchased from Promega Corp. (Nepean, Ontario, Canada).
Probes for GMSA were end-labeled with [P32]-ATP
by T4 polynucleotide kinase (Life Technologies, Inc.,
Gaithersburg, MD), and separated from unincorporated radionucleotides
by passage over Sephadex G-25 column. Nuclear extracts were prepared
according to the method described previously (35). Protein
concentrations were determined by a modified Bradford assay
(Bio-Rad Laboratories, Inc., Hercules, CA). GMSAs were
carried out in 20 µl containing 20 mM HEPES (pH 7.5), 20
mM KCl, 20 mM NaCl, 1.5 mM
MgCl2, 1 mM dithiothreitol, 1
mM EDTA, 10% glycerol, 2 µg poly dI:dC, 5 µg nuclear
proteins, 2 mg/ml of BSA, and radiolabeled probe.
For the competition assays, the unlabeled DNA was added simultaneously
with the labeled probe. Antibodies used in supershift experiments were
added to the nuclear extract at room temperature for 1 h before
the addition of labeled probe. The binding mixture was incubated at
room temperature for 20 min and separated in 6% polyacrylamide gel
containing 1x TBE (Tris-borate-EDTA: 0.09 M Tris-borate
and 2 mM EDTA, pH 8.0). Before loading of samples, the gel
was prerun for 90 min at 100 V at 4 C. Electrophoresis was carried out
at 30 mA at 4 C. The gel was then dried under vacuum and exposed to
x-ray film (Kodak X-OMAT AR film; Eastman Kodak Co., Rochester, NY) at -70 C.
Western Blot Analysis
For Western blot analysis, approximately 1 x
106 cells were incubated in 100 µl of cell
lysis RIPA (containing 1 x PBS (pH 7.4), 1% NP 40, 0.5% sodium
deoxycholate, 0.1% SDS, 10 mg/ml phenylmethylsulfonyl fluoride, 30
mg/ml aprotinin, and 10 mg/ml leupeptin) for 15 min on ice. The
cellular debris was removed by centrifugation and the protein
concentration in the cell lysates was determined using a modified
Bradford assay (Bio-Rad Laboratories, Inc.). Aliquots of
protein from JEG-3 and
T3-1 cells were taken from the total cell
lysates and subjected to SDS-PAGE under reducing conditions. The
separated proteins were then electrophoretically transferred onto
nitrocellulose paper (Hybond-C, Amersham Pharmacia Biotech, Morgan, Ontario, Canada). The membranes were
blocked with 5% (wt/vol) nonfat milk in Tris buffered saline,
containing 20 mM Tris-Cl (pH 8.0), 140 mM NaCl,
and 0.05% (wt/vol) Tween 20, for at least 1 h before the addition
of PR antibody (catalog no. sc-538x, Santa Cruz Biotechnology, Inc.) in 1:2,000 dilution. This antibody reacts with both PR-A
and PR-B of mouse, rat, and human origin (product information,
Santa Cruz Biotechnology, Inc.. All antibody incubation and washing were performed in Tris buffered saline with 0.05\% Tween 20. The Amersham Pharmacia Biotech
enhanced chemiluminescence system (ECL) was used for detection.
Membranes were visualized by exposure to Kodak X-Omat
film.
Data Analysis
Data are shown as the means ± SD of triplicate
assays in at least two independent experiments with triplicate at each
experiment. All data were analyzed by one-way ANOVA followed by
Dunnetts or Tukeys multiple comparison test using the computer
software PRISM GraphPad version 2 (GraphPad Software, Inc., San Diego, CA). Data were considered significantly
different from each other when P < 0.05.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. P. Chambon for providing human PR-A and PR-B
expression vectors.
 |
FOOTNOTES
|
|---|
This work was supported by grants from the Canadian Institutes of
Health Research. P.K.C.L. is a career investigator of the British
Columbia Research Institute for Childrens and Womens Health.
Abbreviations: AMG, Aminoglutethimide; DEX, dexamethasone;
GMSA, gel mobility shift assay; GnRHR, GnRH receptor; NF-
B,
nuclear factor-
B; Oct-1, octamer transcription factor-1; P,
progesterone; PRE, progesterone response element; RSV, Rous sarcoma
virus; Sty-HLuc (-707 to +1), human GnRHR promoter luciferase
construct; TFIID, transcription factor IID.
Received for publication August 23, 2000.
Accepted for publication August 16, 2001.
 |
REFERENCES
|
|---|
-
Gharib SD, Wierman ME, Shupnik MA, Chin WW 1990 Molecular
biology of the pituitary gonadotropins. Endocr Rev 11:177199[Abstract/Free Full Text]
-
Khodr GS, Siler-Khodr TM 1980 Placental LRF and its
synthesis. Science 207:315317[Abstract/Free Full Text]
-
Tan L, Rousseau P 1982 The chemical identity of the
immunoreactive LHRH-like peptide biosynthesized in the placenta.
Biochem Biophys Res Commun 109:10611071[CrossRef][Medline]
-
Seeburg PH, Adelman JP 1984 Characterization of cDNA for
precursor of human luteinizing hormone releasing hormone. Nature 311:666668[CrossRef][Medline]
-
Merz WE, Erlewein C, Licht P, Harbarth P 1991 The secretion
of human chorionic gonadotropin as well as the
- and ß-messenger
ribonucleic acid levels are stimulated by exogenous gonadoliberin pulse
applied to first trimester placenta in a superfusion culture system.
J Clin Endocrinol Metab 73:8492[Abstract/Free Full Text]
-
Siler-Khodr TM, Khodr GS, Rhode J, Vichery BH, Nestor Jr JJ 1987 Gestational age-related inhibition of placental hCG,
hCG and
steroid hormone release in vitro by a GnRH antagonist.
Placenta 8:114[Medline]
-
Cheng KW, Nathwani PS, Leung PCK 2000 Regulation of
human gonadotropin-releasing hormone receptor gene expression in
placental cells. Endocrinology 141:23402349[Abstract/Free Full Text]
-
Duval DL, Nelson SE, Clay CM 1997 The tripartite basal
enhancer of the gonadotropin-releasing hormone (GnRH) receptor gene
promoter regulates cell-specific expression through a novel GnRH
receptor activating sequence. Mol Endocrinol 11:18141821[Abstract/Free Full Text]
-
Ngan ESW, Cheng PKW, Leung PCK, Chow BKC 1999 Steroidogenic
factor-1 interact with a gonadotrope- specific element with the
first exon of the human gonadotropin-releasing hormone gene to mediate
gonadotrope-specific expression. Endocrinology 140:24522462[Abstract/Free Full Text]
-
Norwitz ER, Cardona GR, Jeong KH, Chin WW 1999 Identification
and characterization of the gonadotropin-releasing hormone response
elements in the mouse gonadotropin-releasing hormone receptor gene.
J Biol Chem 274:867888[Abstract/Free Full Text]
-
Bauer-Dantoin AC, Hollenberg AN, Jameson JL1993 Dynamic
regulation of gonadotropin-releasing hormone receptor mRNA levels in
the anterior pituitary gland during the rat estrous cycle.
Endocrinology 133:19111914
-
Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers WJ,
McNeilly AS 1993 Cloning and sequencing of the sheep pituitary
gonadotropin-releasing hormone receptor and changes in expression of
its mRNA during the estrous cycle. Mol Cell Endocrinol 94:R23R27
-
Funabashi T, Brooks PJ, Weesner GD, Pfaff DW 1994 Luteinizing
hormone-releasing hormone receptor messenger ribonucleic acid
expression in the rat during lactation and the estrous cycle.
J Neuroendocrinol 6:261266[Medline]
-
Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1993 Regulation of rat pituitary gonadotropin-releasing hormone receptor
mRNA levels in vivo and in vitro. Endocrinology 133:931934[Abstract/Free Full Text]
-
Sakurai H, Adams BM, Adems TE 1997 Concentrations of GnRH
receptor and GnRH receptor mRNA in pituitary tissue of orchidectomized
sheep: effect of oestradiol, progesterone, and progesterone withdrawal.
J Endocrinol 152:9198[Abstract/Free Full Text]
-
Sagrillo CA, Grattan DR, McCarthy MM, Selmanoff M 1996 Hormonal and neurotransmitter regulation of GnRH gene expression and
related reproductive behaviors. Behav Genet 26:241277[CrossRef][Medline]
-
Schumacher M, Coirini H, Robert F, Guennoun R, El-Etr M 1999 Genomic and membrane actions of progesterone: implications for
reproductive physiology and behavior. Behav Brain Res 105:3752[CrossRef][Medline]
-
Schweiger U, Tuschl R, Broocks A, Pirke KM 1990 Gonadotrophin
secretion in the second half of the menstrual cycle: a comparison of
women with normal cycles, luteal phase defects and disturbed follicular
development. Clin Endocrinol (Oxf) 32:2532[Medline]
-
Poindexter AN, Dildy GA, Brodyand SA, Snabes MC 1993 The
effects of a long-acting progestin on the
hypothalamic-pituitary-ovarian axis in women with normal menstrual
cycles. Contraception 48:3745[CrossRef][Medline]
-
Alexandris E, Millingos S, Kollios G Seferiadis K, Lolis D,
Messinis IE 1997 Changes in gonadotropin response to
gonadotropin-releasing hormone in normal women following bilateral
ovariectomy. Clin Endocrinol (Oxf) 47:721726[CrossRef][Medline]
-
Clemm DL, Macy BL, Santiso-mere D, McDonnell DP 1995 Definition of the critical cellular components which distinguish
between hormone and antihormone activated progesterone receptor. J
Steriod Biochem Mol Biol 53:487495[CrossRef][Medline]
-
Evans RM 1988 The steroid and thyroid hormone receptor
superfamily. Science 240:889895[Abstract/Free Full Text]
-
Tsai MJ, OMalley BW 1994 Molecular mechanisms of action of
steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451486[CrossRef][Medline]
-
Tora L, Gronrmeyer H, Turcotte B, Gaub MP, Chambon P 1988 The
N-terminal region of the chicken progesterone specifies target gene
activation. Nature 333:185188[CrossRef][Medline]
-
Vegeto E, Shahbaz MM, Wen DX, Goldman ME, OMalley BW,
McDonnell DP 1993 Human progesterone receptor A form is a cell- and
promoter-specific repressor of human progesterone receptor B function.
Mol Endocrinol 7:12441255[Abstract/Free Full Text]
-
McDonnell DP, Goldman ME 1994 RU 486 exerts antiestrogenic
activities through a novel progesterone receptor A form-mediated
mechanism. J Biol Chem 269:1194511949[Abstract/Free Full Text]
-
Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS,
Horwitz KB 1994 A third transactivation function (AF3) of human
progesterone receptors located in the unique N-terminal segment of the
B-isoform. Mol Endocrinol 8:13471360[Abstract/Free Full Text]
-
Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A
and B isoforms of the human progesterone receptor operate through
distinct signaling pathways within target cells. Mol Cell Biol 14:83568364[Abstract/Free Full Text]
-
Laws SC, Beggs JM, Webster JC, Miller WL 1990 Inhibin
increases and progesterone decrease receptor for gonadotropin-releasing
hormone in ovine pituitary cultures. Endocrinology 127:373380[Abstract/Free Full Text]
-
Wu JC, Sealfon SC, Miller WL 1994 Gonadal hormones and
gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid
levels for GnRH receptors in sheep. Endocrinology 134:18461850[Abstract/Free Full Text]
-
Kirkpatrick BL, Esquivel E, Moss GE, Hamernik DL, Wise ME 1998 Estradiol and gonadotropin-releasing hormone (GnRH) interact to
increase GnRH receptor expression in ovariectomized ewes after
hypothalamic-pituitary disconnection. Endocrine 8:225229[CrossRef][Medline]
-
Fan NC, Peng C, Krisinger J, Leung PCK 1995 The human
gonadotropin-releasing hormone receptor gene: complete structure
including multiple promoters, transcription initiation sites, and
polyadenylation signals. Mol Cell Endocrinol 107:R1R8
-
Kang SK, Cheng KW, Ngan ESW, Chow BKC, Choi KC, Leung PCK 2000 Differential expression of human gonadotropin-releasing hormone
receptor gene in pituitary and ovarian cells. Mol Cell Endocrinol 162:157166[CrossRef][Medline]
-
Vaananen JE, Lee S, Vaananen CCM, Ho Yuen B, Leung, PCK 1998 Stepwise activation of the gonadotropic signal transduction pathway,
and the ability of prostaglandin F2
to inhibit this activated
pathway. Endocrine 8:301307[CrossRef][Medline]
-
Cheng KW, Ngan ESW, Kang SK, Chow BKC, Leung PKC 2000 Transcriptional down-regulation of human
gonadotropin-releasing hormone (GnRH) receptor gene by GnRH:
role of protein kinase C and activating protein 1. Endocrinology 141:36113622[Abstract/Free Full Text]
-
Harvell DME, Strecker TE, Tochacek M, Xie B, Pennington KL,
McComb RD, Roy SK, Shull JD 2000 Rat strain-specific actions of
17ß-estradiol in the mammary gland: correlation between
estrogen-induced lobuloalceolar hyperplasia and susceptibility to
estrogen-induced mammary cancers. Proc Natl Acad Sci USA 97:27792784[Abstract/Free Full Text]
-
Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M,
Gustafsson JA 2000 Estrogen receptor (ER) ß, a modulator of ER
in
the uterus. Proc Natl Acad Sci USA 97:59365941[Abstract/Free Full Text]
-
El-Hefnawy T, Huhtaniemi I 1998 Progesterone can participate
in down-regulation of the luteinizing hormone receptor gene expression
and function in cultured murine leydig cells. Mol Cell Endocrinol 137:127138[CrossRef][Medline]
-
Cheng KW, Chow BKC, Leung PCK 2001 Functional mapping of a
placental specific upstream promoter for human gonadotropin-releasing
hormone receptor gene. Endocrinology 142:15061516[Abstract/Free Full Text]
-
Mao J, Regelson W, Kalimi M 1992 Molecular mechanism of RU 486
action: a review. Mol Cell Biochem 109:18[Medline]
-
Schott DR, Shyamala G, Schneider W, Parry G 1991 Molecular
cloning, sequence analyses, and expression of complementary DNA
encoding murine progesterone receptor. Biochem 30:70147020[CrossRef][Medline]
-
Reyes FI, Winter JS, Faiman C 1976 Pituitary gonadotropin
function during human pregnancy: serum FSH and LH levels before and
after LHRH administration. J Clin Endocrinol Metab 42:590592[Abstract/Free Full Text]
-
Rubinstein LM, Parlow AF, Derzko C, Hershman J 1978 Pituitary
gonadotropin response to LHRH in human pregnancy. Obstet Gynecol 52:172175[Medline]
-
Sowers JR, Colantino M, Fayez J, Jonas H 1978 Pituitary
response to LHRH in midtrimester pregnancy. Obstet Gynecol 52:685688[Medline]
-
Marrs RP, Kletzky OA, Mishell Jr DR 1981 Functional capacity
if the gonadotrophs during pregnancy and the puerperium. Am J
Obstet Gynecol 141:658661[Medline]
-
Crowder ME, Nett TM 1984 Pituitary content of gonadotropins
and receptors for gonadotropin-releasing hormone (GnRH) and
hypothalamic content of GnRH during the periovulatory period of the
ewe. Endocrinology 114:234239[Abstract/Free Full Text]
-
Turizillo AM, Campion CE, Clay CM, Nett TM 1994 Regulation of
gonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic
acid and GnRH receptor during the early preovulatory period in the ewe.
Endocrinology 135:13531358[Abstract]
-
Yin H, Cheng, KW, Hwa HL, Peng C, Auersperg N, Leung PCK 1998 Expression of the messenger RNA for gonadotropin-releasing hormone
and its receptor in human cancer cell lines. Life Sci 62:20152023[CrossRef][Medline]
-
Fritz MA, Speroff L 1982 The endocrinology of the menstrual
cycle: the interaction of folliculogenesis and neuroendocrine
mechanisms. Fertil Steril 38:509529[Medline]
-
Truss M, Beato M 1993 Steroid hormone receptors: interaction
with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459479[Abstract/Free Full Text]
-
Jaffrain-Rea ML, Petrangeli E, Ortolani F, Fraioli B, Lise A,
Esposito V, Spagnoli LG, Tamburrano G, Gulino A 1996 Cellular receptors
for sex steroids in human pituitary adenomas. J Endocrinol 151:175184[Abstract/Free Full Text]
-
Rossmanith WG, Wolfahrt S, Ecker A, Eberhardt E 1997 The
demonstration of progesterone, but not of estrogen, receptor in the
developing human placenta. Horm Metab Res 29:604610[Medline]
-
Shanker YG, Sharma SC, Rao AJ 1997 Expression of progesterone
receptor mRNA in the first trimester human placenta. Biochem Mol Biol
Int 42:12351240[Medline]
-
Cudeville C, Mondon F, Robert B, Rebourcet R, Mignot TM,
Benassayag C, Freer F 2000 Evidence for progesterone receptors in the
human fetoplacental vascular tree. Biol Reprod 62:759765[Abstract/Free Full Text]
-
Rao AJ, Prasad KS, Sharma SC, Subbraryan VS 1995 Role of 17
ß-estradiol and progesterone in the regulation of synthesis and
secretion of chorionic gonadotropin by the first trimester human
placenta. J Steroid Biochem Mol Biol 53:233239[CrossRef][Medline]
-
Karalis K, Majzoub JA 1996 Regulation of placental
corticotropin-releasing hormone by steroids, Possible
implications in labor initiation. Ann NY Acad Sci 771:551555[CrossRef]
-
Kastner P, Krust A, Turocotte B, Stropp U, Tora L, Gronemeyer
M, Chambon P 1990 Two distinct estrogen- regulated promoter
generate transcripts encoding the two functionally different human
progesterone receptor forms A and B. EMBO J 9:16031614[Medline]
-
Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel, MT,
Granemeyer H 1992 A limiting factor mediate the differential activation
of promoter by the human progesterone receptor isoforms. J Biol
Chem 267:1088210887[Abstract/Free Full Text]
-
Numan M, Roach JK, Del Cerro MC, Guillamon A, Segovia S,
Sheehanm TP, Numan MJ 1999 Expression of intracellular progesterone
receptors in rat brain during different reproductive states, and
involvement in maternal behavior. Brain Res 830:358371[CrossRef][Medline]
-
Wei LL, Miner R 1994 Evidence for the existence of a third
progesterone receptor protein in human breast cancer cell line T47D.
Cancer Res 54:340343[Abstract/Free Full Text]
-
Wei LL, Hawkins P, Baker C, Norris B, Sheridan PL, Quinn PG 1996 An amino-terminal truncated progesterone receptor isoform, PRC,
enhances progestin-induced transcriptional activity. Mol Endocrinol 10:13791387[Abstract/Free Full Text]
-
Beato M, Candau R, Chavez S, Mows C, Truss M 1996 Interaction
of steroid hormone receptors with transcription factors involves
chromatin remodeling. J Steroid Biochem Mol Biol 56:4759[CrossRef][Medline]
-
Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor
coactivators. Curr Opion Cell Biol 9:222232[CrossRef][Medline]
-
Robyr D, Wolffe AP, Wahli W 2000 Nuclear hormone receptor
coregulators in action: diversity for shared tasks. Mol Endcroinol 14:329347
-
Bruggemeier U, Kalff M, Franks S, Scheidereit C, Beato M 1991 Ubiquitous transcription factor OTF-1 mediates induction of the mouse
mammary tumors virus promoter through synergistic interaction with
hormone receptors. Cell 64:565572[CrossRef][Medline]
-
Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in
endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:61696174[Abstract/Free Full Text]
-
Stoecklin E, Wissler M, Schaetzle D, Pfitzner E, Groner B 1999 Interaction in the transcriptional regulation exerted by Stst5 and by
members of the steroid hormone receptor family. J Steroid Biochem Mol
Biol 69:195204[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
B.-S. An, S. L. Poon, W.-K. So, G. L. Hammond, and P. C.K. Leung
Rapid Effect of GNRH1 on Follicle-Stimulating Hormone Beta Gene Expression in LbetaT2 Mouse Pituitary Cells Requires the Progesterone Receptor
Biol Reprod,
August 1, 2009;
81(2):
243 - 249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Jacobsen, P. Jambal, S. A. Schittone, and K. B. Horwitz
ALU Repeats in Promoters Are Position-Dependent Co-Response Elements (coRE) that Enhance or Repress Transcription by Dimeric and Monomeric Progesterone Receptors
Mol. Endocrinol.,
July 1, 2009;
23(7):
989 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang, E.-W. Lee, L. Zhou, P. C. K. Leung, D. D. Ross, J. D. Unadkat, and Q. Mao
Progesterone Receptor (PR) Isoforms PRA and PRB Differentially Regulate Expression of the Breast Cancer Resistance Protein in Human Placental Choriocarcinoma BeWo Cells
Mol. Pharmacol.,
March 1, 2008;
73(3):
845 - 854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Horne and D. L. Blithe
Progesterone receptor modulators and the endometrium: changes and consequences
Hum. Reprod. Update,
November 1, 2007;
13(6):
567 - 580.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C M. Luetjens, A. Didolkar, S. Kliesch, W. Paulus, A. Jeibmann, W. Bocker, E. Nieschlag, and M. Simoni
Tissue expression of the nuclear progesterone receptor in male non-human primates and men.
J. Endocrinol.,
June 1, 2006;
189(3):
529 - 539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-M. Yeung, B.-S. An, C. K. Cheng, B. K.C. Chow, and P. C.K. Leung
Expression and transcriptional regulation of the GnRH receptor gene in human neuronal cells
Mol. Hum. Reprod.,
November 1, 2005;
11(11):
837 - 842.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev.,
April 1, 2005;
26(2):
283 - 306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-S. An, J.-H. Choi, K.-C. Choi, and P. C. K. Leung
Differential Role of Progesterone Receptor Isoforms in the Transcriptional Regulation of Human Gonadotropin-Releasing Hormone I (GnRH I) Receptor, GnRH I, and GnRH II
J. Clin. Endocrinol. Metab.,
February 1, 2005;
90(2):
1106 - 1113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Cheng, B. K. C. Chow, and P. C. K. Leung
An Activator Protein 1-Like Motif Mediates 17{beta}-Estradiol Repression of Gonadotropin-Releasing Hormone Receptor Promoter via an Estrogen Receptor {alpha}-Dependent Mechanism in Ovarian and Breast Cancer Cells
Mol. Endocrinol.,
December 1, 2003;
17(12):
2613 - 2629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-L. Zhang, D. Zhang, F. J. Michel, J. L. Blum, F. A. Simmen, and R. C. M. Simmen
Selective Interactions of Kruppel-like Factor 9/Basic Transcription Element-binding Protein with Progesterone Receptor Isoforms A and B Determine Transcriptional Activity of Progesterone-responsive Genes in Endometrial Epithelial Cells
J. Biol. Chem.,
June 6, 2003;
278(24):
21474 - 21482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Ozisik, G. Mantovani, J. C. Achermann, L. Persani, A. Spada, J. Weiss, P. Beck-Peccoz, and J. L. Jameson
An Alternate Translation Initiation Site Circumvents an Amino-Terminal DAX1 Nonsense Mutation Leading to a Mild Form of X-Linked Adrenal Hypoplasia Congenita
J. Clin. Endocrinol. Metab.,
January 1, 2003;
88(1):
417 - 423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Fang, S. Wong, and B. F. Mitchell
Messenger RNA for progesterone receptor isoforms in the late-gestation rat uterus
Am J Physiol Endocrinol Metab,
December 1, 2002;
283(6):
E1167 - E1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|