| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Laboratory of Receptor Biology and Gene Expression (C.T.B., R.W.,
J.C.R., C.L., G.L.H.) National Cancer Institute National
Institutes of Health Bethesda, Maryland 20892-5055
Molecular Regulation & Neuroendocrinology Section (P.M.,
P.M.Y.) Clinical Endocrinology Branch National Institute of
Diabetes, Digestive and Kidney Diseases National Institutes of
Health Bethesda, Maryland 20892
Department of Pathology
(H.M., M.R.S.) University of Southern California Los Angeles,
California 90033
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, and ubiquitin. In addition, the irreversible
proteasome inhibitor lactacystin induced an increase in the total
fluorescence intensity of the GFP-GRIP1 expressing cells, demonstrating
that GRIP1 is degraded by the proteasome. These findings suggest the
intriguing possibility that degradation of GRIP1 by the 26S proteasome
may be a key component of its regulation. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The mechanism by which the SRCs potentiate transcription from the NHRs has been the focus of intense study (2, 7, 9, 11, 12, 13, 14). The accepted model is that the SRCs act as bridging proteins. In this role, the ligand-bound NHRs bind to and recruit the SRCs to a target promoter (2, 4, 7, 15, 16, 17). The SRCs, in turn, interact with and recruit additional proteins to the hormone-responsive promoter (7, 11, 18). To date, a number of proteins have been found to interact with SRCs. The histone acetyltransferase CBP and its homolog p300 interact with AD1 (19, 20). Additionally, recent studies have found two proteins that interact with AD2, CARM1 (21) and mZac1 (22). CARM1 is a protein methyltransferase that can methylate histone H3 in vitro. Therefore, the recruitment of proteins capable of posttranslational modification appears to be a major way in which the SRCs potentiate NHR transcription. In addition, several of the SRCs, including SRC-1 (23) and ACTR (7), have been shown to be histone acetyltransferases themselves, allowing for yet another mechanism by which the SRCs activate transcription through the NHRs.
The activities of NHRs are regulated at several levels, including ligand binding and posttranslational modifications (24, 25, 26). Recently, changes in the intracellular distribution of the NHRs has also been shown to be an important component of their regulation (27, 28, 29, 30, 31, 32, 33, 34, 35). In stark contrast, little is known about the regulation of the SRCs. As a starting point for the study of SRC regulation, the intracellular distribution of GRIP1 was studied in living cells by constructing green fluorescent protein (GFP)-fusions to full-length GRIP1 and a panel of GRIP1 deletion mutants. We have found that in a subpopulation of cells, GFP-GRIP1 localizes in discrete nuclear foci, the formation of which was dependent on the C-terminal AD2 region. A subset of these foci associated with the promyelocytic leukemia gene product (PML)- and CBP-containing ND10 domains in an AD1-dependent manner. Furthermore, all of the foci are enriched in components of the 26S proteasome, and the addition of an inhibitor of the 26S proteasome induced an increase in the total cellular fluorescence of the GFP-GRIP1 expressing cells. These observations have allowed us to speculate that the activity of GRIP1 may, in part, be modulated by the ubiquitin-dependent proteasome pathway.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). GFP-GRIP1 was expressed in HeLa
cells and found to be the predicted molecular mass of 190 kDa (160
kDa for GRIP1 + 30 kDa for GFP; Fig. 1B). In addition, GFP-GRIP1 was
fully competent to activate GR-dependent transcription from a mouse
mammary tumor virus (MMTV)-luciferase reporter (Fig. 1C). When
expressed in HeLa cells, GFP-GRIP1 localized within the nucleus and was
excluded from nucleoli (Fig. 2A). In the
majority of cells, GFP-GRIP1 was found in a diffuse nucleoplasmic
distribution (Fig. 2A, left panel). However, in a fraction
of cells (10–20%) GFP-GRIP1 localized in discrete intranuclear foci,
either with (Fig. 2A, center panel) or without (Fig. 2A, right panel) a diffuse nucleoplasmic background. Within a
given population of cells, the number of these foci ranged from 10–15
to hundreds per cell. The percentage of cells in which GRIP1
accumulated in foci remained unchanged when the amount of transfected
GFP-GRIP1 expression vector varied from 10 ng to 10 mg (data not
shown). Additionally, no correlation was observed between the total
fluorescence intensity of an individual cell and the presence or
absence of foci, indicating that the focal accumulation of GFP-GRIP1
was not simply an artifact of overexpression. Treatment of cells with
dexamethasone or 9- cis-retinoic acid, agonists for the
glucocorticoid receptor and retinoic X receptor, respectively (both of
which are expressed in HeLa cells), had no effect on the intracellular
distribution of GFP-GRIP1 (data not shown), suggesting that the
distribution was independent of nuclear receptor binding. Similar foci
were seen when GFP-GRIP1 was expressed in mouse mammary adenocarcinoma
cell line 1471.1 (C. T. Baumann, and G. L. Hager, unpublished
observations) and normal human fibroblasts (A. Ishov and G. Maul,
personal communication), demonstrating that the observed distribution
of GFP-GRIP1 was not unique to HeLa cells. To ensure that the GFP tag
was not altering the distribution of GRIP1, an hemagglutinin
(HA)-tagged GRIP1 was expressed in HeLa cells and localized by indirect
immunofluorescence against the hemagglutinin (HA) epitope (Fig. 2B). HA-GRIP1 was found in both diffuse and focal distributions as was
observed for the GFP-tagged variant, demonstrating that the GFP moiety
had no observable effect on the intracellular distribution of GRIP1.
Analysis of the distribution of endogenous GRIP1 was hampered by the
inability of the currently available GRIP1/TIF2 antibodies to recognize
either the endogenous GRIP1 or a transiently expressed protein (data
not shown).
|
|
). The diffusely distributed GFP-GRIP1 was lost upon the
first CSK detergent extraction (Fig. 2C, top row),
indicating that this pool of GFP-GRIP1 was freely soluble within the
nucleoplasm. In contrast, the focal accumulations of GRIP1 were
resistant even to DNase I treatment (Fig. 2C, bottom row),
demonstrating that the GFP-GRIP1 foci associate with an insoluble,
nonchromatin component of the nucleus.
The C Terminus of GRIP1 Is Essential for Foci Formation
GRIP1 is a large protein with several defined functional domains
(Fig. 1) (4). To determine which region of GRIP1 was responsible for
foci formation, GFP fusions were made to a series of GRIP1 mutants
(Fig. 3, A–E). The N-terminal bHLH-PAS
region is the most highly conserved region among members of the SRC
family (36). However, deletion of this domain (
bHLH-PAS) had no
observable effect on the intranuclear distribution of the chimera (Fig. 3A). Similarly, the intranuclear distribution of nrbIIm+nrbIIIm, a
GRIP1 mutation that does not interact with GR (37), was also unchanged
as compared with the full-length protein (Fig. 3B). Therefore,
interactions with GR do not appear to be essential for GRIP1 to
localize to foci, which is in agreement with the lack of effect
dexamethasone had on the intracellular distribution of the chimera
(data not shown). The C-terminal region of GRIP1 contains two well
defined activation domains, AD1 and AD2 (20, 21). Deletion of AD1
(AD1) had a dramatic effect on the intracellular distribution of
GFP-GRIP1, with a loss of nearly all foci (Fig. 3C). In a few cells
(
10%), a small number of foci were found, although always in the
context of a diffuse nucleoplasmic background (Fig. 3C, left
panel). Deletion of the C-terminal region of GRIP1 (AD2), which
deletes both AD2 and the Q-rich domain, resulted in a complete loss of
foci formation (Fig. 3D), indicating that this region of the protein is
essential for foci formation. Deletion of both AD1 and AD2 (AD1 +
AD2) also resulted in a complete loss of foci (Fig. 3E). However, in
many cells expressing GRIP1 AD1 + AD2, the fusion was found to
localize within the nucleoli (Fig. 3E, right panel),
although the significance of this observation is unclear. Together,
these results demonstrate that the C-terminal
region of GRIP1 plays an important role in foci formation.
|
). Each ND10 was associated with a
GFP-GRIP1 focus, although not every GFP-GRIP1 focus associated with an
ND10 (i.e. there were more GRIP1 foci than ND10s). Careful
analysis of the two structures revealed that they do not completely
colocalize; rather they lie adjacent to each other (Fig. 4B). However,
due to the resolution limits of light microscopy, it is not possible to
determine whether the two foci are physically associated by this
technique and is beyond the scope of this study.
|
bHLH-PAS and nrbIIm+nrbIIIm
localize with the ND10s in a manner similar to that of wild-type
GFP-GRIP1 (Fig. 4C; bHLH PAS and nrbIIm + nrbIIIm).
GFP-GRIP1AD1, which formed fewer foci per cell than full-length
GRIP1, did not localize with the ND10s (Fig. 4C; AD1). Finally,
GFP-GRIP1AD2 and GFP-GRIP1AD1+AD2 were studied. Although
neither of these GRIP1 mutants form foci, the ND10s of these cells were
still intact (Fig. 4C; AD2 and AD1 + AD2), demonstrating that
the nuclear architecture was still intact in these cells. Together,
these results suggest that there are two classes of GRIP1 foci: those
that localize with the ND10 and those that do not. Furthermore, AD2 is
necessary for formation of all GRIP1 foci, and the AD1 region of GRIP1
appears to be necessary for the formation of the ND10-localized foci
but may be at least partially dispensable for the other class of
foci.
The results with AD1 suggested that AD1 may interact with some
components of the ND10. Previously, LaMorte et al. (40)
showed that CBP is a component of the ND10. Furthermore, we have
demonstrated that AD1 is a CBP interaction domain (20). Therefore, CBP
may recruit the GRIP1 foci to the ND10s through AD1. To confirm that,
in our system, CBP localized within the ND10s, the distribution of CBP
was followed by indirect immunofluorescence (Fig. 5). As expected, CBP localized to the
ND10s (Fig. 5A) and associated with the GRIP1 foci (Fig. 5B). Together,
these results support the hypothesis that CBP is involved in the
recruitment of the GRIP1 foci to the ND10s.
|
(a subunit of the 11S regulator)
and ubiquitin all accumulate within the GRIP1 foci (Fig. 6A). However, these large accumulations
of proteasomes were not observed in cells where GRIP1 localized
in a diffuse distribution or in nontransfected cells (data not shown).
Therefore, it appears that the proteasome may be recruited to the GRIP1
foci. In addition, the AD1 foci also associated with components of
the proteasome (Fig. 6B). Therefore, recruitment of the proteasome to
the GRIP1 foci does not require the GRIP1 foci to be in association
with ND10s.
|
AD2 was expressed in cells treated with the
irreversible proteasome inhibitor lactacystin or vehicle for 24 h.
The cells were then fixed and the area-corrected fluorescence intensity
of several hundred cells was determined as described in Materials
and Methods. The results of these analyses are shown in Fig. 6, C
and D, as the percentage of GFP-expressing cells that occupy a defined
intensity range (bin). In cells expressing GFP-GRIP1 without
lactacystin (Fig. 6C, gray bars) the majority of cells
(80%) have an area-corrected intensity between 40–60. However, in
the presence of lactacystin (Fig. 6C, black bars), this
value falls to approximately 55%. In contrast, cells expressing
GFP-GRIP1 AD2 displayed a broader range of distributions with the
40–60 and 60–80 intensity ranges each containing between 30% and
40% of the cells in both the presence and absence of lactacystin (Fig. 6D). This suggests that the AD2 region of the protein is essential for
proteasome degradation. Additional support for the importance of
the AD2 region in proteasome-mediated degradation was found in an
analysis of the higher intensity ranges. In the GFP-GRIP1 expressing
cells, the percentage of cells with an area-corrected intensity above
80 doubles in the presence of lactacystin (Fig. 6C). In contrast,
lactacystin had no effect on the intensity distribution of GFP-GRIP1
AD2 with 27% of cells expressing this chimera having an
area-corrected intensity of more than 80 in both the presence and
absence of the inhibitor (Fig. 6D). Combined with the previous results,
our observations demonstrate that GRIP1 is actively degraded by the
proteasome and that the AD2 region of the coactivator is essential for
this degradation to occur.
Intracellular Distribution of TRAM1/RAC3/AIB1/ACTR
Finally, we were interested in ascertaining whether the
intracellular distribution observed with GRIP1 was unique to GRIP1 or
common among the other SRCs. For this, we fused GFP to TRAM1 (47),
another member of the SRC family. As with GFP-GRIP1, when GFP-TRAM1 was
expressed in HeLa cells, a protein of the predicted molecular mass (190
kDa) was produced (160 kDa for TRAM1 and 30 kDa for GFP; Fig. 1B). In
addition, GFP-TRAM1 was fully competent to potentiate GR-dependent
transcription from a MMTV-luciferase reporter (data not shown). The
pattern of intracellular distribution of GFP-TRAM1 was quite similar to
that seen with GFP-GRIP1 (Fig. 7A) with
both diffuse and focal accumulation of TRAM1 being present. However,
the association of GFP-TRAM1 with the ND10s was somewhat different as
expression of GFP-TRAM1 appeared to induce a partial disruption of the
ND10s. This resulted in both fewer ND10s within the
nucleus and significant numbers of ND10s accumulating within the
cytoplasm (Fig. 7B, compare PML, upper row, and PML,
lower row). This disruption occurred regardless of whether
GFP-TRAM1 was in a diffuse distribution or in the focal accumulation
(data not shown). However, most (but not all) of the remaining ND10s
were found to associate with the TRAM1 foci (Fig. 7B, insets). Therefore, it seems that the formation of foci is
not a characteristic unique to GRIP1 and may, in fact, be a general
feature of the SRC family.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, left panel) whereas in the remaining 10–20% of cells,
GFP-GRIP1 was found in discrete intranuclear foci (Fig. 2A, center and right panels). Formation of these foci was
dependent on the AD2 region of the protein that was also essential for
degradation by the proteasome. Similar focal accumulations were seen
previously for TIF2, the human ortholog of GRIP1 (5, 48). The GFP-GRIP1
foci contained components of the 26S proteasome and were found in
association with the PML-containing ND10s.
GRIP1 is a large protein with several characterized functional domains
(Fig. 1) (4). Deletion studies of GFP-GRIP1 identified the C-terminal
region (AD1 and AD2) as being critical for foci formation.
Interestingly, it appears AD1 and AD2 may play distinct roles in foci
formation. As compared with the full-length protein, GFP-GRIP1AD1
formed very few foci (Fig. 3C) that did not associate with the
ND10s (Fig. 4C). Since AD1 is the CBP interaction domain (20) and CBP
has been shown to colocalize with the ND10s (Fig. 5A) (40), a
possible explanation for the requirement of the AD1
for ND10 association is its direct association with CBP. In contrast to
GFP-GRIP1AD1, GFP-GRIP1AD2 was unable to form foci in any cell
(Fig. 3D). A possible explanation of this observation is that an
AD2-associated protein may directly recruit GRIP1 to the foci. To date
though, only two AD2 interacting proteins have been described, CARM1
(21) and mZac1 (22). Preliminary immunofluorescence studies found CARM1
to localize in a diffuse nucleoplasmic distribution with no evidence of
focal accumulations (C. T. Baumann, M. R. Stallcup, and
G. L. Hager, unpublished observations). In addition,
immunofluorescent experiments against hZac1 have shown it to localize
in a uniform nuclear distribution as well (49). Therefore, neither
hZac1 nor CARM1 is a likely candidate to directly recruit GRIP1 to the
foci, although at this point, we cannot say whether other, unidentified
proteins recruit GRIP1 to the foci. A second possibility is that
modification (i.e. phosphorylation, methylation, or
acetylation) of residues within AD2 triggers the recruitment of GRIP1
to the foci. This will be discussed more fully later in the paper.
A number of studies have found mammalian cells to contain multiple subnuclear structures (50, 51). One of the most intensely studied of these are the ND10s (39). ND10s are small nuclear structures consisting of at least 10 proteins including PML, a growth suppresser implicated in a wide variety of cellular function (52), SP100, first identified as a target for autoimmune antibodies in primary biliary cirrhosis (53), DAXX, identified as a Fas-interacting protein that links the receptor to the JNK kinase pathway (54, 55), and CBP, a histone acetyltransferase important for transcription activation in a variety of systems (40). Here, we have shown that a subset of the GRIP1 foci localize adjacent to the ND10s. Previously, it has been shown that several double-stranded DNA viruses deposit their genomes at sites adjacent to the ND10s as well (56). These deposition sites are similar in size and orientation to the GRIP1 foci we have observed, suggesting that there may be an underlying structure with which both the viral deposition sites and the GRIP1 foci may associate.
The ND10s have been implicated in several intracellular processes,
including apoptosis (57, 58) and transcription (59, 60), and have been
found to be both spatially and functionally associated with the
ubiquitin- dependent proteasome (42, 44, 45, 46). Everett et
al. (45) found a ubiquitin-specific protease (HAUSP) that is
dynamically associated with the ND10s. HAUSP interacts with Vmw110
(ICP0), an immediate early gene product from herpes simplex virus
(HSV), which influences the latent/lytic decision of infecting HSV.
During viral infection, Vmw110 associates with the ND10s and
subsequently disrupts them. A recent study has also shown that
misfolded forms of the influenza virus nucleoprotein can recruit the
proteasome to the ND10s (46). In our studies, we have shown that
components of the proteasome are enriched in the GRIP1 foci (Fig. 6A),
whereas when GRIP1 is distributed in a diffuse pattern, few, if any,
discrete structures are seen with the same proteasome antibodies (data
not shown). In cells expressing AD1, the few foci that did form were
also enriched in components of the proteasome although they were not
associated with the ND10s. It is noteworthy that the number and size of
the structures identified by the antiproteasome antibodies correspond
quite well with the number and size of the GRIP1 foci. Therefore, it is
likely that the proteasome is recruited to the GRIP1 foci in a manner
similar to that seen by Anton et al. (46) with the influenza
virus nucleoprotein. In addition, recruitment of the proteasome to
GFP-GRIP1ÄAD1, which does not associate with the ND10s, indicates
that the proteasome can be recruited to intranuclear structures other
than the ND10s.
The intracellular levels of several members of the NHR family,
including the estrogen (61, 62), retinoic acid (63, 64) retinoic X
(64), peroxisome proliferator-activated receptor (PPAR) (65), and
progesterone receptors (66), are regulated by the ubiquitin-dependent
proteasome. In these cases, the addition of the appropriate ligand
agonist results in down-regulation of receptor levels by
ubiquitin-mediated proteasome degradation. Degradation of the
ligand-bound nuclear receptor is believed to play an important role in
"turning off" the hormone response and therefore functioning as an
additional level of regulation of the NHRs. Lazar and co-workers have
demonstrated that the intracellular levels of the nuclear corepressor
(N-CoR) are also mediated by the proteasome (67). In this study, a
mammalian homolog of the Drosophila Seven in absentia
(mSiah2) protein targets N-CoR for proteasome-mediated degradation in
cells expressing high levels of mSiah2 but not in cells limited
in mSiah2. This result begins to explain the cell type
specificity observed for nuclear receptor-mediated repression. Our
observations that GRIP1 can associate with proteasomes suggest that the
intracellular levels of the SRCs may also be regulated in a
proteasome-dependent manner. This is supported by the ability of
lactacystin to increase the levels of GFP-GRIP1 in treated cells (Fig. 6C). Additionally, a recent paper has shown that several members of the
SRC family, including GRIP1, are degraded by the 26S proteasome (41).
Taken as a whole, these results clearly implicate the 26S proteasome in
the degradation of GRIP1 and suggest the protein turnover/stability may
be an important regulatory feature of GRIP1.
To be degraded by the 26S proteasome, GRIP1 would need to be
ubiquitinated. Ubiquitination of proteins generally requires a
so-called PEST sequence; a stretch of amino acids enriched in proline,
serine, threonine, and glutamic acid (68). Analysis of the GRIP1
protein by the PEST-FIND program (http://bioweb.
pasteur.fr/seqanal/interfaces/pestfind.html) has identified four
potential PEST sequences: one in the bHLH-PAS domain [amino acid
(a.a.) 205–215], one between nrb boxes i and ii (a.a. 648–679), one
between nrb boxes ii and iii (a.a. 713–731), and one encompassing a.a.
788–826 (Fig. 8). Since the entire
bHLH-PAS region can be deleted with no observable effect on the
distribution of GRIP1 or the ability of the protein to potentiate
GR-dependent transcription (C. T. Baumann and G. L. Hager,
unpublished observations), the PEST between a.a. 205 and 215 does not
appear to be important in GRIP1 activity. Several transcription
factors, other than the NHRs, have been found to be degraded by the 26S
proteasome (69, 70, 71, 72). Comparison of the PEST sites and the activation
domains from these proteins has found that the two are inseparable from
one another (73). Therefore, it has been suggested that these proteins
may have evolved a tight coupling of the activation potentials and
degradation as a mechanism to carefully regulate their activity (73).
Since the nuclear receptor interaction domain (NID) is essential
for nuclear receptor-mediated transactivation, it is possible that a
similar regulatory mechanism has evolved for GRIP1 as well. Analysis of
the three potential PEST sequences within the nuclear receptor
interacting domain is currently underway.
|
Recently TIF2, the human ortholog of GRIP1, was shown to be associated with acute myeloid leukemia (AML) (82). In AML, a chromosomal translocation results in the C-terminal region of TIF2 being fused to the N terminus of a myeloid-specific histone acetyltransferase (MOZ). The region of TIF2 contained within the MOZ-TIF2 fusion contains AD1 and AD2, both of which play a role in the ability of GFP-GRIP1 to form foci. In a second subtype of AML, CBP was fused to MOZ (83). Although the region of CBP responsible for ND10 association is unknown, one can speculate that the MOZ-TIF2 fusion may by mislocalized through the AD2 of TIF2, resulting in an altered gene expression profile compared with wild-type cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
AD1, pEGFP-GRIP1AD2,
pEGFP-GRIP1AD1 +AD2, and pEGFP-GRIP1 nrbIIm+nrbIIIm were constructed
as described for pEGFP-GRIP1 except
pSG5-HA-GRIP11057-1109
(20), pSG5-HA-GRIP15-1121
(21), pSG5-HA-GRIP1AD1+AD2 (H. Ma and M. R.Stallcup,
unpublished results), and pSG5-HA-GRIP1 nrbIIm+nrbIIIm (20),
respectively, were used. pEGFP-GRIP1-bHLH-PAS was
constructed as follows. Site-directed mutagenesis using the QuikChange
mutagenesis kit (Stratagene, La Jolla, CA) was used to
introduce an AflII site at positions 231–236 and an
EcoRV site at 1,212–1,217 in pEGFP-GRIP1 (numbering based
on nucleotide sequence from the GenBank entry U39060). The following
oligonucleotides were used in the mutagenesis.
GGGATGGGAGAAAACACCTCTCTTAAGTCCAGGGCAGAGACCAG-
AAAACGC and GCGTTTTCTGGTCTCTGCCCTGGACTTA-
AGAGAGGTGTTTTCTCCCATCCC were used to introduce the
AflII site and GGGTTGGCGTTCAGTCAGATCGAT ATCTTTT-
CT TTGTCTGATGGCACTCTCG and
CGAGAGTGCCATCAGACAAAGAAAAGATATCGATCTGACTACGCCAACCC
were used to introduce the EcoRV site. Bold
letters represent the bases changed to introduce the appropriate
restriction enzyme site. The resulting vector was digested with
EcoRV and AflII and closed with a linker to
reintroduce the nuclear localization signal that was lost in the
original EcoRV/AflII fragment
(GAGACTTAAGTCCAGGGCAGAGACCAGAAAACGCAAGGATATCGAGA and
TCTCGATATCCTTGCGTTTTCTGGTCTCTGCCCTGGAC- TTAAGTCTC). To construct pEGFP-TRAM1, the TRAM1 cDNA was amplified by PCR from pBKCMV-TRAM1 (47) with oligonucleotides that added a XhoI site at the 5'-end of the gene and a KpnI site at the 3'-end. The resulting PCR product was cut with XhoI and KpnI and cloned into similarly cut pEGFP-C1.
Cell Culture and Transfections
HeLa cells were routinely maintained in DMEM + 10% FBS + 100
U/ml penicillin and streptomycin + 2 mM
L-glutamine at 37 C and 5% CO2 in a
water-jacketed incubator. Cells were typically split 1:4 every other
day. Where indicated, cells were treated with 1 uM
lactacystin (Alexis Chemicals, San Diego, CA) in EtOH for
24 h. Transfections were done by the calcium phosphate procedure
(Invitrogen, Carlsbad, CA).
Transactivations and Western Blot Analyses
For transactivation assays, 5 x 106
HeLa cells were plated in a 100-mm dish in DMEM + 10%
charcoal-stripped FBS and transfected with 5 µg pLTRLuc and 0.5 mg
pRSVßGal with and without 5 mg of the indicated GRIP1 expression
vector. The following day, cells were washed with PBS and treated with
100 nM dexamethasone for 6 h. Cells were harvested by
scraping, and luciferase and ß-galactosidase assays were done as
described (31). For Western blots, 5 x 106
cells were transfected with 20 µg pEGFP-GRIP1 and 20 µg pCMVIL2 as
described above. The next day, the transfected population of cells was
enriched by sorting with anti-IL2-coated magnet beads, and whole cell
extracts were made as described previously (31). Extract (20 mg) was
run on a 7.5% SDS-PAGE and electrotransferred to Immobilon-P
(Millipore Corp., Bedford, MA) in 192 mM
glycine, 25 mM Tris, 20% methanol, and 0.1% SDS for
18 h at 100 mA. GFP-fusion proteins were detected by a polyclonal
anti-GFP (CLONTECH Laboratories, Inc.) at a 1:500 dilution
and a horseradish peroxidase (HRP)-conjugated goat antirabbit at
1:10,000 (Jackson ImmunoResearch Laboratories, Inc., West
Grove, PA).
Immunofluorescence
Cells (2 x 105)
were plated onto coverslips in a six-well dish
and transfected with 0.5 mg of the indicated GFP-fusion vector. The
following day, cells were washed two times with PBS (without
Ca2+ and Mg2+), fixed for
20 min in freshly prepared 3.5% paraformaldehyde in PBS (without
Ca2+ and Mg2+), washed two
times with PBS (without Ca2+ and
Mg2+), and permeabilized with 0.5% Triton-X 100
in PBS (without Ca2+ and
Mg2+). Primary antibodies were incubated with
cells on coverslips at the dilutions suggested by the manufacturer
overnight at 4 C in PBS (without Ca2+ and
Mg2+) + 10% normal calf serum. The next day, the
coverslips were washed three times in PBS (without
Ca2+ and Mg2+) + 10%
normal calf serum and incubated with the fluorescently conjugated
secondary antibody for 1 h at room temperature in PBS + 10%
normal calf serum. Coverslips were then washed three times with PBS
(without Ca2+ and Mg2+) +
10% normal calf serum, once in PBS (without Ca2+
and Mg2+), once in PBS (without
Ca2+ and Mg2+) + 0.5 mg/ml
Hoechst 33342 (to visualize DNA), and once in
dH2O (to remove residual salts). Coverslips were
then mounted on quartz microscope slides in Vectashield (Vector Laboratories, Inc., Burlingame, CA). The following antibodies
were used for these studies. Primary antibodies: PML, mouse anti-PML
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA); CBP,
rabbit anti-CBP NT (Upstate Biotechnology, Inc. Lake
Placid, NY); ubiquitin, rabbit antiubiquitin (Affiniti Research
Products, Ltd, Exeter, UK); PA28, rabbit anti-PA28 (Affiniti
Research Products, Ltd, Exeter, UK); and 20S core proteasome, rabbit,
anti-core (Affiniti Research Products, Ltd, Exeter, UK). Secondary
antibodies: to visualize PML, ubiquitin, PA28, and the core 20S
proteasome, Texas Red-conjugated secondary antibodies were used of the
appropriate species specificity (Calbiochem-
Novabiochem Corp, La Jolla, CA). To visualize CBP, Cy5-conjugated
goat-antirabbit antibodies were used (Amersham Pharmacia Biotech, Inc, Piscataway, NJ). All secondary antibodies were
used at a 1:250 dilution.
Cell Extractions
Cell extractions were done as follows. HeLa cells (2 x
105) were transfected with 0.5 mg pEGFP-GRIP1 as
described above. The next day, cells were washed with ice-cold PBS and
sequentially extracted with CSK buffer (100 mM NaCl, 300
mM sucrose, 10 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.8,
3 mM MgCl2, 0.5% Triton-X
100, and protease inhibitor cocktail
(Calbiochem-Novabiochem Corp.) for 10 min at 4 C followed
by extraction buffer (250 mM ammonium sulfate,
300 mM sucrose, 10 mM
PIPES, pH 6.8, 3 mM MgCl2,
0.5 Triton-X 100, and protease inhibitor cocktail
(Calbiochem-Novabiochem Corp.) for 5 min at 4 C followed
by 10 mg/ml DNase I in CSK (with 50 mM NaCl
instead of 100 mM) for 1 h at room
temperature. The process was stopped by fixation in 3.5%
paraformaldehyde for 20 min at room temperature, washed, and mounted as
described above.
Fluorescence Imaging
Live-cell microscopy of GFP-fusion proteins was performed on a
Leica Corp. TCS-SP confocal microscope mounted on a DMIRBE
inverted microscope (Leica Corp. Microsystems, Exton,
PA). GFP was excited with the 488-nm laser line of an air-cooled
Ar laser (20 mW nominal output, Coherent Inc., Santa Clara, CA). GFP
emission was monitored between 505 nm and 590 nm, and the cells were
maintained at 37 C with a Nevtek ASI 400 Air Stream Incubator (Nevtek,
Burnsville, VA). For immunofluorescent studies, images were acquired
with either a Eclipse E800 (Nikon, Melville, NY) equipped
with a Micromax cooled CCD (Roper Scientific, Trenton, NJ) or a IE80
(Olympus Corp., Lake Success, NY) equipped with a
Deltavision image acquisition and analysis package (Applied Precision,
Inc., Issaquah, WA). Standard filter sets were used for all imaging
(Chroma Technology Corp., Brattleboro, VT) All images were processed as
tiffs on Corel Photo-Paint (Corel Corp., Ontario, Canada) using
standard image processing techniques.
Quantitative Analysis
The area-corrected intensity of the GFP-GRIP1 expressing cells
was determined using the MetaMorph image analysis software package
(Universal Imaging Corp, West Chester, PA). First, the nucleus was
encircled (using the polygon tool) and the total fluorescence intensity
and total area of the nucleus were determined. Background fluorescence
was determined by measuring the total fluorescence of a random region
within the field of view and dividing that value by the total area of
that region to give the total background per unit area (BA) within the
field of view. The BA was then multiplied by the total area of the
nucleus to give the total background within the nucleus (BN). This
value was then subtracted from the total fluorescence intensity of the
nucleus to give the background-corrected intensity of the nucleus (FN).
For each experiment, the area-corrected intensity of several hundred
cells was determined.
|
FOOTNOTES |
|---|
1 Current Address: Instituto de Bioquimica Vegetal y Fotosintesis,
Centro de Investigaciones Isla de la Cartuja, Av. Americo Vespucio s/n,
41092 Sevilla Spain. 
2 Current Address: Department of Pharmaceutics and Pharmaceutical
Chemistry, University of Utah, Salt Lake City, Utah 84108.
Received for publication May 30, 2000. Revision received November 22, 2000. Accepted for publication December 19, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
reveals a role for ligand in the nuclear distribution of the
receptor. Mol Biol Cell 10:471–486 and coactivator
turnover and for efficient estrogen receptor- transactivation. Mol
Cell 5:939–948[CrossRef][Medline]
. Mol Cell Biol 20:402–415
in acute promyelocytic
leukemia cells. Cell 76:345–356[CrossRef][Medline]
(RAR)
and oncogenic RAR fusion proteins. Proc Natl Acad Sci USA 96:14807–14812
and retinoid X receptor in human keratinocytes. Cancer Res 60:2247–2252
is linked to ligand-dependent activation. J
Biol Chem 275:18527–18533
domain.
Cell 78:787–798[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  T. C. Voss, R. L. Schiltz, M.-H. Sung, T. A. Johnson, S. John, and G. L. Hager Combinatorial probabilistic chromatin interactions produce transcriptional heterogeneity J. Cell Sci., February 1, 2009; 122(3): 345 - 356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. S. Fenne, T. Hoang, M. Hauglid, J. V. Sagen, E. A. Lien, and G. Mellgren Recruitment of Coactivator Glucocorticoid Receptor Interacting Protein 1 to an Estrogen Receptor Transcription Complex Is Regulated by the 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase Endocrinology, September 1, 2008; 149(9): 4336 - 4345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Lonard and B. W. O'Malley SRC-3 Transcription-Coupled Activation, Degradation, and the Ubiquitin Clock: Is There Enough Coactivator to Go Around in Cells? Sci. Signal., April 1, 2008; 1(13): pe16 - pe16. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Amazit, L. Pasini, A. T. Szafran, V. Berno, R.-C. Wu, M. Mielke, E. D. Jones, M. G. Mancini, C. A. Hinojos, B. W. O'Malley, et al. Regulation of SRC-3 Intercompartmental Dynamics by Estrogen Receptor and Phosphorylation Mol. Cell. Biol., October 1, 2007; 27(19): 6913 - 6932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. B. Harvey, J. H. D. Bassett, P. Maruvada, P. M. Yen, and G. R. Williams The Rat Thyroid Hormone Receptor (TR) {Delta}{beta}3 Displays Cell-, TR Isoform-, and Thyroid Hormone Response Element-Specific Actions Endocrinology, April 1, 2007; 148(4): 1764 - 1773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Lin, P. Philibert, B. Ferraz-de-Souza, D. Kelberman, T. Homfray, A. Albanese, V. Molini, N. J. Sebire, S. Einaudi, G. S. Conway, et al. Heterozygous Missense Mutations in Steroidogenic Factor 1 (SF1/Ad4BP, NR5A1) Are Associated with 46,XY Disorders of Sex Development with Normal Adrenal Function J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 991 - 999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. McMaster and D. W. Ray Modelling the glucocorticoid receptor and producing therapeutic agents with anti-inflammatory effects but reduced side-effects Exp Physiol, March 1, 2007; 92(2): 299 - 309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-T. Chin, A. C.S. Chun, Y.-P. Ching, K.-T. Jeang, and D.-Y. Jin Human T-Cell Leukemia Virus Oncoprotein Tax Represses Nuclear Receptor-Dependent Transcription by Targeting Coactivator TAX1BP1 Cancer Res., February 1, 2007; 67(3): 1072 - 1081. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Arnett-Mansfield, J. D. Graham, A. R. Hanson, P. A. Mote, A. Gompel, L. L. Scurr, N. Gava, A. de Fazio, and C. L. Clarke Focal Subnuclear Distribution of Progesterone Receptor Is Ligand Dependent and Associated with Transcriptional Activity Mol. Endocrinol., January 1, 2007; 21(1): 14 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. T. Alarid Lives and Times of Nuclear Receptors Mol. Endocrinol., September 1, 2006; 20(9): 1972 - 1981. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liu, X. Xia, J. D. Fondell, and P. M. Yen Thyroid Hormone-Regulated Target Genes Have Distinct Patterns of Coactivator Recruitment and Histone Acetylation Mol. Endocrinol., March 1, 2006; 20(3): 483 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M-B Debril, L Dubuquoy, J-N Feige, W Wahli, B Desvergne, J Auwerx, and L Gelman Scaffold attachment factor B1 directly interacts with nuclear receptors in living cells and represses transcriptional activity J. Mol. Endocrinol., December 1, 2005; 35(3): 503 - 517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mouthiers, A. Baillet, C. Delomenie, D. Porquet, and N. Mejdoubi-Charef Peroxisome Proliferator-Activated Receptor {alpha} Physically Interacts with CCAAT/Enhancer Binding Protein (C/EBP{beta}) to Inhibit C/EBP{beta}-Responsive {alpha}1-Acid Glycoprotein Gene Expression Mol. Endocrinol., May 1, 2005; 19(5): 1135 - 1146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. B. Kindle, P. J. F. Troke, H. M. Collins, S. Matsuda, D. Bossi, C. Bellodi, E. Kalkhoven, P. Salomoni, P. G. Pelicci, S. Minucci, et al. MOZ-TIF2 Inhibits Transcription by Nuclear Receptors and p53 by Impairment of CBP Function Mol. Cell. Biol., February 1, 2005; 25(3): 988 - 1002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Patel, R. Truant, R. A. Rachubinski, and J. P. Capone Activity and subcellular compartmentalization of peroxisome proliferator-activated receptor {alpha} are altered by the centrosome-associated protein CAP350 J. Cell Sci., January 1, 2005; 118(1): 175 - 186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Grenier, A. Trousson, A. Chauchereau, L. Amazit, A. Lamirand, P. Leclerc, A. Guiochon-Mantel, M. Schumacher, and C. Massaad Selective Recruitment of p160 Coactivators on Glucocorticoid-Regulated Promoters in Schwann Cells Mol. Endocrinol., December 1, 2004; 18(12): 2866 - 2879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Hoang, I. S. Fenne, C. Cook, B. Borud, M. Bakke, E. A. Lien, and G. Mellgren cAMP-dependent Protein Kinase Regulates Ubiquitin-Proteasome-mediated Degradation and Subcellular Localization of the Nuclear Receptor Coactivator GRIP1 J. Biol. Chem., November 19, 2004; 279(47): 49120 - 49130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. E. Black, M. J. Vitto, D. Gioeli, A. Spencer, N. Afshar, M. R. Conaway, M. J. Weber, and B. M. Paschal Transient, Ligand-Dependent Arrest of the Androgen Receptor in Subnuclear Foci Alters Phosphorylation and Coactivator Interactions Mol. Endocrinol., April 1, 2004; 18(4): 834 - 850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Arnett-Mansfield, A. deFazio, P. A. Mote, and C. L. Clarke Subnuclear Distribution of Progesterone Receptors A and B in Normal and Malignant Endometrium J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1429 - 1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Lonard, S. Y. Tsai, and B. W. O'Malley Selective Estrogen Receptor Modulators 4-Hydroxytamoxifen and Raloxifene Impact the Stability and Function of SRC-1 and SRC-3 Coactivator Proteins Mol. Cell. Biol., January 1, 2004; 24(1): 14 - 24. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Fan, T. Yanase, Y. Wu, H. Kawate, M. Saitoh, K. Oba, M. Nomura, T. Okabe, K. Goto, J. Yanagisawa, et al. Protein Kinase A Potentiates Adrenal 4 Binding Protein/Steroidogenic Factor 1 Transactivation by Reintegrating the Subcellular Dynamic Interactions of the Nuclear Receptor with Its Cofactors, General Control Nonderepressed-5/Transformation/ Transcription Domain-Associated Protein, and Suppressor, Dosage-Sensitive Sex Reversal-1: a Laser Confocal Imaging Study in Living KGN Cells Mol. Endocrinol., January 1, 2004; 18(1): 127 - 141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. N. Moraitis and V. Giguere The Co-repressor Hairless Protects ROR{alpha} Orphan Nuclear Receptor from Proteasome-mediated Degradation J. Biol. Chem., December 26, 2003; 278(52): 52511 - 52518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Woodham, L. Birch, and G. S. Prins Neonatal Estrogen Down-Regulates Prostatic Androgen Receptor through a Proteosome-Mediated Protein Degradation Pathway Endocrinology, November 1, 2003; 144(11): 4841 - 4850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Amazit, Y. Alj, R. K. Tyagi, A. Chauchereau, H. Loosfelt, C. Pichon, J. Pantel, E. Foulon-Guinchard, P. Leclerc, E. Milgrom, et al. Subcellular Localization and Mechanisms of Nucleocytoplasmic Trafficking of Steroid Receptor Coactivator-1 J. Biol. Chem., August 22, 2003; 278(34): 32195 - 32203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Yan, X. Gao, D. M. Lonard, and Z. Nawaz Specific Ubiquitin-Conjugating Enzymes Promote Degradation of Specific Nuclear Receptor Coactivators Mol. Endocrinol., July 1, 2003; 17(7): 1315 - 1331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Arabi, C. Rustum, E. Hallberg, and A. P. H. Wright Accumulation of c-Myc and proteasomes at the nucleoli of cells containing elevated c-Myc protein levels J. Cell Sci., May 1, 2003; 116(9): 1707 - 1717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Giandomenico, M. Simonsson, E. Gronroos, and J. Ericsson Coactivator-Dependent Acetylation Stabilizes Members of the SREBP Family of Transcription Factors Mol. Cell. Biol., April 1, 2003; 23(7): 2587 - 2599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kino and G. P. Chrousos Tumor Necrosis Factor alpha Receptor- and Fas-associated FLASH Inhibit Transcriptional Activity of the Glucocorticoid Receptor by Binding to and Interfering with Its Interaction with p160 Type Nuclear Receptor Coactivators J. Biol. Chem., January 24, 2003; 278(5): 3023 - 3029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. J. Rivera, C. S. Song, V. E. Centonze, J. D. Lechleiter, B. Chatterjee, and A. K. Roy Role of the Promyelocytic Leukemia Body in the Dynamic Interaction between the Androgen Receptor and Steroid Receptor Coactivator-1 in Living Cells Mol. Endocrinol., January 1, 2003; 17(1): 128 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Borgius, K. R. Steffensen, J.-A. Gustafsson, and E. Treuter Glucocorticoid Signaling Is Perturbed by the Atypical Orphan Receptor and Corepressor SHP J. Biol. Chem., December 13, 2002; 277(51): 49761 - 49766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Le Drean, N. Mincheneau, P. Le Goff, and D. Michel Potentiation of Glucocorticoid Receptor Transcriptional Activity by Sumoylation Endocrinology, September 1, 2002; 143(9): 3482 - 3489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Deroo, C. Rentsch, S. Sampath, J. Young, D. B. DeFranco, and T. K. Archer Proteasomal Inhibition Enhances Glucocorticoid Receptor Transactivation and Alters Its Subnuclear Trafficking Mol. Cell. Biol., June 15, 2002; 22(12): 4113 - 4123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Vottero, T. Kino, H. Combe, P. Lecomte, and G. P. Chrousos A Novel, C-Terminal Dominant Negative Mutation of the GR Causes Familial Glucocorticoid Resistance through Abnormal Interactions with p160 Steroid Receptor Coactivators J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2658 - 2667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kotaja, M. Vihinen, J. J. Palvimo, and O. A. Janne Androgen Receptor-interacting Protein 3 and Other PIAS Proteins Cooperate with Glucocorticoid Receptor-interacting Protein 1 in Steroid Receptor-dependent Signaling J. Biol. Chem., May 10, 2002; 277(20): 17781 - 17788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Miura, R. Ouchida, N. Yoshikawa, K. Okamoto, Y. Makino, T. Nakamura, C. Morimoto, I. Makino, and H. Tanaka Functional Modulation of the Glucocorticoid Receptor and Suppression of NF-kappa B-dependent Transcription by Ursodeoxycholic Acid J. Biol. Chem., December 7, 2001; 276(50): 47371 - 47378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Sunn, T.-A. Cock, L. A. Crofts, J. A. Eisman, and E. M. Gardiner Novel N-Terminal Variant of Human VDR Mol. Endocrinol., September 1, 2001; 15(9): 1599 - 1609. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
