help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baumann, C. T.
Right arrow Articles by Hager, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baumann, C. T.
Right arrow Articles by Hager, G. L.
Molecular Endocrinology 15 (4): 485-500
Copyright © 2001 by The Endocrine Society

The Glucocorticoid Receptor Interacting Protein 1 (GRIP1) Localizes in Discrete Nuclear Foci That Associate with ND10 Bodies and Are Enriched in Components of the 26S Proteasome

Christopher T. Baumann, Han Ma, Ronald Wolford, Jose C Reyes1, Padma Maruvada, Carol Lim2, Paul M. Yen, Michael R. Stallcup and Gordon L. Hager

Laboratory of Receptor Biology and Gene Expression (C.T.B., R.W., J.C.R., C.L., G.L.H.) National Cancer Institute National Institutes of Health Bethesda, Maryland 20892-5055
Molecular Regulation & Neuroendocrinology Section (P.M., P.M.Y.) Clinical Endocrinology Branch National Institute of Diabetes, Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892
Department of Pathology (H.M., M.R.S.) University of Southern California Los Angeles, California 90033


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The glucocorticoid receptor interacting protein-1 (GRIP1) is a member of the steroid receptor coactivator (SRC) family of transcriptional regulators. Green fluorescent protein (GFP) fusions were made to full-length GRIP1, and a series of GRIP1 mutants lacking the defined regulatory regions and the intracellular distribution of these proteins was studied in HeLa cells. The distribution of GRIP1 was complex, ranging from diffuse nucleoplasmic to discrete intranuclear foci. Formation of these foci was dependent on the C-terminal region of GRIP1, which contains the two characterized transcriptional activation domains, AD1 and AD2. A subpopulation of GRIP1 foci associate with ND10s, small nuclear bodies that contain several proteins including PML, SP100, DAXX, and CREB-binding protein (CBP). Association with the ND10s is dependent on the AD1 of GRIP1, a region of the protein previously described as a CBP-interacting domain. The GRIP1 foci are enriched in components of the 26S proteasome, including the core 20S proteasome, PA28{alpha}, and ubiquitin. In addition, the irreversible proteasome inhibitor lactacystin induced an increase in the total fluorescence intensity of the GFP-GRIP1 expressing cells, demonstrating that GRIP1 is degraded by the proteasome. These findings suggest the intriguing possibility that degradation of GRIP1 by the 26S proteasome may be a key component of its regulation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Nuclear hormone receptors (NHRs) are a large family of ligand-activated transcriptional regulators that include more than 50 distinct proteins (1). Typically, NHRs activate transcription of their target genes in response to specific ligand agonists. Ligand binding induces a conformational change within the receptor, facilitating binding of one or more nuclear receptor interacting proteins (2). The steroid receptor coactivators (SRCs) are a family of nuclear receptor interacting proteins and include SRC1 (3), GRIP1 (glucocorticoid receptor interacting protein 1)/TIF2 (transcriptional intermediary factor 2) (4, 5), and AIB1 (amplified in breast cancer 1)/ACTR (activator of thyroid and retinoic acid receptors)/RAC3 (receptor-associated coactivator 3) (6, 7, 8). These proteins are highly homologous transcription factors with several conserved functional domains, including an N-terminal basic helix-loop-helix (bHLH)-PAS domain, a CREB-binding protein (CBP) interaction domain (AD1), a C-terminal activation domain (AD2), a Q-rich region, and several LXXLL boxes that are involved in nuclear receptor binding (9, 10).

The mechanism by which the SRCs potentiate transcription from the NHRs has been the focus of intense study (2, 7, 9, 11, 12, 13, 14). The accepted model is that the SRCs act as bridging proteins. In this role, the ligand-bound NHRs bind to and recruit the SRCs to a target promoter (2, 4, 7, 15, 16, 17). The SRCs, in turn, interact with and recruit additional proteins to the hormone-responsive promoter (7, 11, 18). To date, a number of proteins have been found to interact with SRCs. The histone acetyltransferase CBP and its homolog p300 interact with AD1 (19, 20). Additionally, recent studies have found two proteins that interact with AD2, CARM1 (21) and mZac1 (22). CARM1 is a protein methyltransferase that can methylate histone H3 in vitro. Therefore, the recruitment of proteins capable of posttranslational modification appears to be a major way in which the SRCs potentiate NHR transcription. In addition, several of the SRCs, including SRC-1 (23) and ACTR (7), have been shown to be histone acetyltransferases themselves, allowing for yet another mechanism by which the SRCs activate transcription through the NHRs.

The activities of NHRs are regulated at several levels, including ligand binding and posttranslational modifications (24, 25, 26). Recently, changes in the intracellular distribution of the NHRs has also been shown to be an important component of their regulation (27, 28, 29, 30, 31, 32, 33, 34, 35). In stark contrast, little is known about the regulation of the SRCs. As a starting point for the study of SRC regulation, the intracellular distribution of GRIP1 was studied in living cells by constructing green fluorescent protein (GFP)-fusions to full-length GRIP1 and a panel of GRIP1 deletion mutants. We have found that in a subpopulation of cells, GFP-GRIP1 localizes in discrete nuclear foci, the formation of which was dependent on the C-terminal AD2 region. A subset of these foci associated with the promyelocytic leukemia gene product (PML)- and CBP-containing ND10 domains in an AD1-dependent manner. Furthermore, all of the foci are enriched in components of the 26S proteasome, and the addition of an inhibitor of the 26S proteasome induced an increase in the total cellular fluorescence of the GFP-GRIP1 expressing cells. These observations have allowed us to speculate that the activity of GRIP1 may, in part, be modulated by the ubiquitin-dependent proteasome pathway.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Intracellular Distribution of GRIP1
To study the intracellular distribution of GRIP1, the GFP was fused to the N terminus of full-length GRIP1 (GFP-GRIP1; Fig. 1AGo). GFP-GRIP1 was expressed in HeLa cells and found to be the predicted molecular mass of 190 kDa (160 kDa for GRIP1 + 30 kDa for GFP; Fig. 1BGo). In addition, GFP-GRIP1 was fully competent to activate GR-dependent transcription from a mouse mammary tumor virus (MMTV)-luciferase reporter (Fig. 1CGo). When expressed in HeLa cells, GFP-GRIP1 localized within the nucleus and was excluded from nucleoli (Fig. 2AGo). In the majority of cells, GFP-GRIP1 was found in a diffuse nucleoplasmic distribution (Fig. 2AGo, left panel). However, in a fraction of cells (10–20%) GFP-GRIP1 localized in discrete intranuclear foci, either with (Fig. 2AGo, center panel) or without (Fig. 2AGo, right panel) a diffuse nucleoplasmic background. Within a given population of cells, the number of these foci ranged from 10–15 to hundreds per cell. The percentage of cells in which GRIP1 accumulated in foci remained unchanged when the amount of transfected GFP-GRIP1 expression vector varied from 10 ng to 10 mg (data not shown). Additionally, no correlation was observed between the total fluorescence intensity of an individual cell and the presence or absence of foci, indicating that the focal accumulation of GFP-GRIP1 was not simply an artifact of overexpression. Treatment of cells with dexamethasone or 9- cis-retinoic acid, agonists for the glucocorticoid receptor and retinoic X receptor, respectively (both of which are expressed in HeLa cells), had no effect on the intracellular distribution of GFP-GRIP1 (data not shown), suggesting that the distribution was independent of nuclear receptor binding. Similar foci were seen when GFP-GRIP1 was expressed in mouse mammary adenocarcinoma cell line 1471.1 (C. T. Baumann, and G. L. Hager, unpublished observations) and normal human fibroblasts (A. Ishov and G. Maul, personal communication), demonstrating that the observed distribution of GFP-GRIP1 was not unique to HeLa cells. To ensure that the GFP tag was not altering the distribution of GRIP1, an hemagglutinin (HA)-tagged GRIP1 was expressed in HeLa cells and localized by indirect immunofluorescence against the hemagglutinin (HA) epitope (Fig. 2BGo). HA-GRIP1 was found in both diffuse and focal distributions as was observed for the GFP-tagged variant, demonstrating that the GFP moiety had no observable effect on the intracellular distribution of GRIP1. Analysis of the distribution of endogenous GRIP1 was hampered by the inability of the currently available GRIP1/TIF2 antibodies to recognize either the endogenous GRIP1 or a transiently expressed protein (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Schematic and Functional Activity of GFP-GRIP1

A, Schematic representation of GFP-GRIP1 with the defined functional domains shown. bHLH-PAS is the basic helix-loop-helix Per-ARNT-SIM domain; NID is the nuclear receptor interaction domain containing three LXXLL motifs; AD1 is the activation domain 1 (also the CBP interaction domain); Q represents the Q-rich region; and AD2 is the activation domain 2. B, Western blot analysis of GFP-GRIP1 and GFP-TRAM1. HeLa cells were mock transfected (lane 1) or transfected with pEGFP-GRIP1 (lane 2) or pEGFP-TRAM1 (lane 3). GFP fusions were detected with an anti-GFP antibody (CLONTECH Laboratories, Inc.) in both the GFP-GRIP1 and GFP-TRAM1 lanes (upper band at ~195 kDa). Lower band is a nonspecific band typically seen with this specific antibody under these conditions. C, Activity of GFP-GRIP1 fusion construct. pSG5-HA-GRIP1 or pEGFP-GRIP1 was transfected into HeLa cells with the pLTRLuc plasmid, and the activity of the endogenous glucocorticoid receptor was monitored (see Materials and Methods). Results are plotted as the fold induction induced by ligand agonists with and without GRIP1. Data shown are representative of at least three independent experiments.

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Intranuclear Distribution and Nuclear Retention of GFP-GRIP1

A, Confocal images of the representative distributions of GFP-GRIP1 in living cells. GFP-GRIP1 localizes in a diffuse intranuclear distribution in approximately 80% of cells (left panel) and in discrete intranuclear foci in the remaining 20% (middle and right panels). B, Intranuclear distribution of HA-tagged GRIP1 determined by indirect immunofluorescence. HA-GRIP1 was found in both diffuse (left panel) and focal (right panel) distributions. C, Association of the GFP-GRIP1 foci with an insoluble nuclear fraction. GFP-GRIP1 expressing cells were sequentially extracted with detergent (CSK, top panel), high salt (Extraction, middle panel), and DNase I (DNase I, lower panel). Left column shows the localization of GFP-GRIP1 and right column shows the staining pattern of chromatin (DAPI). Note the loss of chromatin after DNase I treatment.

 
To further characterize the intracellular distribution of GFP-GRIP1, cells were sequentially extracted with detergent, high salt, and DNase I (Fig. 2CGo). The diffusely distributed GFP-GRIP1 was lost upon the first CSK detergent extraction (Fig. 2CGo, top row), indicating that this pool of GFP-GRIP1 was freely soluble within the nucleoplasm. In contrast, the focal accumulations of GRIP1 were resistant even to DNase I treatment (Fig. 2CGo, bottom row), demonstrating that the GFP-GRIP1 foci associate with an insoluble, nonchromatin component of the nucleus.

The C Terminus of GRIP1 Is Essential for Foci Formation
GRIP1 is a large protein with several defined functional domains (Fig. 1Go) (4). To determine which region of GRIP1 was responsible for foci formation, GFP fusions were made to a series of GRIP1 mutants (Fig. 3Go, A–E). The N-terminal bHLH-PAS region is the most highly conserved region among members of the SRC family (36). However, deletion of this domain ({Delta}bHLH-PAS) had no observable effect on the intranuclear distribution of the chimera (Fig. 3AGo). Similarly, the intranuclear distribution of nrbIIm+nrbIIIm, a GRIP1 mutation that does not interact with GR (37), was also unchanged as compared with the full-length protein (Fig. 3BGo). Therefore, interactions with GR do not appear to be essential for GRIP1 to localize to foci, which is in agreement with the lack of effect dexamethasone had on the intracellular distribution of the chimera (data not shown). The C-terminal region of GRIP1 contains two well defined activation domains, AD1 and AD2 (20, 21). Deletion of AD1 ({Delta}AD1) had a dramatic effect on the intracellular distribution of GFP-GRIP1, with a loss of nearly all foci (Fig. 3CGo). In a few cells (~10%), a small number of foci were found, although always in the context of a diffuse nucleoplasmic background (Fig. 3CGo, left panel). Deletion of the C-terminal region of GRIP1 ({Delta}AD2), which deletes both AD2 and the Q-rich domain, resulted in a complete loss of foci formation (Fig. 3DGo), indicating that this region of the protein is essential for foci formation. Deletion of both AD1 and AD2 ({Delta}AD1 + {Delta}AD2) also resulted in a complete loss of foci (Fig. 3EGo). However, in many cells expressing GRIP1 {Delta}AD1 + {Delta}AD2, the fusion was found to localize within the nucleoli (Fig. 3EGo, right panel), although the significance of this observation is unclear. Together, these results demonstrate that the C-terminal region of GRIP1 plays an important role in foci formation.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 3. Intranuclear Distribution of GFP-GRIP1 Mutants in HeLa Cells

Representative images of the five GFP-GRIP1 mutants (A–E) used in this study. A schematic of each mutant is located directly above each set of images. bHLH-PAS is the basic helix-loop-helix Per-ARNT-SIM domain, NID is the nuclear receptor interaction domain containing three LXXLL motifs, AD1 is the activation domain 1 (also the CBP interaction domain), Q represents the Q-rich region and AD2 is the activation domain 2.

 
A Subset of GFP-GRIP1 Foci Associates with the ND10 Domains
Based on the size and number of the GFP-GRIP1 foci, we hypothesized that they may be associated with ND10s (reviewed in Refs. 38, 39), small nuclear substructures containing at least 10 proteins. To determine whether the observed GFP-GRIP1 foci were associated with ND10s, GFP-GRIP1 expressing HeLa cells were fixed and the intranuclear localization of the ND10s was determined by indirect immunofluorescence against PML; a clear correlation was observed (Fig. 4AGo). Each ND10 was associated with a GFP-GRIP1 focus, although not every GFP-GRIP1 focus associated with an ND10 (i.e. there were more GRIP1 foci than ND10s). Careful analysis of the two structures revealed that they do not completely colocalize; rather they lie adjacent to each other (Fig. 4BGo). However, due to the resolution limits of light microscopy, it is not possible to determine whether the two foci are physically associated by this technique and is beyond the scope of this study.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Association of GFP-GRIP1 with ND10 Domains

GFP-GRIP1-expressing HeLa cells were fixed in paraformaldehyde and the intranuclear localization of the ND10s was determined by indirect immunofluorescence against PML. For A and C, the left panel (green) is the GFP-GRIP1 vector, the center (red) shows PML, and the right panel is the overlay of the two. In the overlays, yellow indicates regions of overlap between GRIP1 and PML. A, Wild-type GRIP1. B, Expanded view of region indicated in overlay of A. C, The five GFP-GRIP1 mutants used in this study.

 
Next, the ability of the GRIP1 mutants described above to localize with the ND10s was investigated. Both {Delta}bHLH-PAS and nrbIIm+nrbIIIm localize with the ND10s in a manner similar to that of wild-type GFP-GRIP1 (Fig. 4CGo; {Delta}bHLH PAS and nrbIIm + nrbIIIm). GFP-GRIP1{Delta}AD1, which formed fewer foci per cell than full-length GRIP1, did not localize with the ND10s (Fig. 4CGo; {Delta}AD1). Finally, GFP-GRIP1{Delta}AD2 and GFP-GRIP1{Delta}AD1+{Delta}AD2 were studied. Although neither of these GRIP1 mutants form foci, the ND10s of these cells were still intact (Fig. 4CGo; {Delta}AD2 and {Delta}AD1 + {Delta} AD2), demonstrating that the nuclear architecture was still intact in these cells. Together, these results suggest that there are two classes of GRIP1 foci: those that localize with the ND10 and those that do not. Furthermore, AD2 is necessary for formation of all GRIP1 foci, and the AD1 region of GRIP1 appears to be necessary for the formation of the ND10-localized foci but may be at least partially dispensable for the other class of foci.

The results with {Delta}AD1 suggested that AD1 may interact with some components of the ND10. Previously, LaMorte et al. (40) showed that CBP is a component of the ND10. Furthermore, we have demonstrated that AD1 is a CBP interaction domain (20). Therefore, CBP may recruit the GRIP1 foci to the ND10s through AD1. To confirm that, in our system, CBP localized within the ND10s, the distribution of CBP was followed by indirect immunofluorescence (Fig. 5Go). As expected, CBP localized to the ND10s (Fig. 5AGo) and associated with the GRIP1 foci (Fig. 5BGo). Together, these results support the hypothesis that CBP is involved in the recruitment of the GRIP1 foci to the ND10s.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. CBP Localizes with the GFP-GRIP1 Foci

A, Nontransfected HeLa cells were fixed with paraformaldehyde and the distribution of PML (left panel) and CBP (middle panel) was detected by indirect immunofluorescence as described in Materials and Methods. The overlay of the two images is shown in the right panel. B, GFP-GRIP1 localizes adjacent to CBP. GFP-GRIP1 (left panel) and endogenous CBP (middle panel) were identified. The overlay is shown on the right.

 
The GRIP1 Foci Contain Ubiquitin and Colocalize with Components of the Proteasome
Recently, O’Malley and co-workers (41) have shown that several members of the SRC family, including GRIP1, is degraded by the 26S proteasome. Additionally, several groups have suggested that the ND10s are sites of proteolytic degradation and associate with components of the proteasome (42, 43, 44, 45, 46). Therefore, we investigated whether the GRIP1 foci also contained components of the proteasome. Indirect immunofluorescence against several components of the proteasome found that the core 20S proteasome, PA28{alpha} (a subunit of the 11S regulator) and ubiquitin all accumulate within the GRIP1 foci (Fig. 6AGo). However, these large accumulations of proteasomes were not observed in cells where GRIP1 localized in a diffuse distribution or in nontransfected cells (data not shown). Therefore, it appears that the proteasome may be recruited to the GRIP1 foci. In addition, the {Delta}AD1 foci also associated with components of the proteasome (Fig. 6BGo). Therefore, recruitment of the proteasome to the GRIP1 foci does not require the GRIP1 foci to be in association with ND10s.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. GRIP1 Foci Are Enriched in Ubiquitin and Components of the Proteasome

A, GFP-GRIP1 (left column) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of several components of the proteasome was detected by indirect immunofluorescence (middle column). Antibodies used were: PA28a, top row; ubiquitin, middle row; core 20S proteasome, bottom row. The overlay for each is shown in the right column. B, GFP-GRIP1{Delta}AD1 (left panel) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of PA28a was detected by indirect immunofluorescence (middle panel). The overlay is shown in the right panel. C and D, Histogram showing the distribution of area-corrected intensities of a population of GFP-GRIP1 (C) and GFP-GRIP1{Delta}AD1 (D) expressing cells either with (black bars) or without (gray bars) the irreversible proteasome inhibitor lactacystin. Percentage of total cell is plotted on the y-axis and the intensity ranges are binned on the x-axis.

 
To determine whether GRIP1 is being degraded by the proteasome, GFP-GRIP1 or GFP-GRIP1 {Delta}AD2 was expressed in cells treated with the irreversible proteasome inhibitor lactacystin or vehicle for 24 h. The cells were then fixed and the area-corrected fluorescence intensity of several hundred cells was determined as described in Materials and Methods. The results of these analyses are shown in Fig. 6Go, C and D, as the percentage of GFP-expressing cells that occupy a defined intensity range (bin). In cells expressing GFP-GRIP1 without lactacystin (Fig. 6CGo, gray bars) the majority of cells (~80%) have an area-corrected intensity between 40–60. However, in the presence of lactacystin (Fig. 6CGo, black bars), this value falls to approximately 55%. In contrast, cells expressing GFP-GRIP1 {Delta}AD2 displayed a broader range of distributions with the 40–60 and 60–80 intensity ranges each containing between 30% and 40% of the cells in both the presence and absence of lactacystin (Fig. 6DGo). This suggests that the AD2 region of the protein is essential for proteasome degradation. Additional support for the importance of the AD2 region in proteasome-mediated degradation was found in an analysis of the higher intensity ranges. In the GFP-GRIP1 expressing cells, the percentage of cells with an area-corrected intensity above 80 doubles in the presence of lactacystin (Fig. 6CGo). In contrast, lactacystin had no effect on the intensity distribution of GFP-GRIP1 {Delta}AD2 with 27% of cells expressing this chimera having an area-corrected intensity of more than 80 in both the presence and absence of the inhibitor (Fig. 6DGo). Combined with the previous results, our observations demonstrate that GRIP1 is actively degraded by the proteasome and that the AD2 region of the coactivator is essential for this degradation to occur.

Intracellular Distribution of TRAM1/RAC3/AIB1/ACTR
Finally, we were interested in ascertaining whether the intracellular distribution observed with GRIP1 was unique to GRIP1 or common among the other SRCs. For this, we fused GFP to TRAM1 (47), another member of the SRC family. As with GFP-GRIP1, when GFP-TRAM1 was expressed in HeLa cells, a protein of the predicted molecular mass (190 kDa) was produced (160 kDa for TRAM1 and 30 kDa for GFP; Fig. 1BGo). In addition, GFP-TRAM1 was fully competent to potentiate GR-dependent transcription from a MMTV-luciferase reporter (data not shown). The pattern of intracellular distribution of GFP-TRAM1 was quite similar to that seen with GFP-GRIP1 (Fig. 7AGo) with both diffuse and focal accumulation of TRAM1 being present. However, the association of GFP-TRAM1 with the ND10s was somewhat different as expression of GFP-TRAM1 appeared to induce a partial disruption of the ND10s. This resulted in both fewer ND10s within the nucleus and significant numbers of ND10s accumulating within the cytoplasm (Fig. 7BGo, compare PML, upper row, and PML, lower row). This disruption occurred regardless of whether GFP-TRAM1 was in a diffuse distribution or in the focal accumulation (data not shown). However, most (but not all) of the remaining ND10s were found to associate with the TRAM1 foci (Fig. 7BGo, insets). Therefore, it seems that the formation of foci is not a characteristic unique to GRIP1 and may, in fact, be a general feature of the SRC family.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 7. TRAM1 Associates in Intranuclear Foci Analogous to GRIP1

A, Live cell imaging of GFP-TRAM1-expressing HeLa cells showing the three types of distributions observed with TRAM1. B, GFP-TRAM1 (left column) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of the ND10s was determined by indirect immunofluorescence against PML (middle panel). The overlay of each image pair is shown (right panel). The top row shows a GFP-TRAM1 expressing cell where the bottom row shows a control cell that is not expressing GFP-TRAM1 (green is the pseudo coloring of the background fluorescence) where GFP-TRAM1 is not expressed. Insets in the top overlays show an expanded view of the GFP-TRAM1-ND10 association.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this report, the intracellular distribution of GRIP1 was studied using fusions to the GFP (GFP-GRIP1). GFP-GRIP1 has a complex distribution with the chimera localizing in a diffuse intranuclear distribution in approximately 80–90% of the cells (Fig. 2AGo, left panel) whereas in the remaining 10–20% of cells, GFP-GRIP1 was found in discrete intranuclear foci (Fig. 2AGo, center and right panels). Formation of these foci was dependent on the AD2 region of the protein that was also essential for degradation by the proteasome. Similar focal accumulations were seen previously for TIF2, the human ortholog of GRIP1 (5, 48). The GFP-GRIP1 foci contained components of the 26S proteasome and were found in association with the PML-containing ND10s.

GRIP1 is a large protein with several characterized functional domains (Fig. 1Go) (4). Deletion studies of GFP-GRIP1 identified the C-terminal region (AD1 and AD2) as being critical for foci formation. Interestingly, it appears AD1 and AD2 may play distinct roles in foci formation. As compared with the full-length protein, GFP-GRIP1{Delta}AD1 formed very few foci (Fig. 3CGo) that did not associate with the ND10s (Fig. 4CGo). Since AD1 is the CBP interaction domain (20) and CBP has been shown to colocalize with the ND10s (Fig. 5AGo) (40), a possible explanation for the requirement of the AD1 for ND10 association is its direct association with CBP. In contrast to GFP-GRIP1{Delta}AD1, GFP-GRIP1{Delta}AD2 was unable to form foci in any cell (Fig. 3DGo). A possible explanation of this observation is that an AD2-associated protein may directly recruit GRIP1 to the foci. To date though, only two AD2 interacting proteins have been described, CARM1 (21) and mZac1 (22). Preliminary immunofluorescence studies found CARM1 to localize in a diffuse nucleoplasmic distribution with no evidence of focal accumulations (C. T. Baumann, M. R. Stallcup, and G. L. Hager, unpublished observations). In addition, immunofluorescent experiments against hZac1 have shown it to localize in a uniform nuclear distribution as well (49). Therefore, neither hZac1 nor CARM1 is a likely candidate to directly recruit GRIP1 to the foci, although at this point, we cannot say whether other, unidentified proteins recruit GRIP1 to the foci. A second possibility is that modification (i.e. phosphorylation, methylation, or acetylation) of residues within AD2 triggers the recruitment of GRIP1 to the foci. This will be discussed more fully later in the paper.

A number of studies have found mammalian cells to contain multiple subnuclear structures (50, 51). One of the most intensely studied of these are the ND10s (39). ND10s are small nuclear structures consisting of at least 10 proteins including PML, a growth suppresser implicated in a wide variety of cellular function (52), SP100, first identified as a target for autoimmune antibodies in primary biliary cirrhosis (53), DAXX, identified as a Fas-interacting protein that links the receptor to the JNK kinase pathway (54, 55), and CBP, a histone acetyltransferase important for transcription activation in a variety of systems (40). Here, we have shown that a subset of the GRIP1 foci localize adjacent to the ND10s. Previously, it has been shown that several double-stranded DNA viruses deposit their genomes at sites adjacent to the ND10s as well (56). These deposition sites are similar in size and orientation to the GRIP1 foci we have observed, suggesting that there may be an underlying structure with which both the viral deposition sites and the GRIP1 foci may associate.

The ND10s have been implicated in several intracellular processes, including apoptosis (57, 58) and transcription (59, 60), and have been found to be both spatially and functionally associated with the ubiquitin- dependent proteasome (42, 44, 45, 46). Everett et al. (45) found a ubiquitin-specific protease (HAUSP) that is dynamically associated with the ND10s. HAUSP interacts with Vmw110 (ICP0), an immediate early gene product from herpes simplex virus (HSV), which influences the latent/lytic decision of infecting HSV. During viral infection, Vmw110 associates with the ND10s and subsequently disrupts them. A recent study has also shown that misfolded forms of the influenza virus nucleoprotein can recruit the proteasome to the ND10s (46). In our studies, we have shown that components of the proteasome are enriched in the GRIP1 foci (Fig. 6AGo), whereas when GRIP1 is distributed in a diffuse pattern, few, if any, discrete structures are seen with the same proteasome antibodies (data not shown). In cells expressing {Delta}AD1, the few foci that did form were also enriched in components of the proteasome although they were not associated with the ND10s. It is noteworthy that the number and size of the structures identified by the antiproteasome antibodies correspond quite well with the number and size of the GRIP1 foci. Therefore, it is likely that the proteasome is recruited to the GRIP1 foci in a manner similar to that seen by Anton et al. (46) with the influenza virus nucleoprotein. In addition, recruitment of the proteasome to GFP-GRIP1ÄAD1, which does not associate with the ND10s, indicates that the proteasome can be recruited to intranuclear structures other than the ND10s.

The intracellular levels of several members of the NHR family, including the estrogen (61, 62), retinoic acid (63, 64) retinoic X (64), peroxisome proliferator-activated receptor (PPAR) (65), and progesterone receptors (66), are regulated by the ubiquitin-dependent proteasome. In these cases, the addition of the appropriate ligand agonist results in down-regulation of receptor levels by ubiquitin-mediated proteasome degradation. Degradation of the ligand-bound nuclear receptor is believed to play an important role in "turning off" the hormone response and therefore functioning as an additional level of regulation of the NHRs. Lazar and co-workers have demonstrated that the intracellular levels of the nuclear corepressor (N-CoR) are also mediated by the proteasome (67). In this study, a mammalian homolog of the Drosophila Seven in absentia (mSiah2) protein targets N-CoR for proteasome-mediated degradation in cells expressing high levels of mSiah2 but not in cells limited in mSiah2. This result begins to explain the cell type specificity observed for nuclear receptor-mediated repression. Our observations that GRIP1 can associate with proteasomes suggest that the intracellular levels of the SRCs may also be regulated in a proteasome-dependent manner. This is supported by the ability of lactacystin to increase the levels of GFP-GRIP1 in treated cells (Fig. 6CGo). Additionally, a recent paper has shown that several members of the SRC family, including GRIP1, are degraded by the 26S proteasome (41). Taken as a whole, these results clearly implicate the 26S proteasome in the degradation of GRIP1 and suggest the protein turnover/stability may be an important regulatory feature of GRIP1.

To be degraded by the 26S proteasome, GRIP1 would need to be ubiquitinated. Ubiquitination of proteins generally requires a so-called PEST sequence; a stretch of amino acids enriched in proline, serine, threonine, and glutamic acid (68). Analysis of the GRIP1 protein by the PEST-FIND program (http://bioweb. pasteur.fr/seqanal/interfaces/pestfind.html) has identified four potential PEST sequences: one in the bHLH-PAS domain [amino acid (a.a.) 205–215], one between nrb boxes i and ii (a.a. 648–679), one between nrb boxes ii and iii (a.a. 713–731), and one encompassing a.a. 788–826 (Fig. 8Go). Since the entire bHLH-PAS region can be deleted with no observable effect on the distribution of GRIP1 or the ability of the protein to potentiate GR-dependent transcription (C. T. Baumann and G. L. Hager, unpublished observations), the PEST between a.a. 205 and 215 does not appear to be important in GRIP1 activity. Several transcription factors, other than the NHRs, have been found to be degraded by the 26S proteasome (69, 70, 71, 72). Comparison of the PEST sites and the activation domains from these proteins has found that the two are inseparable from one another (73). Therefore, it has been suggested that these proteins may have evolved a tight coupling of the activation potentials and degradation as a mechanism to carefully regulate their activity (73). Since the nuclear receptor interaction domain (NID) is essential for nuclear receptor-mediated transactivation, it is possible that a similar regulatory mechanism has evolved for GRIP1 as well. Analysis of the three potential PEST sequences within the nuclear receptor interacting domain is currently underway.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 8. The Potential PEST Sites within the NID of GRIP1

Top, Schematic of the NID of GRIP1. The three nrb boxes are indicated (black boxes) and are numbered i–iii. The potential PEST sites (black lines) are also indicated below. Bottom, Amino acid sequence of the three potential PEST sites found with the NID.

 
Of note, none of the predicted PEST sequences is located within the AD2 region. However, we have shown that the AD2 region of GRIP1 is essential for both foci formation and proteasome degradation. Why then is the AD2 region absolutely necessary for these functions? It is possible that posttranslational modifications within the AD2 region may target GRIP1 for degradation. For example, phosphorylation can serve as a signal to target proteins for ubiquitination and subsequent degradation (74, 75, 76, 77, 78). Analysis of the amino acid sequence of AD2 has identified three consensus cdc2 phosphorylation sites and a consensus mitogen-activated protein (MAP) kinase site. cdc2 is a cell cycle-regulated protein kinase involved in regulating cell cycle progression (79). Phosphorylation of proteins by cdc2 has been shown to target them for ubiquitin-dependent degradation (80). As the kinase activity of cdc2 is cell cycle regulated and the GRIP1 foci are found in only 20% of the cells, it is intriguing to speculate that formation of these foci may be cell cycle regulated through the cdc2 kinase. MAP kinase has also been shown to target proteins for degradation (81, 81). Specifically, phosphorylation of the ligand-bound human progesterone receptor at serine 194 by MAP kinase targets it for degradation. Analysis of these and other potential kinase sites within AD2 is an area we are actively pursuing.

Recently TIF2, the human ortholog of GRIP1, was shown to be associated with acute myeloid leukemia (AML) (82). In AML, a chromosomal translocation results in the C-terminal region of TIF2 being fused to the N terminus of a myeloid-specific histone acetyltransferase (MOZ). The region of TIF2 contained within the MOZ-TIF2 fusion contains AD1 and AD2, both of which play a role in the ability of GFP-GRIP1 to form foci. In a second subtype of AML, CBP was fused to MOZ (83). Although the region of CBP responsible for ND10 association is unknown, one can speculate that the MOZ-TIF2 fusion may by mislocalized through the AD2 of TIF2, resulting in an altered gene expression profile compared with wild-type cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
pLTRLuc, pCMVIL2, and pRSVßGal were described pre-viously (31). pEGFP-GRIP1 was constructed as follows. An EcoRI fragment containing the GRIP1 cDNA was excised from pSG5-HA-GRIP1 (21) and cloned into similarly cut pEGFP-C2 (CLONTECH Laboratories, Inc. Palo Alto, CA). pEGFP-GRIP1{Delta}AD1, pEGFP-GRIP1{Delta}AD2, pEGFP-GRIP1{Delta}AD1 +AD2, and pEGFP-GRIP1 nrbIIm+nrbIIIm were constructed as described for pEGFP-GRIP1 except pSG5-HA-GRIP1{Delta}1057-1109 (20), pSG5-HA-GRIP15-1121 (21), pSG5-HA-GRIP1{Delta}AD1+AD2 (H. Ma and M. R.Stallcup, unpublished results), and pSG5-HA-GRIP1 nrbIIm+nrbIIIm (20), respectively, were used. pEGFP-GRIP1-{Delta}bHLH-PAS was constructed as follows. Site-directed mutagenesis using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) was used to introduce an AflII site at positions 231–236 and an EcoRV site at 1,212–1,217 in pEGFP-GRIP1 (numbering based on nucleotide sequence from the GenBank entry U39060). The following oligonucleotides were used in the mutagenesis. GGGATGGGAGAAAACACCTCTCTTAAGTCCAGGGCAGAGACCAG- AAAACGC and GCGTTTTCTGGTCTCTGCCCTGGACTTA- AGAGAGGTGTTTTCTCCCATCCC were used to introduce the AflII site and GGGTTGGCGTTCAGTCAGATCGAT ATCTTTT- CT TTGTCTGATGGCACTCTCG and CGAGAGTGCCATCAGACAAAGAAAAGATATCGATCTGACTACGCCAACCC were used to introduce the EcoRV site. Bold letters represent the bases changed to introduce the appropriate restriction enzyme site. The resulting vector was digested with EcoRV and AflII and closed with a linker to reintroduce the nuclear localization signal that was lost in the original EcoRV/AflII fragment (GAGACTTAAGTCCAGGGCAGAGACCAGAAAACGCAAGGATATCGAGA and TCTCGATATCCTTGCGTTTTCTGGTCTCTGCCCTGGAC- TTAAGTCTC).

To construct pEGFP-TRAM1, the TRAM1 cDNA was amplified by PCR from pBKCMV-TRAM1 (47) with oligonucleotides that added a XhoI site at the 5'-end of the gene and a KpnI site at the 3'-end. The resulting PCR product was cut with XhoI and KpnI and cloned into similarly cut pEGFP-C1.

Cell Culture and Transfections
HeLa cells were routinely maintained in DMEM + 10% FBS + 100 U/ml penicillin and streptomycin + 2 mM L-glutamine at 37 C and 5% CO2 in a water-jacketed incubator. Cells were typically split 1:4 every other day. Where indicated, cells were treated with 1 uM lactacystin (Alexis Chemicals, San Diego, CA) in EtOH for 24 h. Transfections were done by the calcium phosphate procedure (Invitrogen, Carlsbad, CA).

Transactivations and Western Blot Analyses
For transactivation assays, 5 x 106 HeLa cells were plated in a 100-mm dish in DMEM + 10% charcoal-stripped FBS and transfected with 5 µg pLTRLuc and 0.5 mg pRSVßGal with and without 5 mg of the indicated GRIP1 expression vector. The following day, cells were washed with PBS and treated with 100 nM dexamethasone for 6 h. Cells were harvested by scraping, and luciferase and ß-galactosidase assays were done as described (31). For Western blots, 5 x 106 cells were transfected with 20 µg pEGFP-GRIP1 and 20 µg pCMVIL2 as described above. The next day, the transfected population of cells was enriched by sorting with anti-IL2-coated magnet beads, and whole cell extracts were made as described previously (31). Extract (20 mg) was run on a 7.5% SDS-PAGE and electrotransferred to Immobilon-P (Millipore Corp., Bedford, MA) in 192 mM glycine, 25 mM Tris, 20% methanol, and 0.1% SDS for 18 h at 100 mA. GFP-fusion proteins were detected by a polyclonal anti-GFP (CLONTECH Laboratories, Inc.) at a 1:500 dilution and a horseradish peroxidase (HRP)-conjugated goat antirabbit at 1:10,000 (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA).

Immunofluorescence
Cells (2 x 105) were plated onto coverslips in a six-well dish and transfected with 0.5 mg of the indicated GFP-fusion vector. The following day, cells were washed two times with PBS (without Ca2+ and Mg2+), fixed for 20 min in freshly prepared 3.5% paraformaldehyde in PBS (without Ca2+ and Mg2+), washed two times with PBS (without Ca2+ and Mg2+), and permeabilized with 0.5% Triton-X 100 in PBS (without Ca2+ and Mg2+). Primary antibodies were incubated with cells on coverslips at the dilutions suggested by the manufacturer overnight at 4 C in PBS (without Ca2+ and Mg2+) + 10% normal calf serum. The next day, the coverslips were washed three times in PBS (without Ca2+ and Mg2+) + 10% normal calf serum and incubated with the fluorescently conjugated secondary antibody for 1 h at room temperature in PBS + 10% normal calf serum. Coverslips were then washed three times with PBS (without Ca2+ and Mg2+) + 10% normal calf serum, once in PBS (without Ca2+ and Mg2+), once in PBS (without Ca2+ and Mg2+) + 0.5 mg/ml Hoechst 33342 (to visualize DNA), and once in dH2O (to remove residual salts). Coverslips were then mounted on quartz microscope slides in Vectashield (Vector Laboratories, Inc., Burlingame, CA). The following antibodies were used for these studies. Primary antibodies: PML, mouse anti-PML (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); CBP, rabbit anti-CBP NT (Upstate Biotechnology, Inc. Lake Placid, NY); ubiquitin, rabbit antiubiquitin (Affiniti Research Products, Ltd, Exeter, UK); PA28{alpha}, rabbit anti-PA28{alpha} (Affiniti Research Products, Ltd, Exeter, UK); and 20S core proteasome, rabbit, anti-core (Affiniti Research Products, Ltd, Exeter, UK). Secondary antibodies: to visualize PML, ubiquitin, PA28{alpha}, and the core 20S proteasome, Texas Red-conjugated secondary antibodies were used of the appropriate species specificity (Calbiochem- Novabiochem Corp, La Jolla, CA). To visualize CBP, Cy5-conjugated goat-antirabbit antibodies were used (Amersham Pharmacia Biotech, Inc, Piscataway, NJ). All secondary antibodies were used at a 1:250 dilution.

Cell Extractions
Cell extractions were done as follows. HeLa cells (2 x 105) were transfected with 0.5 mg pEGFP-GRIP1 as described above. The next day, cells were washed with ice-cold PBS and sequentially extracted with CSK buffer (100 mM NaCl, 300 mM sucrose, 10 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.8, 3 mM MgCl2, 0.5% Triton-X 100, and protease inhibitor cocktail (Calbiochem-Novabiochem Corp.) for 10 min at 4 C followed by extraction buffer (250 mM ammonium sulfate, 300 mM sucrose, 10 mM PIPES, pH 6.8, 3 mM MgCl2, 0.5 Triton-X 100, and protease inhibitor cocktail (Calbiochem-Novabiochem Corp.) for 5 min at 4 C followed by 10 mg/ml DNase I in CSK (with 50 mM NaCl instead of 100 mM) for 1 h at room temperature. The process was stopped by fixation in 3.5% paraformaldehyde for 20 min at room temperature, washed, and mounted as described above.

Fluorescence Imaging
Live-cell microscopy of GFP-fusion proteins was performed on a Leica Corp. TCS-SP confocal microscope mounted on a DMIRBE inverted microscope (Leica Corp. Microsystems, Exton, PA). GFP was excited with the 488-nm laser line of an air-cooled Ar laser (20 mW nominal output, Coherent Inc., Santa Clara, CA). GFP emission was monitored between 505 nm and 590 nm, and the cells were maintained at 37 C with a Nevtek ASI 400 Air Stream Incubator (Nevtek, Burnsville, VA). For immunofluorescent studies, images were acquired with either a Eclipse E800 (Nikon, Melville, NY) equipped with a Micromax cooled CCD (Roper Scientific, Trenton, NJ) or a IE80 (Olympus Corp., Lake Success, NY) equipped with a Deltavision image acquisition and analysis package (Applied Precision, Inc., Issaquah, WA). Standard filter sets were used for all imaging (Chroma Technology Corp., Brattleboro, VT) All images were processed as tiffs on Corel Photo-Paint (Corel Corp., Ontario, Canada) using standard image processing techniques.

Quantitative Analysis
The area-corrected intensity of the GFP-GRIP1 expressing cells was determined using the MetaMorph image analysis software package (Universal Imaging Corp, West Chester, PA). First, the nucleus was encircled (using the polygon tool) and the total fluorescence intensity and total area of the nucleus were determined. Background fluorescence was determined by measuring the total fluorescence of a random region within the field of view and dividing that value by the total area of that region to give the total background per unit area (BA) within the field of view. The BA was then multiplied by the total area of the nucleus to give the total background within the nucleus (BN). This value was then subtracted from the total fluorescence intensity of the nucleus to give the background-corrected intensity of the nucleus (FN). For each experiment, the area-corrected intensity of several hundred cells was determined.


    FOOTNOTES
 
Address requests for reprints to: Dr. Gordon Hager, Laboratory of Receptor Biology & Gene Expression, National Cancer Institute, NIH Building 41, Room B602, Bethesda, Maryland 20892-5055. E-mail: hagerg{at}exchange.nih.gov

1 Current Address: Instituto de Bioquimica Vegetal y Fotosintesis, Centro de Investigaciones Isla de la Cartuja, Av. Americo Vespucio s/n, 41092 Sevilla Spain. Back

2 Current Address: Department of Pharmaceutics and Pharmaceutical Chemistry, University of Utah, Salt Lake City, Utah 84108. Back

Received for publication May 30, 2000. Revision received November 22, 2000. Accepted for publication December 19, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Giguere V 1999 Orphan nuclear receptors: from gene to function. Endocr Rev 20:689–725[Abstract/Free Full Text]
  2. Feng W, Ribiero RCJ, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  3. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  4. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  5. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  6. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  7. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  8. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  9. Westin S, Rosenfeld MG, Glass CK 2000 Nuclear receptor coactivators. Adv Pharmacol 47:89–112
  10. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear receptor coactivators. Curr Opin Cell Biol 9:222–232[CrossRef][Medline]
  11. Yao TP, Ku G, Zhou N, Scully R, Livingston DM 1996 The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc Natl Acad Sci USA 93:10626–10631[Abstract/Free Full Text]
  12. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frail DE 1998 A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273:27645–27653[Abstract/Free Full Text]
  13. Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9:140–147[CrossRef][Medline]
  14. Szapary D, Huang Y, Simons Jr SS 1999 Opposing effects of corepressor and coactivators in determining the dose-response curve of agonists, and residual agonist activity of antagonists, for glucocorticoid receptor-regulated gene expression. Mol Endocrinol 13:2108–2121[Abstract/Free Full Text]
  15. Pugh BF, Tjian R 1990 Mechanism of transcriptional activation by Sp1: evidence for coactivators. Cell 61:1187–1197[CrossRef][Medline]
  16. Henttu PM, Kalkhoven E, Parker MG 1997 AF-2 activity and recruitment of steroid receptor coactivator 1 to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol Cell Biol 17:1832–1839[Abstract]
  17. DiRenzo J, Soderstrom M, Kurokawa R, Ogliastro MH, Ricote M, Ingrey S, Horlein A, Rosenfeld MG, Glass CK 1997 Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors. Mol Cell Biol 17:2166–2176[Abstract]
  18. Goldman PS, Tran VK, Goodman RH 1997 The multifunctional role of the co-activator CBP in transcriptional regulation. Recent Prog Horm Res 52:103–119
  19. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  20. Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee GA, Stallcup MR 1999 Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:6164–6173[Abstract/Free Full Text]
  21. Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW, Stallcup MR 1999 Regulation of transcription by a protein methyltransferase. Science 284:2174–2177[Abstract/Free Full Text]
  22. Huang SM, Stallcup MR 2000 Mouse Zac1, a transcriptional coactivator and repressor for nuclear receptors. Mol Cell Biol 20:1855–1867[Abstract/Free Full Text]
  23. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  24. Munck A, Naray-Fejes-Toth A 1992 The ups and downs of glucocorticoid physiology. Permissive and suppressive effects revisited. Mol Cell Endocrinol 90:C1–C4
  25. Hu JM, Bodwell JE, Munck A 1994 Cell cycle-dependent glucocorticoid receptor phosphorylation and activity. Mol Endocrinol 8:1709–1713[Abstract/Free Full Text]
  26. Munck A, Naray-Fejes-Toth A 1994 Glucocorticoids and stress: permissive and suppressive actions. Ann NY Acad Sci 746:115–130; discussion 131–133[Medline]
  27. van Steensel B, Jenster G, Damm K, Brinkmann AO, van Driel R 1995 Domains of the human androgen receptor and glucocorticoid receptor involved in binding to the nuclear matrix. J Cell Biochem 57:465–478[CrossRef][Medline]
  28. van Steensel B, Brink M, van der Meulen K, van Binnendijk EP, Wansink DG, de Jong L, de Kloet ER, van Driel R 1995 Localization of the glucocorticoid receptor in discrete clusters in the cell nucleus. J Cell Sci 108:3003–3011[Abstract]
  29. Htun H, Barsony J, Renyi I, Gould DJ, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850[Abstract/Free Full Text]
  30. Smith CL, Wolford RG, O’Neill TB, Hager GL 2000 Characterization of transiently- and constitutively-expressed progesterone receptors: evidence for two functional states. Mol Endocrinol 14:956–971[Abstract/Free Full Text]
  31. Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL, Hager GL 1999 Differential localization and activity of the A and B forms of the human progesterone receptor using green fluorescent protein chimeras. Mol Endocrinol 13:366–375[Abstract/Free Full Text]
  32. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization of ligand occupied and unoccupied human estrogen receptor {alpha} reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471–486[Abstract/Free Full Text]
  33. Hager GL, Lim CS, Elbi C, Baumann CT 2000 Trafficking of nuclear receptors in living cells. In: Estrogens and Women’s Health: Benefit or Threat. J Steroid Biochem Mol Biol 74:249–254[CrossRef][Medline]
  34. Baumann CT, Lim CS, Hager GL 1999 Intracellular localization and trafficking of steroid receptors. Cell Biochem Biophys 31:119–127[CrossRef][Medline]
  35. Baumann CT, Maruvada P, Hager GL, Yen PM 2001 Nuclear-cytoplasmic shuttling by thyroid hormone receptors: multiple protein interactions are required for nuclear retention. J Biol Chem, in press
  36. Mckenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  37. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313[Abstract/Free Full Text]
  38. Maul GG, Negorev D, Bell P, Ishov AM 2000 Review: properties and assembly mechanisms of ND10, PML bodies, or PODs. J Struct Biol 129:278–287[CrossRef][Medline]
  39. Sternsdorf T, Grotzinger T, Jensen K, Will H 1997 Nuclear dots: actors on many stages. Immunobiology 198:307–331[Medline]
  40. LaMorte VJ, Dyck JA, Ochs RL, Evans RM 1998 Localization of nascent RNA and CREB binding protein with the PML-containing nuclear body. Proc Natl Acad Sci USA 95:4991–4996[Abstract/Free Full Text]
  41. Lonard DM, Nawaz Z, Smith CL, O’Malley BW 2000 The 26S proteasome is required for estrogen receptor-{alpha} and coactivator turnover and for efficient estrogen receptor-{alpha} transactivation. Mol Cell 5:939–948[CrossRef][Medline]
  42. Everett RD, Maul GG 1994 HSV-1 IE protein Vmw110 causes redistribution of PML. EMBO J 13:5062–5069[Medline]
  43. Everett RD, Earnshaw WC, Pluta AF, Sternsdorf T, Ainsztein AM, Carmena M, Ruchaud S, Hsu WL, Orr A 1999 A dynamic connection between centromeres and ND10 proteins. J Cell Sci 112:3443–3454[Abstract]
  44. Chelbi-Alix MK, de The H 1999 Herpes virus induced proteasome-dependent degradation of the nuclear bodies-associated PML and Sp100 proteins. Oncogene 18:935–941[CrossRef][Medline]
  45. Everett RD, Freemont P, Saitoh H, Dasso M, Orr A, Kathoria M, Parkinson J 1998 The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110- and proteasome-dependent loss of several PML isoforms. J Virol 72:6581–6591[Abstract/Free Full Text]
  46. Anton LC, Schubert U, Bacik I, Princiotta MF, Wearsch PA, Gibbs J, Day PM, Realini C, Rechsteiner MC, Bennink JR, Yewdell JW 1999 Intracellular localization of proteasomal degradation of a viral antigen. J Cell Biol 146:113–124[Abstract/Free Full Text]
  47. Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  48. Carrero P, Okamoto K, Coumailleau P, O’Brien S, Tanaka H, Poellinger L Redox-regulated recruitment of the transcriptional coactivators CREB-binding protein and SRC-1 to hypoxia-inducible factor 1{alpha}. Mol Cell Biol 20:402–415
  49. Varrault A, Ciani E, Apiou F, Bilanges B, Hoffmann A, Pantaloni C, Bockaert J, Spengler D, Journot L 1998 hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc Natl Acad Sci USA 95:8835–8840[Abstract/Free Full Text]
  50. Gall JG, Tsvetkov A, Wu Z, Murphy C 1995 Is the sphere organelle/coiled body a universal nuclear component? Dev Genet 16:25–35[CrossRef][Medline]
  51. Misteli T, Caceres JF, Spector DL 1997 The dynamics of a pre-mRNA splicing factor in living cells. Nature 387:523–527[CrossRef][Medline]
  52. Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T, Carmo-Fonseca M, Lamond A, Dejean A 1994 Retinoic acid regulates aberrant nuclear localization of PML-RAR {alpha} in acute promyelocytic leukemia cells. Cell 76:345–356[CrossRef][Medline]
  53. Sternsdorf T, Jensen K, Reich B, Will H 1999 The nuclear dot protein sp100, characterization of domains necessary for dimerization, subcellular localization, and modification by small ubiquitin-like modifiers. J Biol Chem 274:12555–12566[Abstract/Free Full Text]
  54. Torii S, Egan DA, Evans RA, Reed JC 1999 Human Daxx regulates Fas-induced apoptosis from nuclear PML oncogenic domains (PODs). EMBO J 18:6037–6049[CrossRef][Medline]
  55. Ishov AM, Sotnikov AG, Negorev D, Vladimirova OV, Neff N, Kamitani T, Yeh ET, Strauss JF, III, Maul GG 1999 PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J Cell Biol 147:221–234[Abstract/Free Full Text]
  56. Maul GG 1998 Nuclear domain 10, the site of DNA virus transcription and replication. Bioessays 20:660–667[CrossRef][Medline]
  57. Wang ZG, Ruggero D, Ronchetti S, Zhong S, Gaboli M, Rivi R, Pandolfi PP 1998 PML is essential for multiple apoptotic pathways. Nat Genet 20:266–272[CrossRef][Medline]
  58. Quignon F, De Bels F, Koken M, Feunteun J, Ameisen JC, de The H 1998 PML induces a novel caspase-independent death process. Nat Genet 20:259–265[CrossRef][Medline]
  59. Vallian S, Gaken JA, Trayner ID, Gingold EB, Kouzarides T, Chang KS, Farzaneh F 1997 Transcriptional repression by the promyelocytic leukemia protein, PML. Exp Cell Res 237:371–382[CrossRef][Medline]
  60. Alcalay M, Tomassoni L, Colombo E, Stoldt S, Grignani F, Fagioli M, Szekely L, Helin K, Pelicci PG 1998 The promyelocytic leukemia gene product (PML) forms stable complexes with the retinoblastoma protein. Mol Cell Biol 18:1084–1093[Abstract/Free Full Text]
  61. Nawaz Z, Lonard DM, Dennis AP, Smith CL, O’Malley BW 1999 Proteasome-dependent degradation of the human estrogen receptor. Proc Natl Acad Sci USA 96:1858–1862[Abstract/Free Full Text]
  62. Alarid ET, Bakopoulos N, Solodin N 1999 Proteasome-mediated proteolysis of estrogen receptor: a novel component in autologous down-regulation. Mol Endocrinol 13:1522–1534[Abstract/Free Full Text]
  63. Zhu J, Gianni M, Kopf E, Honore N, Chelbi-Alix M, Koken M, Quignon F, Rochette-Egly C, de The H 1999 Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor {alpha} (RAR{alpha}) and oncogenic RAR{alpha} fusion proteins. Proc Natl Acad Sci USA 96:14807–14812[Abstract/Free Full Text]
  64. Boudjelal M, Wang Z, Voorhees JJ, Fisher GJ Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor {gamma} and retinoid X receptor {alpha} in human keratinocytes. Cancer Res 60:2247–2252
  65. Hauser S, Adelmant G, Sarraf P, Wright HM, Mueller E, Spiegelman BM 2000 Degradation of the peroxisome proliferator-activated receptor (PPAR) {gamma} is linked to ligand-dependent activation. J Biol Chem 275:18527–18533[Abstract/Free Full Text]
  66. Syvala H, Vienonen A, Zhuang YH, Kivineva M, Ylikomi T, Tuohimaa P 1998 Evidence for enhanced ubiquitin- mediated proteolysis of the chicken progesterone receptor by progesterone. Life Sci 63:1505–1512[CrossRef][Medline]
  67. Zhang J, Guenther MG, Carthew RW, Lazar MA 1998 Proteasomal regulation of nuclear receptor corepressor-mediated repression. Genes Dev 12:1775–1780[Abstract/Free Full Text]
  68. Rechsteiner M 1989 PEST regions, proteolysis and cell cycle progression. Rev Biol Cell 20:235–253
  69. Salghetti SE, Kim SY, Tansey WP 1999 Destruction of Myc by ubiquitin-mediated proteolysis: cancer-associated and transforming mutations stabilize Myc. EMBO J 18:717–726[CrossRef][Medline]
  70. Treier M, Staszewski LM, Bohmann D 1994 Ubiquitin-dependent c-Jun degradation in vivo is mediated by the {delta} domain. Cell 78:787–798[CrossRef][Medline]
  71. Chowdary DR, Dermody JJ, Jha KK, Ozer HL 1994 Accumulation of p53 in a mutant cell line defective in the ubiquitin pathway. Mol Cell Biol 14:1997–2003[Abstract/Free Full Text]
  72. Campanero MR, Flemington EK 1997 Regulation of E2F through ubiquitin-proteasome-dependent degradation: stabilization by the pRB tumor suppressor protein. Proc Natl Acad Sci USA 94:2221–2226[Abstract/Free Full Text]
  73. Salghetti SE, Muratani M, Wijnen H, Futcher B, Tansey WP Functional overlap of sequences that activate transcription and signal ubiquitin-mediated proteolysis. Proc Natl Acad Sci USA 97:3118–3123
  74. Ku NO, Omary MB Keratins turn over by ubiquitination in a phosphorylation-modulated fashion. J Cell Biol 149:547–552
  75. Breitschopf K, Haendeler J, Malchow P, Zeiher AM, Dimmeler S Posttranslational modification of Bcl-2 facilitates its proteasome-dependent degradation: molecular characterization of the involved signaling pathway. Mol Cell Biol 20:1886–1896
  76. Mitsui A, Sharp PA 1999 Ubiquitination of RNA polymerase II large subunit signaled by phosphorylation of carboxyl-terminal domain. Proc Natl Acad Sci USA 96:6054–6059[Abstract/Free Full Text]
  77. Montagnoli A, Fiore F, Eytan E, Carrano AC, Draetta GF, Hershko A, Pagano M 1999 Ubiquitination of p27 is regulated by Cdk-dependent phosphorylation and trimeric complex formation. Genes Dev 13:1181–1189[Abstract/Free Full Text]
  78. Alessandrini A, Chiaur DS, Pagano M 1997 Regulation of the cyclin-dependent kinase inhibitor p27 by degradation and phosphorylation. Leukemia 11:342–345[CrossRef][Medline]
  79. Krek W, Nigg EA 1991 Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J 10:305–316[Medline]
  80. Benito J, Martin-Castellanos C, Moreno S 1998 Regulation of the G1 phase of the cell cycle by periodic stabilization and degradation of the p25rum1 CDK inhibitor. EMBO J 17:482–497[CrossRef][Medline]
  81. Lange CA, Shen T, Horwitz KB 2000 Phosphorylation of human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26S proteasome. Proc Natl Acad Sci USA 97:1032–1037[Abstract/Free Full Text]
  82. Carapeti M, Aguiar RC, Goldman JM, Cross NC 1998 A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia. Blood 91:3127–3133[Abstract/Free Full Text]
  83. Giles RH, Dauwerse JG, Higgins C, Petrij F, Wessels JW, Beverstock GC, Dohner H, Jotterand-Bellomo M, Falkenburg JH, Slater RM, van Ommen GJ, Hagemeijer A, van der Reijden BA, Breuning MH 1997 Detection of CBP rearrangements in acute myelogenous leukemia with t(8;16). Leukemia 11:2087–2096[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
T. C. Voss, R. L. Schiltz, M.-H. Sung, T. A. Johnson, S. John, and G. L. Hager
Combinatorial probabilistic chromatin interactions produce transcriptional heterogeneity
J. Cell Sci., February 1, 2009; 122(3): 345 - 356.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. S. Fenne, T. Hoang, M. Hauglid, J. V. Sagen, E. A. Lien, and G. Mellgren
Recruitment of Coactivator Glucocorticoid Receptor Interacting Protein 1 to an Estrogen Receptor Transcription Complex Is Regulated by the 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase
Endocrinology, September 1, 2008; 149(9): 4336 - 4345.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
D. M. Lonard and B. W. O'Malley
SRC-3 Transcription-Coupled Activation, Degradation, and the Ubiquitin Clock: Is There Enough Coactivator to Go Around in Cells?
Sci. Signal., April 1, 2008; 1(13): pe16 - pe16.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Amazit, L. Pasini, A. T. Szafran, V. Berno, R.-C. Wu, M. Mielke, E. D. Jones, M. G. Mancini, C. A. Hinojos, B. W. O'Malley, et al.
Regulation of SRC-3 Intercompartmental Dynamics by Estrogen Receptor and Phosphorylation
Mol. Cell. Biol., October 1, 2007; 27(19): 6913 - 6932.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. B. Harvey, J. H. D. Bassett, P. Maruvada, P. M. Yen, and G. R. Williams
The Rat Thyroid Hormone Receptor (TR) {Delta}{beta}3 Displays Cell-, TR Isoform-, and Thyroid Hormone Response Element-Specific Actions
Endocrinology, April 1, 2007; 148(4): 1764 - 1773.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Lin, P. Philibert, B. Ferraz-de-Souza, D. Kelberman, T. Homfray, A. Albanese, V. Molini, N. J. Sebire, S. Einaudi, G. S. Conway, et al.
Heterozygous Missense Mutations in Steroidogenic Factor 1 (SF1/Ad4BP, NR5A1) Are Associated with 46,XY Disorders of Sex Development with Normal Adrenal Function
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 991 - 999.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
A. McMaster and D. W. Ray
Modelling the glucocorticoid receptor and producing therapeutic agents with anti-inflammatory effects but reduced side-effects
Exp Physiol, March 1, 2007; 92(2): 299 - 309.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K.-T. Chin, A. C.S. Chun, Y.-P. Ching, K.-T. Jeang, and D.-Y. Jin
Human T-Cell Leukemia Virus Oncoprotein Tax Represses Nuclear Receptor-Dependent Transcription by Targeting Coactivator TAX1BP1
Cancer Res., February 1, 2007; 67(3): 1072 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. L. Arnett-Mansfield, J. D. Graham, A. R. Hanson, P. A. Mote, A. Gompel, L. L. Scurr, N. Gava, A. de Fazio, and C. L. Clarke
Focal Subnuclear Distribution of Progesterone Receptor Is Ligand Dependent and Associated with Transcriptional Activity
Mol. Endocrinol., January 1, 2007; 21(1): 14 - 29.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. T. Alarid
Lives and Times of Nuclear Receptors
Mol. Endocrinol., September 1, 2006; 20(9): 1972 - 1981.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Liu, X. Xia, J. D. Fondell, and P. M. Yen
Thyroid Hormone-Regulated Target Genes Have Distinct Patterns of Coactivator Recruitment and Histone Acetylation
Mol. Endocrinol., March 1, 2006; 20(3): 483 - 490.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M-B Debril, L Dubuquoy, J-N Feige, W Wahli, B Desvergne, J Auwerx, and L Gelman
Scaffold attachment factor B1 directly interacts with nuclear receptors in living cells and represses transcriptional activity
J. Mol. Endocrinol., December 1, 2005; 35(3): 503 - 517.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Mouthiers, A. Baillet, C. Delomenie, D. Porquet, and N. Mejdoubi-Charef
Peroxisome Proliferator-Activated Receptor {alpha} Physically Interacts with CCAAT/Enhancer Binding Protein (C/EBP{beta}) to Inhibit C/EBP{beta}-Responsive {alpha}1-Acid Glycoprotein Gene Expression
Mol. Endocrinol., May 1, 2005; 19(5): 1135 - 1146.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. B. Kindle, P. J. F. Troke, H. M. Collins, S. Matsuda, D. Bossi, C. Bellodi, E. Kalkhoven, P. Salomoni, P. G. Pelicci, S. Minucci, et al.
MOZ-TIF2 Inhibits Transcription by Nuclear Receptors and p53 by Impairment of CBP Function
Mol. Cell. Biol., February 1, 2005; 25(3): 988 - 1002.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Patel, R. Truant, R. A. Rachubinski, and J. P. Capone
Activity and subcellular compartmentalization of peroxisome proliferator-activated receptor {alpha} are altered by the centrosome-associated protein CAP350
J. Cell Sci., January 1, 2005; 118(1): 175 - 186.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Grenier, A. Trousson, A. Chauchereau, L. Amazit, A. Lamirand, P. Leclerc, A. Guiochon-Mantel, M. Schumacher, and C. Massaad
Selective Recruitment of p160 Coactivators on Glucocorticoid-Regulated Promoters in Schwann Cells
Mol. Endocrinol., December 1, 2004; 18(12): 2866 - 2879.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hoang, I. S. Fenne, C. Cook, B. Borud, M. Bakke, E. A. Lien, and G. Mellgren
cAMP-dependent Protein Kinase Regulates Ubiquitin-Proteasome-mediated Degradation and Subcellular Localization of the Nuclear Receptor Coactivator GRIP1
J. Biol. Chem., November 19, 2004; 279(47): 49120 - 49130.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. E. Black, M. J. Vitto, D. Gioeli, A. Spencer, N. Afshar, M. R. Conaway, M. J. Weber, and B. M. Paschal
Transient, Ligand-Dependent Arrest of the Androgen Receptor in Subnuclear Foci Alters Phosphorylation and Coactivator Interactions
Mol. Endocrinol., April 1, 2004; 18(4): 834 - 850.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. L. Arnett-Mansfield, A. deFazio, P. A. Mote, and C. L. Clarke
Subnuclear Distribution of Progesterone Receptors A and B in Normal and Malignant Endometrium
J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1429 - 1442.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. M. Lonard, S. Y. Tsai, and B. W. O'Malley
Selective Estrogen Receptor Modulators 4-Hydroxytamoxifen and Raloxifene Impact the Stability and Function of SRC-1 and SRC-3 Coactivator Proteins
Mol. Cell. Biol., January 1, 2004; 24(1): 14 - 24.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. Fan, T. Yanase, Y. Wu, H. Kawate, M. Saitoh, K. Oba, M. Nomura, T. Okabe, K. Goto, J. Yanagisawa, et al.
Protein Kinase A Potentiates Adrenal 4 Binding Protein/Steroidogenic Factor 1 Transactivation by Reintegrating the Subcellular Dynamic Interactions of the Nuclear Receptor with Its Cofactors, General Control Nonderepressed-5/Transformation/ Transcription Domain-Associated Protein, and Suppressor, Dosage-Sensitive Sex Reversal-1: a Laser Confocal Imaging Study in Living KGN Cells
Mol. Endocrinol., January 1, 2004; 18(1): 127 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Moraitis and V. Giguere
The Co-repressor Hairless Protects ROR{alpha} Orphan Nuclear Receptor from Proteasome-mediated Degradation
J. Biol. Chem., December 26, 2003; 278(52): 52511 - 52518.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Woodham, L. Birch, and G. S. Prins
Neonatal Estrogen Down-Regulates Prostatic Androgen Receptor through a Proteosome-Mediated Protein Degradation Pathway
Endocrinology, November 1, 2003; 144(11): 4841 - 4850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Amazit, Y. Alj, R. K. Tyagi, A. Chauchereau, H. Loosfelt, C. Pichon, J. Pantel, E. Foulon-Guinchard, P. Leclerc, E. Milgrom, et al.
Subcellular Localization and Mechanisms of Nucleocytoplasmic Trafficking of Steroid Receptor Coactivator-1
J. Biol. Chem., August 22, 2003; 278(34): 32195 - 32203.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Yan, X. Gao, D. M. Lonard, and Z. Nawaz
Specific Ubiquitin-Conjugating Enzymes Promote Degradation of Specific Nuclear Receptor Coactivators
Mol. Endocrinol., July 1, 2003; 17(7): 1315 - 1331.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Arabi, C. Rustum, E. Hallberg, and A. P. H. Wright
Accumulation of c-Myc and proteasomes at the nucleoli of cells containing elevated c-Myc protein levels
J. Cell Sci., May 1, 2003; 116(9): 1707 - 1717.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. Giandomenico, M. Simonsson, E. Gronroos, and J. Ericsson
Coactivator-Dependent Acetylation Stabilizes Members of the SREBP Family of Transcription Factors
Mol. Cell. Biol., April 1, 2003; 23(7): 2587 - 2599.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen
Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors
J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kino and G. P. Chrousos
Tumor Necrosis Factor alpha Receptor- and Fas-associated FLASH Inhibit Transcriptional Activity of the Glucocorticoid Receptor by Binding to and Interfering with Its Interaction with p160 Type Nuclear Receptor Coactivators
J. Biol. Chem., January 24, 2003; 278(5): 3023 - 3029.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
O. J. Rivera, C. S. Song, V. E. Centonze, J. D. Lechleiter, B. Chatterjee, and A. K. Roy
Role of the Promyelocytic Leukemia Body in the Dynamic Interaction between the Androgen Receptor and Steroid Receptor Coactivator-1 in Living Cells
Mol. Endocrinol., January 1, 2003; 17(1): 128 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. Borgius, K. R. Steffensen, J.-A. Gustafsson, and E. Treuter
Glucocorticoid Signaling Is Perturbed by the Atypical Orphan Receptor and Corepressor SHP
J. Biol. Chem., December 13, 2002; 277(51): 49761 - 49766.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Le Drean, N. Mincheneau, P. Le Goff, and D. Michel
Potentiation of Glucocorticoid Receptor Transcriptional Activity by Sumoylation
Endocrinology, September 1, 2002; 143(9): 3482 - 3489.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. J. Deroo, C. Rentsch, S. Sampath, J. Young, D. B. DeFranco, and T. K. Archer
Proteasomal Inhibition Enhances Glucocorticoid Receptor Transactivation and Alters Its Subnuclear Trafficking
Mol. Cell. Biol., June 15, 2002; 22(12): 4113 - 4123.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Vottero, T. Kino, H. Combe, P. Lecomte, and G. P. Chrousos
A Novel, C-Terminal Dominant Negative Mutation of the GR Causes Familial Glucocorticoid Resistance through Abnormal Interactions with p160 Steroid Receptor Coactivators
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2658 - 2667.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Kotaja, M. Vihinen, J. J. Palvimo, and O. A. Janne
Androgen Receptor-interacting Protein 3 and Other PIAS Proteins Cooperate with Glucocorticoid Receptor-interacting Protein 1 in Steroid Receptor-dependent Signaling
J. Biol. Chem., May 10, 2002; 277(20): 17781 - 17788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Miura, R. Ouchida, N. Yoshikawa, K. Okamoto, Y. Makino, T. Nakamura, C. Morimoto, I. Makino, and H. Tanaka
Functional Modulation of the Glucocorticoid Receptor and Suppression of NF-kappa B-dependent Transcription by Ursodeoxycholic Acid
J. Biol. Chem., December 7, 2001; 276(50): 47371 - 47378.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. L. Sunn, T.-A. Cock, L. A. Crofts, J. A. Eisman, and E. M. Gardiner
Novel N-Terminal Variant of Human VDR
Mol. Endocrinol., September 1, 2001; 15(9): 1599 - 1609.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baumann, C. T.
Right arrow Articles by Hager, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baumann, C. T.
Right arrow Articles by Hager, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals