Molecular Endocrinology 15 (4): 485-500
Copyright © 2001 by The Endocrine Society
The Glucocorticoid Receptor Interacting Protein 1 (GRIP1) Localizes in Discrete Nuclear Foci That Associate with ND10 Bodies and Are Enriched in Components of the 26S Proteasome
Christopher T. Baumann,
Han Ma,
Ronald Wolford,
Jose C Reyes1,
Padma Maruvada,
Carol Lim2,
Paul M. Yen,
Michael R. Stallcup and
Gordon L. Hager
Laboratory of Receptor Biology and Gene Expression (C.T.B., R.W.,
J.C.R., C.L., G.L.H.) National Cancer Institute National
Institutes of Health Bethesda, Maryland 20892-5055
Molecular Regulation & Neuroendocrinology Section (P.M.,
P.M.Y.) Clinical Endocrinology Branch National Institute of
Diabetes, Digestive and Kidney Diseases National Institutes of
Health Bethesda, Maryland 20892
Department of Pathology
(H.M., M.R.S.) University of Southern California Los Angeles,
California 90033
 |
ABSTRACT
|
|---|
The glucocorticoid receptor interacting protein-1
(GRIP1) is a member of the steroid receptor coactivator (SRC) family of
transcriptional regulators. Green fluorescent protein (GFP) fusions
were made to full-length GRIP1, and a series of GRIP1 mutants lacking
the defined regulatory regions and the intracellular distribution of
these proteins was studied in HeLa cells. The distribution of GRIP1 was
complex, ranging from diffuse nucleoplasmic to discrete intranuclear
foci. Formation of these foci was dependent on the C-terminal region of
GRIP1, which contains the two characterized transcriptional activation
domains, AD1 and AD2. A subpopulation of GRIP1 foci associate with
ND10s, small nuclear bodies that contain several proteins including
PML, SP100, DAXX, and CREB-binding protein (CBP). Association with the
ND10s is dependent on the AD1 of GRIP1, a region of the protein
previously described as a CBP-interacting domain. The GRIP1 foci are
enriched in components of the 26S proteasome, including the core 20S
proteasome, PA28
, and ubiquitin. In addition, the irreversible
proteasome inhibitor lactacystin induced an increase in the total
fluorescence intensity of the GFP-GRIP1 expressing cells, demonstrating
that GRIP1 is degraded by the proteasome. These findings suggest the
intriguing possibility that degradation of GRIP1 by the 26S proteasome
may be a key component of its regulation.
 |
INTRODUCTION
|
|---|
Nuclear hormone receptors (NHRs) are a large family of
ligand-activated transcriptional regulators that include more than 50
distinct proteins (1). Typically, NHRs activate transcription of their
target genes in response to specific ligand agonists. Ligand binding
induces a conformational change within the receptor, facilitating
binding of one or more nuclear receptor interacting proteins (2). The
steroid receptor coactivators (SRCs) are a family of nuclear receptor
interacting proteins and include SRC1 (3), GRIP1 (glucocorticoid
receptor interacting protein 1)/TIF2 (transcriptional
intermediary factor 2) (4, 5), and AIB1 (amplified in breast cancer
1)/ACTR (activator of thyroid and retinoic acid receptors)/RAC3
(receptor-associated coactivator 3) (6, 7, 8). These proteins are highly
homologous transcription factors with several conserved functional
domains, including an N-terminal basic helix-loop-helix (bHLH)-PAS
domain, a CREB-binding protein (CBP) interaction domain (AD1), a
C-terminal activation domain (AD2), a Q-rich region, and several LXXLL
boxes that are involved in nuclear receptor binding (9, 10).
The mechanism by which the SRCs potentiate transcription from the NHRs
has been the focus of intense study (2, 7, 9, 11, 12, 13, 14). The accepted
model is that the SRCs act as bridging proteins. In this role, the
ligand-bound NHRs bind to and recruit the SRCs to a target promoter (2, 4, 7, 15, 16, 17). The SRCs, in turn, interact with and recruit additional
proteins to the hormone-responsive promoter (7, 11, 18). To date, a
number of proteins have been found to interact with SRCs. The histone
acetyltransferase CBP and its homolog p300 interact with AD1 (19, 20).
Additionally, recent studies have found two proteins that interact with
AD2, CARM1 (21) and mZac1 (22). CARM1 is a protein methyltransferase
that can methylate histone H3 in vitro. Therefore, the
recruitment of proteins capable of posttranslational modification
appears to be a major way in which the SRCs potentiate NHR
transcription. In addition, several of the SRCs, including SRC-1 (23)
and ACTR (7), have been shown to be histone acetyltransferases
themselves, allowing for yet another mechanism by which the SRCs
activate transcription through the NHRs.
The activities of NHRs are regulated at several levels, including
ligand binding and posttranslational modifications (24, 25, 26). Recently,
changes in the intracellular distribution of the NHRs has also been
shown to be an important component of their regulation (27, 28, 29, 30, 31, 32, 33, 34, 35). In
stark contrast, little is known about the regulation of the SRCs. As a
starting point for the study of SRC regulation, the intracellular
distribution of GRIP1 was studied in living cells by constructing green
fluorescent protein (GFP)-fusions to full-length GRIP1 and a panel of
GRIP1 deletion mutants. We have found that in a subpopulation of cells,
GFP-GRIP1 localizes in discrete nuclear foci, the formation of which
was dependent on the C-terminal AD2 region. A subset of these foci
associated with the promyelocytic leukemia gene product (PML)- and
CBP-containing ND10 domains in an AD1-dependent manner. Furthermore,
all of the foci are enriched in components of the 26S proteasome, and
the addition of an inhibitor of the 26S proteasome induced an increase
in the total cellular fluorescence of the GFP-GRIP1 expressing cells.
These observations have allowed us to speculate that the activity of
GRIP1 may, in part, be modulated by the ubiquitin-dependent proteasome
pathway.
 |
RESULTS
|
|---|
Intracellular Distribution of GRIP1
To study the intracellular distribution of GRIP1, the GFP was
fused to the N terminus of full-length GRIP1 (GFP-GRIP1; Fig. 1A
). GFP-GRIP1 was expressed in HeLa
cells and found to be the predicted molecular mass of 190 kDa (160
kDa for GRIP1 + 30 kDa for GFP; Fig. 1B
). In addition, GFP-GRIP1 was
fully competent to activate GR-dependent transcription from a mouse
mammary tumor virus (MMTV)-luciferase reporter (Fig. 1C
). When
expressed in HeLa cells, GFP-GRIP1 localized within the nucleus and was
excluded from nucleoli (Fig. 2A
). In the
majority of cells, GFP-GRIP1 was found in a diffuse nucleoplasmic
distribution (Fig. 2A
, left panel). However, in a fraction
of cells (1020%) GFP-GRIP1 localized in discrete intranuclear foci,
either with (Fig. 2A
, center panel) or without (Fig. 2A
, right panel) a diffuse nucleoplasmic background. Within a
given population of cells, the number of these foci ranged from 1015
to hundreds per cell. The percentage of cells in which GRIP1
accumulated in foci remained unchanged when the amount of transfected
GFP-GRIP1 expression vector varied from 10 ng to 10 mg (data not
shown). Additionally, no correlation was observed between the total
fluorescence intensity of an individual cell and the presence or
absence of foci, indicating that the focal accumulation of GFP-GRIP1
was not simply an artifact of overexpression. Treatment of cells with
dexamethasone or 9- cis-retinoic acid, agonists for the
glucocorticoid receptor and retinoic X receptor, respectively (both of
which are expressed in HeLa cells), had no effect on the intracellular
distribution of GFP-GRIP1 (data not shown), suggesting that the
distribution was independent of nuclear receptor binding. Similar foci
were seen when GFP-GRIP1 was expressed in mouse mammary adenocarcinoma
cell line 1471.1 (C. T. Baumann, and G. L. Hager, unpublished
observations) and normal human fibroblasts (A. Ishov and G. Maul,
personal communication), demonstrating that the observed distribution
of GFP-GRIP1 was not unique to HeLa cells. To ensure that the GFP tag
was not altering the distribution of GRIP1, an hemagglutinin
(HA)-tagged GRIP1 was expressed in HeLa cells and localized by indirect
immunofluorescence against the hemagglutinin (HA) epitope (Fig. 2B
). HA-GRIP1 was found in both diffuse and focal distributions as was
observed for the GFP-tagged variant, demonstrating that the GFP moiety
had no observable effect on the intracellular distribution of GRIP1.
Analysis of the distribution of endogenous GRIP1 was hampered by the
inability of the currently available GRIP1/TIF2 antibodies to recognize
either the endogenous GRIP1 or a transiently expressed protein (data
not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. Schematic and Functional Activity of GFP-GRIP1
A, Schematic representation of GFP-GRIP1 with the defined functional
domains shown. bHLH-PAS is the basic helix-loop-helix Per-ARNT-SIM
domain; NID is the nuclear receptor interaction domain containing three
LXXLL motifs; AD1 is the activation domain 1 (also the CBP interaction
domain); Q represents the Q-rich region; and AD2 is the activation
domain 2. B, Western blot analysis of GFP-GRIP1 and GFP-TRAM1. HeLa
cells were mock transfected (lane 1) or transfected with pEGFP-GRIP1
(lane 2) or pEGFP-TRAM1 (lane 3). GFP fusions were detected with an
anti-GFP antibody (CLONTECH Laboratories, Inc.) in both
the GFP-GRIP1 and GFP-TRAM1 lanes (upper band at
195 kDa). Lower band is a nonspecific band typically
seen with this specific antibody under these conditions. C, Activity of
GFP-GRIP1 fusion construct. pSG5-HA-GRIP1 or pEGFP-GRIP1 was
transfected into HeLa cells with the pLTRLuc plasmid, and the activity
of the endogenous glucocorticoid receptor was monitored (see
Materials and Methods). Results are plotted as the fold
induction induced by ligand agonists with and without GRIP1. Data shown
are representative of at least three independent experiments.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Intranuclear Distribution and Nuclear Retention of
GFP-GRIP1
A, Confocal images of the representative distributions of GFP-GRIP1 in
living cells. GFP-GRIP1 localizes in a diffuse intranuclear
distribution in approximately 80% of cells (left panel)
and in discrete intranuclear foci in the remaining 20% (middle and right panels). B, Intranuclear distribution
of HA-tagged GRIP1 determined by indirect immunofluorescence. HA-GRIP1
was found in both diffuse (left panel) and focal
(right panel) distributions. C, Association of the
GFP-GRIP1 foci with an insoluble nuclear fraction. GFP-GRIP1 expressing
cells were sequentially extracted with detergent (CSK, top
panel), high salt (Extraction, middle panel),
and DNase I (DNase I, lower panel). Left
column shows the localization of GFP-GRIP1 and right
column shows the staining pattern of chromatin (DAPI). Note the
loss of chromatin after DNase I treatment.
|
|
To further characterize the intracellular distribution of GFP-GRIP1,
cells were sequentially extracted with detergent, high salt, and DNase
I (Fig. 2C
). The diffusely distributed GFP-GRIP1 was lost upon the
first CSK detergent extraction (Fig. 2C
, top row),
indicating that this pool of GFP-GRIP1 was freely soluble within the
nucleoplasm. In contrast, the focal accumulations of GRIP1 were
resistant even to DNase I treatment (Fig. 2C
, bottom row),
demonstrating that the GFP-GRIP1 foci associate with an insoluble,
nonchromatin component of the nucleus.
The C Terminus of GRIP1 Is Essential for Foci Formation
GRIP1 is a large protein with several defined functional domains
(Fig. 1
) (4). To determine which region of GRIP1 was responsible for
foci formation, GFP fusions were made to a series of GRIP1 mutants
(Fig. 3
, AE). The N-terminal bHLH-PAS
region is the most highly conserved region among members of the SRC
family (36). However, deletion of this domain (
bHLH-PAS) had no
observable effect on the intranuclear distribution of the chimera (Fig. 3A
). Similarly, the intranuclear distribution of nrbIIm+nrbIIIm, a
GRIP1 mutation that does not interact with GR (37), was also unchanged
as compared with the full-length protein (Fig. 3B
). Therefore,
interactions with GR do not appear to be essential for GRIP1 to
localize to foci, which is in agreement with the lack of effect
dexamethasone had on the intracellular distribution of the chimera
(data not shown). The C-terminal region of GRIP1 contains two well
defined activation domains, AD1 and AD2 (20, 21). Deletion of AD1
(
AD1) had a dramatic effect on the intracellular distribution of
GFP-GRIP1, with a loss of nearly all foci (Fig. 3C
). In a few cells
(
10%), a small number of foci were found, although always in the
context of a diffuse nucleoplasmic background (Fig. 3C
, left
panel). Deletion of the C-terminal region of GRIP1 (
AD2), which
deletes both AD2 and the Q-rich domain, resulted in a complete loss of
foci formation (Fig. 3D
), indicating that this region of the protein is
essential for foci formation. Deletion of both AD1 and AD2 (
AD1 +
AD2) also resulted in a complete loss of foci (Fig. 3E
). However, in
many cells expressing GRIP1
AD1 +
AD2, the fusion was found to
localize within the nucleoli (Fig. 3E
, right panel),
although the significance of this observation is unclear. Together,
these results demonstrate that the C-terminal
region of GRIP1 plays an important role in foci formation.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 3. Intranuclear Distribution of GFP-GRIP1 Mutants in
HeLa Cells
Representative images of the five GFP-GRIP1 mutants (AE) used in this
study. A schematic of each mutant is located directly
above each set of images. bHLH-PAS is the basic
helix-loop-helix Per-ARNT-SIM domain, NID is the nuclear receptor
interaction domain containing three LXXLL motifs, AD1 is the activation
domain 1 (also the CBP interaction domain), Q represents the Q-rich
region and AD2 is the activation domain 2.
|
|
A Subset of GFP-GRIP1 Foci Associates with the ND10 Domains
Based on the size and number of the GFP-GRIP1 foci, we
hypothesized that they may be associated with ND10s (reviewed in Refs.
38, 39), small nuclear substructures containing at least 10
proteins. To determine whether the observed GFP-GRIP1 foci were
associated with ND10s, GFP-GRIP1 expressing HeLa cells were fixed and
the intranuclear localization of the ND10s was determined by indirect
immunofluorescence against PML; a clear correlation was observed (Fig. 4A
). Each ND10 was associated with a
GFP-GRIP1 focus, although not every GFP-GRIP1 focus associated with an
ND10 (i.e. there were more GRIP1 foci than ND10s). Careful
analysis of the two structures revealed that they do not completely
colocalize; rather they lie adjacent to each other (Fig. 4B
). However,
due to the resolution limits of light microscopy, it is not possible to
determine whether the two foci are physically associated by this
technique and is beyond the scope of this study.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Association of GFP-GRIP1 with ND10 Domains
GFP-GRIP1-expressing HeLa cells were fixed in paraformaldehyde and the
intranuclear localization of the ND10s was determined by indirect
immunofluorescence against PML. For A and C, the left
panel (green) is the GFP-GRIP1 vector, the
center (red) shows PML, and the
right panel is the overlay of the two. In the overlays,
yellow indicates regions of overlap between GRIP1 and
PML. A, Wild-type GRIP1. B, Expanded view of region indicated in
overlay of A. C, The five GFP-GRIP1 mutants used in this study.
|
|
Next, the ability of the GRIP1 mutants described above to localize with
the ND10s was investigated. Both
bHLH-PAS and nrbIIm+nrbIIIm
localize with the ND10s in a manner similar to that of wild-type
GFP-GRIP1 (Fig. 4C
;
bHLH PAS and nrbIIm + nrbIIIm).
GFP-GRIP1
AD1, which formed fewer foci per cell than full-length
GRIP1, did not localize with the ND10s (Fig. 4C
;
AD1). Finally,
GFP-GRIP1
AD2 and GFP-GRIP1
AD1+
AD2 were studied. Although
neither of these GRIP1 mutants form foci, the ND10s of these cells were
still intact (Fig. 4C
;
AD2 and
AD1 +
AD2), demonstrating that
the nuclear architecture was still intact in these cells. Together,
these results suggest that there are two classes of GRIP1 foci: those
that localize with the ND10 and those that do not. Furthermore, AD2 is
necessary for formation of all GRIP1 foci, and the AD1 region of GRIP1
appears to be necessary for the formation of the ND10-localized foci
but may be at least partially dispensable for the other class of
foci.
The results with
AD1 suggested that AD1 may interact with some
components of the ND10. Previously, LaMorte et al. (40)
showed that CBP is a component of the ND10. Furthermore, we have
demonstrated that AD1 is a CBP interaction domain (20). Therefore, CBP
may recruit the GRIP1 foci to the ND10s through AD1. To confirm that,
in our system, CBP localized within the ND10s, the distribution of CBP
was followed by indirect immunofluorescence (Fig. 5
). As expected, CBP localized to the
ND10s (Fig. 5A
) and associated with the GRIP1 foci (Fig. 5B
). Together,
these results support the hypothesis that CBP is involved in the
recruitment of the GRIP1 foci to the ND10s.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5. CBP Localizes with the GFP-GRIP1 Foci
A, Nontransfected HeLa cells were fixed with paraformaldehyde and the
distribution of PML (left panel) and CBP (middle
panel) was detected by indirect immunofluorescence as described
in Materials and Methods. The overlay of the two images
is shown in the right panel. B, GFP-GRIP1 localizes
adjacent to CBP. GFP-GRIP1 (left panel) and endogenous
CBP (middle panel) were identified. The overlay is shown
on the right.
|
|
The GRIP1 Foci Contain Ubiquitin and Colocalize with Components of
the Proteasome
Recently, OMalley and co-workers (41) have shown that several
members of the SRC family, including GRIP1, is degraded by the 26S
proteasome. Additionally, several groups have suggested that the ND10s
are sites of proteolytic degradation and associate with components of
the proteasome (42, 43, 44, 45, 46). Therefore, we investigated whether the GRIP1
foci also contained components of the proteasome. Indirect
immunofluorescence against several components of the proteasome found
that the core 20S proteasome, PA28
(a subunit of the 11S regulator)
and ubiquitin all accumulate within the GRIP1 foci (Fig. 6A
). However, these large accumulations
of proteasomes were not observed in cells where GRIP1 localized
in a diffuse distribution or in nontransfected cells (data not shown).
Therefore, it appears that the proteasome may be recruited to the GRIP1
foci. In addition, the
AD1 foci also associated with components of
the proteasome (Fig. 6B
). Therefore, recruitment of the proteasome to
the GRIP1 foci does not require the GRIP1 foci to be in association
with ND10s.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6. GRIP1 Foci Are Enriched in Ubiquitin and Components
of the Proteasome
A, GFP-GRIP1 (left column) expressing HeLa cells were
fixed in paraformaldehyde, and the intranuclear localization of several
components of the proteasome was detected by indirect
immunofluorescence (middle column). Antibodies used
were: PA28a, top row; ubiquitin, middle
row; core 20S proteasome, bottom row. The
overlay for each is shown in the right column. B,
GFP-GRIP1 AD1 (left panel) expressing HeLa cells were
fixed in paraformaldehyde, and the intranuclear localization of PA28a
was detected by indirect immunofluorescence (middle
panel). The overlay is shown in the right panel.
C and D, Histogram showing the distribution of area-corrected
intensities of a population of GFP-GRIP1 (C) and GFP-GRIP1 AD1 (D)
expressing cells either with (black bars) or without
(gray bars) the irreversible proteasome inhibitor
lactacystin. Percentage of total cell is plotted on the y-axis and the
intensity ranges are binned on the x-axis.
|
|
To determine whether GRIP1 is being degraded by the proteasome,
GFP-GRIP1 or GFP-GRIP1
AD2 was expressed in cells treated with the
irreversible proteasome inhibitor lactacystin or vehicle for 24 h.
The cells were then fixed and the area-corrected fluorescence intensity
of several hundred cells was determined as described in Materials
and Methods. The results of these analyses are shown in Fig. 6
, C
and D, as the percentage of GFP-expressing cells that occupy a defined
intensity range (bin). In cells expressing GFP-GRIP1 without
lactacystin (Fig. 6C
, gray bars) the majority of cells
(
80%) have an area-corrected intensity between 4060. However, in
the presence of lactacystin (Fig. 6C
, black bars), this
value falls to approximately 55%. In contrast, cells expressing
GFP-GRIP1
AD2 displayed a broader range of distributions with the
4060 and 6080 intensity ranges each containing between 30% and
40% of the cells in both the presence and absence of lactacystin (Fig. 6D
). This suggests that the AD2 region of the protein is essential for
proteasome degradation. Additional support for the importance of
the AD2 region in proteasome-mediated degradation was found in an
analysis of the higher intensity ranges. In the GFP-GRIP1 expressing
cells, the percentage of cells with an area-corrected intensity above
80 doubles in the presence of lactacystin (Fig. 6C
). In contrast,
lactacystin had no effect on the intensity distribution of GFP-GRIP1
AD2 with 27% of cells expressing this chimera having an
area-corrected intensity of more than 80 in both the presence and
absence of the inhibitor (Fig. 6D
). Combined with the previous results,
our observations demonstrate that GRIP1 is actively degraded by the
proteasome and that the AD2 region of the coactivator is essential for
this degradation to occur.
Intracellular Distribution of TRAM1/RAC3/AIB1/ACTR
Finally, we were interested in ascertaining whether the
intracellular distribution observed with GRIP1 was unique to GRIP1 or
common among the other SRCs. For this, we fused GFP to TRAM1 (47),
another member of the SRC family. As with GFP-GRIP1, when GFP-TRAM1 was
expressed in HeLa cells, a protein of the predicted molecular mass (190
kDa) was produced (160 kDa for TRAM1 and 30 kDa for GFP; Fig. 1B
). In
addition, GFP-TRAM1 was fully competent to potentiate GR-dependent
transcription from a MMTV-luciferase reporter (data not shown). The
pattern of intracellular distribution of GFP-TRAM1 was quite similar to
that seen with GFP-GRIP1 (Fig. 7A
) with
both diffuse and focal accumulation of TRAM1 being present. However,
the association of GFP-TRAM1 with the ND10s was somewhat different as
expression of GFP-TRAM1 appeared to induce a partial disruption of the
ND10s. This resulted in both fewer ND10s within the
nucleus and significant numbers of ND10s accumulating within the
cytoplasm (Fig. 7B
, compare PML, upper row, and PML,
lower row). This disruption occurred regardless of whether
GFP-TRAM1 was in a diffuse distribution or in the focal accumulation
(data not shown). However, most (but not all) of the remaining ND10s
were found to associate with the TRAM1 foci (Fig. 7B
, insets). Therefore, it seems that the formation of foci is
not a characteristic unique to GRIP1 and may, in fact, be a general
feature of the SRC family.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 7. TRAM1 Associates in Intranuclear Foci Analogous to
GRIP1
A, Live cell imaging of GFP-TRAM1-expressing HeLa cells showing the
three types of distributions observed with TRAM1. B, GFP-TRAM1
(left column) expressing HeLa cells were fixed in
paraformaldehyde, and the intranuclear localization of the ND10s was
determined by indirect immunofluorescence against PML (middle
panel). The overlay of each image pair is shown (right
panel). The top row shows a GFP-TRAM1 expressing
cell where the bottom row shows a control cell that is
not expressing GFP-TRAM1 (green is the pseudo coloring
of the background fluorescence) where GFP-TRAM1 is not expressed.
Insets in the top overlays show an expanded view of the
GFP-TRAM1-ND10 association.
|
|
 |
DISCUSSION
|
|---|
In this report, the intracellular distribution of GRIP1 was
studied using fusions to the GFP (GFP-GRIP1). GFP-GRIP1 has a
complex distribution with the chimera localizing in a diffuse
intranuclear distribution in approximately 8090% of the cells (Fig. 2A
, left panel) whereas in the remaining 1020% of cells,
GFP-GRIP1 was found in discrete intranuclear foci (Fig. 2A
, center and right panels). Formation of these foci was
dependent on the AD2 region of the protein that was also essential for
degradation by the proteasome. Similar focal accumulations were seen
previously for TIF2, the human ortholog of GRIP1 (5, 48). The GFP-GRIP1
foci contained components of the 26S proteasome and were found in
association with the PML-containing ND10s.
GRIP1 is a large protein with several characterized functional domains
(Fig. 1
) (4). Deletion studies of GFP-GRIP1 identified the C-terminal
region (AD1 and AD2) as being critical for foci formation.
Interestingly, it appears AD1 and AD2 may play distinct roles in foci
formation. As compared with the full-length protein, GFP-GRIP1
AD1
formed very few foci (Fig. 3C
) that did not associate with the
ND10s (Fig. 4C
). Since AD1 is the CBP interaction domain (20) and CBP
has been shown to colocalize with the ND10s (Fig. 5A
) (40), a
possible explanation for the requirement of the AD1
for ND10 association is its direct association with CBP. In contrast to
GFP-GRIP1
AD1, GFP-GRIP1
AD2 was unable to form foci in any cell
(Fig. 3D
). A possible explanation of this observation is that an
AD2-associated protein may directly recruit GRIP1 to the foci. To date
though, only two AD2 interacting proteins have been described, CARM1
(21) and mZac1 (22). Preliminary immunofluorescence studies found CARM1
to localize in a diffuse nucleoplasmic distribution with no evidence of
focal accumulations (C. T. Baumann, M. R. Stallcup, and
G. L. Hager, unpublished observations). In addition,
immunofluorescent experiments against hZac1 have shown it to localize
in a uniform nuclear distribution as well (49). Therefore, neither
hZac1 nor CARM1 is a likely candidate to directly recruit GRIP1 to the
foci, although at this point, we cannot say whether other, unidentified
proteins recruit GRIP1 to the foci. A second possibility is that
modification (i.e. phosphorylation, methylation, or
acetylation) of residues within AD2 triggers the recruitment of GRIP1
to the foci. This will be discussed more fully later in the paper.
A number of studies have found mammalian cells to contain multiple
subnuclear structures (50, 51). One of the most intensely studied of
these are the ND10s (39). ND10s are small nuclear structures consisting
of at least 10 proteins including PML, a growth suppresser implicated
in a wide variety of cellular function (52), SP100, first identified as
a target for autoimmune antibodies in primary biliary cirrhosis (53),
DAXX, identified as a Fas-interacting protein that links the receptor
to the JNK kinase pathway (54, 55), and CBP, a histone
acetyltransferase important for transcription activation in a variety
of systems (40). Here, we have shown that a subset of the GRIP1 foci
localize adjacent to the ND10s. Previously, it has been shown that
several double-stranded DNA viruses deposit their genomes at
sites adjacent to the ND10s as well (56). These deposition sites are
similar in size and orientation to the GRIP1 foci we have observed,
suggesting that there may be an underlying structure with which both
the viral deposition sites and the GRIP1 foci may associate.
The ND10s have been implicated in several intracellular processes,
including apoptosis (57, 58) and transcription (59, 60), and have been
found to be both spatially and functionally associated with the
ubiquitin- dependent proteasome (42, 44, 45, 46). Everett et
al. (45) found a ubiquitin-specific protease (HAUSP) that is
dynamically associated with the ND10s. HAUSP interacts with Vmw110
(ICP0), an immediate early gene product from herpes simplex virus
(HSV), which influences the latent/lytic decision of infecting HSV.
During viral infection, Vmw110 associates with the ND10s and
subsequently disrupts them. A recent study has also shown that
misfolded forms of the influenza virus nucleoprotein can recruit the
proteasome to the ND10s (46). In our studies, we have shown that
components of the proteasome are enriched in the GRIP1 foci (Fig. 6A
),
whereas when GRIP1 is distributed in a diffuse pattern, few, if any,
discrete structures are seen with the same proteasome antibodies (data
not shown). In cells expressing
AD1, the few foci that did form were
also enriched in components of the proteasome although they were not
associated with the ND10s. It is noteworthy that the number and size of
the structures identified by the antiproteasome antibodies correspond
quite well with the number and size of the GRIP1 foci. Therefore, it is
likely that the proteasome is recruited to the GRIP1 foci in a manner
similar to that seen by Anton et al. (46) with the influenza
virus nucleoprotein. In addition, recruitment of the proteasome to
GFP-GRIP1ÄAD1, which does not associate with the ND10s, indicates
that the proteasome can be recruited to intranuclear structures other
than the ND10s.
The intracellular levels of several members of the NHR family,
including the estrogen (61, 62), retinoic acid (63, 64) retinoic X
(64), peroxisome proliferator-activated receptor (PPAR) (65), and
progesterone receptors (66), are regulated by the ubiquitin-dependent
proteasome. In these cases, the addition of the appropriate ligand
agonist results in down-regulation of receptor levels by
ubiquitin-mediated proteasome degradation. Degradation of the
ligand-bound nuclear receptor is believed to play an important role in
"turning off" the hormone response and therefore functioning as an
additional level of regulation of the NHRs. Lazar and co-workers have
demonstrated that the intracellular levels of the nuclear corepressor
(N-CoR) are also mediated by the proteasome (67). In this study, a
mammalian homolog of the Drosophila Seven in absentia
(mSiah2) protein targets N-CoR for proteasome-mediated degradation in
cells expressing high levels of mSiah2 but not in cells limited
in mSiah2. This result begins to explain the cell type
specificity observed for nuclear receptor-mediated repression. Our
observations that GRIP1 can associate with proteasomes suggest that the
intracellular levels of the SRCs may also be regulated in a
proteasome-dependent manner. This is supported by the ability of
lactacystin to increase the levels of GFP-GRIP1 in treated cells (Fig. 6C
). Additionally, a recent paper has shown that several members of the
SRC family, including GRIP1, are degraded by the 26S proteasome (41).
Taken as a whole, these results clearly implicate the 26S proteasome in
the degradation of GRIP1 and suggest the protein turnover/stability may
be an important regulatory feature of GRIP1.
To be degraded by the 26S proteasome, GRIP1 would need to be
ubiquitinated. Ubiquitination of proteins generally requires a
so-called PEST sequence; a stretch of amino acids enriched in proline,
serine, threonine, and glutamic acid (68). Analysis of the GRIP1
protein by the PEST-FIND program (http://bioweb.
pasteur.fr/seqanal/interfaces/pestfind.html) has identified four
potential PEST sequences: one in the bHLH-PAS domain [amino acid
(a.a.) 205215], one between nrb boxes i and ii (a.a. 648679), one
between nrb boxes ii and iii (a.a. 713731), and one encompassing a.a.
788826 (Fig. 8
). Since the entire
bHLH-PAS region can be deleted with no observable effect on the
distribution of GRIP1 or the ability of the protein to potentiate
GR-dependent transcription (C. T. Baumann and G. L. Hager,
unpublished observations), the PEST between a.a. 205 and 215 does not
appear to be important in GRIP1 activity. Several transcription
factors, other than the NHRs, have been found to be degraded by the 26S
proteasome (69, 70, 71, 72). Comparison of the PEST sites and the activation
domains from these proteins has found that the two are inseparable from
one another (73). Therefore, it has been suggested that these proteins
may have evolved a tight coupling of the activation potentials and
degradation as a mechanism to carefully regulate their activity (73).
Since the nuclear receptor interaction domain (NID) is essential
for nuclear receptor-mediated transactivation, it is possible that a
similar regulatory mechanism has evolved for GRIP1 as well. Analysis of
the three potential PEST sequences within the nuclear receptor
interacting domain is currently underway.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 8. The Potential PEST Sites within the NID of GRIP1
Top, Schematic of the NID of GRIP1. The three nrb boxes
are indicated (black boxes) and are numbered iiii. The
potential PEST sites (black lines) are also indicated
below. Bottom, Amino acid sequence of the three
potential PEST sites found with the NID.
|
|
Of note, none of the predicted PEST sequences is located within the AD2
region. However, we have shown that the AD2 region of GRIP1 is
essential for both foci formation and proteasome degradation. Why then
is the AD2 region absolutely necessary for these functions? It is
possible that posttranslational modifications within the AD2 region may
target GRIP1 for degradation. For example, phosphorylation can serve as
a signal to target proteins for ubiquitination and subsequent
degradation (74, 75, 76, 77, 78). Analysis of the amino acid sequence of AD2 has
identified three consensus cdc2 phosphorylation sites and a consensus
mitogen-activated protein (MAP) kinase site. cdc2 is a cell
cycle-regulated protein kinase involved in regulating cell cycle
progression (79). Phosphorylation of proteins by cdc2 has been shown to
target them for ubiquitin-dependent degradation (80). As the kinase
activity of cdc2 is cell cycle regulated and the GRIP1 foci are found
in only 20% of the cells, it is intriguing to speculate that formation
of these foci may be cell cycle regulated through the cdc2 kinase. MAP
kinase has also been shown to target proteins for degradation (81, 81).
Specifically, phosphorylation of the ligand-bound human progesterone
receptor at serine 194 by MAP kinase targets it for degradation.
Analysis of these and other potential kinase sites within AD2 is an
area we are actively pursuing.
Recently TIF2, the human ortholog of GRIP1, was shown to be associated
with acute myeloid leukemia (AML) (82). In AML, a chromosomal
translocation results in the C-terminal region of TIF2 being fused to
the N terminus of a myeloid-specific histone acetyltransferase (MOZ).
The region of TIF2 contained within the MOZ-TIF2 fusion contains AD1
and AD2, both of which play a role in the ability of GFP-GRIP1 to form
foci. In a second subtype of AML, CBP was fused to MOZ (83). Although
the region of CBP responsible for ND10 association is unknown, one can
speculate that the MOZ-TIF2 fusion may by mislocalized through the AD2
of TIF2, resulting in an altered gene expression profile compared with
wild-type cells.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
pLTRLuc, pCMVIL2, and pRSVßGal were described pre-viously
(31). pEGFP-GRIP1 was constructed as follows. An EcoRI
fragment containing the GRIP1 cDNA was excised from pSG5-HA-GRIP1 (21)
and cloned into similarly cut pEGFP-C2 (CLONTECH Laboratories, Inc. Palo Alto, CA). pEGFP-GRIP1
AD1, pEGFP-GRIP1
AD2,
pEGFP-GRIP1
AD1 +AD2, and pEGFP-GRIP1 nrbIIm+nrbIIIm were constructed
as described for pEGFP-GRIP1 except
pSG5-HA-GRIP1
1057-1109
(20), pSG5-HA-GRIP15-1121
(21), pSG5-HA-GRIP1
AD1+AD2 (H. Ma and M. R.Stallcup,
unpublished results), and pSG5-HA-GRIP1 nrbIIm+nrbIIIm (20),
respectively, were used. pEGFP-GRIP1-
bHLH-PAS was
constructed as follows. Site-directed mutagenesis using the QuikChange
mutagenesis kit (Stratagene, La Jolla, CA) was used to
introduce an AflII site at positions 231236 and an
EcoRV site at 1,2121,217 in pEGFP-GRIP1 (numbering based
on nucleotide sequence from the GenBank entry U39060). The following
oligonucleotides were used in the mutagenesis.
GGGATGGGAGAAAACACCTCTCTTAAGTCCAGGGCAGAGACCAG-
AAAACGC and GCGTTTTCTGGTCTCTGCCCTGGACTTA-
AGAGAGGTGTTTTCTCCCATCCC were used to introduce the
AflII site and GGGTTGGCGTTCAGTCAGATCGAT ATCTTTT-
CT TTGTCTGATGGCACTCTCG and
CGAGAGTGCCATCAGACAAAGAAAAGATATCGATCTGACTACGCCAACCC
were used to introduce the EcoRV site. Bold
letters represent the bases changed to introduce the appropriate
restriction enzyme site. The resulting vector was digested with
EcoRV and AflII and closed with a linker to
reintroduce the nuclear localization signal that was lost in the
original EcoRV/AflII fragment
(GAGACTTAAGTCCAGGGCAGAGACCAGAAAACGCAAGGATATCGAGA and
TCTCGATATCCTTGCGTTTTCTGGTCTCTGCCCTGGAC- TTAAGTCTC).
To construct pEGFP-TRAM1, the TRAM1 cDNA was amplified by PCR from
pBKCMV-TRAM1 (47) with oligonucleotides that added a XhoI
site at the 5'-end of the gene and a KpnI site at the
3'-end. The resulting PCR product was cut with XhoI and
KpnI and cloned into similarly cut pEGFP-C1.
Cell Culture and Transfections
HeLa cells were routinely maintained in DMEM + 10% FBS + 100
U/ml penicillin and streptomycin + 2 mM
L-glutamine at 37 C and 5% CO2 in a
water-jacketed incubator. Cells were typically split 1:4 every other
day. Where indicated, cells were treated with 1 uM
lactacystin (Alexis Chemicals, San Diego, CA) in EtOH for
24 h. Transfections were done by the calcium phosphate procedure
(Invitrogen, Carlsbad, CA).
Transactivations and Western Blot Analyses
For transactivation assays, 5 x 106
HeLa cells were plated in a 100-mm dish in DMEM + 10%
charcoal-stripped FBS and transfected with 5 µg pLTRLuc and 0.5 mg
pRSVßGal with and without 5 mg of the indicated GRIP1 expression
vector. The following day, cells were washed with PBS and treated with
100 nM dexamethasone for 6 h. Cells were harvested by
scraping, and luciferase and ß-galactosidase assays were done as
described (31). For Western blots, 5 x 106
cells were transfected with 20 µg pEGFP-GRIP1 and 20 µg pCMVIL2 as
described above. The next day, the transfected population of cells was
enriched by sorting with anti-IL2-coated magnet beads, and whole cell
extracts were made as described previously (31). Extract (20 mg) was
run on a 7.5% SDS-PAGE and electrotransferred to Immobilon-P
(Millipore Corp., Bedford, MA) in 192 mM
glycine, 25 mM Tris, 20% methanol, and 0.1% SDS for
18 h at 100 mA. GFP-fusion proteins were detected by a polyclonal
anti-GFP (CLONTECH Laboratories, Inc.) at a 1:500 dilution
and a horseradish peroxidase (HRP)-conjugated goat antirabbit at
1:10,000 (Jackson ImmunoResearch Laboratories, Inc., West
Grove, PA).
Immunofluorescence
Cells (2 x 105)
were plated onto coverslips in a six-well dish
and transfected with 0.5 mg of the indicated GFP-fusion vector. The
following day, cells were washed two times with PBS (without
Ca2+ and Mg2+), fixed for
20 min in freshly prepared 3.5% paraformaldehyde in PBS (without
Ca2+ and Mg2+), washed two
times with PBS (without Ca2+ and
Mg2+), and permeabilized with 0.5% Triton-X 100
in PBS (without Ca2+ and
Mg2+). Primary antibodies were incubated with
cells on coverslips at the dilutions suggested by the manufacturer
overnight at 4 C in PBS (without Ca2+ and
Mg2+) + 10% normal calf serum. The next day, the
coverslips were washed three times in PBS (without
Ca2+ and Mg2+) + 10%
normal calf serum and incubated with the fluorescently conjugated
secondary antibody for 1 h at room temperature in PBS + 10%
normal calf serum. Coverslips were then washed three times with PBS
(without Ca2+ and Mg2+) +
10% normal calf serum, once in PBS (without Ca2+
and Mg2+), once in PBS (without
Ca2+ and Mg2+) + 0.5 mg/ml
Hoechst 33342 (to visualize DNA), and once in
dH2O (to remove residual salts). Coverslips were
then mounted on quartz microscope slides in Vectashield (Vector Laboratories, Inc., Burlingame, CA). The following antibodies
were used for these studies. Primary antibodies: PML, mouse anti-PML
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA); CBP,
rabbit anti-CBP NT (Upstate Biotechnology, Inc. Lake
Placid, NY); ubiquitin, rabbit antiubiquitin (Affiniti Research
Products, Ltd, Exeter, UK); PA28
, rabbit anti-PA28
(Affiniti
Research Products, Ltd, Exeter, UK); and 20S core proteasome, rabbit,
anti-core (Affiniti Research Products, Ltd, Exeter, UK). Secondary
antibodies: to visualize PML, ubiquitin, PA28
, and the core 20S
proteasome, Texas Red-conjugated secondary antibodies were used of the
appropriate species specificity (Calbiochem-
Novabiochem Corp, La Jolla, CA). To visualize CBP, Cy5-conjugated
goat-antirabbit antibodies were used (Amersham Pharmacia Biotech, Inc, Piscataway, NJ). All secondary antibodies were
used at a 1:250 dilution.
Cell Extractions
Cell extractions were done as follows. HeLa cells (2 x
105) were transfected with 0.5 mg pEGFP-GRIP1 as
described above. The next day, cells were washed with ice-cold PBS and
sequentially extracted with CSK buffer (100 mM NaCl, 300
mM sucrose, 10 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.8,
3 mM MgCl2, 0.5% Triton-X
100, and protease inhibitor cocktail
(Calbiochem-Novabiochem Corp.) for 10 min at 4 C followed
by extraction buffer (250 mM ammonium sulfate,
300 mM sucrose, 10 mM
PIPES, pH 6.8, 3 mM MgCl2,
0.5 Triton-X 100, and protease inhibitor cocktail
(Calbiochem-Novabiochem Corp.) for 5 min at 4 C followed
by 10 mg/ml DNase I in CSK (with 50 mM NaCl
instead of 100 mM) for 1 h at room
temperature. The process was stopped by fixation in 3.5%
paraformaldehyde for 20 min at room temperature, washed, and mounted as
described above.
Fluorescence Imaging
Live-cell microscopy of GFP-fusion proteins was performed on a
Leica Corp. TCS-SP confocal microscope mounted on a DMIRBE
inverted microscope (Leica Corp. Microsystems, Exton,
PA). GFP was excited with the 488-nm laser line of an air-cooled
Ar laser (20 mW nominal output, Coherent Inc., Santa Clara, CA). GFP
emission was monitored between 505 nm and 590 nm, and the cells were
maintained at 37 C with a Nevtek ASI 400 Air Stream Incubator (Nevtek,
Burnsville, VA). For immunofluorescent studies, images were acquired
with either a Eclipse E800 (Nikon, Melville, NY) equipped
with a Micromax cooled CCD (Roper Scientific, Trenton, NJ) or a IE80
(Olympus Corp., Lake Success, NY) equipped with a
Deltavision image acquisition and analysis package (Applied Precision,
Inc., Issaquah, WA). Standard filter sets were used for all imaging
(Chroma Technology Corp., Brattleboro, VT) All images were processed as
tiffs on Corel Photo-Paint (Corel Corp., Ontario, Canada) using
standard image processing techniques.
Quantitative Analysis
The area-corrected intensity of the GFP-GRIP1 expressing cells
was determined using the MetaMorph image analysis software package
(Universal Imaging Corp, West Chester, PA). First, the nucleus was
encircled (using the polygon tool) and the total fluorescence intensity
and total area of the nucleus were determined. Background fluorescence
was determined by measuring the total fluorescence of a random region
within the field of view and dividing that value by the total area of
that region to give the total background per unit area (BA) within the
field of view. The BA was then multiplied by the total area of the
nucleus to give the total background within the nucleus (BN). This
value was then subtracted from the total fluorescence intensity of the
nucleus to give the background-corrected intensity of the nucleus (FN).
For each experiment, the area-corrected intensity of several hundred
cells was determined.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Gordon Hager, Laboratory of Receptor Biology & Gene Expression, National Cancer Institute, NIH Building 41, Room B602, Bethesda, Maryland 20892-5055. E-mail:
hagerg{at}exchange.nih.gov
1 Current Address: Instituto de Bioquimica Vegetal y Fotosintesis,
Centro de Investigaciones Isla de la Cartuja, Av. Americo Vespucio s/n,
41092 Sevilla Spain. 
2 Current Address: Department of Pharmaceutics and Pharmaceutical
Chemistry, University of Utah, Salt Lake City, Utah 84108. 
Received for publication May 30, 2000.
Revision received November 22, 2000.
Accepted for publication December 19, 2000.
 |
REFERENCES
|
|---|
-
Giguere V 1999 Orphan nuclear receptors: from gene to
function. Endocr Rev 20:689725[Abstract/Free Full Text]
-
Feng W, Ribiero RCJ, Wagner RL, Nguyen H, Apriletti JW,
Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent
coactivator binding to a hydrophobic cleft on nuclear receptors.
Science 280:17471749[Abstract/Free Full Text]
-
Onate SA, Tsai SY, Tsai MJ, OMalley BW 1995 Sequence and
characterization of a coactivator for the steroid hormone receptor
superfamily. Science 270:13541357[Abstract/Free Full Text]
-
Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a
transcriptional coactivator for the AF-2 transactivation domain of
steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:27352744[Abstract]
-
Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent
activation function AF-2 of nuclear receptors. EMBO J 15:36673675[Medline]
-
Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan
XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid
receptor coactivator amplified in breast and ovarian cancer. Science 277:965968[Abstract/Free Full Text]
-
Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L,
Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator
ACTR is a novel histone acetyltransferase and forms a multimeric
activation complex with P/CAF and CBP/p300. Cell 90:569580[CrossRef][Medline]
-
Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear
receptor-associated coactivator that is related to SRC-1 and TIF2. Proc
Natl Acad Sci USA 94:84798484[Abstract/Free Full Text]
-
Westin S, Rosenfeld MG, Glass CK 2000 Nuclear receptor
coactivators. Adv Pharmacol 47:89112
-
Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor
coactivators. Curr Opin Cell Biol 9:222232[CrossRef][Medline]
-
Yao TP, Ku G, Zhou N, Scully R, Livingston DM 1996 The nuclear
hormone receptor coactivator SRC-1 is a specific target of p300. Proc
Natl Acad Sci USA 93:1062610631[Abstract/Free Full Text]
-
Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR,
Frail DE 1998 A transcriptional coactivator, steroid receptor
coactivator-3, selectively augments steroid receptor
transcriptional activity. J Biol Chem 273:2764527653[Abstract/Free Full Text]
-
Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor
complexes in nuclear receptor function. Curr Opin Genet Dev 9:140147[CrossRef][Medline]
-
Szapary D, Huang Y, Simons Jr SS 1999 Opposing effects of
corepressor and coactivators in determining the dose-response curve of
agonists, and residual agonist activity of antagonists, for
glucocorticoid receptor-regulated gene expression. Mol Endocrinol 13:21082121[Abstract/Free Full Text]
-
Pugh BF, Tjian R 1990 Mechanism of transcriptional activation
by Sp1: evidence for coactivators. Cell 61:11871197[CrossRef][Medline]
-
Henttu PM, Kalkhoven E, Parker MG 1997 AF-2 activity and
recruitment of steroid receptor coactivator 1 to the estrogen receptor
depend on a lysine residue conserved in nuclear receptors. Mol Cell
Biol 17:18321839[Abstract]
-
DiRenzo J, Soderstrom M, Kurokawa R, Ogliastro MH, Ricote M,
Ingrey S, Horlein A, Rosenfeld MG, Glass CK 1997 Peroxisome
proliferator-activated receptors and retinoic acid receptors
differentially control the interactions of retinoid X receptor
heterodimers with ligands, coactivators, and corepressors. Mol Cell
Biol 17:21662176[Abstract]
-
Goldman PS, Tran VK, Goodman RH 1997 The multifunctional role
of the co-activator CBP in transcriptional regulation. Recent Prog Horm
Res 52:103119
-
Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone
acetyltransferases. Cell 87:953959[CrossRef][Medline]
-
Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee
GA, Stallcup MR 1999 Multiple signal input and output domains of the
160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:61646173[Abstract/Free Full Text]
-
Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW,
Stallcup MR 1999 Regulation of transcription by a protein
methyltransferase. Science 284:21742177[Abstract/Free Full Text]
-
Huang SM, Stallcup MR 2000 Mouse Zac1, a
transcriptional coactivator and repressor for nuclear receptors. Mol
Cell Biol 20:18551867[Abstract/Free Full Text]
-
Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA,
McKenna NJ, Onate SA, Tsai SY, Tsai MJ, OMalley BW 1997 Steroid
receptor coactivator-1 is a histone acetyltransferase. Nature 389:194198[CrossRef][Medline]
-
Munck A, Naray-Fejes-Toth A 1992 The ups and downs of
glucocorticoid physiology. Permissive and suppressive effects
revisited. Mol Cell Endocrinol 90:C1C4
-
Hu JM, Bodwell JE, Munck A 1994 Cell cycle-dependent
glucocorticoid receptor phosphorylation and activity. Mol Endocrinol 8:17091713[Abstract]
-
Munck A, Naray-Fejes-Toth A 1994 Glucocorticoids and stress:
permissive and suppressive actions. Ann NY Acad Sci 746:115130;
discussion 131133[Abstract]
-
van Steensel B, Jenster G, Damm K, Brinkmann AO, van Driel R 1995 Domains of the human androgen receptor and glucocorticoid receptor
involved in binding to the nuclear matrix. J Cell Biochem 57:465478[CrossRef][Medline]
-
van Steensel B, Brink M, van der Meulen K, van Binnendijk EP,
Wansink DG, de Jong L, de Kloet ER, van Driel R 1995 Localization of
the glucocorticoid receptor in discrete clusters in the cell nucleus.
J Cell Sci 108:30033011[Abstract]
-
Htun H, Barsony J, Renyi I, Gould DJ, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intranuclear
organization in living cells with a green fluorescent protein chimera.
Proc Natl Acad Sci USA 93:48454850[Abstract/Free Full Text]
-
Smith CL, Wolford RG, ONeill TB, Hager GL 2000 Characterization of transiently- and constitutively-expressed
progesterone receptors: evidence for two functional states. Mol
Endocrinol 14:956971[Abstract/Free Full Text]
-
Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL, Hager GL 1999 Differential localization and activity of the A and B forms of the
human progesterone receptor using green fluorescent protein chimeras.
Mol Endocrinol 13:366375[Abstract/Free Full Text]
-
Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct
visualization of ligand occupied and unoccupied human estrogen receptor
reveals a role for ligand in the nuclear distribution of the
receptor. Mol Biol Cell 10:471486[Abstract/Free Full Text]
-
Hager GL, Lim CS, Elbi C, Baumann CT 2000 Trafficking of
nuclear receptors in living cells. In: Estrogens and Womens Health:
Benefit or Threat. J Steroid Biochem Mol Biol 74:249254[CrossRef][Medline]
-
Baumann CT, Lim CS, Hager GL 1999 Intracellular localization
and trafficking of steroid receptors. Cell Biochem Biophys 31:119127[CrossRef][Medline]
-
Baumann CT, Maruvada P, Hager GL, Yen PM 2001 Nuclear-cytoplasmic shuttling by thyroid hormone receptors: multiple
protein interactions are required for nuclear retention. J Biol Chem,
in press
-
Mckenna NJ, Lanz RB, OMalley BW 1999 Nuclear receptor
coregulators: cellular and molecular biology. Endocr Rev 20:321344[Abstract/Free Full Text]
-
Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ,
Stallcup MR 1998 Nuclear receptor-binding sites of coactivators
glucocorticoid receptor interacting protein 1 (GRIP1) and steroid
receptor coactivator 1 (SRC-1): multiple motifs with different binding
specificities. Mol Endocrinol 12:302313[Abstract/Free Full Text]
-
Maul GG, Negorev D, Bell P, Ishov AM 2000 Review:
properties and assembly mechanisms of ND10, PML bodies, or PODs. J
Struct Biol 129:278287[CrossRef][Medline]
-
Sternsdorf T, Grotzinger T, Jensen K, Will H 1997 Nuclear
dots: actors on many stages. Immunobiology 198:307331[Medline]
-
LaMorte VJ, Dyck JA, Ochs RL, Evans RM 1998 Localization of
nascent RNA and CREB binding protein with the PML-containing nuclear
body. Proc Natl Acad Sci USA 95:49914996[Abstract/Free Full Text]
-
Lonard DM, Nawaz Z, Smith CL, OMalley BW 2000 The 26S
proteasome is required for estrogen receptor-
and coactivator
turnover and for efficient estrogen receptor-
transactivation. Mol
Cell 5:939948[CrossRef][Medline]
-
Everett RD, Maul GG 1994 HSV-1 IE protein Vmw110 causes
redistribution of PML. EMBO J 13:50625069[Medline]
-
Everett RD, Earnshaw WC, Pluta AF, Sternsdorf T, Ainsztein AM,
Carmena M, Ruchaud S, Hsu WL, Orr A 1999 A dynamic connection between
centromeres and ND10 proteins. J Cell Sci 112:34433454[Abstract]
-
Chelbi-Alix MK, de The H 1999 Herpes virus induced
proteasome-dependent degradation of the nuclear bodies-associated PML
and Sp100 proteins. Oncogene 18:935941[CrossRef][Medline]
-
Everett RD, Freemont P, Saitoh H, Dasso M, Orr A, Kathoria M,
Parkinson J 1998 The disruption of ND10 during herpes simplex virus
infection correlates with the Vmw110- and proteasome-dependent loss of
several PML isoforms. J Virol 72:65816591[Abstract/Free Full Text]
-
Anton LC, Schubert U, Bacik I, Princiotta MF, Wearsch PA,
Gibbs J, Day PM, Realini C, Rechsteiner MC, Bennink JR, Yewdell JW 1999 Intracellular localization of proteasomal degradation of a viral
antigen. J Cell Biol 146:113124[Abstract/Free Full Text]
-
Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule,
exhibits distinct properties from steroid receptor coactivator-1.
J Biol Chem 272:2762927634[Abstract/Free Full Text]
-
Carrero P, Okamoto K, Coumailleau P, OBrien S, Tanaka H,
Poellinger L Redox-regulated recruitment of the transcriptional
coactivators CREB-binding protein and SRC-1 to hypoxia-inducible factor
1
. Mol Cell Biol 20:402415
-
Varrault A, Ciani E, Apiou F, Bilanges B, Hoffmann A,
Pantaloni C, Bockaert J, Spengler D, Journot L 1998 hZAC encodes a zinc
finger protein with antiproliferative properties and maps to a
chromosomal region frequently lost in cancer. Proc Natl Acad Sci USA 95:88358840[Abstract/Free Full Text]
-
Gall JG, Tsvetkov A, Wu Z, Murphy C 1995 Is the sphere
organelle/coiled body a universal nuclear component? Dev Genet 16:2535[CrossRef][Medline]
-
Misteli T, Caceres JF, Spector DL 1997 The dynamics of a
pre-mRNA splicing factor in living cells. Nature 387:523527[CrossRef][Medline]
-
Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T,
Carmo-Fonseca M, Lamond A, Dejean A 1994 Retinoic acid regulates
aberrant nuclear localization of PML-RAR
in acute promyelocytic
leukemia cells. Cell 76:345356[CrossRef][Medline]
-
Sternsdorf T, Jensen K, Reich B, Will H 1999 The nuclear dot
protein sp100, characterization of domains necessary for dimerization,
subcellular localization, and modification by small ubiquitin-like
modifiers. J Biol Chem 274:1255512566[Abstract/Free Full Text]
-
Torii S, Egan DA, Evans RA, Reed JC 1999 Human Daxx regulates
Fas-induced apoptosis from nuclear PML oncogenic domains (PODs). EMBO J 18:60376049[CrossRef][Medline]
-
Ishov AM, Sotnikov AG, Negorev D, Vladimirova OV, Neff N,
Kamitani T, Yeh ET, Strauss JF, III, Maul GG 1999 PML is critical for
ND10 formation and recruits the PML-interacting protein daxx to this
nuclear structure when modified by SUMO-1. J Cell Biol 147:221234[Abstract/Free Full Text]
-
Maul GG 1998 Nuclear domain 10, the site of DNA virus
transcription and replication. Bioessays 20:660667[CrossRef][Medline]
-
Wang ZG, Ruggero D, Ronchetti S, Zhong S, Gaboli M, Rivi R,
Pandolfi PP 1998 PML is essential for multiple apoptotic pathways. Nat
Genet 20:266272[CrossRef][Medline]
-
Quignon F, De Bels F, Koken M, Feunteun J, Ameisen JC, de The
H 1998 PML induces a novel caspase-independent death process. Nat Genet 20:259265[CrossRef][Medline]
-
Vallian S, Gaken JA, Trayner ID, Gingold EB, Kouzarides T,
Chang KS, Farzaneh F 1997 Transcriptional repression by the
promyelocytic leukemia protein, PML. Exp Cell Res 237:371382[CrossRef][Medline]
-
Alcalay M, Tomassoni L, Colombo E, Stoldt S, Grignani F,
Fagioli M, Szekely L, Helin K, Pelicci PG 1998 The promyelocytic
leukemia gene product (PML) forms stable complexes with the
retinoblastoma protein. Mol Cell Biol 18:10841093[Abstract/Free Full Text]
-
Nawaz Z, Lonard DM, Dennis AP, Smith CL, OMalley BW 1999 Proteasome-dependent degradation of the human estrogen receptor. Proc
Natl Acad Sci USA 96:18581862[Abstract/Free Full Text]
-
Alarid ET, Bakopoulos N, Solodin N 1999 Proteasome-mediated
proteolysis of estrogen receptor: a novel component in autologous
down-regulation. Mol Endocrinol 13:15221534[Abstract/Free Full Text]
-
Zhu J, Gianni M, Kopf E, Honore N, Chelbi-Alix M, Koken M,
Quignon F, Rochette-Egly C, de The H 1999 Retinoic acid induces
proteasome-dependent degradation of retinoic acid receptor
(RAR
)
and oncogenic RAR
fusion proteins. Proc Natl Acad Sci USA 96:1480714812[Abstract/Free Full Text]
-
Boudjelal M, Wang Z, Voorhees JJ, Fisher GJ
Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor
and retinoid X receptor
in human keratinocytes. Cancer Res 60:22472252
-
Hauser S, Adelmant G, Sarraf P, Wright HM, Mueller E,
Spiegelman BM 2000 Degradation of the peroxisome proliferator-activated
receptor (PPAR)
is linked to ligand-dependent activation. J
Biol Chem 275:1852718533[Abstract/Free Full Text]
-
Syvala H, Vienonen A, Zhuang YH, Kivineva M, Ylikomi T,
Tuohimaa P 1998 Evidence for enhanced ubiquitin- mediated
proteolysis of the chicken progesterone receptor by progesterone. Life
Sci 63:15051512[CrossRef][Medline]
-
Zhang J, Guenther MG, Carthew RW, Lazar MA 1998 Proteasomal
regulation of nuclear receptor corepressor-mediated repression. Genes
Dev 12:17751780[Abstract/Free Full Text]
-
Rechsteiner M 1989 PEST regions, proteolysis and cell cycle
progression. Rev Biol Cell 20:235253
-
Salghetti SE, Kim SY, Tansey WP 1999 Destruction of Myc by
ubiquitin-mediated proteolysis: cancer-associated and transforming
mutations stabilize Myc. EMBO J 18:717726[CrossRef][Medline]
-
Treier M, Staszewski LM, Bohmann D 1994 Ubiquitin-dependent
c-Jun degradation in vivo is mediated by the
domain.
Cell 78:787798[CrossRef][Medline]
-
Chowdary DR, Dermody JJ, Jha KK, Ozer HL 1994 Accumulation of
p53 in a mutant cell line defective in the ubiquitin pathway. Mol Cell
Biol 14:19972003[Abstract/Free Full Text]
-
Campanero MR, Flemington EK 1997 Regulation of E2F through
ubiquitin-proteasome-dependent degradation: stabilization by the pRB
tumor suppressor protein. Proc Natl Acad Sci USA 94:22212226[Abstract/Free Full Text]
-
Salghetti SE, Muratani M, Wijnen H, Futcher B, Tansey WP
Functional overlap of sequences that activate transcription and signal
ubiquitin-mediated proteolysis. Proc Natl Acad Sci USA 97:31183123
-
Ku NO, Omary MB Keratins turn over by ubiquitination in a
phosphorylation-modulated fashion. J Cell Biol 149:547552
-
Breitschopf K, Haendeler J, Malchow P, Zeiher AM, Dimmeler S
Posttranslational modification of Bcl-2 facilitates its
proteasome-dependent degradation: molecular characterization of the
involved signaling pathway. Mol Cell Biol 20:18861896
-
Mitsui A, Sharp PA 1999 Ubiquitination of RNA polymerase II
large subunit signaled by phosphorylation of carboxyl-terminal domain.
Proc Natl Acad Sci USA 96:60546059[Abstract/Free Full Text]
-
Montagnoli A, Fiore F, Eytan E, Carrano AC, Draetta GF,
Hershko A, Pagano M 1999 Ubiquitination of p27 is regulated by
Cdk-dependent phosphorylation and trimeric complex formation. Genes Dev 13:11811189[Abstract/Free Full Text]
-
Alessandrini A, Chiaur DS, Pagano M 1997 Regulation of the
cyclin-dependent kinase inhibitor p27 by degradation and
phosphorylation. Leukemia 11:342345[CrossRef][Medline]
-
Krek W, Nigg EA 1991 Differential phosphorylation of
vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell
cycle: identification of major phosphorylation sites. EMBO J 10:305316[Medline]
-
Benito J, Martin-Castellanos C, Moreno S 1998 Regulation of
the G1 phase of the cell cycle by periodic stabilization and
degradation of the p25rum1 CDK inhibitor. EMBO J 17:482497[CrossRef][Medline]
-
Lange CA, Shen T, Horwitz KB 2000 Phosphorylation of human
progesterone receptors at serine-294 by mitogen-activated protein
kinase signals their degradation by the 26S proteasome. Proc Natl Acad
Sci USA 97:10321037[Abstract/Free Full Text]