help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sherman, C. T.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sherman, C. T.
Right arrow Articles by Brasier, A. R.
Molecular Endocrinology 15 (3): 441-457
Copyright © 2001 by The Endocrine Society

Role of Signal Transducers and Activators of Transcription 1 and -3 in Inducible Regulation of the Human Angiotensinogen Gene by Interleukin-6

Christopher T. Sherman and Allan R. Brasier

Department of Internal Medicine Sealy Center for Molecular Sciences and Human Biological Chemistry and Genetics The University of Texas Medical Branch Galveston, Texas 77555-1060


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The circulating level of angiotensinogen (AGT) is dynamically regulated as an important determinant of blood pressure and electrolyte homeostasis. Because the mechanisms controlling the regulated expression of human angiotensinogen (hAGT) are unknown, we investigated the inducible regulation of the hAGT gene in well differentiated HepG2 cells. Interleukin-6 (IL-6) stimulation produced a 3.2-fold increase in hAGT mRNA peaking at 96 h after stimulation. Deletional mutagenesis of the hAGT promoter in transient transfection assays identified an IL-6 response domain between nucleotides -350 and -122 containing three reiterated motifs, termed human acute phase response elements (hAPREs). Although mutation of each site individually caused a fall in IL-6-inducible luciferase activity, mutation of all three sites was required to block the IL-6 effect. Electrophoretic mobility shift assay (EMSA), supershift, and microaffinity DNA binding assays indicate IL-6-inducible high-affinity binding of signal transducers and activators of transcription 1 and -3 (STAT1 and -3) to hAPRE1 and -3 but only low-affinity binding to hAPRE2. Expression of a dominant-negative form of STAT3, but not STAT1, produced a concentration-dependent reduction in IL-6-induced hAGT transcription and endogenous mRNA expression. These data indicate that STAT3 plays a major role in hAGT gene induction through three functionally distinct hAPREs in its promoter and suggest a mechanism for its up-regulation during the acute-phase response.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Hypertension is a major risk factor for ischemic heart disease, a leading cause of death in the United States (1). The renin-angiotensinogen system (RAS) contributes to the regulation of blood pressure by controlling peripheral vascular resistance and electrolyte homeostasis and plays a significant role in the etiology of renovascular and essential hypertension (2). An important regulatory step in the RAS is the production rate of the potent vasoactive peptide, angiotensin II (Ang II). Ang II is the product of sequential proteolysis of the angiotensinogen (AGT) prohormone, a protein principally secreted by the liver (3). The circulating level of AGT is dynamically regulated and is an important determinant of RAS activity because it circulates at concentrations that are rate limiting for the formation of Ang II (4). Although the constitutive regulation of human AGT (hAGT) expression has been studied (5, 6, 7), little is known of control elements that mediate inducible hAGT expression (8).

Probably arising as a gene duplication event in the serine protease inhibitor gene family that includes {alpha}1-antitrypsin (9), the AGT gene retains regulatory features of these acute-phase reactants (3). The hepatic acute-phase response is a switch in secretory protein transcription in the vertebrate liver in response to systemic inflammation (3). Acute-phase reactants have been divided into two subclasses based on the activators for their expression (10). Class I acute-phase proteins (mouse serum amyloid A, complement, and the rodent homolog of AGT) are dependent on the IL-1-like cytokines [IL-1{alpha} and ß, tumor necrosis factor (TNF)-{alpha} and ß]. By contrast, class II acute-phase reactants (fibrinogen, human haptoglobin, and rat {alpha}2-macroglobulin) are regulated by interleukin 6 (IL-6)-like cytokines [IL-6, leukemia-inhibitory factor (LIF), IL-11, oncostatin M (OSM)] and glucocorticoids (3, 10).

Class II acute-phase reactants are activated through two discrete IL-6 signaling pathways (10). After binding IL-6, the IL-6 receptor complexes with two signal transducing gp130 ß-subunits to constitute the activated receptor (11). The active IL-6 receptor activates the tyrosine-specific Janus kinases JAK1, JAK2, and Tyk2 (12). Subsequent tyrosine phosphorylation of signal transducers and activators of transcription (STATs) in a src homology domain induce their homo- and heterodimerization, nuclear translocation, and DNA binding (12). In a separate pathway, IL-6 binding activates Ras, mitogen-activated protein (MAP) kinase, and threonine phosphorylation of the nuclear factor-IL-6 (NF-IL6) transcription factor (10). NF-IL6 is of particular relevance to hAGT regulation as others have shown that the rodent homolog, DBP, binds to -100 to -80 nucleotides (nt) and transactivates the hAGT promoter in overexpression experiments (13). However, the role of NF-IL6 in mediating cytokine-inducible hAGT expression has not been reported.

The mechanisms and signaling pathways by which the hAGT gene can be regulated by IL-6 have not been described. Here we demonstrate that IL-6 activates hAGT through an approximately 230-nt domain containing three functionally distinct cis-regulatory elements. These elements specifically bind common STAT1 and -3 subunits; surprisingly, only STAT3 appears to mediate the IL-6 effect. Overall, our data implicate hAGT as a class II acute-phase reactant mediated through a JAK-STAT3 pathway.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Kinetics of IL-6-Inducible hAGT mRNA Abundance in HepG2 Cells
Northern analysis of RNA extracted from HepG2 liver cells was performed to determine changes in steady state hAGT mRNA abundance after various stimuli. In preliminary experiments, systematic stimulation of HepG2 cells with inducers of class I acute phase reactants (IL-1{alpha}, 6 ng/ml, and TNF{alpha}, 30 ng/ml) failed to induce detectable changes in steady-state hAGT mRNA (data not shown). However, the class II inducer, IL-6, induced hAGT transcript abundance (Fig. 1Go). An increase in the abundance of the single 1.9-kb hAGT transcript (detectable in unstimulated cells) was detected as early as 24 h after IL-6 treatment (1.8 ± 0.4 fold increase). hAGT transcript abundance continued to increase until a significant induction was observed at 96 h after treatment (3.2 ± 0.1 fold). No changes in hAGT transcript abundance were observed in parallel plates maintained under similar conditions in the absence of IL-6 stimulation (data not shown). Additionally, there was no further stimulatory effect on hAGT mRNA abundance when a combination of IL-6 and the aforementioned class I acute phase reactants were used to stimulate HepG2 cells (data not shown).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. Kinetics of IL-6-Inducible hAGT mRNA Abundance in HepG2 Cells

HepG2 cells were serum starved (media supplemented with 0.5% BSA wt/vol) 24 h before and during stimulation with IL-6 (8 ng/ml) for the indicated times. Top, Autoradiogram after hybridization with hAGT cDNA probe. Bottom, Exposure after hybridization with 18S internal control. For each time point hAGT signal was normalized to 18S signal after exposure to a PhosphorImager cassette. Relative to unstimulated cells, normalized hAGT RNA increases 1.8 ± 0.4 at 24 h, 1.6 ± 0.4 at 48 h, 2.5 ± 0.3* at 72 h, and 3.3 ± 0.1* at 96 h (mean ± SD of four experiments). * Indicates significant difference from unstimulated cells (P < 0.05, Student’s t test).

 
The IL-6 Response Domain Is Located between Nucleotides -350 and -122 of the hAGT Promoter
To identify regulatory elements responsible for IL-6 induction of hAGT, the hAGT promoter [-991/+20 nucleotides (nt) relative to the cap site (14) and corresponding to the M235T allele (6)] driving a luciferase reporter was used in transient transfection assays in HepG2 cells.

-991/+20 hAGT/LUC responded by changes in luciferase reporter activity when stimulated with IL-6 (Fig. 2Go, A and B). In response to increasing doses of IL-6, a saturating response of approximately 8.5-fold was observed after stimulation with 8.0 ng/ml (Fig. 2AGo; although an ~11-fold induction was seen after stimulation with 80 ng/ml, this was not statistically different from the induction produced by 8 ng/ml). Induction of -991/+20 hAGT/LUC with a saturating dose of IL-6 (8 ng/ml) was observed to be time dependent, with an 8.4 ± 0.9-fold induction seen at 24 h (Fig. 2BGo). This level of induction plateaued thereafter until 48 h of stimulation (Fig. 2BGo). We note that the kinetics of luciferase induction is more rapid than that of endogenous hAGT mRNA accumulation detected by Northern blot, where the peak in hAGT gene expression does not occur until 96 h after IL-6 stimulation (Fig. 1Go). The discrepancy in the time of peak activity between luciferase reporter activity and hAGT mRNA abundance in Northern blot may be due to the relative differences in mRNA half-life. AGT mRNA, being more stable than luciferase, will require longer times to reach steady state.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. Identification of IL-6 Response Domain in the hAGT Promoter

A, Dose-response curve to increasing concentrations of IL-6. HepG2 cells were transiently transfected with -991/+22 hAGT/LUC (Materials and Methods). Cells were stimulated with indicated concentrations of IL-6 for 24 h before simultaneous harvest and reporter gene assay. Numbers above vertical bars represent fold-increase of reporter activity relative to unstimulated cells. Data are mean ± SD of three experiments. * Indicates significant difference from unstimulated promoter (P < 0.05, Student’s t test). B, Time course of IL-6 induction after stimulation with 8 ng/ml IL-6. Transiently transfected HepG2 cells were stimulated for the indicated times before simultaneous harvest and reporter gene assay. Data presented as in panel A. C, 5'-Deletions of IL-6 response domain. HepG2 cells transiently transfected with hAGT promoter deletion constructs were untreated or stimulated with 8 ng/ml IL-6 for 24 h before simultaneous harvest and reporter gene assay. Left, Schematic diagram of hAGT promoter 5'-deletional constructs. Numbers at left indicate upstream boundary of AGT promoter being tested. Right, Fold activation of stimulated 5'-deletion constructs relative to their unstimulated reporter activity. Data are means ± SD of three experiments. ** Denotes significant difference from -991/+20 hAGT/LUC promoter activity (P < 0.05, Student’s t test). D, 3'-Deletions of IL-6 response domain. Experiment as in 2C. Left, Schematic diagram of hAGT promoter 3'-deletional constructs. Thin lines indicate nucleotides removed from the -350/+20 hAGT/LUC reporter. Right, Fold activation of stimulated 3'-deletion constructs relative to their unstimulated reporter activity. Data are means ± SD of three experiments. ** Denotes significant difference from -350/+20 hAGT/LUC promoter activity (P < 0.05, Student’s t test). E, Site mutations of hAPREs. HepG2 cells transiently transfected with hAGT site-mutation constructs were untreated or stimulated with 8 ng/ml IL-6 for 24 h before simultaneous harvest and reporter gene assay. Left, Schematic diagram of hAPRE site mutants within the context of the full-length hAGT promoter. For sequences of wild-type and mutant hAPREs, see Table 1Go. Right, Percent activation relative to wild-type (-991/+20) hAGT promoter. Data are means ± SD of three experiments. ** Denotes significant difference from -991/+20 hAGT/LUC promoter activity (P < 0.05, Student’s t test).

 
Serial 5'-deletions of -991/+20 hAGT/LUC were assayed to map the boundary of the IL-6 response domain. Each 5'-deletion was tested for basal and IL-6-stimulated activity in transient transfection assays. The effect of each 5'-deletion did not significantly influence unstimulated activity compared with wild-type (not shown). hAGT/LUC promoters from -991 nt to -350 nt were consistently 8- to 10-fold inducible by the addition of IL-6 (Fig. 2CGo). This induction was significantly, but not completely, lost by deletion to -260 nt. The weak approximately 4-fold induction of -260 nt was completely lost upon further deletion to –46 nt. These data indicate that a region from -350 nt to -260 nt was partly required for IL-6 activation and an additional region downstream of -260 nt may also participate.

Internal deletions between -288 nt and -46 nt of the hAGT promoter were then assayed to map the 3'-boundary of the IL-6 responsive domain. Each 3'-deletion was tested for basal and IL-6-stimulated activity in transient transfection assays. The effect of each 3'- deletion did not significantly influence unstimulated activity compared with wild-type (not shown). Deletions of a region between nucleotides -46 to -122 produced a construct that was fully IL-6 inducible, whereas deletions of nucleotides -46 to -201 lost all responsiveness (Fig. 2DGo). This indicates the requirement of downstream sequences between -122 nt and -201 nt for IL-6 activation. Together these data indicate that the hAGT promoter contains a bipartite IL-6-responsive domain with one domain contained within -350 nt to -260 nt and the second between -122 nt to -201 nt. Inspection of this IL-6-responsive domain led to the identification of three reiterated sequences bearing homology to IL-6 response elements, 5'-TTNNNNNAA-3' (15, 16, 17), termed human acute phase-response elements (hAPREs); hAPRE1 (-278 to -269 nt), hAPRE2 (-246 to -237 nt), and hAPRE3 [-171 to -162 nt (see Table 1Go)].


View this table:
[in this window]
[in a new window]
 
Table 1. Reiterated Sequences between -350 and -122 of hAGT Promoter Bearing Homology to Known IL-6 Response Elements

 
A series of hAPRE site mutations were constructed alone and in combination using the full-length hAGT promoter (-991/+20 hAGT/LUC). Table 1Go shows the base pair changes used for each hAPRE site mutant. Each mutant was tested for basal and IL-6-stimulated activity in transient transfection assays. The effect of each site mutant did not detectably influence unstimulated activity compared with wild type (not shown). However, the site mutations had distinct responses to IL-6 stimulation (Fig. 2EGo). Here, activity of each construct is reported as a percentage of the maximal fold activation of the wild-type promoter measured in the same experiment. Although mutation of hAPRE1 and -2 reduced IL-6 activation, mutation of the most downstream element, hAPRE3, caused the greatest fall in inducible transcriptional activity in constructs containing only a single site mutation. Mutation of all three hAPREs caused the most significant loss of IL-6 activation. Together these data indicate hAGT is an IL-6-inducible (or class II) acute-phase reactant.

Characterization of IL-6-Inducible Proteins Binding to the hAPREs
Electrophoretic mobility shift assays (EMSAs) were performed to identify the kinetics and specificity of proteins binding to hAPREs 1–3. In unstimulated cells, two rapidly migrating nonspecific complexes were detected binding to all of the hAPRE probes (Fig. 3AGo). After 15 min of IL-6 stimulation, two complexes (C1 and C2) were rapidly induced to bind hAPREs 1 and 3 (an apparent decrease in the nonspecific complexes was observed due to probe binding by C1/C2). By contrast, no inducible complexes were observed to bind hAPRE2. To determine binding specificity, radiolabeled wild-type and mutant hAPRE oligonucleotides were incubated with IL-6-stimulated HepG2 nuclear extracts and then subjected to native PAGE. As shown in Fig. 3BGo, wild-type hAPREs 1 and 3 form complexes with IL-6-stimulated HepG2 nuclear proteins while their (transcriptionally inactive) mutant counterparts do not. These data demonstrate that the inducible complexes observed in Fig. 3AGo are sequence specific.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Characterization of IL-6-Inducible Proteins Binding to hAPREs

A, IL-6-inducible complexes on hAPREs 1–3. Nuclear extracts from HepG2 cells left unstimulated (lanes 1–3) or stimulated with IL-6 (8 ng/ml) for 15 min (lanes 4–6) were used to bind radiolabeled wild-type hAPREs 1–3. B, Determination of IL-6-inducible complex binding specificity. Nuclear extracts from HepG2 cells stimulated with IL-6 (8 ng/ml) for 15 min were used to bind either radiolabeled wild-type (lanes 1, 3, and 5) or mutant (lanes 2, 4, and 6) hAPREs 1–3. C, Comparison of IL-6-inducible complexes formed with high-affinity SIE and hAPRE1. Nuclear extracts from HepG2 cells left unstimulated (lanes 1 and 3) or stimulated with IL-6 (8 ng/ml) for 15 min (lanes 2 and 4) were used to bind radiolabeled high-affinity SIE (lanes 1 and 2) or wild-type hAPRE1 (lanes 3 and 4) oligonucleotides. D, Supershift analysis of IL-6-inducible hAPRE1 complexes using anti-STAT1 or STAT3 antibodies. Nuclear extracts from HepG2 cells stimulated with IL-6 (8 ng/ml) for 15 min were used to bind radiolabeled wild-type hAPRE1 in the presence of 5 µg of normal rabbit IgG (lane 1), anti-STAT1 antibody (lane 2), or anti-STAT3 antibody (lane 3). E, Time course of IL-6 stimulation. EMSA of nuclear proteins binding wild-type hAPRE1 from HepG2 cells stimulated for the indicated times with 8 ng/ml IL-6. In this particular EMSA, the C1/C2 complexes are not well resolved. This figures is representative of the pattern of binding seen in one of three experiments. Note that in this particular experiment the apparent induction of the faster migrating NS band was not reproducible. The pattern of binding shown in lane 1 of panels A and D (hAPRE1 binding to non-IL-6-stimulated HepG2 nuclear extracts) was more consistently observed.

 
Activation of class II acute-phase reactants has been shown to be mediated through the JAK-STAT pathway (10). A modified form of the sis-inducible element (SIE) from the human c-fos promoter, termed the high-affinity SIE, has been previously shown to bind to STATs 1 and 3 in EMSA (15, 18). We therefore compared the complexes formed by the high-affinity SIE with those formed on the IL-6-inducible hAPRE1 (Fig. 3CGo). Incubation of the high-affinity SIE with IL-6-stimulated HepG2 nuclear extracts resulted in the appearance of two IL-6-inducible complexes that exactly comigrate with the IL-6- inducible hAPRE1 complexes. These two IL-6-inducible complexes formed by the high-affinity SIE have been previously observed by other investigators using IL-6-stimulated HepG2 nuclear extracts (15, 18). To test for STAT1 or STAT3 binding to the hAPRE1, supershift analysis was performed (Fig. 3DGo). We observed that antibodies specific for either STAT1 or STAT3 produced a supershifted band whereas binding reactions containing normal rabbit IgG failed to produce a supershifted band. These data indicate that STAT1 and STAT3 are rapidly induced to bind hAPRE1 and -3.

We were surprised to see the rapid induction of STAT1 and STAT3 binding (within 15 min) for the hAPRE whereas activation of the hAGT Luc reporter requires longer stimulation (24 h). To investigate these observations further, we determined whether IL-6- inducible complexes were formed 24–48 h after IL-6 stimulation of HepG2 cells (Fig. 3EGo). The C1/C2 complexes were also observed 24, 36, and 48 h following IL-6 stimulation.

STAT1 and STAT3 Bind to hAPREs 1–3 with Varying Affinities
Activation of class II acute-phase reactants is mediated through either the JAK-STAT or the Ras-MAPK-NF-IL6 pathway (10). To identify the spectrum of proteins binding to the hAPREs more rigorously than what was possible by supershift assay, microaffinity isolation/Western immunoblot DNA-binding assays were performed using biotinylated (Bt) oligonucleotides for each of the three hAPREs. In this assay, each Bt-hAPRE was used to bind IL-6-stimulated (8 ng/ml; 15 min) HepG2 nuclear extracts. hAPRE-binding proteins were captured by the addition of streptavidin agarose beads and washed, and the presence of bound proteins was detected using Western immunoblot (Fig. 4AGo). hAPRE1 and -3 bound with high affinity to STAT1 whereas hAPRE2 bound STAT1 only weakly. By contrast, hAPRE1 bound STAT3 strongly whereas hAPRE2 and -3 bound STAT3 weakly. The antiphosphotyrosine blot, a measure of total STAT binding, indicated that hAPREs bound phospho-STAT proteins in the hierarchical order hAPRE1>hAPRE3>hAPRE2. None of the hAPREs appeared to bind STAT5 or NF-IL6, even though both proteins were present in HepG2 nuclei (Fig. 4AGo). These data indicated that the hAPREs are targets of the JAK-STAT pathway but that they bound STAT1 and STAT3 with differing affinities.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Microaffinity Isolation/Western Immunoblot of STAT Isoforms Binding hAPREs 1–3

A, hAPRE binding STAT isoforms. Specific binding of STAT1 (91 kDa), STAT3 (92/89 kDa), and antiphosphotyrosine (92/89 kDa) are detectable on hAPREs 1–3 after binding reaction with 1 mg of IL-6 stimulated (8 ng/ml, 15 min) HepG2 cell nuclear extract. Inclusion of 50 µg of IL-6-stimulated (8 ng/ml, 15 min) HepG2 cell nuclear extract (NE) provided a positive control for STAT5 and NF-IL6 antibody. B, Binding competition for STAT1. Specific STAT1 staining increases dramatically for all hAPRE sites after IL-6 stimulation. hAPRE1 binds with high affinity to STAT1 where its binding is completely competed by a 2.5 molar excess of WT but not a 2.5 molar excess of {Delta} hAPRE oligonucleotides. Note that the panel for hAPRE2 is exposed 8 times longer (8 min exposure) than the panels for hAPREs 1 and 3 due to the lower affinity of this binding site for STAT1 (see panel A). A doublet of STAT1 binding is inconsistently seen due to partial proteolysis in this particular experiment. C, Binding competition for STAT3. Experiment is as for 4B, but anti-STAT3 is used in the immunoblot. Similar results are seen where hAPRE1 binds specifically and with high affinity to STAT3. Note that the panel for hAPRE2 is exposed 8 times longer (8 min exposure) than the panels for hAPREs 1 and 3 due to the lower affinity of this binding site for STAT3 (see panel A). Minor proteolytic bands are observed at smaller molecular weights. Figures are representative of one of four experiments.

 
To identify the specificity of proteins binding to the hAPREs, competition experiments in the microaffinity isolation/Western immunoblot DNA-binding assays were performed. Here Bt-hAPREs were included in the presence of non-Bt wild-type or mutant competitors. Figure 4BGo shows the result of this assay where the blot is probed for STAT1. Very little STAT1 binding is detectable in unstimulated extracts (because hAPRE2 bound so weakly, this panel is exposed longer than for either hAPRE1 or -3). Inclusion of non-Bt wild-type hAPRE completely competes for STAT1 binding but not when non-Bt mutant hAPRE is used, indicating sequence-specific binding. Additionally, no signal for STAT1 was detected when no DNA was included in the initial binding as a control for nonspecific binding. In Fig. 4CGo, a similar analysis is performed for STAT3. Similar results are noted. Importantly, hAPRE2 weakly but specifically binds STAT3. Also, hAPRE3 binds STAT3 with lower affinity than hAPRE1, and the WT competitor does not completely compete for its binding. These data indicate that STATs 1 and 3 inducibly bind each of the three hAPREs in a sequence-specific fashion but with different affinities.

Western immunoblot was performed on sucrose cushion-purified nuclear extracts taken from IL-6-treated HepG2 cells using antibodies specific for either tyrosine-phosphorylated STAT1 or STAT3 to determine whether inducible binding was due to changes in their nuclear abundance (Fig. 5Go). No tyrosine-phosphorylated STAT1 (pY-STAT1) was detected in the nucleus of unstimulated HepG2 cells. Fifteen minutes after IL-6 stimulation, however, a doublet appears. This doublet strengthens in intensity by 30 min. The doublet diminished to a single band at 45 and 60 min and is almost completely absent at 2 and 6 h. The doublet reappears, although it is somewhat fuzzy in this image, at 12 h and gradually strengthens in intensity by 48 h following IL-6 stimulation. Reprobing the blot with an antibody specific for tyrosine-phosphorylated STAT3 (pY-STAT3) reveals similar kinetics as pY-STAT1. In the case of pY-STAT3 there is an intense doublet appearing at both 15 and 30 min following IL-6 stimulation (Fig. 5Go). A probe for ß-actin controls for equivalent lane-to-lane protein loading. These data indicate biphasic induction of activated STAT isoforms in the nucleus of stimulated HepG2 cells and are consistent with the time course EMSA where a peak in IL-6-inducible bands is observed with hAPRE1 at 24, 36, and 48 h following IL-6 stimulation (see Fig. 3EGo) with a nadir in binding between 30 min and 24 h (not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. Changes in Nuclear Abundance of pY-STAT1 and pY-STAT3 after IL-6 Treatment

HepG2 cells were serum starved (media supplemented with 0.5% BSA, wt/vol) 24 h before and during stimulation with IL-6 (8 ng/ml) for the indicated times. Location of specific staining is indicated at left. Constitutively expressed ß-actin (46 kDa) controls for gel loading and protein transfer. Steady state nuclear abundance pY-STAT1 and pY-STAT3 rapidly increase after IL-6 stimulation, decline by 2 h, and reappear at 12 through 48 h. Figure is representative of one of three experiments performed with similar results.

 
Only hAPRE1 is an IL-6-Inducible Enhancer
To independently test the transcriptional activity of the hAPREs, each site was multimerized and ligated upstream of the inert -46/+20 hAGT/LUC promoter. Constructs containing five copies [(hAPREn)5LUC, n = 1, 2, or 3] of their respective sites were selected and individually tested for IL-6 inducibility. (hAPRE1)5LUC was inducible in a similar fashion as -991/+20 hAGT/LUC with a dose-dependent increase between 0.8–8.0 ng/ml and an apparent maximal response of 30-fold at 80 ng/ml (Fig. 6AGo; compare with Fig. 2AGo). The kinetics of (hAPRE1)5LUC was also similar to -991/+20 hAGT/LUC with a peak induction at 24 h persisting until 48 h (Fig. 6BGo; compare with Fig. 2BGo). Pentamers of hAPRE2 and, surprisingly, hAPRE3 were not significantly IL-6 inducible (Fig. 6Go, C and D). To exclude possible artifacts from concatenation of hAPRE3, monomers, dimers, and trimers of hAPRE3 were ligated upstream of -46/+22 hAGT/LUC and tested for IL-6 inducibility. No IL-6-inducible changes in luciferase were observed, indicating hAPRE3 is not independently IL-6 inducible at any copy number (data not shown). These data indicate that hAPRE1, the high-affinity binding site for STAT3, is the only bona fide IL-6-inducible enhancer of the hAGT promoter.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 6. Transcriptional Activity of Multimerized hAPRE Templates Upstream of the hAGT Minimal Promoter

A, Dose-response curve of (hAPRE1)5LUC transcription to IL-6. Transiently transfected HepG2 cells were stimulated for 24 h with the indicated doses of IL-6 before simultaneous harvest and reporter gene assay. Numbers above vertical bars represent fold-increase of stimulated reporter activity relative to unstimulated promoter. Data are means ± SD of one of three experiments. * Indicates significant difference from unstimulated promoter (P < 0.05, Student’s t test). B, Time course of (hAPRE1)5LUC induction. Transiently transfected cells were stimulated with 8 ng/ml IL-6 for the indicated times before simultaneous harvest and reporter gene assay. Data presented as in panel A. C, Dose-response curve of (hAPRE2)5LUC. Experiment and data presentation as in panel A. D, Dose-response curve of (hAPRE3)5LUC. Experiment and data presentation as in panel A.

 
Dominant Negative Form of STAT3, but not STAT1, Has an Effect on IL-6 Inducibility of Multimerized hAPRE1 Reporter Plasmid
A critical tyrosine at amino acid 701 of STAT1 (19) and 705 of STAT3 (20) is required for homo- and heterodimerization of these proteins and their subsequent nuclear translocation and transcriptional activation. Mutation of this tyrosine to a phenylalanine in either STAT1 or STAT3 causes the protein to act in a dominant negative fashion (20, 21). To determine the individual contribution of STAT1 and STAT3 on hAGT induction by IL-6, expression vectors containing FLAG-tagged (STAT3-DN) or V5-tagged (STAT1-DN) cDNA sequences were constructed. To confirm their expression, extracts from a homogenous population of transfected cells (22) were subjected to Western immunoblot with an anti-FLAG antibody (STAT3) or anti-V5 antibody (STAT1; Fig. 7AGo). Both epitope-tagged inhibitor proteins were expressed in HepG2 cells.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Effect of STAT1 and STAT3 Dominant Negative (DN) Forms on IL-6-Induced (hAPRE1)5LUC Activity

A, Western immunoblot with anti-V5 (detecting STAT1-DN) or anti-FLAG (detecting STAT3-DN) antibody of immunoaffinity isolated HepG2 cytoplasmic extracts. The 91- kDa STAT1-DN and the 92 kDa STAT3-DN are only detected in cells transfected with expression plasmid containing the respective dominant negative cDNA sequence vs. cells transfected with an empty expression plasmid (no cDNA insert). B, Relative level of expression of ectopically expressed STAT1 or STAT3 to endogenous STATs. The 84- kDa STAT1{Delta}TA and the 89-kDa STAT3{Delta}TA are only detected in cells transfected with expression plasmid containing the truncated sequence vs. cells transfected with an empty expression plasmid. STAT1{Delta}TA is expressed at higher levels than endogenous 91- or 84- kDa STAT1. STAT3{Delta}TA is expressed at equivalent levels to 92-kDa STAT3. C, Specificity of STAT-DN isoforms. Cells transfected with STAT1-DN, STAT3-DN, or empty expression vectors were stimulated with IL-6 (8 ng/ml, 15 min) and isolated on magnetic beads for Western immunoblot and stained with the indicated phosphotyrosine-specific STAT antibody. Cells transfected with STAT1-DN show a decrease in the amount of pY-STAT1 and an increase in the overall abundance of STAT1 relative to cells transfected with an empty expression vector. The induction of pY-STAT3 was unaffected. Conversely, cells transfected with STAT3-DN show a decrease in the amount of pY-STAT3 and an increase in the overall abundance of STAT3 relative to cells transfected with an empty expression vector. The induction of pY-STAT1 was unaffected. D, Effect of STAT1-DN on hAGT transcriptional activity. Percentage reduction of IL-6-induced -991/+22 hAGT/LUC and (hAPRE1)5LUC activity in the presence of increasing amounts of an expression vector containing the STAT1DN cDNA sequence (STAT1-DN). Amount of transfected DNA was kept equivalent using an empty expression plasmid. Transiently transfected HepG2 cells were stimulated with 8 ng/ml IL-6 for 24 h before simultaneous harvest and reporter gene assays. E, Effect of STAT3-DN on hAGT transcriptional activity. Percentage reduction of IL-6-induced -991/+22 hAGT/LUC and (hAPRE1)5LUC activity in the presence of increasing amounts of an expression vector containing STAT3-DN cDNA sequence (STAT3-DN). Amount of transfected DNA was kept equivalent using an empty expression plasmid. Cells were transfected as in panel D. Data are means ± SD of triplicate plates from three experiments.

 
STAT1-DN and STAT3-DN comigrate with endogenous STAT 1 and STAT3, respectively, making a direct comparison of their relative expression levels ambiguous. To circumnavigate this problem, we expressed the naturally occurring ß-isoforms of STAT1 and STAT3 (21, 23) encoding alternatively spliced proteins lacking the C-terminal transactivation domain (TA). Importantly, the ß-isoforms are smaller than the transcriptionally active {alpha}-isoforms and are naturally expressed in low abundance; these features allow an uncomplicated interpretation of the relative expression levels of endogenous protein and dominant negative proteins by Western immunoblot. cDNAs encoding C-terminal truncation of STAT1 and STAT3 were generated by placing a stop codon at residue 713 of STAT1 (STAT1{Delta}TA, a 38-amino acid C-terminal truncation) and residue 715 of STAT3 (STAT3{Delta}TA, a 55-amino acid C-terminal truncation). We assume that there would be an insignificant difference in the level of expression between the full-length STAT-DNs and the STAT{Delta}TAs because the expression plasmids are otherwise identical. Extracts from a homogenous population of HepG2 cells (22) transfected with either STAT1{Delta}TA or STAT3{Delta}TA cDNAs were subjected to Western immunoblot with anti-STAT1 or anti-STAT3 antibodies (Fig. 7BGo). We note that the STAT1{Delta}TA was expressed at higher levels than full-length endogenous STAT1 and that STAT3{Delta}TA was expressed at equivalent levels to full-length endogenous STAT3. These data indicate high-level expression of both dominant negative proteins.

To determine whether expression of the STAT1-DN decreased STAT1 activation, the amount of tyrosine-phosphorylated (activated) STAT1 was measured with a specific antibody in a homogenous population of STAT1-DN transiently transfected cells (Fig. 7CGo, top panel). These cells were stimulated with IL-6 (8 ng/ml, 15 min) before immunoaffinity isolation (Materials and Methods) and lysates were immunoblotted with antiphosphotyrosine STAT1. Expression of STAT1-DN caused a decrease in the amount of tyrosine-phosphorylated STAT1 compared with cells transfected with either an empty expression vector or the STAT3-DN expression vector. Probing the same blot with an anti-STAT1 antibody revealed a much greater level of STAT1 protein expression in the cells transfected with the STAT1-DN expression vector making the ratio of unphosphorylated to phosphorylated STAT1 high (Fig. 7CGo, compare top two panels). Note that there is not a significant decrease in the amount of phosphorylated STAT1 in extracts from cells transfected with the STAT3-DN expression vector. This is consistent with observations that tyrosine phosphorylation of STAT1 by gp130 is independent of STAT3 tyrosine phosphorylation (24).

The above strategy was again employed to determine whether expression of STAT3-DN caused a decrease in the amount of tyrosine-phosphorylated STAT3 (Fig. 7CGo, bottom panels). Here we observed that STAT3-DN caused a decrease in the amount of tyrosine- phosphorylated STAT3 with respect to extracts from a homogenous population of cells transfected with either an empty expression vector or the STAT1-DN expression vector. Probing the same blot with an anti-STAT3 antibody revealed a greater level of STAT3 protein expression in the cells transfected with the STAT3-DN expression vector making the ratio of unphosphorylated to phosphorylated STAT3 high (Fig. 7CGo, compare bottom two panels). Note that there is not a significant decrease in the amount of phosphorylated STAT3 in extracts from cells transfected with the STAT1-DN expression vector, indicating that both dominant negative proteins selectively interfere with activation of their cognate STAT isoform. This is consistent with observations that STAT3 docks on the gp 130 IL-6 receptor at a distinct site from that bound by STAT1 (24, 25).

Surprisingly, in spite of its high level of expression relative to its endogenous counterpart (Fig. 7BGo), and its ability to specifically block STAT1 activation (Fig. 7CGo), expression of STAT1-DN had no significant effect on IL-6 induced -991/+22 hAGT/LUC or (hAPRE1)5LUC reporter activity (Fig. 7DGo). Additionally, expression of the truncated form of STAT1, STAT1{Delta}TA, also had no significant effect on IL-6 induced -991/+22 hAGT/LUC or (hAPRE1)5LUC luciferase activity (data not shown). In contrast to STAT1-DN, expression of increasing amounts of STAT3-DN expression vector caused IL-6 induced -991/+22 hAGT/LUC reporter activity to decrease more than 75% while IL-6- induced (hAPRE1)5LUC reporter activity was decreased more than 90% (Fig. 7EGo). Expression of STAT3{Delta}TA produced a similar fall in induced luciferase activity for both -991/+22 hAGT/LUC and (hAPRE1)5LUC (data not shown; S. Ray, C. T. Sherman, and A. R. Brasier, manuscript in preparation). These results indicate an essential (predominant) role of STAT3 in IL-6 activation of hAGT expression.

Dominant Negative Form of STAT3 Blocks Endogenous hAGT mRNA Induction
To further confirm the major contributory role of STAT3 in the inducible regulation of hAGT, HepG2 cells were stably transfected with the FLAG-tagged STAT3DN expression vector and subjected to Northern analysis after stimulation with IL-6 (Fig. 8Go). Western analysis of cytoplasmic extracts from stable STAT3DN-HepG2 cells using an anti-FLAG antibody confirmed expression of STAT3DN in these cells (data not shown). No significant increase in hAGT mRNA abundance was observed in HepG2 cells stably transfected with STAT3DN (Fig. 8Go, lanes 4–6). Cells stably transfected with an empty expression vector, however, did show a significant increase in hAGT mRNA abundance after IL-6 stimulation for 72 and 96 h (Fig. 8Go, lanes 1–3). This observation was not significantly different from our observations in Fig. 1Go. Together these indicate an essential requirement for STAT3 in IL-6-inducible expression of endogenous hAGT transcripts.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 8. Kinetics of IL-6-Inducible hAGT mRNA Abundance in HepG2 Cells Stably Transfected with STAT3-DN Expression Vector

HepG2 cells either stably transfected with an empty expression vector (lanes 1–3) or the pcDNA3-STAT3{Delta}Y705F/FLAG expression vector (lanes 4–6) were serum starved (media supplemented with 0.5% BSA, wt/vol) 24 h before and during stimulation with IL-6 (8 ng/ml) for the indicated times. Top, Autoradiogram after hybridization with hAGT cDNA probe. Bottom, Exposure after hybridization with 18S internal control. For each time point hAGT signal was normalized to 18S signal after exposure to a PhosphorImager cassette. Relative to unstimulated cells, normalized hAGT RNA increases 2.4 ± 0.2* at 72 h, and 3.5 ± 0.4* at 96 h in cells stably transfected with an empty expression vector and 1.2 ± 0.1 at 72 h, and 1.5 ± 0.1 at 96 in cells stably expressing STAT3{Delta}Y705F/FLAG (mean ± SD of two experiments). * Indicates significant difference from unstimulated cells (P < 0.05, Student’s t test).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interest in the regulation of the hAGT gene has intensified as a result of its linkage to essential hypertension (2). In certain hAGT allelotypes, overexpression of hAGT may lead to increased RAS tone and hypertension. Of particular interest are studies implicating base pair changes in the promoter with increased expression of hAGT (7). In patients homozygous for the hypertensive M235T allele, constitutive increases in AGT transcription activity are thought to produce an approximately 1.8-fold increase in circulating AGT concentrations and AII-dependent hypertension (2). This study is the first of its kind investigating the inducible regulation of the hAGT gene. Understanding the mechanisms for inducible AGT transcription regulation in the liver is important and biologically relevant as hepatocytes, which lack the capacity to store presynthesized proteins, translate and secrete proteins through constitutive pathways (3). In liver cells, therefore, transcription and secretion are coupled. Moreover, the liver represents the major organ controlling circulating levels of AGT (3). We have identified a 228-nt IL-6- inducible domain containing three cis-acting DNA elements that participate in IL-6- induced transcription of the hAGT gene in liver cells. Although specific inducible STAT1 and -3 binding occurs on hAPREs 1–3, they bind with various affinities and produce distinct functional activities. We believe that STAT3 primarily mediates inducible IL-6 hAGT gene expression because the high-affinity STAT3 binding site, hAPRE1, is the only bona fide IL-6-inducible enhancer and only STAT3-DN significantly reduces IL-6-induced reporter activity and endogenous gene expression. Finally, although others have shown that NF-IL6 binds to a region (-100 to -80 nt) in the hAGT promoter (13), our functional assays show that this region is neither required (Fig. 2DGo) nor sufficient (Fig. 2CGo) for IL-6 activation, nor does NF-IL6 interact with the IL-6 response elements (Fig. 4AGo). Together these data indicate hAGT is a class II acute-phase reactant activated through the JAK-STAT3 pathway.

Our observation on the regulation of the hAGT gene by IL-6 is in contrast to the well characterized regulation of the rodent AGT gene, a class I acute-phase reactant (3). The rodent AGT gene is IL-1 and TNF-{alpha} inducible through a potent nuclear factor-{kappa}B site (for review see Ref. 3). Our data (and that not shown) indicate that IL-6 is a potent stimulant of hAGT expression; whether IL-6-inducible hAGT expression can be further modified by class I inducers (IL-1 and TNF) will require exploration of doses and timing of their administration. Surprisingly, there is significant sequence divergence between species (14). Although the rodent AGT promoter contains a single STAT binding site 5'-TTCCTGGAAG-3' [-160 to -170 nt (26)], the human promoter has three response elements between -278 to -162 nt. Preliminary characterization of the rodent STAT-binding site indicates that this site binds STATs 3, 5, and 6 (26). The sequence and number of hAGT hAPRE sites diverge from their rodent counterpart and, although the latter binds STAT3, we do not detect STAT5 binding to any of the hAPREs. Thus functional and sequence divergence exists between the rodent and hAGT genes with regard to the number and binding preferences of STAT sites contained within their promoters.

The hAPREs contained within the hAGT promoter are homologous to other STAT binding sites in IL-6-inducible promoters including {alpha}2-macroglobulin (27), {alpha}1-antichymotrypsin (28), and hepatic serine protease inhibitor 2.1 (29). For these characterized promoters, two STAT-binding sites are found in close proximity (<160 bp) of the cap site and spaced close to one another (<20 bp). However, in contrast, the number of STAT binding sites in the hAGT promoter is unique in that three sites are present, are spaced far apart (>20 bp), and are further from the cap site (>160 bp).

In native promoters, STAT binding sites are frequently arranged in tandem as head-to-tail binding sites. This is significant because multimeric sites bind to STAT proteins in a cooperative fashion (30). In the mig gene, for example, neighboring weak STAT binding sites are required for a strong STAT binding site to confer interferon (IFN)-inducible transcription (31). In the hAGT promoter a strong STAT1/3 binding site (hAPRE1) is 5' to a weak STAT site (hAPRE2) upstream of a STAT1 preferring site (hAPRE3). The significance of head-to-tail organization is that cooperative STAT binding, mediated by the STAT NH2-terminus, occurs only in this arrangement (32). Our study does not address the issue of cooperative binding; however, the behavior of the hAPRE site mutations (Fig. 2EGo) indicates that these principles will probably apply to the hAGT promoter. We believe this explains the requirement of hAPRE3 in the context of the native hAGT promoter in IL-6 induction along with its inability to confer IL-6 induction by itself (compare Figs. 2Go and 6Go).

Our data indicate important functional distinctions between the hAPREs. hAPRE1, a high-affinity site for STAT1 and STAT3 binding, is able to confer IL-6 induction onto an inert promoter (Fig. 6AGo). By contrast, hAPRE3 preferentially binds STAT1 over STAT3 but is not independently IL-6 inducible. In combination with the ability of dominant negative STAT3 (but not STAT1) to block hAGT transcription (Fig. 7Go, D and E) and endogenous gene expression (Fig. 8Go), these data suggest that STAT3 primarily mediates IL-6-inducible hAGT transcription in HepG2 cells. Because hAPRE3 preferentially binds STAT1, it is not strongly activated by IL-6. In this regard, we note that the STAT1 -/- knockout mouse has an intact response to IL-6-like cytokines but not IFN-{gamma} (33), indicating that STAT1 is not required for IL-6 responsiveness. Analysis of STAT binding sites indicate that a crucial determinant of binding specificity is the half-site spacing (17). We propose that TT(N)5AA palindromic sites (such as hAPRE3) selectively bind STAT1 over STAT3.

Functional interactions have been reported between STAT3 and C/EBPß/NF-IL-6 (34, 35), NF-{kappa}B (36), AP-1 (34, 37), and the glucocorticoid receptor (38). Direct protein-protein interaction between STAT3 and other factors have been reported with c-Jun and the glucocorticoid receptor (38, 39). STAT1 has been shown to associate with members of the IRF-1 family and SP-1 (40, 41, 42). Thus, an alternative explanation for the lack of hAPRE3 induction when multimerized and placed upstream of the inert -46 hAGT/LUC promoter may be a loss of context with respect to other cooperating transcription factor binding sites present in the native hAGT promoter.

We have observed a biphasic profile of tyrosine-phosphorylated STAT1 and STAT3 in the nucleus both at early (15 and 30 min) and at later times (12, 24, 36, and 48 h, Fig. 5Go) in IL-6-stimulated HepG2 cells. We note that the biphasic presence of tyrosine- phosphorylated STATs in the nucleus is coincident with STAT binding to the hAPREs both at early and late time points (Fig. 3EGo), indicating that these forms are active in DNA binding. This study, to our knowledge, is the first of its kind to demonstrate IL-6-inducible STAT binding to an IL-6 response element (hAPRE1) at time points beyond 6 h; the mechanism underlying this biphasic profile will require further investigation. Our functional assays with both the -991/+22 hAGT/LUC and (hAPRE1)5LUC reporter plasmids show peak luciferase activity (24 through 48 h) at time points in which STAT binding to hAPREs is observed (Figs. 2BGo and 6BGo, respectively), indicating that this reporter assay mimics closely changes in the second peak in STAT binding. But what to make of the earlier STAT binding? Why isn’t luciferase activity induced earlier than 24 h? In this regard, we note that STAT1 and STAT3 have been shown to interact with the CBP/p300 class of coactivators (43), proteins that are known to have histone acetyltransferase (HAT) activity (44), an activity believed to mediate transcriptional activation by relaxing chromatin near the transcription start site (45). It is possible that HAT activity and promoter remodeling may play a role subsequent to this early STAT nuclear translocation and be rate limiting for transcription initiation. The role of chromatin structure in controlling constitutive or IL-6-inducible gene expression, however, will require additional investigation.

Recent investigation has revealed that there is very little monomeric STAT3 in the cytosol of unstimulated liver cells (46). Instead, the bulk of STAT3 (and STAT1, 5a, and 5b) is present in the cytosol as two high molecular mass complexes, one ranging in size from 200–400 kDa (statosome I) and the other from 1–2 MDa (statosome II) (46). After IL-6 stimulation, tyrosine-phosphorylated STAT3 was found to remain in the 200- to 400- kDa and 1- to 2-MDa complexes (46). Isolation of the IL-6-stimulated 200- to 400-kDa complex from the cytoplasm of Hep3B and rat liver cells revealed that it was DNA binding competent and formed the so-called SIF-A STAT3 homodimer (15) by EMSA analysis (46). Mass spectroscopy identified several proteins in the statosome complexes including the scaffolding protein GRP58/ER-60/Erp57 (46). These, as well as our own observation, reveal that the JAK/STAT signal transduction pathway is much more complex than previously believed and requires further investigation.

In summary, hAGT is a class II acute-phase reactant with a transcriptional activation mechanism mediated by nuclear translocation of STATs. The promoter of the hAGT differs from other class II acute-phase reactants in that it contains three STAT binding sites that appear to function in IL-6-mediated transcriptional activation and differ in their binding affinity for STAT3, the predominant mediator of AGT induction. Further investigation of hAGT gene regulation is necessary to identify modulators of class II acute-phase reactant signal transduction and better understand transcriptional activation initiated through this pathway. Potential targets for future hypertension therapy and inflammation control could evolve from this knowledge.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Treatment
The human hepatoblastoma cell-line HepG2 was obtained from ATCC(Manassas, VA) and grown in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% (vol/vol) heat-inactivated FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, penicillin/streptomycin, and 100 nM dexamethasone (Calbiochem, San Diego, CA) in dose response, time course, promoter deletion, and site-mutation studies described in Fig. 2Go. Cells were maintained in a humidified atmosphere of 5% CO2. For Northern, Western, and EMSA time course analysis, cells were serum starved in 0.5% (wt/vol) BSA (Sigma, St. Louis, MO) 24 h before and during stimulation with recombinant IL-6 (Calbiochem, San Diego, CA). Transient transfections were performed using LipofectAMINE PLUS (Life Technologies, Inc.) to introduce 1 µg luciferase reporter plasmid, 70 ng SV40-driven alkaline phosphatase, and 80 ng pRShGR{alpha} plasmid [a well described expression vector for the human {alpha}-glucocorticoid receptor (47)] per 60-mm plate (106 cells). Cells were stimulated with ligand 24 h (unless otherwise indicated) and then harvested to measure luciferase and alkaline phosphatase activities as previously described (22). Stable transfection of HepG2 cells was performed using LipofectAMINE PLUS (Life Technologies, Inc.) to introduce 3 µg of either an empty FLAG-tagged pcDNA3 (Invitrogen, Carlsbad, CA) expression plasmid or the pcDNA3-STAT3{Delta}Y705F/FLAG expression plasmid (described below) onto 100-mm culture dishes (108 cells). After 48 h, cells were cultured in 800 µg/ml G418-containing growth medium for 4 weeks with medium changes twice each week. Colonies were selected and screened for expression of FLAG-tagged STAT3{Delta}Y705F.

Plasmid Construction
The hAGT promoter driving a luciferase reporter was constructed by PCR using gene-specific primers, 5'-ATGTTTGGATCCTGGGTAATTTCATGTCTGC-3' (BamHI site underlined) and 5'-GCTGTAAAGCTTAGAACAACGGCAGCTTCTTCC-3' (HindIII site underlined). The 1,013-bp product was restricted with BamHI and HindIII and ligated into poLUC (48). 5'-Deletions were produced using the following primers: (BamHI site underlined): -648 hAGT: 5'-ATGCCTGGATCCTGAAGGCATTTTGTTTGT-3'; -493 hAGT: 5'-AGGGTAGGATCCTTGGAGCACCTGAAGGTC-3'; -350 hAGT: 5'-GGGGGTGGATCCCCCGGGGCTGGGTCAGAA-3'; -260 hAGT: 5'-AACCTTGGATCCGACTCCTGCAAACTTCGG-3'; -203 hAGT: 5'-TCACTCGGATCCGCAGTGAAACTCTGCATC-3'; -46 hAGT: 5'-ACAGCTGGATCCCCACCCCTCAGCTATAAA-3'. Products were restricted with BamHI/HindIII and subcloned into poLUC. 3'-Deletion constructs of -350/+22 hAGT/LUC were produced using the following primers (BglII site underlined): -122 hAGT: 5'-ACAGGCAGATCTGAAGGACAGATGCCA-3'; -201 hAGT: 5'-CTTTCAGATCTGAACAGAGTGAGCC-3'; -261 hAGT: 5'-TTGCAGAGATCTGGGCCAAGGTTCCCAG-3'; -288 hAGT: 5'-GAAACGAGATCTTCTCCCTAGGTGTGTG-3'. Products were restricted with BamHI/BglII, gel purified, and subcloned into BamHI-linearized -46/+22 hAGT/LUC. Site-directed mutagenesis of the hAPREs was performed using PCR SOEING (splicing by overlap extension) (49) with mutagenic primers (mutations underlined): 5'-TGCTCCCGTGGATGGGCCCTTGGCCCCGACTC-3' and 5'-GCCAAGGGGCCCATCCACGGAGCATCTCC-3' (hAPRE1); 5'-TGCAAACGGAGGGCCCTGTGTAACTCGACC-3' and 5'-TACACAGGGCCCTCCGTTTGCAGGAGTCGG-3' (hAPRE2); 5'-CTAAGACGGACTGGCCGAGGTCCCAGCGTG-3' and 5'-GGACCTCGGCCAGTCCGTCGTCTTAGTGATCGATGC-3' (hAPRE3). Products were subcloned into the poLUC vector. The multimerized hAPRE1 constructs were produced by annealing oligonucleotides 5'-GATCCTCCCGTTTCTGGGAACCTTGGA-3' (sense) and 5'GAGGGCAAAGACCCTTGGAACCTCTAG-3' (antisense). These duplex oligonucleotides were phosphorylated, ligated, and gel purified. The eluted fragments were ligated into BamHI-linearized -46/+22 hAGT/LUC. Multimerization of hAPREs 2 and 3 also employed this methodology using 5'-GATCCGCAAACTTCGGTTAAATGTGTAA-3' and 5'-GATCTTACACATTTACCGAAGTTTGCG-3' (hAPRE2); 5'-GATCCTAAGCTTCCTGGAAGAGGTCCA-3' and 5'-GATCTGGACCTCTTCCAGGAAGCTTAG-3' (APRE3).

The human STAT3 expression plasmid was constructed using RT-PCR and gene-specific primers: 5'-GGATCCGCCCAATGGAATCAGCTAC-3' and 5'-AAGCTTTCACATGGGGGAGGTAGCGCAC-3' (BamHI and HindIII sites underlined) in RT-PCR using HepG2 RNA as template. The PCR product was digested with BamHI/HindIII, gel purified, and ligated into a modified pcDNA3 expression vector (pcDNA3-FLAG) digested with BamHI and HindIII producing the plasmid pcDNA3-STAT3/FLAG. The plasmid pcDNA3-FLAG was constructed by ligating a duplex oligonucleotide obtained by annealing the sequence, 5'-AAGCTCGTCTACCATGGACTACAAAGACGATGACGATAAGGGATCCAAGGAAAA GCTTGATATCTCTAGA-3' with the sequence 5'-TCTAGAGATATCAAGCTTTTCCTTGGA TCCCTTATCGTCATCGTCTTTGTAGTCCATGGTAGACGAGCTT -3' between the HindIII and XbaI sites of pcDNA3 (Invitrogen). This sequence encodes an ATG initiation codon (underlined) and the FLAG epitope. Site-directed mutagenesis of the STAT3 cDNA sequence at a tyrosine residue (codon 705) required for IL-6 activation (20) was performed using PCR SOEING (49) with mutagenic primers (mutations underlined): 5'-GCGCTGCCCCATTCCTGAAGACCAAG-3' and 5'-CTTGGTCTTCAGGAATGGGGCAGCGC-3' using pcDNA3-STAT3/FLAG as the template to produce the FLAG-tagged expression plasmid pcDNA3-STAT3{Delta}Y705F/FLAG.

The truncated human STAT3 expression plasmid was constructed using PCR and gene- specific primers: 5'-GGATCCGCCCAATGGAATCAGCTAC-3' and 5'- AAGCTTTCATGGTGTCACACAGATAAACTTGGTC-3' (BamHI and HindIII sites underlined; stop codon in bold italics) using pcDNA3-STAT3/FLAG as the template. The PCR product was digested with Bam/HindIII, gel purified, and ligated into the modified pcDNA3 expression vector (pcDNA3-FLAG) digested with BamHI and HindIII, producing the plasmid pcDNA3-STAT3{Delta}TA/FLAG. This 55-residue C-terminal truncation (stop codon at residue 715) eliminates the transactivation domain of STAT3, giving it a sequence similar to endogenous STAT3ß (23).

The human STAT1 dominant negative expression plasmid was constructed using PCR and gene-specific primers: 5'-GGTTATGGGCTCTCAGTGGTACGAACTTCAGCAG-3' and 5'-TACTGTGTTCATCATACTGTCGAATTC-3' using pcDNA3m~Stat1 (21) as template. The PCR product was cloned into the pEF6/V5-His TOPO vector (Invitrogen) producing the V5-epitope-tagged expression vector pEF6-STAT1/V5-His. Site-directed mutagenesis of the STAT1 cDNA sequence at a tyrosine residue (codon 701) required for IL-6 activation (19) was performed using PCR SOEING (49) with mutagenic primers (mutations underlined): 5'-GAACTGGATTTATCAAGACTGA-3' and 5'-GTCTTGATAAATCCAGTTCCTTTAGGG-3' using pEF6-STAT1/V5-His as the template to produce the V5-epitope-tagged expression vector pEF6-STAT1{Delta}Y701F/V5-His.

The truncated human STAT1 expression plasmid was constructed using PCR and gene-specific primers: 5'-GGTTATGGGCTCTCAGTGGTACGAACTTCAGCAG-3' and 5'-AAGCTTTTAAACTTCAGACACAGAAATC-3' (stop codon in bold italics) using pcDNA3m~Stat1 as the template. The PCR product was TA cloned into the pEF6/V5-His TOPO vector (Invitrogen) producing the expression vector pEF6-STAT1{Delta}TA. This 38-residue C-terminal truncation (stop codon at residue 713) eliminated the transactivation domain of STAT1, giving it a sequence similar to endogenous STAT1ß (21).

Immunoaffinity Isolation of Transfected HepG2 cells on Magnetic Beads
To isolate a homogenous population of transiently transfected cells, HepG2 cells were transfected by electroporation (to increase the number of transient transfectants). Briefly, logarithmically growing cells were trypsinized, washed in Ca2+/Mg2+-free PBS, and resuspended at a density of 2 x 107 cells/250 µl volume in an 0.4-cm electroporation cuvette (Bio-Rad Laboratories, Inc., Hercules, CA). The following types and amounts of supercoiled plasmid DNA were then added to the cuvettes: 35 µg of (hAPRE1-WT)5LUC, 5 µg plasmid CMV.IL2R encoding the IL-2 receptor, and either 10 µg of pcDNA3-STAT{Delta}3Y705F/FLAG expression plasmid or 10 µg of pEF6-STAT1{Delta}Y701F/V5-His expression plasmid or 10 µg of an empty pcDNA3/FLAG or pEF6/V5-His TOPO expression plasmid. This same strategy was employed for the studies involving the pcDNA3-STAT3{Delta}TA/FLAG and pEF6-STAT1{Delta}TA expression plasmids. Cells were incubated on ice for 15 min and electroporated at 960 µF, 250 V. The cells were incubated on ice for an additional 15 min and plated on prewarmed growth medium. Cells were cultured for 48 h after transfection with daily changes of medium and then harvested for cytoplasmic proteins.

For immunoaffinity isolation of transiently transfected cell populations, minor modifications of published protocols were used (50, 51). Transfected cells were washed twice with cold PBS and incubated for 30 min at 4 C with 1 µg of antihuman CD25 monoclonal antibody (Caltag Laboratories, Inc. Burlingame, CA) in 8 ml of PBS/0.01%BSA. After this incubation, cells were washed twice with PBS, and 25 µl of a slurry of goat antimouse IgG-conjugated magnetic beads (Dynabeads, M-450, DynAl, Great Neck, NY) were added to 8 ml of PBS/0.01%BSA. After incubation for 30 min at 4 C, cells were washed, trypsinized, and captured on a magnetic stand in Eppendorf tubes. The method has been previously shown in our laboratory to yield homogenous transfected cell populations for assay (22).

Sucrose Density-Purified Nuclear Extracts
For the purification of nuclear proteins, unstimulated or IL-6-stimulated (8 ng/ml; 15 min unless otherwise indicated) HepG2 cells were resuspended in Buffer A [50 mM HEPES (pH 7.4), 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol (DTT), 0.1 µg/ml phenylmethylsulfonyl fluoride (PMSF), 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, 10 µg/ml aprotinin, 20 mM NaF, 1 mM NaP207, 1 mM Na3VO3, and 0.5% NP-40]. After 10 min on ice, the lysates were centrifuged at 4,000 x g for 4 min at 4 C. The supernatant was saved as the cytoplasmic fraction. The nuclear pellet was then resuspended in Buffer B (Buffer A with 1.7 M sucrose), and centrifuged at 15,000 x g for 30 min at 4 C (52). The purified nuclear pellet was then incubated in Buffer C [10% glycerol, 50 mM HEPES (pH 7.4), 400 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.1 µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, 20 mM NaF, 1 mM NaP207, 1 mM Na3VO3, and 10 µg/ml aprotinin] with frequent vortexing for 30 min at 4 C. After centrifugation at 15,000 x g for 5 min at 4 C, the supernatant was saved as nuclear extract. Both the cytoplasmic and nuclear fractions were normalized for protein amounts determined by protein assay (Protein Reagent; Bio-Rad Laboratories, Inc.).

Microaffinity Purification
Duplex oligonucleotides corresponding to the three hAPREs are listed below.

hAPRE1-WT: GATCCTCCCGTTTCTGGGAACCTTGGA GAGGGCAAAGACCCTTGGAACCTCTAG

hAPRE2-WT: GATCCGCAAACTTCGGTAAATGTGTAA GCGTTTGAAGCCATTTACACATTCTAG

hAPRE3-WT: GATCCTAAGACTTCCTGGAAGAGGTCCA GATTCTGAAGGACCTTCTCCAGGTCTAG

hAPRE1-{Delta}: GATCCTCCCGTGGATGGGCCCCTTGGA GAGGGCACCTACCCGGGGAACCTCTAG

hAPRE2-{Delta}: GATCCGCAAACGGAGGGCCCTGTGTAA GCGTTTGCCTCCCGGGACACATTCTAG

hAPRE3-{Delta}: GATCCTAAGACGGACTGGCCGAGGTCCA GATTCTGCCTGACCGGCTCCAGGTCTAG

Underlines indicate purine-to-noncomplementary-pyrimidine substitutions. Microaffinity purification of hAPRE binding proteins was performed using chemically synthesized hAPRE wild-type (WT) oligonucleotides containing 5' biotin (Bt) on a flexible linker (Genosys, The Woodlands, TX). Forty picomoles of duplex Bt-hAPRE-WT were incubated with 1 mg of control or IL-6-treated (8 ng/ml; 15 min) HepG2 nuclear extracts in the presence of 10 µg of poly(dIdC) in a 1,000 µl volume of binding buffer [containing 8% (vol/vol) glycerol, 5 mM MgCl2, 1 mM DTT, 100 mM KCL, 1 mM EDTA, and 12 mM HEPES (pH 7.9)] for 20 min at 25 C. Binding reactions were then centrifuged at 13,000 rpm for 5 min at 25 C. Supernatants were aliquoted into fresh microfuge tubes and binding proteins were captured by the addition of 50 µl of a 50% (vol/vol) slurry of streptavidin-agarose beads (Pierce Chemical Co., Rockford, IL) for 5 min at 25 C with mixing. Beads were pelleted by centrifugation at 5,000 rpm for 2 min at 25 C and washed two times in binding buffer. hAPRE-binding proteins were then eluted with 1x SDS-PAGE loading buffer for Western immunoblot analysis. For competition, a 2.5-fold excess of nonbiotinylated wild-type or mutant (hAPRE-{Delta}) oligonucleotide was included in the initial binding reaction. Inclusion of a reaction that contained no biotinylated DNA in the initial binding reaction controlled for nonspecific binding of protein to the streptavidin-agarose beads.

EMSA
Nuclear extracts from unstimulated and IL-6 stimulated HepG2 cells were prepared as described above. Nuclear proteins were bound to the radiolabeled duplex oligonucleotides given above (see Microaffinity Purification). High-affinity SIE m67 was prepared by annealing 5'-GATCCGTCGACATTTCCCGTAAATCA-3' and 5'-GATCTGATTTACGGGAAATGTCGACG-3'. Oligonucleotides were radiolabeled using the large fragment (Klenow) of DNA polymerase, dNTP-dA, and {alpha}32P-dATP. DNA binding reactions using either mutant or wild-type hAPRE1–3 contained 30 µg nuclear protein, 8% (vol/vol) glycerol, 5 mM MgCl2, 1 mM DTT, 100 mM KCl, 1 mM EDTA, 2 µg of poly(dI-dC), 12 mM HEPES (pH 7.9), and 40,000 cpm of 32P-labeled double-stranded oligonucleotide in a total volume of 20 µl. The nuclear proteins were incubated with the probe for 15 min at room temperature and then fractionated by 5% nondenaturing PAGE in 0.5x TBE buffer (45.5 mM Tris-HCL, 45.5 mM boric acid, 1.0 mM EDTA, pH 8.0). Antibody supershift assays were performed by adding 5 µg of affinity-purified normal rabbit IgG (sc-2027), anti-STAT1 (sc-345X), or anti-STAT3 (sc-482X) to the binding reaction. All of the antibodies used for supershift analysis were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). After incubation for 1 h on ice, the binding reactions were electrophoresed on a native 5% PAGE gel as described above. After electrophoretic separation, gels were dried and exposed for autoradiography using X-AR film (Eastman Kodak Co., Rochester, NY) at -70 C using intensifying screens.

Western Immunoblots
Proteins were fractionated by SDS-PAGE (10% polyacrylamide) and transferred to polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA). Membranes were blocked in 8% Carnation evaporated milk and immunoblotted with commercially available antibodies. Affinity-purified rabbit polyclonal antibodies used in this study were: anti-STAT 1 (sc-345, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and anti-STAT 3 (sc-493, Santa Cruz Biotechnology, Inc.), anti-STAT5 (sc-836, Santa Cruz Biotechnology, Inc., specific for STAT5a and b), and anti-NF-IL6 [produced in our laboratory (53)]. Affinity-purified mouse monoclonal antibodies used in this study were: antiphosphotyrosine (4G10; Upstate Biotechnology, Inc. Lake Placid, NY), antiphosphotyrosine-STAT1 (sc-8394, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), antiphosphotyrosine-STAT3 (sc-8059, Santa Cruz Biotechnology, Inc.), anti-FLAG M2-peroxidase (A-8592, Sigma), anti-V5 antibody (Invitrogen) and anti-ß-actin (Sigma). Immune complexes were detected by binding donkey antirabbit IgG or sheep antimouse IgG, each conjugated to horseradish peroxidase (Pierce Chemical Co., Rockford, IL), followed by reaction in the enhanced chemiluminescence assay (ECL, Amersham International, Arlington Heights, IL) according to the manufacturer’s recommendations. Anti-FLAG M2-peroxidase and anti-V5 antibody both had horseradish peroxidase directly conjugated to them; thus immune complexes were detected using enhanced chemiluminescence without incubation with antimouse IgG.

Northern Blots
Five micrograms of total cellular RNA were extracted from HepG2 cells using acid guanidium/phenol extraction (RNAZOL B, Tel-Test, Friendswood, TX), fractionated by electrophoresis on a 1% agarose-formaldehyde gel, capillary transferred to a nylon membrane (Hybond, Amersham Pharmacia Biotech, Buckinghamshire, UK), and prehybridized for 4 h in hybridization buffer (0.5 M sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA, 1% BSA) at 65 C. The membrane was then hybridized using a body-labeled cDNA probe generated by PCR using hAGT cDNA specific primers (sense, 5'-AAAGGCCAATGCCGGGAAGC-3'; antisense, 5'-TGTGAAGTCCAGAGAGCGTG-3') and template plasmid containing the hAGT cDNA sequence. The membrane was hybridized with 1 x 106 cpm 32P-labeled hAGT cDNA probe per ml overnight in the same buffer, washed three times (20 min each) with 1% SDS-containing phosphate buffer at 65 C, and exposed to X-AR film for 24–48 h. For the 18S RNA hybridization, the same membrane was reprobed with 32P-labeled human 18S cDNA and briefly exposed. Bands in the autoradiogram were quantitated by exposure to a Phosphorimager (Molecular Dynamics, Inc., Sunnyvale, CA) cassette. 18S signal was used to normalized hAGT signal controlling for differences in loading and transfer.


    ACKNOWLEDGMENTS
 
The authors wish to thank Michael Holtzman for the pcDNA3m~Stat1 vector.


    FOOTNOTES
 
Address requests for reprints to: Dr. Allan R. Brasier, Division of Endocrinology, MRB 8.138, University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-1060. E-mail: arbrasie{at}utmb.edu

This work was supported in part by National Heart, Lung, and Blood Institute Grant 55630 (to A.R.B.), an American Heart Association (AHA) Grant in Aid (9950345N) and National Institute of Environmental Health Sciences Grant ES06676 (R.S. Lloyd, University of Texas Medical Branch). A.R.B. is an Established Investigator of the AHA. C.T.S. is supported by The James W. McLaughlin Fellowship Fund.

Received for publication March 23, 2000. Revision received November 30, 2000. Accepted for publication December 4, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. American Heart Association 2000 2001 Heart and Stroke Statistical Update. American Heart Association, Dallas, TX
  2. Corvol P, Jeunemaitre X 1997 Molecular genetics of human hypertension: role of angiotensinogen. Endocr Rev 18:662–677[Abstract/Free Full Text]
  3. Brasier AR, Li J 1996 Mechanisms for inducible control of angiotensinogen gene transcription. J Hypertens 27:465–475
  4. Reid IA, Morris BJ, Ganong WG 1978 The renin-angiotensin system. Annu Rev Physiol 40:377–410[CrossRef][Medline]
  5. Nibu Y, Takahashi S, Tanimoto K, Murakami K, Fukamizu A 1994 Identification of cell type-dependent enhancer core element located in the 3'downstream region of the human angiotensinogen gene. J Biol Chem 269:28598–28605[Abstract/Free Full Text]
  6. Yanai K, Saito T, Hirota K, Kobayashi H, Murakami K, Fukamizu A 1997 Molecular variation of the human angiotensinogen core promoter element located between the TATA box and transcription initiation site affects its transcriptional activity. J Biol Chem 272:30558–30562[Abstract/Free Full Text]
  7. Inoue I, Nakajima T, Williams CS, Quackenbush J, Puryear R, Powers M, Cheng T, Ludwig WH, Sharma AM, Harta A, Jeunemaitre X, Lalouel JM 1997 A nucleotide substitution in the promoter of human angiotensinogen is associated with essential hypertension and affects basal transcription in vitro. J Clin Invest 99:1786–1797[Medline]
  8. Brasier AR, Youqi H, Sherman C 1999 Transcriptional regulation of angiotensinogen gene expression. Vitam Horm 57:217–247[Medline]
  9. Doolittle RF 1983 Angiotensinogen is related to the antitrypsin-antithrombin-ovalbumin family. Science 222:417–419[Abstract/Free Full Text]
  10. Akira S, Nishio Y, Tanaka T, Inoue H, Matsusaka T, Wang X-J, Wei S, Yoshida N, Kishimoto T 1995 Transcription factors NF-IL6 and APRF involved in gp130-mediated signalling pathway. Ann NY Acad Sci 762:12–28
  11. Kishimoto T, Akira S, Narazaki M, Taga T 1995 Interleukin-6 family of cytokines and gp130. Blood 86:1243–1254[Free Full Text]
  12. Ihle JN 1996 STATs: signal transducers and activators of transcription. Cell 84:331–334[CrossRef][Medline]
  13. Narayanan CS, Cui Y, Kumar A 1998 DBP binds to the proximal promoter and regulates liver-specific expression of the human angiotensinogen gene. Biochem Biophys Res Commun 251:388–393[CrossRef][Medline]
  14. Gaillard I, Clauser E, Corvol P 1989 Structure of human angiotensinogen gene. DNA 8:87–99[Medline]
  15. Zhong Z, Wen Z, Darnell Jr JE 1994 Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264:95–98[Abstract/Free Full Text]
  16. Hattori M, Abraham LJ, Northemann W, Fey GH 1990 Acute-phase reaction induces a specific complex between hepatic nuclear proteins and the interleukin 6 response element of the rat {alpha}2-macroglobulin gene. Proc Natl Acad Sci USA 87:2364–2368[Abstract/Free Full Text]
  17. Seidel HM, Milocco LH, Lamb P, Darnell Jr JE, Stein RB, Rosen J 1995 Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc Natl Acad Sci USA 92:3041–3045[Abstract/Free Full Text]
  18. Shuai K, Darnell Jr JE, Gilman MZ 1993 A common nuclear signal transduction pathway activated by growth factor cytokine receptors. Science 261:1739–1744[Abstract/Free Full Text]
  19. Shuai K, Stark GR, Kerr IM, Darnell Jr JE 1993 A single phospotyrosine residue of Stat91 required for gene activation by interferon-{gamma}. Science 261:1744–1746[Abstract/Free Full Text]
  20. Kaptein R, Paillard J, Saunders M 1996 Dominant negative Stat3 mutant inhibits interleukin-6-induced Jak-STAT signal transduction. J Biol Chem 271:5961–5964[Abstract/Free Full Text]
  21. Walter MJ, Look DC, Tidwell RM, Roswit WT, Holtzman MJ 1997 Targeted inhibition of interferon-{gamma} -dependent intercellular adhesion molecule-1 (ICAM-1) expression using dominant-negative Stat1. J Biol Chem 272:28582–28589[Abstract/Free Full Text]
  22. Jamaluddin M, Meng T, Sun J, Bolodogh I, Han Y, Brasier AR 2000 Angiotensin II induces nuclear factor (NF)-{kappa} B1 isoforms to bind the angiotensinogen gene acute-phase response element: a stimulus-specific pathway for NF-{kappa} B activation. Mol Endocrinol 14:99–113[Abstract/Free Full Text]
  23. Caldenhoven E, van Dijk TB, Solari R, Armstrong J, Raaijmakers JAM, Lammers J-WJ, Koenderman L, de Groot RP 1996 STAT3ß, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J Biol Chem 271:13221–13227[Abstract/Free Full Text]
  24. Gerhartz C, Heesel B, Sasse J, Hemmann U, Landgraf C, Schneider-Mergener J, Orn F, Einrich PC, Graeve L 1996 Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. J Biol Chem 271:12991–12998[Abstract/Free Full Text]
  25. Hemmann U, Gerhartz C, Heesel B, Sasse J, Kurapkat G, Grotzinger J, Wollmer A, Zhong Z, Darnell Jr JE, Graeve L, Heinrich PC, Horn F 1996 Differential activation of acute phase response factor/Stat3 and Stat1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. II. Src homology SH2 domains define the specificity of stat factor activation. J Biol Chem 271:12999–13007[Abstract/Free Full Text]
  26. Mascareno E, Dhar M, Siddiqui MAQ 1998 Signal transduction and activator of transcription (STAT) protein-dependent activation of angiotensinogen promoter: a cellular signal for hypertrophy in cardiac muscle. Proc Natl Acad Sci USA 95:5594
  27. Wegenka UM, Buschmann J, Lutticken C, Heinrich PC, Horn F 1993 Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level. Mol Cell Biol 13:276–288[Abstract/Free Full Text]
  28. Kordula T, Rydel RE, Brigham EF, Horn F, Heinrich PC, Travis J 1998 Oncostatin M and the interleukin-6 and soluble interleukin-6 receptor complex regulate {alpha}1-antichymotrypsin expression in human cortical astrocytes. J Biol Chem 273:4112–4118[Abstract/Free Full Text]
  29. Begad PL, Shih HM, Towle HC, Schwarzenberg SJ, Berry SA 1995 Growth hormone induction of hepatic serine protease inhibitor 2.1 transcription is mediated by a STAT5-related factor binding synergistically to two {gamma}-activated sites. J Biol Chem 27:24903–24910
  30. Xu X, Sun Y-L, Hoey T 1996 Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain. Science 273:794–797[Abstract]
  31. Guyer NB, Severns CW, Wong P, Feghali CA, Wright TM 1995 IFN-{gamma} induces a p91/STAT1{alpha}-related transcription factor with distinct activation and binding properties. J Immunol 155:3472–3480[Abstract]
  32. Vinkemeier U, Cohen SJ, Moarefi I, Chait BT, Kuriyan J, Darnell Jr JE 1996 DNA binding of in vitro activated Stat1{alpha}, Stat1ß and truncated Stat1: interaction between NH2 -terminal domains stabilizes binding of two dimers to tandem DNA sites. EMBO J 15:5616–5626[Medline]
  33. Meraz MA, White JM, Sheehan KC, Bach EA, Rodig SJ, Dighe AS, Kaplan DH, Riley JK, Greenlund AC, Campbell D, Carver-Moore K, DuBois RN, Clark R, Aguet M, and Schreiber RD 1996 Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signalling pathway. Cell 84:431–442[CrossRef][Medline]
  34. Schumann RR, Kirschning CJ, Unbehaun A, Aberle H, Knoff H-P, Lamping N, Ulevitch RJ, Herrmann F 1999 The lipopolysaccharide-binding protein is a secretory class 1 acute-phase protein whose gene is transcriptionally activated by APRF/STAT3 and other cytokine-inducible nuclear proteins. Mol Cell Biol 16:3490–3503.7[Abstract]
  35. Stephanou A, Isenberg DA, Akira S, Kishimoto T, Latchman DS 1998 The nuclear factor interleukin-6 (NF-IL6) and signal transducer and activator of transcription-3 (STAT-3) signalling pathways co-operate to mediate the activation of the hsp90ß gene by interleukin-6 but have opposite effects on its inducibility by heat shock. Biochem J 330:189–195
  36. Brown RT, Ades IZ, Nordan RP 1995 An acute phase response factor/NF-{kappa} B site downstream of the junB gene that mediates responsiveness to interleukin-6 in a murine plasmacytoma. J Biol Chem 270:31129–31135[Abstract/Free Full Text]
  37. Bugno M, Graeve L, Gatsios P, Koj A, Heinrich PC, Travis J, Kordula T 1995 Identification of the interleukin-6/oncostatin M response element in the rat tissue inhibitor of metalloproteinases-1 (TIMP-1) promoter. Nucleic Acids Res 23:5041–5047[Abstract/Free Full Text]
  38. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM 1997 STAT3 Acts as a Co-activator of glucocorticoid receptor signaling. J Biol Chem 272:30607–30610[Abstract/Free Full Text]
  39. Schaefer TS, Sanders LK, D. Nathans D 1995 Cooperative transcriptional activity of Jun and Stat3ß, a short form of Stat3. Proc Natl Acad Sci USA 92:9097–9101[Abstract/Free Full Text]
  40. Fu X-Y, Schindler C, Improta T, Aebersold R, Darnell Jr JE 1992 The proteins of ISGF-3, the interferon {alpha}-induced transcriptional activator, define a gene femily involved in signal transduction. Proc Natl Acad Sci USA 89:7840–7843[Abstract/Free Full Text]
  41. Horvath CM, Stark GR, Kerr IM, Darnell Jr JE 1996 Interaction between STAT and non-STAT proteins in the interferon-stimulated gene factor 3 transcription complex. Mol Cell Biol 16:6957–6964[Abstract]
  42. Look DC, Pelletier MR, Tidwell RM, Roswit WT, Holtzman MJ 1995 STAT1 depends on transcriptional synergy with Sp1. J Biol Chem 270:30264–30267[Abstract/Free Full Text]
  43. Zhang JJ, Vinkemeier U, Gu W, Hakravarti D, Horvath CM, Darnell Jr JE 1996 Two contact regions between Stat1 and CBP/p300 in interferon {gamma} signaling. Proc Natl Acad Sci USA 93:15092–15096[Abstract/Free Full Text]
  44. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  45. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai M-J, O’Malley BW 1999 Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69:3–12[CrossRef][Medline]
  46. Ndubuisi MI, Guo GG, Fried VA, Etlinger JD, Sehgal PB 1999 Cellular physiology of STAT3: where’s the cytoplasmic monomer? J Biol Chem 274:25499–25509[Abstract/Free Full Text]
  47. Giguere V, Hollenberg SM, Rosenfeld MG, Evans RM 1986 Functional domains of the human glucocorticoid receptor. Cell 46:645–652[CrossRef][Medline]
  48. Brasier AR 1990 Reporter system using firefly luciferase. In: Ausubel FM (ed) Current Protocols in Molecular Biology. John Wiley & Sons, New York, pp 9.6.10–9.6.13
  49. Horton RM, Cai Z, Ho SN, Pease LR 1990 Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8:528–535[Medline]
  50. Smith CL, Htun H, Wolford RG, Hagers GL 1997 Differential activity of progesterone and glucocorticoid receptors on mouse mammary tumor virus templates differing in chromatin structure. J Biol Chem 272:14227–14235[Abstract/Free Full Text]
  51. Padmanabhan R, Padmanabhan R, Howard T, Gottesman MM, Howard BH 1993 Magnetic affinity cell sorting to isolate transiently transfected cells, multidrug-resistant cells, somatic cell hybrids and virally infected cells. Methods Enzymol 218:637–651[Medline]
  52. Han Y, Brasier AR 1997 Mechanism for biphasic Rel A:NF-{kappa} B1 nuclear translocation in tumor necrosis factor {alpha}-stimulated hepatocytes. J Biol Chem 272:9823–9830
  53. Jamaluddin M, Garofalo R, Ogra PL, Brasier AR 1996 Inducible translational regulation of the NF-IL6 transcription factor by respiratory syncytial virus infection in pulmonary epithelial cells. J Virol 70:1554–1563[Abstract]



This article has been cited by other articles:


Home page
FASEB J.Home page
A. Abdul-Hafez, R. Shu, and B. D. Uhal
JunD and HIF-1{alpha} mediate transcriptional activation of angiotensinogen by TGF-{beta}1 in human lung fibroblasts
FASEB J, June 1, 2009; 23(6): 1655 - 1662.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Jain, G. Vinukonda, S. N. Fiering, and A. Kumar
A haplotype of human angiotensinogen gene containing -217A increases blood pressure in transgenic mice compared with -217G
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1849 - R1857.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Ray, C. Lee, T. Hou, I. Boldogh, and A. R. Brasier
Requirement of histone deacetylase1 (HDAC1) in signal transducer and activator of transcription 3 (STAT3) nucleocytoplasmic distribution
Nucleic Acids Res., August 1, 2008; 36(13): 4510 - 4520.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Satou, R. A. Gonzalez-Villalobos, K. Miyata, N. Ohashi, A. Katsurada, L. G. Navar, and H. Kobori
Costimulation with angiotensin II and interleukin 6 augments angiotensinogen expression in cultured human renal proximal tubular cells
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F283 - F289.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hou, S. Ray, and A. R. Brasier
The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression
J. Biol. Chem., December 21, 2007; 282(51): 37091 - 37102.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Jain, Y. Li, S. Patil, and A. Kumar
HNF-1{alpha} plays an important role in IL-6-induced expression of the human angiotensinogen gene
Am J Physiol Cell Physiol, July 1, 2007; 293(1): C401 - C410.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Jamaluddin, S. Choudhary, S. Wang, A. Casola, R. Huda, R. P. Garofalo, S. Ray, and A. R. Brasier
Respiratory Syncytial Virus-Inducible BCL-3 Expression Antagonizes the STAT/IRF and NF-{kappa}B Signaling Pathways by Inducing Histone Deacetylase 1 Recruitment to the Interleukin-8 Promoter
J. Virol., December 15, 2005; 79(24): 15302 - 15313.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Choudhary, S. Boldogh, R. Garofalo, M. Jamaluddin, and A. R. Brasier
Respiratory Syncytial Virus Influences NF-{kappa}B-Dependent Gene Expression through a Novel Pathway Involving MAP3K14/NIK Expression and Nuclear Complex Formation with NF-{kappa}B2
J. Virol., July 15, 2005; 79(14): 8948 - 8959.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Proietti, M. Salatino, C. Rosemblit, R. Carnevale, A. Pecci, A. R. Kornblihtt, A. A. Molinolo, I. Frahm, E. H. Charreau, R. Schillaci, et al.
Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells
Mol. Cell. Biol., June 15, 2005; 25(12): 4826 - 4840.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Schick, E. J. Oakeley, N. E. Hynes, and A. Badache
TEL/ETV6 Is a Signal Transducer and Activator of Transcription 3 (Stat3)-induced Repressor of Stat3 Activity
J. Biol. Chem., September 10, 2004; 279(37): 38787 - 38796.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Guo, E. Mascareno, and M. A. Q. Siddiqui
Distinct Components of Janus Kinase/Signal Transducer and Activator of Transcription Signaling Pathway Mediate the Regulation of Systemic and Tissue Localized Renin-Angiotensin System
Mol. Endocrinol., April 1, 2004; 18(4): 1033 - 1041.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Zhang, M. Jamaluddin, S. Wang, B. Tian, R. P. Garofalo, A. Casola, and A. R. Brasier
Ribavirin Treatment Up-Regulates Antiviral Gene Expression via the Interferon-Stimulated Response Element in Respiratory Syncytial Virus-Infected Epithelial Cells
J. Virol., May 15, 2003; 77(10): 5933 - 5947.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X. Li, H. Zhang, V. Soledad-Conrad, J. Zhuang, and B. D. Uhal
Bleomycin-induced apoptosis of alveolar epithelial cells requires angiotensin synthesis de novo
Am J Physiol Lung Cell Mol Physiol, March 1, 2003; 284(3): L501 - L507.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. R. Brasier, A. Recinos III, and M. S. Eledrisi
Vascular Inflammation and the Renin-Angiotensin System
Arterioscler Thromb Vasc Biol, August 1, 2002; 22(8): 1257 - 1266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Ray, C. T. Sherman, M. Lu, and A. R. Brasier
Angiotensinogen Gene Expression Is Dependent on Signal Transducer and Activator of Transcription 3-Mediated p300/cAMP Response Element Binding Protein-Binding Protein Coactivator Recruitment and Histone Acetyltransferase Activity
Mol. Endocrinol., April 1, 2002; 16(4): 824 - 836.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sherman, C. T.
Right arrow Articles by Brasier, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sherman, C. T.
Right arrow Articles by Brasier, A. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals