| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institut National de la Santé et la Recherche Médicale Unité 397, Endocrinologie et Communication Cellulaire, Institut Fédératif de Recherche Louis Bugnard, Centre Hospitalier Universitaire Rangueil, 31403 Toulouse cedex 04, France
| ABSTRACT |
|---|
|
|
|---|
These data unravel a further level of complexity in the regulation of VEGF expression.
| INTRODUCTION |
|---|
|
|
|---|
Numerous studies have been devoted to understanding the expression regulation of this factor, especially at the transcriptional level. A wide range of cytokines or oncogenic proteins including IL-1ß (2), IL-6 (3), IGF-I (4), TGFß (5), c-Src (6), v-Raf (7), or Ras (8), together with oxygen pressure (9), have been shown to regulate VEGF gene transcription. VEGF expression is also posttranscriptionally regulated. Human VEGF pre-mRNA undergoes alternative splicing, which generates five polypeptide isoforms of 121, 145, 165, 189, and 206 amino acids (a.a.), the functions of which have not yet been fully defined (10, 11). VEGF mRNA stability is also influenced by hypoxic conditions (12). Posttranslational modifications of VEGF isoforms, including plasmin proteolysis or glycosylation, have been described (13, 14, 15). Recently, we and others have demonstrated a translational regulation of VEGF expression (16, 17, 18, 19). The VEGF mRNA, with the c-myc mRNA, are the first messengers described so far which bear two independent internal ribosome entry sites (IRES A and B) in their 5'-untranslated region (5'-UTR) (16). The VEGF IRES A located upstream from the AUG codon directs a cap-independent translation initiation, which has been shown to allow VEGF synthesis in hypoxic conditions (17). VEGF thus belongs to the growing family of growth factor-coding messengers, the translation of which is controlled by an IRES-dependent mechanism (16, 20, 21, 22). The expression of many of these genes is also regulated by an alternative translation initiation process that allows the synthesis of different protein isoforms from a single mRNA; this alternative initiation occurs mainly at the level of the AUG and CUG codons (23, 24, 25, 26, 27). This mechanism is of major importance as it generates isoforms with distinct cellular localizations and functions. In the case of the angiogenic fibroblast growth factor 2 (FGF-2), four nuclear isoforms initiated at four distinct CUG codons and a cytoplasmic AUG-initiated form are generated from the unique FGF-2 mRNA (27).
Here we provide evidence of further VEGF isoform diversity by showing that an alternative translation initiation process, IRES B driven, occurs at the first upstream CUG codon. This generates a larger VEGF isoform bearing an NH2-terminal extension of 206 a.a. Interestingly, we demonstrate that a high mol wt form of VEGF [large VEGF (L-VEGF] is cleaved into two polypeptides. The COOH product has the same apparent size as the classical AUG-initiated form and is secreted from the cell. In contrast, the NH2 product has an intracellular localization. Our data thus reveal a new level of regulation of VEGF production.
| RESULTS |
|---|
|
|
|---|
|
Comparison of the deduced a.a. sequences in the three species (Fig. 1B
)
revealed that a 358- to 361-a.a. protein could be encoded by the mouse,
bovine, and human VEGF 165 cDNAs, respectively. Moreover, the a.a.
identity of this putative amino-terminal extension of VEGF was high
(76%) in all three species and could be compared with that observed in
the classical AUG-initiated VEGF165 protein (87%). This degree of
conservation, which is unexpected from a proposed "uncoding"
sequence, led us to investigate whether the region located downstream
from the CUG could represent a real coding sequence and generate a
larger VEGF isoform.
In the case of the rat sequence (31), no ORF is apparent. This could result from a genetic divergence, but it should be noted that this region is very GC rich and some technical problems during cDNA cloning or during sequence determination could also occur similar to those observed for the mouse (present paper). Partial 5'-VEGF sequences are also available for zebrafish, Xenopus, and quail but no ORF is evident at this time.
VEGF cDNA Generates a L-VEGF Isoform in Vitro
We first analyzed the products obtained after translation in the
in vitro rabbit reticulocyte lysate system of an in
vitro transcribed VEGF189 mRNA, which contained or did not contain
the 5'-UTR. Translation of the full-length VEGF mRNA produced two main
proteins with apparent sizes of 43 kDa and 23 kDa, respectively (Fig. 2A
, lane 1). The 23-kDa product
corresponded in size to that of the AUG-initiated isoform (Fig. 2A
, lane 2). The larger and more abundant translation product had the
expected size of a CUG1-initiated protein.
|
The production of this large isoform was then tested in COS-7
cells. These cells were transfected with the VEGF189 or the VEGF-5'189
constructs shown in Fig. 2A
. Cell extracts were analyzed by Western
blotting using the N-Ab. As shown in Fig. 2B
, a large 43-kDa isoform
was specifically detected in cells transfected with the cDNA containing
the 5'-leader. It should be noted that N-Ab specifically detects VEGF
products initiated upstream from the AUG codon but not an AUG-initiated
protein (Fig. 2B
, lane 189). We also detected a major polypeptide
around 23 kDa in 5'189-transfected cells (see further explanation in
Fig. 5A
).
|
The presence of a large 43-kDa immunoreactive protein was observed in
all the tissue extracts with both antibodies with the same relative
intensities. This large protein has the same electrophoretic mobility
as that of the L-VEGF protein produced in COS-7 cells transfected with
the full-length VEGF189 cDNA (5'189 in Fig. 2
, C and D). In Fig. 2D
, the 21- and 23-kDa proteins correspond to VEGF189 AUG-initiated
forms.
This experiment suggests the physiological reality of the endogenous synthesis of a L-VEGF isoform.
Identification of the L-VEGF Translation Initiation Codon
To further characterize the translation initiation codon, we
studied the effect of different deletions or point mutations in the
5'-UTR on L-VEGF translation. These experiments were performed both
in vitro and in transfected COS-7 cells.
We chose to use a reporter gene that encodes a chimeric
VEGF-chloramphenicol acetyltransferase (CAT) protein. This protein is
indeed easily detectable with an anti-CAT antibody. The use of this
reporter also avoided any confusion due to the presence of endogenous
VEGF in the transfected cells. The reporter cDNA consisted of fusion of
the CAT reporter gene 168 nt downstream from the VEGF AUG. The
different chimeric VEGF-CAT constructs used are shown in Fig. 3A
.
|
This confirms the role played by the first CUG in such synthesis. This is further strengthened by the results obtained with construct E. Indeed, the mutation of CUG1 into a noninitiating UUU codon completely abolished translation of the 50-kDa L-VEGF-CAT (lane E). The additional isoform observed in that case could correspond to a CUG2-initiated protein. This has already been observed for other alternative initiation processes (27, 32).
In contrast, the mutation of CUG1 into an AUG initiation codon resulted in an increased L-VEGF translation (construct D). Altogether, these results suggested that the translation of the L-VEGF isoform is initiated at the CUG1 codon.
Similar conclusions were derived from transfection experiments. The
different cDNA (constructs AE) were transfected in COS-7 cells (Fig. 3C
). The cellular extracts were analyzed by Western blotting using an
anti-CAT antibody (CAT-Ab). The mRNA lacking the 5'-leader (construct
A) was translated into two polypeptides of 34 kDa and 29 kDa (lane A,
Fig. 3C
). These corresponded to glycosylated and unglycosylated forms,
respectively, of the same protein. Indeed, only the unglycosylated
29-kDa protein could be detected after tunicamycin treatment of the
transfected cells with construct A (Fig. 3C
, right panel).
The VEGF-CAT fusion did not contain the VEGF glycosylation site but we
identified a glycosylation site in the CAT protein.
Again the synthesis of a large L-VEGF-CAT protein was detected from
cells transfected with the full-length cDNA (lane C). However, in
contrast with the in vitro results of Fig. 3B
, this large
protein accumulated at a lower level than the low molecular
AUG-initiated forms.
The same expression profile was also observed after transfection of the
nonchimeric VEGF189 cDNA using an anti-VEGF antibody (see Fig. 2D
, 5
'189).
Interestingly, the mutation of the CUG1 codon into an AUG codon (lane D) strongly enhanced the expression of the L-VEGF isoform. Conversely, the mutation into a noninitiating UUU codon (lane E) or the removal of the CUG1 (lane B) abolished this expression.
All together, these results confirmed that the L-VEGF protein is initiated at the CUG1 codon at position 499 in the 5'-leader.
The IRES B Directs Cap-Independent L-VEGF Translation
Initiation
As the CUG1 codon is located just downstream from the IRESB in the
5'-leader, we investigated the involvement of this IRES in the L-VEGF
translation initiation. To test this hypothesis, we checked whether
L-VEGF initiation was cap independent and driven by IRES B in
bicistronic vectors (16, 21). Two vectors, differing in
the presence or absence of a stable hairpin structure upstream from the
first CAT cistron, were transfected in COS-7 cells and the translation
products analyzed by Western blotting using the CAT-Ab. As shown in
Fig. 4
, translation of the chimeric
L-VEGF remained constant independently of the presence or absence of
the hairpin structure that abolished cap-dependent expression of the
first cistron (compare lanes 1 and 2). This suggested that IRES B
located upstream from CUG1 directed the cap-independent translation
initiation of the L-VEGF protein.
|
Even more striking was the observation that the N-Ab selectively raised
against the NH2 part of L-VEGF was able to
recognize not only the L-VEGF but also a 23-kDa low molecular mass
protein (Fig. 2B
, lane 5'189) in the transfected cells.
One interpretation of these observations could be that the L-VEGF was actually cleaved physiologically in the cell and that such a cleavage did not occur in vitro at a significant level.
To test this hypothesis, chimeric VEGF-CAT and the VEGF189 cDNA were
transfected in COS-7 cells, and the translation products were detected
by Western blotting using the N-Ab. Transfection of both constructs led
to the detection of large proteins (Fig. 5A
, lanes 1 and 2). As expected, the size
of these proteins varied according to the size of the coding sequences.
Interestingly, two additional 23- and 24-kDa proteins were also
detected regardless of the nature and the size of the coding sequence
used. This supports the idea that the L-VEGF isoform is processed. The
two proteins could indeed correspond to the NH2 cleavage products.
To more precisely define the cleavage site, we transfected constructs starting at the codon 499 and ending just before (nt 1,038) and just after (nt 1,115) the coding sequence for the signal peptide of the classical AUG-initiated VEGF isoform (constructs 3 and 4). In this experiment the CUG1 was mutated into an AUG to enhance the detection. The same result was obtained with the original CUG (not shown). We observed that constructs 1, 2, and 4 generated the same 23- and 24-kDa products. In contrast, construct 3, which lacked the hydrophobic peptide sequence, produced only one protein of lower molecular mass (lane 3). These results indicated that the 23- and 24-kDa polypeptides corresponded in size to proteins that contained the hydrophobic sequence corresponding to the VEGF signal peptide. We hypothesize that the 24-kDa polypeptide might correspond to an as-yet-unidentified posttranslational modification of the 23-kDa peptide since both isoforms were produced from construct 4.
The Processing of the L-VEGF Isoform Occurs at the Level of a
Central Hydrophobic Sequence
The data presented above suggested that the position of the
cleavage site could be at or near the end of the VEGF signal peptide.
The cleavage of L-VEGF could thus generate COOH polypeptides that could
migrate with the same electrophoretic mobility as the classical
AUG-initiated protein. To allow the identification of this
carboxy-terminal cleavage product of L-VEGF, we suppressed the
synthesis of the AUG-initiated form. Three AUG codons are present in
the VEGF coding sequence but only the first one, the AUG 1,039, is
normally used for translation initiation. It was thus mutated into a
noninitiation codon, CCC. As a first step we tested the effect of these
mutations on translation of the classical low molecular mass VEGF
isoform.
Figure 5B
, lane 2, shows that, as expected, the mutation of the AUG
completely abolished the translation initiation of these low molecular
forms (compare lanes 1 and 2). We then mutated the AUG 1,039 in the
full-length VEGF-CAT construct (construct 4). Despite this mutation,
the accumulation of the low molecular mass proteins of 29 and 34 kDa
was still observed (lane 4).
The protein of approximately 26 kDa, which appears in lane 4, most probably corresponds to a polypeptide whose translation was initiated at a downstream AUG in the VEGF sequence. When the upstream CUG codon was converted into an AUG, the L-VEGF expression was significantly increased (lanes 5 and 6). The low molecular mass proteins also clearly accumulated. However, the abundance of these proteins was not significantly different when the AUG 1,039 was converted into noninitiation codon. This was unlike what was observed in lanes 3 and 4 with the original CUG.
This suggests that these low molecular mass proteins corresponded partially (lane 3) or totally (lane 5) to cleavage products of the L-VEGF. This difference could be due to a polar effect of the upstream AUG 499, which impairs the initiation at the downstream AUG 1,039 (in lanes 5 and 6).
We thus concluded from these results that the low molecular mass proteins corresponded to the COOH fragments of the L-VEGF-CAT form. Remarkably, these two polypeptides have the same apparent molecular mass (29 and 34 kDa) as the AUG 1,039-initiated protein.
Cleavage of L-VEGF Requires a Functional Central Hydrophobic
Sequence
As the cleavage of the L-VEGF occurred in the vicinity of the
hydrophobic sequence that plays the role of signal peptide in the
AUG-initiated form, we evaluated the influence of the functionality of
this sequence in the processing of the L-VEGF isoform.
New constructs were designed in which we mutated two critical amino
acids of the signal peptide (the 9th and the
14th) to impair its cleavage and the subsequent
export process of the AUG-initiated form (see Materials and
Methods). The effect of the mutation was evaluated by COS-7 cells
transfection. Both the cellular extracts and the culture media were
analyzed by Western blotting using the CAT-Ab (Fig. 6A
). One notes, in Fig. 6A
, lane 1, the
presence of the chimeric L-VEGF as well as that of the two low
molecular mass polypeptides of 29 and 34 kDa.
|
To further evaluate the effect of these mutations of the signal
sequence on the processing of L-VEGF, we tested the disappearance of
its amino- and carboxy-terminal cleavage products in transfected cell
extracts. We introduced the mutations of the signal sequence in
construct 6 of Fig. 5B
in which the AUG 1,039 was converted into
noninitiation codon (construct 2 in Fig. 6B
). The resulting construct
was transfected in COS-7 cells and analyzed by Western blotting using
both the CAT-Ab and the N-Ab. As shown in Fig. 6B
, lane 2 (left
and right panels), in contrast with the results observed with the
WT signal sequence (lane 1, left and right panels), the
mutation introduced in the hydrophobic sequence abolished the
accumulation of the low molecular mass products. Because this was
observed with both antibodies, we concluded that the mutations that
inactivated the signal peptide of the classical AUG-initiated form also
prevented the L-VEGF cleavage. These results also clearly eliminated
the possibility of an artifactual cleavage of the L-VEGF during cell
lysis.
Cleavage of the L-VEGF Protein in Microsomes Complemented Rabbit
Reticulocyte Lysate (RRL)
Because the presence of the functional hydrophobic signal sequence
appeared to play a crucial role in L-VEGF processing, we tested the
possibility that this processing could take place in the endoplasmic
reticulum. We therefore tried to reproduce this cleavage in
vitro in a reticulocyte lysate supplemented with canine pancreatic
microsomal membranes.
To check the efficiency of the system, we first verified the cleavage of the signal peptide in the control Escherichia coli ß-lactamase precursor protein (data not shown). To test the cleavage of the L-VEGF in these conditions, we used the chimeric VEGF-CAT mRNA transcribed from constructs lacking the ATG initiation codon with or without mutations in the central hydrophobic region. The neosynthesized proteins were labeled by incorporating 35S-methionine.
In uncomplemented lysate, translation of the full-length mRNA (from
construct A) led to the accumulation of the 50-kDa L-VEGF protein (Fig. 7
, lane A, -). In presence of
microsomes, this protein was partially processed into a lower molecular
mass protein (lane A,+). In contrast, as seen in lane B, the L-VEGF
isoform containing a mutated hydrophobic sequence (translated from mRNA
B) did not undergo such a cleavage even in the presence of microsomes.
In these experiments, the NH2 fragment resulting
from cleavage of the L-VEGF was not detected because it did not contain
any methionine.
|
Subcellular Localizations of L-VEGF and Its Cleavage Products
We first determined whether the L-VEGF isoform and the fragments
resulting from its processing were secreted from the cells (Fig. 8A
). We attempted to localize these
polypeptides by transfecting COS-7 cells with full-length VEGF-CAT cDNA
containing or not the mutation of the AUG 1,039. In both constructs the
upstream CUG was converted into a more potent AUG initiation codon to
maximize the production of the chimeric L-VEGF form and thus facilitate
the localization of the products.
|
In an attempt to identify the intracellular localization of the L-VEGF and its NH2 fragment, immunocytodetections were carried out using the N-Ab on transfected COS-7 cells. Cells were transfected with a low amount of DNA and harvested 24 h later to prevent any overexpression of proteins that might perturb their localization.
Figure 8B
shows that comparable staining was obtained in cells
transfected with constructs that generate the full-length L-VEGF
(construct 1) or only the NH2-terminal fragment
(construct 2). In both cases, the labeling was localized in the
reticulum-Golgi network. Indeed the staining was very similar to that
observed with an anti-Golgi antibody (red labeling) or the
endoplasmic reticulum staining (blue labeling).
| DISCUSSION |
|---|
|
|
|---|
One interesting feature of the L-VEGF, revealed by our data, is its partial cleavage into two long fragments with distinct cellular localizations, namely a 206-a.a. N-terminal fragment that remains in the cell but appears to be associated with the secretion apparatus and a C-terminal fragment that is secreted. Clearly, the L-VEGF protein represents an unusual model of cleavage and protein export. This atypical internal cleavage indeed occurs in the vicinity of a hydrophobic peptide located in the central part of the L-VEGF, which plays the role of signal peptide in the classical AUG-initiated form. Point mutation of this sequence affects its signal peptide function in the AUG 1,039-initiated form and also prevents the cleavage of the L-VEGF. Obviously, the large size and the primary structure of the N-terminal sequence located upstream from the hydrophobic signal peptide in L-VEGF prevent neither Golgi membrane localization nor cleavage. It should be noted that such an unusual cleavage at the internal signal peptide level has also been described for another growth factor, the FGF-3 CUG-initiated protein. In that case, however, the position of the signal peptide is quite different since it is only 10 a.a. away from the N-terminal end of the protein (26, 34).
Another prerequisite of the L-VEGF cleavage is translocation of the protein into the endoplasmic reticulum, as shown by the data obtained in a rabbit reticulocyte lysate complemented with microsomal membranes. It should be noted that the addition of microsomes after translation completion does not induce cleavage (not shown), which thus seems to be a cotranslational process. The localization of the L-VEGF in the Golgi is not surprising. This situation is observed with the precursor proteins of TGFß-1 or insulin, which also accumulate as immature isoforms in the Golgi structure (35, 36).
The C-terminal fragment of the L-VEGF is likely to be similar, if not identical, to the AUG-initiated VEGF. The size and posttranslational modifications appear to be identical, and both molecules exhibit the same mitogenic activity (not shown).
The function of the NH2 fragment generated by the cleavage is intriguing. So far, the screening of different protein data bases did not lead to the identification of any known structural motif in the NH2 fragment of the L-VEGF, and the possible function of this protein remains to be elucidated.
It is tempting to postulate that this fragment has a specific function since its length and primary structure are remarkably conserved throughout the three species from which a sequence is available. This contrasts, for instance, with the amino-terminal parts of the CUG-initiated FGF-2 isoforms, which are much less conserved throughout mammals.
It should be noted here that the high degree of conservation of the a.a. sequence of this NH2 fragment could, at least partially, result from the structural constraints imposed on the mRNA by the existence of IRES A. Indeed, this ribosomal entry site constitutes more than half of the NH2 extension coding sequence.
The L-VEGF protein is initiated at the level of a relatively "weak" CUG initiation codon, whereas the secreted isoform is initiated at the level of an AUG codon which is in a very poor Kozak context (37). Maybe the selection of such a CUG limits the initiation of an isoform whose expression needs to be strictly balanced with that of the AUG-initiated form to promote the VEGF action. Several growth factors (FGF-2, FGF-3) and c-myc also exist as CUG-initiated isoforms, and their physiological roles are often different from those of the AUG-initiated forms (23, 27, 38, 39, 40). Nevertheless, in the case of FGF-2, FGF-3, and c-myc, the presence of a CUG start codon is explained by the need to allow leaky scanning of the 43S ribosomal subunit that leads to recognition of the downstream AUG. In the case of VEGF, the initiation at the AUG does not require a leaky scanning mechanism since it is driven by a ribosomal entry site, IRES A.
We show that IRES B controls the translation of the L-VEGF isoform, which is cleaved to generate a COOH fragment indistinguishable from the genuine AUG 1,039-initiated form. The presence of IRES B thus appears to enhance the level of production of this protein. This explains our previous data (16), which indicated that the AUG-initiated protein was more abundantly produced when the messenger contained both IRES A and B than when only the IRES A was present.
These data also suggest that the regular VEGF protein is, in fact, produced either by initiation at the classical initiation at the AUG 1,039 or through synthesis of the L-VEGF followed by the cleavage of the NH2 fragment. The choice between these two possibilities may be determined by the cellular environment and hence the relative efficiency of the two IRES A and B. We previously demonstrated that different cellular proteins were able to bind to the two IRES A and B (16). These two ribosomal entry sites could thus act as molecular sensors of cell physiology. They may control a potential differential regulation of the alternative initiation that leads to a balanced synthesis of the L-VEGF and the AUG 1,039 VEGF isoforms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Constructions
The human VEGF 189 coding sequence and the DNA fragment
corresponding to the 5'-UTR of the messenger were kindly provided by J.
Abraham (29). These fragments were cloned into
pSCT-derived plasmid (42) downstream from the
cytomegalovirus and T7 promoters between the XbaI and
BglII sites to generate the p5'189 plasmid (Fig. 2A
). The
p189 plasmid was obtained by deletion of the 5'-UTR (up to
NaeI site in position 1,012) from p5'189. The construct of
the plasmid pVC (C in Fig. 3A
) has already been described
(16). The pVC1012 construct (A in Fig. 3A
) was obtained
after deletion of the 5'-UTR up to the NaeI site (position
1,012), from the pVC plasmid. The pVC585 (B in Fig. 3A
) results from
the deletion of the XbaI-SacII (nt 585) fragment
from the pVC. The pVC-derived pVCATG vector (D in Fig. 3A
) contains the
entire 5'-UTR and the mutation of the CTG codon (position 499) into an
ATG codon. This construct is the result of the cloning into the
PvuII and XbaI sites of pVC (positions 483 and
917 in the 5'-UTR, respectively) of the
PvuII-XbaI-digested PCR fragment obtained
after amplification of the 5'-UTR with the primers +1CTG
5'-TGGGATCCCGCAGCTGACCAGTCGCC ATGGCG-3' and
VN3'. The pVCTTT vector (E in Fig. 3A
) contains the full 5'-UTR in
which the CTG codon in position 499 was mutated into a TTT codon. This
mutation was generated using the primer +1TTT
5'-TTGGGATCCCGCAGCTGACCAGTCGCG TTTCCGGACA-3' and
VN3' 5'-AAAGGAGCTCAGATCTATTAGGTTTCGGAGGCCCGACC-3'.
The amplified fragment of 5'-UTR was digested and cloned into the
BamHI and the SmaI sites of the pVC
vector.
To introduce the mutation of the ATG1039 in the pVC1012, pVC, and pVCATG, the following plasmids were constructed.
The pVC1012CCC (construct 2 in Fig. 5B
) harbors the mutation of the
ATG1039 into a CCC codon. It was obtained by
cloning a PCR product digested NgoMI kle-SacI
into the XbaI kle-SacI sites of the PSCT12VCAT
vector (42). The PCR fragment was amplified from the pVC
plasmid using the primers ATG-CCC 5':
CCGCGCCGGCCCCGGTCGGGCCTCCGAAACC CCCAACTTTCTG-3'
(matching residues 1,008 to 1,044) and " 4REV, " complementary to
the end of the CAT gene, whose sequence is
5'-TTTGAGCTCAGATCTCATTACGCCCCGCCCTGCCA-3'. The pVCCCC
plasmid (construct 4 in Fig. 5B
) was obtained by cloning the same PCR
fragment into the pVC vector digested at the NgoMI (nt
1,012) and SacI sites (end of the CAT gene). The mutation of
the ATG codon 1039 was also introduced into the pVCATG vector by
inserting the NheI-XhoI fragment from PVCCCC in
place of the NheI-XhoI fragment of pVCATG to form
the pVCATG-CCC vector (construct 6 in Fig. 5B
). The pRVCTG plasmid
(construct 3 in Fig. 5A
) is a pRF11AEN-derived vector (27)
in which a XbaI-SacI-digested PCR fragment
obtained after amplification of the 5'-UTR with the primers VN5'
5'-AAATCTAGACTCGAGACC
ATGGGAACGGACAGACAGACAGAC-3' and VN3' was cloned into the
XbaI-SacI-digested pRF11AEN. This vector
contains nt 4991,038 of the 5'-UTR and the mutation of the CTG
(position 499) into the ATG codon without any CAT coding sequence. The
PVSP plasmid (construct 4 in Fig. 5A
) was obtained by cloning a PCR
fragment into the NheI and the BglII sites of the
PVCATG499 vector (see below). This fragment (nt 7361,117) resulted
from the amplification of PVC with the oligonucleotides NHE and
PSSTOPAS 5'-AAAAGATCT
ATTAAGCCTGGGACCACTTGGCATG-3'. In this way, two stop codons were
created just downstream from the VEGF signal peptide coding sequence
(nt 1,0391,115).
The mutation of the signal peptide was performed using the hybridizing
PCR method. A first PCR fragment was obtained after amplification of
the pVC plasmid with the primers PSS (matching nt 1,0591,084) 5'-GGTG
GATTGGAGCCTTGCC GAGCTGC-3' and 4REV (matching the
end of the CAT gene). This PCR product was hybridized with a second
amplification product obtained from pVC with the primers NHE (matching
nt 736754) and PSAS, complementary with the PSS,
5'-GCAGCTCGGCAAGGCTCCAATCCACC-3'. This hybrid served as template for
the third amplification using primers NHE and 4REV. The product was
then digested at the XbaI and DraIII sites
(positions 917 and 1,150 on the amplified fragment, respectively) and
cloned into the XbaI-DraIII-digested pVC and
pVCATG-CCC vectors to create the plasmids pVCmSP (construct A' in
Fig. 6A
) and pVCATG-CCCmSP (construct 2 in Fig. 6B
).
The pVC499ATG (construct 1 in Fig. 8B
) is a pVC-derived plasmid in
which the 5'-UTR has been deleted between nt 1 and 499 and the CTG
codon in position 499 mutated into an ATG codon. For technical
convenience the ATG was designed to become an NcoI site,
which led to the addition of a GGA codon downstream from the ATG. To
obtain this plasmid, a PCR was performed using the primers VN5' and
VN3'. The amplified product extending from positions 499 to 1,038 was
digested with XbaI and SmaI and cloned into the
pVC plasmid. The primer generated this XbaI site. The
construction of the pCVC and pHCVC vectors (constructs A and B in Fig. 4
) has been described previously (16).
In Vitro Translation And Immunoprecipitation
The plasmids 5'189 and 189 were linearized downstream from the
3'-end of the VEGF coding sequence at the BglII site.
Uncapped mRNA was generated in vitro using the T7 m-message
machine kit (Ambion, Inc., Austin, TX) according to
manufacturers instructions. mRNA was quantified by absorbance at 260
nm. Ethidium bromide staining of agarose gel was used as a quality
control. In vitro translation in rabbit reticulocyte lysate
(Promega Corp., Madison, WI) was performed as previously
described (42), in the presence of
35S-methionine (Amersham Pharmacia Biotech, Piscataway, NJ). For the microsome-induced maturation
assay, 35S-methionine (ICN, Orsay,
France) was used to label the translation products and 1 µl of
canine pancreatic microsomal membranes (Promega Corp.,
Roche, Indianapolis, IN) were added per 10 µl of lysate.
Seven microliters (or 10 µl when microsomes were added) of
translation sample were analyzed by electrophoresis in a 12.5%
SDS-polyacrylamide gel. The neosynthesized proteins in Fig. 2A
were
immunoprecipitated with pansorbin as previously described: 20 µl of
the translation sample were diluted to 150 µl in the PBS/NP40 buffer
(PBS 1x, 50 mM NaF, 2 mM
EDTA, 2 mM EGTA, 0.05% NP40) and precleared by
incubation with 50 µl of pansorbin for 10 min at room temperature.
The supernatant was incubated for 30 min at room temperature with 10
µl of N-Ab or VEGF-Ab (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA, sc-152) and then for 30 min at room temperature with 50
µl of pansorbin. After five washes in HEPES/NP40 buffer (150
mM NaCl, 15 mM HEPES, pH
7.4, 1 mM EDTA, pH 7.4, 0.5% NP40), the samples
were analyzed by 12.5% PAGE as above.
DNA Transfection and Western Blotting
COS-7 monkey cells were transfected using Fugene-6 transfection
reagent (Roche) according to manufacturers instructions.
In the case of tunicamycin treatment, cells were incubated 12 h
after transfection with 100 µM tunicamycin
(Roche) for 24 h. Twenty-four to 48 h after
transfection, cells were lysed in dithiothreitol and
ß-mercaptoethanol-containing sample buffer (1x) and scraped.
The samples were heated for 2 min at 95 C. For analysis of secreted
proteins, transfections were performed in the absence of serum, and
proteins from the cell media were precipitated with 7 volumes of
acetone or 20% of acetic acid. The protein pellets were then
resuspended in equal volumes of sample buffer (1x). The proteins were
separated in a 12.5% polyacrylamide gel and transferred onto a
nitrocellulose membrane. CAT proteins were immunodetected using rabbit
polyclonal CAT-Ab prepared in the laboratory (1:10,000 dilution). The
VEGF proteins were detected using VEGF-Ab (Santa Cruz Biotechnology, Inc., sc-152) (dilution 1:300). The N-Ab was
prepared in the laboratory. The antigen injected into the rabbits
corresponds to the a.a. sequence deduced from the cDNA sequence located
between nt 554 (NaeI site) and 937 (SmaI site).
Antibodies were detected using an enhanced chemiluminescence kit
(Amersham Pharmacia Biotech).
Immunocytolocalization
COS-7 cells were seeded on lamella before transfection.
Twenty-four hours after fugene-6 transfection, the cells were washed
four times with PBS and fixed for 7 min. in 3% paraformaldehyde. They
were then washed again three times for 5 min each, twice with PBS and
once with PBS plus NH4Cl 50 mM, and
permeabilized for 20 min at 37 C with nonimmune antibody (1:100 in
PBS-0.025% saponin-0.5% BSA). The cells were then incubated with the
N-Ab (1:200) or the anti-58K antibody (1:200, Sigma, St.
Louis, MO; G2404) in PBS-0.025% saponin-0.5% BSA, respectively) for
90 min at 37 C, washed again three times with PBS-0.025% saponin, and
incubated for 40 min at room temperature with fluorescein
isothiocyanate-coupled antirabbit antibody (1:400, Tebu, Le
Perray, France) and washed again three times. The lamella was
fixed on microscope slides with Citifluor (Pelco, Inc.). Labeling of
the endoplasmic reticulum in Fig. 8B
was obtained by incubating fixed
cells with 1 µM ER tracker blue-white DPX
(Molecular Probes, Inc., Eugene, OR) during 30 min
following manufacturers instructions.
Tissue Protein Extraction
Tissues were crushed with a potter in a buffer made of Tris-HCl,
pH 7.5, 50 mM, NaCl 150 mM, EDTA 1
mM, in the presence of a protease inhibitors mix. The
lysate was filtered and centrifuged at 105,000 x g for
30 min. The supernatant corresponding to the cytoplasmic fraction was
aliquoted. The pellet was then resuspended in a buffer made of
Tris-HCl, pH 7.5, NaCl 150 mM, NP 40 1%, SDS
0.1%, and sodium deoxycholate 0.5%. The suspension was sonicated and
recentrifuged for 20 min at 1,000 x g. The pellet was
discarded and the supernatant was aliquoted. The protein amount was
quantified using the BCA protein assay (Pierce Chemical Co., Rockford, IL).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by grants from the Ligue Nationale contre le Cancer. I.H. received a fellowship from the Association pour la Recherche contre le Cancer. S.B. received a fellowship from the Ministère de lEducation Nationale et de la Recherche Scientifique. L.C. received a fellowship from the Aventis Company.
Abbreviations: a.a., Amino acid; CAT, chloramphenicol acetyltransferase; CAT-Ab, anti-CAT antibody; FGF, fibroblast growth factor; IRES, internal ribosome entry site; L-VEGF, large VEGF; N-Ab, polyclonal antibody; nt, nucleotide; ORF, open reading frame; RRL, rabbit reticulocyte lysates; UTR, untranslated region; VEGF, vascular endothelial growth factor; VEGF-Ab, anti-VEGF antibody.
Received for publication November 2, 2000. Accepted for publication August 16, 2001.
| REFERENCES |
|---|
|
|
|---|
. Biochem Biophys Res Commun 257:8488[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Fallot, R. Ben Naya, C. Hieblot, P. Mondon, E. Lacazette, K. Bouayadi, A. Kharrat, C. Touriol, and H. Prats Alternative-splicing-based bicistronic vectors for ratio-controlled protein expression and application to recombinant antibody production Nucleic Acids Res., November 1, 2009; 37(20): e134 - e134. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Schneider, M. Radovich, and K. D. Miller The Role of Vascular Endothelial Growth Factor Genetic Variability in Cancer Clin. Cancer Res., September 1, 2009; 15(17): 5297 - 5302. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. S. Karaa, J. S. Iacovoni, A. Bastide, E. Lacazette, C. Touriol, and H. Prats The VEGF IRESes are differentially susceptible to translation inhibition by miR-16 RNA, February 1, 2009; 15(2): 249 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Young, S.-J. Wang, J. D. Gordan, X. Ji, S. A. Liebhaber, and M. C. Simon Hypoxia-mediated Selective mRNA Translation by an Internal Ribosome Entry Site-independent Mechanism J. Biol. Chem., June 13, 2008; 283(24): 16309 - 16319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Shinohara, H.-J. Kim, J.-H. Kim, V. A. Garcia, and H. Cantor Alternative translation of osteopontin generates intracellular and secreted isoforms that mediate distinct biological activities in dendritic cells PNAS, May 20, 2008; 105(20): 7235 - 7239. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bastide, Z. Karaa, S. Bornes, C. Hieblot, E. Lacazette, H. Prats, and C. Touriol An upstream open reading frame within an IRES controls expression of a specific VEGF-A isoform Nucleic Acids Res., April 1, 2008; 36(7): 2434 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bornes, L. Prado-Lourenco, A. Bastide, C. Zanibellato, J. S. Iacovoni, E. Lacazette, A.-C. Prats, C. Touriol, and H. Prats Translational Induction of VEGF Internal Ribosome Entry Site Elements During the Early Response to Ischemic Stress Circ. Res., February 16, 2007; 100(3): 305 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. I.V. Errera, L. H. Canani, M. E. R. Silva, E. Yeh, W. Takahashi, K. G. Santos, K. E.P. Souto, B. Tschiedel, I. Roisenberg, J. L. Gross, et al. Functional Vascular Endothelial Growth Factor -634G>C SNP Is Associated With Proliferative Diabetic Retinopathy: A case-control study in a Brazilian population of European ancestry Diabetes Care, February 1, 2007; 30(2): 275 - 279. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Baird, M. Turcotte, R. G. Korneluk, and M. Holcik Searching for IRES RNA, October 1, 2006; 12(10): 1755 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Plotkin and M. S. Goligorsky Mesenchymal cells from adult kidney support angiogenesis and differentiate into multiple interstitial cell types including erythropoietin-producing fibroblasts Am J Physiol Renal Physiol, October 1, 2006; 291(4): F902 - F912. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Summers, B. M. Coupes, M. F. Brennan, S. A. Ralph, C. D. Short, and P. E. C. Brenchley VEGF -460 genotype plays an important role in progression to chronic kidney disease stage 5 Nephrol. Dial. Transplant., November 1, 2005; 20(11): 2427 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Thomson, C. M. Cahill, H.-H. Cho, K. D. Kassachau, M. R. Epis, K. R. Bridges, P. J. Leedman, and J. T. Rogers The Acute Box cis-Element in Human Heavy Ferritin mRNA 5'-Untranslated Region Is a Unique Translation Enhancer That Binds Poly(C)-binding Proteins J. Biol. Chem., August 26, 2005; 280(34): 30032 - 30045. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Jang, L. E.-C. Leong, L. T. Hoang, P. H. Wang, G. A. Gutman, and B. L. Semler Structurally Distinct Elements Mediate Internal Ribosome Entry within the 5'-Noncoding Region of a Voltage-gated Potassium Channel mRNA J. Biol. Chem., November 12, 2004; 279(46): 47419 - 47430. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Woolard, W.-Y. Wang, H. S. Bevan, Y. Qiu, L. Morbidelli, R. O. Pritchard-Jones, T.-G. Cui, M. Sugiono, E. Waine, R. Perrin, et al. VEGF165b, an Inhibitory Vascular Endothelial Growth Factor Splice Variant: Mechanism of Action, In vivo Effect On Angiogenesis and Endogenous Protein Expression Cancer Res., November 1, 2004; 64(21): 7822 - 7835. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bossard, L. V. d. Berghe, H. Laurell, C. Castano, M. Cerutti, A.-C. Prats, and H. Prats Antiangiogenic Properties of Fibstatin, an Extracellular FGF-2-Binding Polypeptide Cancer Res., October 15, 2004; 64(20): 7507 - 7512. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Segrelles, S. Ruiz, M. Santos, J. Martinez-Palacio, M. F. Lara, and J. M. Paramio Akt mediates an angiogenic switch in transformed keratinocytes Carcinogenesis, July 1, 2004; 25(7): 1137 - 1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bornes, M. Boulard, C. Hieblot, C. Zanibellato, J. S. Iacovoni, H. Prats, and C. Touriol Control of the Vascular Endothelial Growth Factor Internal Ribosome Entry Site (IRES) Activity and Translation Initiation by Alternatively Spliced Coding Sequences J. Biol. Chem., April 30, 2004; 279(18): 18717 - 18726. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Miles, J. Slight, L. Spraggon, M. O'Sullivan, C. Patek, and N. D. Hastie Mice Lacking the 68-Amino-Acid, Mammal-Specific N-Terminal Extension of WT1 Develop Normally and Are Fertile Mol. Cell. Biol., April 1, 2003; 23(7): 2608 - 2613. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |