| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Internal Medicine Sealy Center for Molecular Sciences and Human Biological Chemistry and Genetics The University of Texas Medical Branch Galveston, Texas 77555-1060
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Probably arising as a gene duplication event in the serine protease
inhibitor gene family that includes
1-antitrypsin (9), the AGT gene
retains regulatory features of these acute-phase reactants (3). The
hepatic acute-phase response is a switch in secretory protein
transcription in the vertebrate liver in response to systemic
inflammation (3). Acute-phase reactants have been divided into two
subclasses based on the activators for their expression (10). Class I
acute-phase proteins (mouse serum amyloid A, complement, and the rodent
homolog of AGT) are dependent on the IL-1-like cytokines [IL-1
and
ß, tumor necrosis factor (TNF)-
and ß]. By contrast, class II
acute-phase reactants (fibrinogen, human haptoglobin, and rat
2-macroglobulin) are regulated by interleukin
6 (IL-6)-like cytokines [IL-6, leukemia-inhibitory factor (LIF),
IL-11, oncostatin M (OSM)] and glucocorticoids (3, 10).
Class II acute-phase reactants are activated through two discrete IL-6 signaling pathways (10). After binding IL-6, the IL-6 receptor complexes with two signal transducing gp130 ß-subunits to constitute the activated receptor (11). The active IL-6 receptor activates the tyrosine-specific Janus kinases JAK1, JAK2, and Tyk2 (12). Subsequent tyrosine phosphorylation of signal transducers and activators of transcription (STATs) in a src homology domain induce their homo- and heterodimerization, nuclear translocation, and DNA binding (12). In a separate pathway, IL-6 binding activates Ras, mitogen-activated protein (MAP) kinase, and threonine phosphorylation of the nuclear factor-IL-6 (NF-IL6) transcription factor (10). NF-IL6 is of particular relevance to hAGT regulation as others have shown that the rodent homolog, DBP, binds to -100 to -80 nucleotides (nt) and transactivates the hAGT promoter in overexpression experiments (13). However, the role of NF-IL6 in mediating cytokine-inducible hAGT expression has not been reported.
The mechanisms and signaling pathways by which the hAGT gene can be regulated by IL-6 have not been described. Here we demonstrate that IL-6 activates hAGT through an approximately 230-nt domain containing three functionally distinct cis-regulatory elements. These elements specifically bind common STAT1 and -3 subunits; surprisingly, only STAT3 appears to mediate the IL-6 effect. Overall, our data implicate hAGT as a class II acute-phase reactant mediated through a JAK-STAT3 pathway.
| RESULTS |
|---|
|
|
|---|
, 6 ng/ml, and TNF
, 30 ng/ml) failed to induce
detectable changes in steady-state hAGT mRNA (data not shown). However,
the class II inducer, IL-6, induced hAGT transcript abundance (Fig. 1
|
-991/+20 hAGT/LUC responded by changes in luciferase reporter
activity when stimulated with IL-6 (Fig. 2
, A and B). In
response to increasing doses of IL-6, a saturating response of
approximately 8.5-fold was observed after stimulation with 8.0 ng/ml
(Fig. 2A
; although an
11-fold induction was seen after stimulation
with 80 ng/ml, this was not statistically different from the induction
produced by 8 ng/ml). Induction of -991/+20 hAGT/LUC with a saturating
dose of IL-6 (8 ng/ml) was observed to be time dependent, with an
8.4 ± 0.9-fold induction seen at 24 h (Fig. 2B
). This level
of induction plateaued thereafter until 48 h of stimulation (Fig. 2B
). We note that the kinetics of luciferase induction is more rapid
than that of endogenous hAGT mRNA accumulation detected by Northern
blot, where the peak in hAGT gene expression does not occur until
96 h after IL-6 stimulation (Fig. 1
). The discrepancy in the time
of peak activity between luciferase reporter activity and hAGT mRNA
abundance in Northern blot may be due to the relative differences in
mRNA half-life. AGT mRNA, being more stable than luciferase, will
require longer times to reach steady state.
|
Internal deletions between -288 nt and -46 nt of the hAGT
promoter were then assayed to map the 3'-boundary of the IL-6
responsive domain. Each 3'-deletion was tested for basal and
IL-6-stimulated activity in transient transfection assays. The effect
of each 3'- deletion did not significantly influence unstimulated
activity compared with wild-type (not shown). Deletions of a region
between nucleotides -46 to -122 produced a construct that was fully
IL-6 inducible, whereas deletions of nucleotides -46 to -201 lost all
responsiveness (Fig. 2D
). This indicates the requirement of downstream
sequences between -122 nt and -201 nt for IL-6 activation. Together
these data indicate that the hAGT promoter contains a bipartite
IL-6-responsive domain with one domain contained within -350 nt to
-260 nt and the second between -122 nt to -201 nt. Inspection of
this IL-6-responsive domain led to the identification of three
reiterated sequences bearing homology to IL-6 response elements,
5'-TTNNNNNAA-3' (15, 16, 17), termed human acute phase-response elements
(hAPREs); hAPRE1 (-278 to -269 nt), hAPRE2 (-246 to -237 nt), and
hAPRE3 [-171 to -162 nt (see Table 1
)].
|
Characterization of IL-6-Inducible Proteins Binding to the
hAPREs
Electrophoretic mobility shift assays (EMSAs) were performed to
identify the kinetics and specificity of proteins binding to hAPREs
13. In unstimulated cells, two rapidly migrating nonspecific
complexes were detected binding to all of the hAPRE probes (Fig. 3A
). After 15 min of
IL-6 stimulation, two complexes (C1 and C2) were rapidly induced to
bind hAPREs 1 and 3 (an apparent decrease in the nonspecific complexes
was observed due to probe binding by C1/C2). By contrast, no inducible
complexes were observed to bind hAPRE2. To determine binding
specificity, radiolabeled wild-type and mutant hAPRE oligonucleotides
were incubated with IL-6-stimulated HepG2 nuclear extracts and then
subjected to native PAGE. As shown in Fig. 3B
, wild-type hAPREs 1 and 3
form complexes with IL-6-stimulated HepG2 nuclear proteins while their
(transcriptionally inactive) mutant counterparts do not. These data
demonstrate that the inducible complexes observed in Fig. 3A
are
sequence specific.
|
We were surprised to see the rapid induction of STAT1 and STAT3
binding (within 15 min) for the hAPRE whereas activation of the hAGT
Luc reporter requires longer stimulation (24 h). To investigate these
observations further, we determined whether IL-6- inducible complexes
were formed 2448 h after IL-6 stimulation of HepG2 cells (Fig. 3E
).
The C1/C2 complexes were also observed 24, 36, and 48 h following
IL-6 stimulation.
STAT1 and STAT3 Bind to hAPREs 13 with Varying Affinities
Activation of class II acute-phase reactants is mediated through
either the JAK-STAT or the Ras-MAPK-NF-IL6 pathway (10). To identify
the spectrum of proteins binding to the hAPREs more rigorously than
what was possible by supershift assay, microaffinity isolation/Western
immunoblot DNA-binding assays were performed using biotinylated (Bt)
oligonucleotides for each of the three hAPREs. In this assay, each
Bt-hAPRE was used to bind IL-6-stimulated (8 ng/ml; 15 min) HepG2
nuclear extracts. hAPRE-binding proteins were captured by the addition
of streptavidin agarose beads and washed, and the presence of bound
proteins was detected using Western immunoblot (Fig. 4A
). hAPRE1 and -3 bound with high
affinity to STAT1 whereas hAPRE2 bound STAT1 only weakly. By
contrast, hAPRE1 bound STAT3 strongly whereas hAPRE2 and -3
bound STAT3 weakly. The antiphosphotyrosine blot, a measure of total
STAT binding, indicated that hAPREs bound phospho-STAT proteins in the
hierarchical order hAPRE1>hAPRE3>hAPRE2. None of the hAPREs appeared
to bind STAT5 or NF-IL6, even though both proteins were present in
HepG2 nuclei (Fig. 4A
). These data indicated that the hAPREs are
targets of the JAK-STAT pathway but that they bound STAT1 and STAT3
with differing affinities.
|
Western immunoblot was performed on sucrose cushion-purified nuclear
extracts taken from IL-6-treated HepG2 cells using antibodies specific
for either tyrosine-phosphorylated STAT1 or STAT3 to determine whether
inducible binding was due to changes in their nuclear abundance (Fig. 5
). No tyrosine-phosphorylated STAT1
(pY-STAT1) was detected in the nucleus of unstimulated HepG2 cells.
Fifteen minutes after IL-6 stimulation, however, a doublet appears.
This doublet strengthens in intensity by 30 min. The doublet diminished
to a single band at 45 and 60 min and is almost completely absent at 2
and 6 h. The doublet reappears, although it is somewhat fuzzy in
this image, at 12 h and gradually strengthens in intensity by
48 h following IL-6 stimulation. Reprobing the blot with an
antibody specific for tyrosine-phosphorylated STAT3 (pY-STAT3) reveals
similar kinetics as pY-STAT1. In the case of pY-STAT3 there is an
intense doublet appearing at both 15 and 30 min following IL-6
stimulation (Fig. 5
). A probe for ß-actin controls for equivalent
lane-to-lane protein loading. These data indicate biphasic induction of
activated STAT isoforms in the nucleus of stimulated HepG2 cells and
are consistent with the time course EMSA where a peak in IL-6-inducible
bands is observed with hAPRE1 at 24, 36, and 48 h following IL-6
stimulation (see Fig. 3E
) with a nadir in binding between 30 min and
24 h (not shown).
|
|
|
-isoforms and are naturally expressed in
low abundance; these features allow an uncomplicated interpretation of
the relative expression levels of endogenous protein and dominant
negative proteins by Western immunoblot. cDNAs encoding C-terminal
truncation of STAT1 and STAT3 were generated by placing a stop codon at
residue 713 of STAT1 (STAT1
TA, a 38-amino acid C-terminal
truncation) and residue 715 of STAT3 (STAT3
TA, a 55-amino acid
C-terminal truncation). We assume that there would be an insignificant
difference in the level of expression between the full-length STAT-DNs
and the STAT
TAs because the expression plasmids are otherwise
identical. Extracts from a homogenous population of HepG2 cells (22)
transfected with either STAT1
TA or STAT3
TA cDNAs were subjected
to Western immunoblot with anti-STAT1 or anti-STAT3 antibodies (Fig. 7B
TA was expressed at higher levels than
full-length endogenous STAT1 and that STAT3
TA was expressed at
equivalent levels to full-length endogenous STAT3. These data indicate
high-level expression of both dominant negative proteins.
To determine whether expression of the STAT1-DN decreased STAT1
activation, the amount of tyrosine-phosphorylated (activated) STAT1 was
measured with a specific antibody in a homogenous population of
STAT1-DN transiently transfected cells (Fig. 7C
, top panel).
These cells were stimulated with IL-6 (8 ng/ml, 15 min) before
immunoaffinity isolation (Materials and Methods) and lysates
were immunoblotted with antiphosphotyrosine STAT1. Expression of
STAT1-DN caused a decrease in the amount of tyrosine-phosphorylated
STAT1 compared with cells transfected with either an empty expression
vector or the STAT3-DN expression vector. Probing the same blot with an
anti-STAT1 antibody revealed a much greater level of STAT1 protein
expression in the cells transfected with the STAT1-DN expression vector
making the ratio of unphosphorylated to phosphorylated STAT1 high (Fig. 7C
, compare top two panels). Note that there is
not a significant decrease in the amount of phosphorylated
STAT1 in extracts from cells transfected with the STAT3-DN expression
vector. This is consistent with observations that tyrosine
phosphorylation of STAT1 by gp130 is independent of STAT3 tyrosine
phosphorylation (24).
The above strategy was again employed to determine whether expression
of STAT3-DN caused a decrease in the amount of tyrosine-phosphorylated
STAT3 (Fig. 7C
, bottom panels). Here we observed that
STAT3-DN caused a decrease in the amount of tyrosine- phosphorylated
STAT3 with respect to extracts from a homogenous population of cells
transfected with either an empty expression vector or the STAT1-DN
expression vector. Probing the same blot with an anti-STAT3 antibody
revealed a greater level of STAT3 protein expression in the cells
transfected with the STAT3-DN expression vector making the ratio of
unphosphorylated to phosphorylated STAT3 high (Fig. 7C
, compare
bottom two panels). Note that there is not a
significant decrease in the amount of phosphorylated STAT3 in extracts
from cells transfected with the STAT1-DN expression vector, indicating
that both dominant negative proteins selectively interfere with
activation of their cognate STAT isoform. This is consistent with
observations that STAT3 docks on the gp 130 IL-6 receptor at a distinct
site from that bound by STAT1 (24, 25).
Surprisingly, in spite of its high level of expression relative to its
endogenous counterpart (Fig. 7B
), and its ability to specifically block
STAT1 activation (Fig. 7C
), expression of STAT1-DN had no significant
effect on IL-6 induced -991/+22 hAGT/LUC or
(hAPRE1)5LUC reporter activity (Fig. 7D
).
Additionally, expression of the truncated form of STAT1, STAT1
TA,
also had no significant effect on IL-6 induced -991/+22 hAGT/LUC or
(hAPRE1)5LUC luciferase activity (data not
shown). In contrast to STAT1-DN, expression of increasing amounts of
STAT3-DN expression vector caused IL-6 induced -991/+22 hAGT/LUC
reporter activity to decrease more than 75% while IL-6- induced
(hAPRE1)5LUC reporter activity was decreased more
than 90% (Fig. 7E
). Expression of STAT3
TA produced a similar fall
in induced luciferase activity for both -991/+22 hAGT/LUC and
(hAPRE1)5LUC (data not shown; S. Ray, C. T.
Sherman, and A. R. Brasier, manuscript in preparation). These
results indicate an essential (predominant) role of STAT3 in IL-6
activation of hAGT expression.
Dominant Negative Form of STAT3 Blocks Endogenous hAGT mRNA
Induction
To further confirm the major contributory role of STAT3 in the
inducible regulation of hAGT, HepG2 cells were stably transfected with
the FLAG-tagged STAT3DN expression vector and subjected to Northern
analysis after stimulation with IL-6 (Fig. 8
). Western analysis of cytoplasmic
extracts from stable STAT3DN-HepG2 cells using an anti-FLAG antibody
confirmed expression of STAT3DN in these cells (data not shown). No
significant increase in hAGT mRNA abundance was observed in HepG2 cells
stably transfected with STAT3DN (Fig. 8
, lanes 46). Cells stably
transfected with an empty expression vector, however, did show a
significant increase in hAGT mRNA abundance after IL-6 stimulation for
72 and 96 h (Fig. 8
, lanes 13). This observation was not
significantly different from our observations in Fig. 1
. Together these
indicate an essential requirement for STAT3 in IL-6-inducible
expression of endogenous hAGT transcripts.
|
| DISCUSSION |
|---|
|
|
|---|
Our observation on the regulation of the hAGT gene by IL-6 is in
contrast to the well characterized regulation of the rodent AGT gene, a
class I acute-phase reactant (3). The rodent AGT gene is IL-1 and
TNF-
inducible through a potent nuclear factor-
B site (for review
see Ref. 3). Our data (and that not shown) indicate that IL-6 is a
potent stimulant of hAGT expression; whether IL-6-inducible hAGT
expression can be further modified by class I inducers (IL-1 and TNF)
will require exploration of doses and timing of their administration.
Surprisingly, there is significant sequence divergence between species
(14). Although the rodent AGT promoter contains a single STAT binding
site 5'-TTCCTGGAAG-3' [-160 to -170 nt (26)], the human promoter
has three response elements between -278 to -162 nt. Preliminary
characterization of the rodent STAT-binding site indicates that this
site binds STATs 3, 5, and 6 (26). The sequence and number of hAGT
hAPRE sites diverge from their rodent counterpart and, although the
latter binds STAT3, we do not detect STAT5 binding to any of the
hAPREs. Thus functional and sequence divergence exists between the
rodent and hAGT genes with regard to the number and binding preferences
of STAT sites contained within their promoters.
The hAPREs contained within the hAGT promoter are homologous to other
STAT binding sites in IL-6-inducible promoters including
2-macroglobulin (27),
1-antichymotrypsin (28), and hepatic serine
protease inhibitor 2.1 (29). For these characterized promoters, two
STAT-binding sites are found in close proximity (<160 bp) of the cap
site and spaced close to one another (<20 bp). However, in contrast,
the number of STAT binding sites in the hAGT promoter is unique in that
three sites are present, are spaced far apart (>20 bp), and are
further from the cap site (>160 bp).
In native promoters, STAT binding sites are frequently arranged in
tandem as head-to-tail binding sites. This is significant because
multimeric sites bind to STAT proteins in a cooperative fashion (30).
In the mig gene, for example, neighboring weak STAT binding
sites are required for a strong STAT binding site to confer interferon
(IFN)-inducible transcription (31). In the hAGT promoter a strong
STAT1/3 binding site (hAPRE1) is 5' to a weak STAT site (hAPRE2)
upstream of a STAT1 preferring site (hAPRE3). The significance of
head-to-tail organization is that cooperative STAT binding, mediated by
the STAT NH2-terminus, occurs only in this
arrangement (32). Our study does not address the issue of cooperative
binding; however, the behavior of the hAPRE site mutations (Fig. 2E
)
indicates that these principles will probably apply to the hAGT
promoter. We believe this explains the requirement of hAPRE3 in the
context of the native hAGT promoter in IL-6 induction along with its
inability to confer IL-6 induction by itself (compare Figs. 2
and 6
).
Our data indicate important functional distinctions between the hAPREs.
hAPRE1, a high-affinity site for STAT1 and STAT3 binding, is able to
confer IL-6 induction onto an inert promoter (Fig. 6A
). By contrast,
hAPRE3 preferentially binds STAT1 over STAT3 but is not independently
IL-6 inducible. In combination with the ability of dominant negative
STAT3 (but not STAT1) to block hAGT transcription (Fig. 7
, D and E) and
endogenous gene expression (Fig. 8
), these data suggest that STAT3
primarily mediates IL-6-inducible hAGT transcription in HepG2 cells.
Because hAPRE3 preferentially binds STAT1, it is not strongly activated
by IL-6. In this regard, we note that the STAT1 -/- knockout mouse
has an intact response to IL-6-like cytokines but not IFN-
(33),
indicating that STAT1 is not required for IL-6 responsiveness. Analysis
of STAT binding sites indicate that a crucial determinant of binding
specificity is the half-site spacing (17). We propose that
TT(N)5AA palindromic sites (such as hAPRE3)
selectively bind STAT1 over STAT3.
Functional interactions have been reported between STAT3 and
C/EBPß/NF-IL-6 (34, 35), NF-
B (36), AP-1 (34, 37), and the
glucocorticoid receptor (38). Direct protein-protein interaction
between STAT3 and other factors have been reported with c-Jun and the
glucocorticoid receptor (38, 39). STAT1 has been shown to associate
with members of the IRF-1 family and SP-1 (40, 41, 42). Thus, an
alternative explanation for the lack of hAPRE3 induction when
multimerized and placed upstream of the inert -46 hAGT/LUC
promoter may be a loss of context with respect to other cooperating
transcription factor binding sites present in the native hAGT
promoter.
We have observed a biphasic profile of tyrosine-phosphorylated STAT1
and STAT3 in the nucleus both at early (15 and 30 min) and at later
times (12, 24, 36, and 48 h, Fig. 5
) in IL-6-stimulated HepG2
cells. We note that the biphasic presence of tyrosine- phosphorylated
STATs in the nucleus is coincident with STAT binding to the hAPREs both
at early and late time points (Fig. 3E
), indicating that these forms
are active in DNA binding. This study, to our knowledge, is the first
of its kind to demonstrate IL-6-inducible STAT binding to an IL-6
response element (hAPRE1) at time points beyond 6 h; the mechanism
underlying this biphasic profile will require further investigation.
Our functional assays with both the -991/+22 hAGT/LUC and
(hAPRE1)5LUC reporter plasmids show peak
luciferase activity (24 through 48 h) at time points in which STAT
binding to hAPREs is observed (Figs. 2B
and 6B
, respectively),
indicating that this reporter assay mimics closely changes in the
second peak in STAT binding. But what to make of the earlier STAT
binding? Why isnt luciferase activity induced earlier than 24 h?
In this regard, we note that STAT1 and STAT3 have been shown to
interact with the CBP/p300 class of coactivators (43), proteins that
are known to have histone acetyltransferase (HAT) activity (44), an
activity believed to mediate transcriptional activation by relaxing
chromatin near the transcription start site (45). It is possible that
HAT activity and promoter remodeling may play a role subsequent to this
early STAT nuclear translocation and be rate limiting for transcription
initiation. The role of chromatin structure in controlling constitutive
or IL-6-inducible gene expression, however, will require
additional investigation.
Recent investigation has revealed that there is very little monomeric STAT3 in the cytosol of unstimulated liver cells (46). Instead, the bulk of STAT3 (and STAT1, 5a, and 5b) is present in the cytosol as two high molecular mass complexes, one ranging in size from 200400 kDa (statosome I) and the other from 12 MDa (statosome II) (46). After IL-6 stimulation, tyrosine-phosphorylated STAT3 was found to remain in the 200- to 400- kDa and 1- to 2-MDa complexes (46). Isolation of the IL-6-stimulated 200- to 400-kDa complex from the cytoplasm of Hep3B and rat liver cells revealed that it was DNA binding competent and formed the so-called SIF-A STAT3 homodimer (15) by EMSA analysis (46). Mass spectroscopy identified several proteins in the statosome complexes including the scaffolding protein GRP58/ER-60/Erp57 (46). These, as well as our own observation, reveal that the JAK/STAT signal transduction pathway is much more complex than previously believed and requires further investigation.
In summary, hAGT is a class II acute-phase reactant with a transcriptional activation mechanism mediated by nuclear translocation of STATs. The promoter of the hAGT differs from other class II acute-phase reactants in that it contains three STAT binding sites that appear to function in IL-6-mediated transcriptional activation and differ in their binding affinity for STAT3, the predominant mediator of AGT induction. Further investigation of hAGT gene regulation is necessary to identify modulators of class II acute-phase reactant signal transduction and better understand transcriptional activation initiated through this pathway. Potential targets for future hypertension therapy and inflammation control could evolve from this knowledge.
| MATERIALS AND METHODS |
|---|
|
|
|---|
plasmid [a well described expression vector for the human
-glucocorticoid receptor (47)] per 60-mm plate
(106 cells). Cells were stimulated with ligand
24 h (unless otherwise indicated) and then harvested to measure
luciferase and alkaline phosphatase activities as previously described
(22). Stable transfection of HepG2 cells was performed using
LipofectAMINE PLUS (Life Technologies, Inc.) to introduce
3 µg of either an empty FLAG-tagged pcDNA3 (Invitrogen,
Carlsbad, CA) expression plasmid or the pcDNA3-STAT3
Y705F/FLAG
expression plasmid (described below) onto 100-mm culture dishes
(108 cells). After 48 h, cells were cultured
in 800 µg/ml G418-containing growth medium for 4 weeks with medium
changes twice each week. Colonies were selected and screened for
expression of FLAG-tagged STAT3
Y705F.
Plasmid Construction
The hAGT promoter driving a luciferase reporter was constructed
by PCR using gene-specific primers,
5'-ATGTTTGGATCCTGGGTAATTTCATGTCTGC-3' (BamHI
site underlined) and
5'-GCTGTAAAGCTTAGAACAACGGCAGCTTCTTCC-3'
(HindIII site underlined). The 1,013-bp product
was restricted with BamHI and HindIII and ligated
into poLUC (48). 5'-Deletions were produced using the following
primers: (BamHI site underlined): -648 hAGT:
5'-ATGCCTGGATCCTGAAGGCATTTTGTTTGT-3'; -493 hAGT:
5'-AGGGTAGGATCCTTGGAGCACCTGAAGGTC-3'; -350 hAGT:
5'-GGGGGTGGATCCCCCGGGGCTGGGTCAGAA-3'; -260 hAGT:
5'-AACCTTGGATCCGACTCCTGCAAACTTCGG-3'; -203 hAGT:
5'-TCACTCGGATCCGCAGTGAAACTCTGCATC-3'; -46 hAGT:
5'-ACAGCTGGATCCCCACCCCTCAGCTATAAA-3'. Products were
restricted with BamHI/HindIII and subcloned into
poLUC. 3'-Deletion constructs of -350/+22 hAGT/LUC were produced using
the following primers (BglII site underlined):
-122 hAGT: 5'-ACAGGCAGATCTGAAGGACAGATGCCA-3'; -201 hAGT:
5'-CTTTCAGATCTGAACAGAGTGAGCC-3'; -261 hAGT:
5'-TTGCAGAGATCTGGGCCAAGGTTCCCAG-3'; -288 hAGT:
5'-GAAACGAGATCTTCTCCCTAGGTGTGTG-3'. Products were
restricted with BamHI/BglII, gel purified, and
subcloned into BamHI-linearized -46/+22 hAGT/LUC.
Site-directed mutagenesis of the hAPREs was performed using PCR SOEING
(splicing by overlap extension) (49) with mutagenic primers
(mutations underlined):
5'-TGCTCCCGTGGATGGGCCCTTGGCCCCGACTC-3' and
5'-GCCAAGGGGCCCATCCACGGAGCATCTCC-3'
(hAPRE1);
5'-TGCAAACGGAGGGCCCTGTGTAACTCGACC-3' and
5'-TACACAGGGCCCTCCGTTTGCAGGAGTCGG-3'
(hAPRE2); 5'-CTAAGACGGACTGGCCGAGGTCCCAGCGTG-3'
and
5'-GGACCTCGGCCAGTCCGTCGTCTTAGTGATCGATGC-3'
(hAPRE3). Products were subcloned into the poLUC vector. The
multimerized hAPRE1 constructs were produced by annealing
oligonucleotides 5'-GATCCTCCCGTTTCTGGGAACCTTGGA-3' (sense) and
5'GAGGGCAAAGACCCTTGGAACCTCTAG-3' (antisense). These duplex
oligonucleotides were phosphorylated, ligated, and gel purified. The
eluted fragments were ligated into BamHI-linearized -46/+22
hAGT/LUC. Multimerization of hAPREs 2 and 3 also employed this
methodology using 5'-GATCCGCAAACTTCGGTTAAATGTGTAA-3' and
5'-GATCTTACACATTTACCGAAGTTTGCG-3' (hAPRE2);
5'-GATCCTAAGCTTCCTGGAAGAGGTCCA-3' and
5'-GATCTGGACCTCTTCCAGGAAGCTTAG-3' (APRE3).
The human STAT3 expression plasmid was constructed using RT-PCR and
gene-specific primers: 5'-GGATCCGCCCAATGGAATCAGCTAC-3' and
5'-AAGCTTTCACATGGGGGAGGTAGCGCAC-3' (BamHI
and HindIII sites underlined) in RT-PCR using
HepG2 RNA as template. The PCR product was digested with
BamHI/HindIII, gel purified, and ligated into a
modified pcDNA3 expression vector (pcDNA3-FLAG) digested with
BamHI and HindIII producing the plasmid
pcDNA3-STAT3/FLAG. The plasmid pcDNA3-FLAG was constructed by ligating
a duplex oligonucleotide obtained by annealing the sequence,
5'-AAGCTCGTCTACCATGGACTACAAAGACGATGACGATAAGGGATCCAAGGAAAA
GCTTGATATCTCTAGA-3' with the sequence
5'-TCTAGAGATATCAAGCTTTTCCTTGGA
TCCCTTATCGTCATCGTCTTTGTAGTCCATGGTAGACGAGCTT -3' between the
HindIII and XbaI sites of pcDNA3
(Invitrogen). This sequence encodes an ATG initiation
codon (underlined) and the FLAG epitope. Site-directed
mutagenesis of the STAT3 cDNA sequence at a tyrosine residue (codon
705) required for IL-6 activation (20) was performed using PCR SOEING
(49) with mutagenic primers (mutations underlined):
5'-GCGCTGCCCCATTCCTGAAGACCAAG-3' and
5'-CTTGGTCTTCAGGAATGGGGCAGCGC-3' using pcDNA3-STAT3/FLAG as
the template to produce the FLAG-tagged expression plasmid
pcDNA3-STAT3
Y705F/FLAG.
The truncated human STAT3 expression plasmid was constructed using PCR
and gene- specific primers: 5'-GGATCCGCCCAATGGAATCAGCTAC-3'
and 5'- AAGCTTTCATGGTGTCACACAGATAAACTTGGTC-3'
(BamHI and HindIII sites underlined;
stop codon in bold italics) using pcDNA3-STAT3/FLAG as the
template. The PCR product was digested with Bam/HindIII, gel
purified, and ligated into the modified pcDNA3 expression vector
(pcDNA3-FLAG) digested with BamHI and HindIII,
producing the plasmid pcDNA3-STAT3
TA/FLAG. This 55-residue
C-terminal truncation (stop codon at residue 715) eliminates the
transactivation domain of STAT3, giving it a sequence similar to
endogenous STAT3ß (23).
The human STAT1 dominant negative expression plasmid was
constructed using PCR and gene-specific primers:
5'-GGTTATGGGCTCTCAGTGGTACGAACTTCAGCAG-3' and
5'-TACTGTGTTCATCATACTGTCGAATTC-3' using pcDNA3m
Stat1 (21) as
template. The PCR product was cloned into the pEF6/V5-His TOPO
vector (Invitrogen) producing the V5-epitope-tagged
expression vector pEF6-STAT1/V5-His. Site-directed mutagenesis of the
STAT1 cDNA sequence at a tyrosine residue (codon 701) required for IL-6
activation (19) was performed using PCR SOEING (49) with mutagenic
primers (mutations underlined):
5'-GAACTGGATTTATCAAGACTGA-3' and
5'-GTCTTGATAAATCCAGTTCCTTTAGGG-3' using pEF6-STAT1/V5-His as the
template to produce the V5-epitope-tagged expression vector
pEF6-STAT1
Y701F/V5-His.
The truncated human STAT1 expression plasmid was constructed using PCR
and gene-specific primers: 5'-GGTTATGGGCTCTCAGTGGTACGAACTTCAGCAG-3' and
5'-AAGCTTTTAAACTTCAGACACAGAAATC-3' (stop codon in bold
italics) using pcDNA3m
Stat1 as the template. The PCR product
was TA cloned into the pEF6/V5-His TOPO vector
(Invitrogen) producing the expression vector
pEF6-STAT1
TA. This 38-residue C-terminal truncation (stop codon at
residue 713) eliminated the transactivation domain of STAT1, giving it
a sequence similar to endogenous STAT1ß (21).
Immunoaffinity Isolation of Transfected HepG2 cells on Magnetic
Beads
To isolate a homogenous population of transiently transfected
cells, HepG2 cells were transfected by electroporation (to increase the
number of transient transfectants). Briefly, logarithmically growing
cells were trypsinized, washed in
Ca2+/Mg2+-free PBS, and
resuspended at a density of 2 x 107
cells/250 µl volume in an 0.4-cm electroporation cuvette
(Bio-Rad Laboratories, Inc., Hercules, CA). The following
types and amounts of supercoiled plasmid DNA were then added to the
cuvettes: 35 µg of (hAPRE1-WT)5LUC, 5 µg
plasmid CMV.IL2R encoding the IL-2 receptor, and either 10 µg of
pcDNA3-STAT
3Y705F/FLAG expression plasmid or 10 µg of
pEF6-STAT1
Y701F/V5-His expression plasmid or 10 µg of an empty
pcDNA3/FLAG or pEF6/V5-His TOPO expression plasmid. This same strategy
was employed for the studies involving the pcDNA3-STAT3
TA/FLAG and
pEF6-STAT1
TA expression plasmids. Cells were incubated on ice for 15
min and electroporated at 960 µF, 250 V. The cells were incubated on
ice for an additional 15 min and plated on prewarmed growth medium.
Cells were cultured for 48 h after transfection with daily changes
of medium and then harvested for cytoplasmic proteins.
For immunoaffinity isolation of transiently transfected cell populations, minor modifications of published protocols were used (50, 51). Transfected cells were washed twice with cold PBS and incubated for 30 min at 4 C with 1 µg of antihuman CD25 monoclonal antibody (Caltag Laboratories, Inc. Burlingame, CA) in 8 ml of PBS/0.01%BSA. After this incubation, cells were washed twice with PBS, and 25 µl of a slurry of goat antimouse IgG-conjugated magnetic beads (Dynabeads, M-450, DynAl, Great Neck, NY) were added to 8 ml of PBS/0.01%BSA. After incubation for 30 min at 4 C, cells were washed, trypsinized, and captured on a magnetic stand in Eppendorf tubes. The method has been previously shown in our laboratory to yield homogenous transfected cell populations for assay (22).
Sucrose Density-Purified Nuclear Extracts
For the purification of nuclear proteins, unstimulated or
IL-6-stimulated (8 ng/ml; 15 min unless otherwise indicated) HepG2
cells were resuspended in Buffer A [50 mM HEPES (pH 7.4),
10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1
mM dithiothreitol (DTT), 0.1 µg/ml phenylmethylsulfonyl
fluoride (PMSF), 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml
soybean trypsin inhibitor, 10 µg/ml aprotinin, 20 mM NaF,
1 mM NaP207, 1
mM Na3VO3, and
0.5% NP-40]. After 10 min on ice, the lysates were centrifuged at
4,000 x g for 4 min at 4 C. The supernatant was saved
as the cytoplasmic fraction. The nuclear pellet was then resuspended in
Buffer B (Buffer A with 1.7 M sucrose), and
centrifuged at 15,000 x g for 30 min at 4 C (52). The
purified nuclear pellet was then incubated in Buffer C [10% glycerol,
50 mM HEPES (pH 7.4), 400
mM KCl, 1 mM EDTA, 1
mM EGTA, 1 mM DTT, 0.1
µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 10 µg/ml
soybean trypsin inhibitor, 20 mM NaF, 1
mM
NaP207, 1
mM
Na3VO3, and 10 µg/ml
aprotinin] with frequent vortexing for 30 min at 4 C. After
centrifugation at 15,000 x g for 5 min at 4 C, the
supernatant was saved as nuclear extract. Both the cytoplasmic and
nuclear fractions were normalized for protein amounts determined by
protein assay (Protein Reagent; Bio-Rad Laboratories, Inc.).
Microaffinity Purification
Duplex oligonucleotides corresponding to the three hAPREs are
listed
below.
hAPRE1-WT: GATCCTCCCGTTTCTGGGAACCTTGGA GAGGGCAAAGACCCTTGGAACCTCTAG
hAPRE2-WT: GATCCGCAAACTTCGGTAAATGTGTAA GCGTTTGAAGCCATTTACACATTCTAG
hAPRE3-WT: GATCCTAAGACTTCCTGGAAGAGGTCCA GATTCTGAAGGACCTTCTCCAGGTCTAG
hAPRE1-
: GATCCTCCCGTGGATGGGCCCCTTGGA GAGGGCACCTACCCGGGGAACCTCTAG
hAPRE2-
: GATCCGCAAACGGAGGGCCCTGTGTAA GCGTTTGCCTCCCGGGACACATTCTAG
hAPRE3-
: GATCCTAAGACGGACTGGCCGAGGTCCA GATTCTGCCTGACCGGCTCCAGGTCTAG
Underlines indicate
purine-to-noncomplementary-pyrimidine substitutions. Microaffinity
purification of hAPRE binding proteins was performed using chemically
synthesized hAPRE wild-type (WT) oligonucleotides containing 5' biotin
(Bt) on a flexible linker (Genosys, The Woodlands, TX).
Forty picomoles of duplex Bt-hAPRE-WT were incubated with 1 mg of
control or IL-6-treated (8 ng/ml; 15 min) HepG2 nuclear extracts in the
presence of 10 µg of poly(dIdC) in a 1,000 µl volume of binding
buffer [containing 8% (vol/vol) glycerol, 5 mM
MgCl2, 1 mM DTT, 100
mM KCL, 1 mM EDTA, and 12
mM HEPES (pH 7.9)] for 20 min at 25 C. Binding
reactions were then centrifuged at 13,000 rpm for 5 min at 25 C.
Supernatants were aliquoted into fresh microfuge tubes and binding
proteins were captured by the addition of 50 µl of a 50% (vol/vol)
slurry of streptavidin-agarose beads (Pierce Chemical Co.,
Rockford, IL) for 5 min at 25 C with mixing. Beads were pelleted by
centrifugation at 5,000 rpm for 2 min at 25 C and washed two times in
binding buffer. hAPRE-binding proteins were then eluted with 1x
SDS-PAGE loading buffer for Western immunoblot analysis. For
competition, a 2.5-fold excess of nonbiotinylated wild-type or mutant
(hAPRE-
) oligonucleotide was included in the initial binding
reaction. Inclusion of a reaction that contained no biotinylated DNA in
the initial binding reaction controlled for nonspecific binding of
protein to the streptavidin-agarose beads.
EMSA
Nuclear extracts from unstimulated and IL-6 stimulated HepG2
cells were prepared as described above. Nuclear proteins were bound to
the radiolabeled duplex oligonucleotides given above (see
Microaffinity Purification). High-affinity SIE m67 was
prepared by annealing 5'-GATCCGTCGACATTTCCCGTAAATCA-3' and
5'-GATCTGATTTACGGGAAATGTCGACG-3'. Oligonucleotides were
radiolabeled using the large fragment (Klenow) of DNA polymerase,
dNTP-dA, and
32P-dATP. DNA binding reactions
using either mutant or wild-type hAPRE13 contained 30 µg nuclear
protein, 8% (vol/vol) glycerol, 5 mM
MgCl2, 1 mM DTT, 100
mM KCl, 1 mM EDTA, 2 µg
of poly(dI-dC), 12 mM HEPES (pH 7.9), and 40,000
cpm of 32P-labeled double-stranded
oligonucleotide in a total volume of 20 µl. The nuclear proteins were
incubated with the probe for 15 min at room temperature and then
fractionated by 5% nondenaturing PAGE in 0.5x TBE buffer (45.5
mM Tris-HCL, 45.5 mM boric
acid, 1.0 mM EDTA, pH 8.0). Antibody supershift
assays were performed by adding 5 µg of affinity-purified normal
rabbit IgG (sc-2027), anti-STAT1 (sc-345X), or anti-STAT3 (sc-482X) to
the binding reaction. All of the antibodies used for supershift
analysis were obtained from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). After incubation for 1 h on ice, the binding
reactions were electrophoresed on a native 5% PAGE gel as described
above. After electrophoretic separation, gels were dried and exposed
for autoradiography using X-AR film (Eastman Kodak Co.,
Rochester, NY) at -70 C using intensifying screens.
Western Immunoblots
Proteins were fractionated by SDS-PAGE (10%
polyacrylamide) and transferred to polyvinylidene difluoride membranes
(Millipore Corp., Bedford, MA). Membranes were blocked in
8% Carnation evaporated milk and immunoblotted with commercially
available antibodies. Affinity-purified rabbit polyclonal antibodies
used in this study were: anti-STAT 1 (sc-345, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and anti-STAT 3 (sc-493,
Santa Cruz Biotechnology, Inc.), anti-STAT5 (sc-836,
Santa Cruz Biotechnology, Inc., specific for STAT5a and
b), and anti-NF-IL6 [produced in our laboratory (53)].
Affinity-purified mouse monoclonal antibodies used in this study were:
antiphosphotyrosine (4G10; Upstate Biotechnology, Inc.
Lake Placid, NY), antiphosphotyrosine-STAT1 (sc-8394, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), antiphosphotyrosine-STAT3
(sc-8059, Santa Cruz Biotechnology, Inc.), anti-FLAG
M2-peroxidase (A-8592, Sigma), anti-V5 antibody
(Invitrogen) and anti-ß-actin (Sigma).
Immune complexes were detected by binding donkey antirabbit IgG or
sheep antimouse IgG, each conjugated to horseradish peroxidase
(Pierce Chemical Co., Rockford, IL), followed by reaction
in the enhanced chemiluminescence assay (ECL, Amersham International, Arlington Heights, IL) according to the
manufacturers recommendations. Anti-FLAG M2-peroxidase and anti-V5
antibody both had horseradish peroxidase directly conjugated to them;
thus immune complexes were detected using enhanced chemiluminescence
without incubation with antimouse IgG.
Northern Blots
Five micrograms of total cellular RNA were extracted from HepG2
cells using acid guanidium/phenol extraction (RNAZOL B,
Tel-Test, Friendswood, TX), fractionated by
electrophoresis on a 1% agarose-formaldehyde gel, capillary
transferred to a nylon membrane (Hybond, Amersham Pharmacia Biotech, Buckinghamshire, UK), and prehybridized for
4 h in hybridization buffer (0.5 M sodium phosphate,
pH 7.2, 7% SDS, 1 mM EDTA, 1% BSA) at 65 C. The membrane
was then hybridized using a body-labeled cDNA probe generated by PCR
using hAGT cDNA specific primers (sense, 5'-AAAGGCCAATGCCGGGAAGC-3';
antisense, 5'-TGTGAAGTCCAGAGAGCGTG-3') and template plasmid containing
the hAGT cDNA sequence. The membrane was hybridized with 1 x
106 cpm 32P-labeled hAGT
cDNA probe per ml overnight in the same buffer, washed three times (20
min each) with 1% SDS-containing phosphate buffer at 65 C, and exposed
to X-AR film for 2448 h. For the 18S RNA hybridization, the same
membrane was reprobed with 32P-labeled human 18S
cDNA and briefly exposed. Bands in the autoradiogram were quantitated
by exposure to a Phosphorimager (Molecular Dynamics, Inc.,
Sunnyvale, CA) cassette. 18S signal was used to normalized hAGT signal
controlling for differences in loading and transfer.
| ACKNOWLEDGMENTS |
|---|
Stat1 vector. | FOOTNOTES |
|---|
This work was supported in part by National Heart, Lung, and Blood Institute Grant 55630 (to A.R.B.), an American Heart Association (AHA) Grant in Aid (9950345N) and National Institute of Environmental Health Sciences Grant ES06676 (R.S. Lloyd, University of Texas Medical Branch). A.R.B. is an Established Investigator of the AHA. C.T.S. is supported by The James W. McLaughlin Fellowship Fund.
Received for publication March 23, 2000. Revision received November 30, 2000. Accepted for publication December 4, 2000.
| REFERENCES |
|---|
|
|
|---|
2-macroglobulin gene. Proc Natl Acad Sci USA 87:23642368
. Science 261:17441746