help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bunn, C. F.
Right arrow Articles by Allison, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bunn, C. F.
Right arrow Articles by Allison, L. A.
Molecular Endocrinology 15 (4): 512-533
Copyright © 2001 by The Endocrine Society

Nucleocytoplasmic Shuttling of the Thyroid Hormone Receptor {alpha}

Caroline F. Bunn, Jessica A. Neidig, Kathryn E. Freidinger, Tracy A. Stankiewicz, Brian S. Weaver, Julie McGrew and Lizabeth A. Allison

Department of Biology (J.A.N., K.E.F., T.A.S., B.S.W., L.A.A.) College of William and Mary Williamsburg, Virginia, 23187
Department of Zoology (C.F.B., J. M., L.A.A.) University of Canterbury Christchurch, New Zealand 8001


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The thyroid hormone receptor {alpha} (TR{alpha}) exhibits a dual role as an activator or repressor of gene transcription in response to thyroid hormone (T3). Our studies show that TR{alpha}, formerly thought to reside solely in the nucleus tightly bound to DNA, actually shuttles rapidly between the nucleus and cytoplasm. The finding that TR{alpha} shuttles reveals an additional checkpoint in receptor control of gene expression. Using Xenopus oocyte microinjection assays, we show that there are two coexisting mechanisms for nuclear entry of TR{alpha}. First, nuclear import of TR{alpha} (molecular mass 46 kDa) was not sensitive to general inhibitors of signal-mediated transport, indicating that TR{alpha} can enter the oocyte nucleus by passive diffusion. Second, when TR{alpha} was tagged with glutathione-S-transferase, import of the fusion protein (molecular mass 73 kDa) was completely blocked by these inhibitors, demonstrating that an alternative, signal-mediated import pathway exists for TR{alpha}. Nuclear retention of TR{alpha} in oocytes is enhanced in the presence of T3, suggesting that more intranuclear binding sites are available for the ligand-bound receptor. Using mammalian cells, we show that shuttling of green fluorescent protein (GFP)-tagged and untagged TR{alpha} is inhibited in both chilled and energy-depleted cells, suggesting that there is an energy-requiring step in the nuclear retention/export process. Nuclear export of TR{alpha} is not blocked by leptomycin B, a specific inhibitor of the export receptor CRM1, indicating that TR{alpha} does not require the CRM1 pathway to exit the nucleus. Dominant negative mutants of TR with defects in DNA binding and transactivation accumulate in the cytoplasm at steady state, illustrating that even single amino acid changes in functional domains may alter the subcellular distribution of TR. In contrast to TR{alpha}, nuclear export of its oncogenic homolog v-ErbA is sensitive to leptomycin B, suggesting that the oncoprotein follows a CRM1-mediated export pathway. Acquisition of altered nuclear export capabilities may contribute to the oncogenic properties of v-ErbA.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid hormone (T3) controls homeostasis in adult mammals and several aspects of development, including amphibian metamorphosis, development of the mammalian brain and hearing, and regulation of erythroid cell growth and differentiation (1). Thyroid hormone action is mediated by the thyroid hormone receptor (TR), a member of the nuclear receptor superfamily. Three major TR isoforms, TR{alpha}1, TRß1, and TRß2, exhibit similar ligand-dependent regulation of gene activity, whereas a fourth isoform, TR{alpha}2, produced by differential splicing of the TR{alpha} primary transcript, lacks the ligand-binding and transactivation domains (1). In addition, v-erbA, a mutated viral derivative of the cellular locus encoding TR{alpha}1 (c-erbA{alpha}), has acquired oncogenic properties. The v-ErbA oncoprotein is unable to bind ligand and acts as a constitutive dominant repressor of transcription regulated by TR in mammalian and avian cells (2).

Most members of the nuclear receptor superfamily require ligand binding for functional activity. For example, the unliganded glucocorticoid receptor resides in the cytoplasm, while the liganded receptor undergoes rapid nuclear translocation and promotes gene activation (3), and, although unliganded receptors for progesterone, estrogen, and retinoic acid are primarily intranuclear, ligand binding is required for these receptors to interact with target genes (4, 5). TR is unusual in that it is bound to target genes both in the presence and absence of ligand (1). The dual role of TR as a repressor (or activator in some cases) of specific genes in the absence of ligand and an activator (or repressor) of these same genes in the presence of ligand implies constitutive nuclear localization. Most studies, although limited in their resolution, have provided evidence in favor of this restricted subcellular distribution for TR (1, 2, 6, 7, 8, 9, 10); however, when overexpressed, some TR{alpha}1 (11) and TRß1 (12) may localize to the cytoplasm.

The nucleus forms a discrete compartment in eukaryotic cells. This allows gene expression to be regulated by altering the nucleocytoplasmic distribution of transcription factors in response to external stimuli. To fully understand the cellular response to T3, investigation of all levels of receptor control is essential, including mechanisms for transport of TR across the nuclear envelope and its subsequent nuclear retention.

In recent years, there has been a tremendous increase in our mechanistic understanding of how macromolecules enter and exit the nucleus. After synthesis in the cytoplasm, nuclear proteins are imported into the nucleus exclusively through large proteinaceous structures of approximately 125 MDa in size called nuclear pore complexes (NPCs) (13, 14). The majority of nuclear proteins contain a short amino acid motif called a nuclear localization signal (NLS), which interacts with soluble receptor and NPC-associated proteins in a multistep, energy-dependent import process. There is a diversity of import receptors that recognize different classes of NLS (13).

In addition to serving as a gated entry point for large proteins, the NPC also provides a passive diffusion channel for ions and metabolites and, in principle, for proteins smaller than 60 kDa (13). However, in most cases, small proteins, like larger proteins, enter the nucleus by an energy-dependent and receptor-mediated process (13, 15). There are only a few known exceptions to this general rule (16, 17, 18, 19, 20, 21). It was originally thought that the process of translocation through the central channel of the NPC was the energy-requiring step in nuclear import. Recent data suggest, however, that translocation occurs in the absence of energy and that cytoplasmic hydrolysis of GTP by Ran during receptor recycling may be the only energy-consuming event in nuclear transport (13).

A number of proteins, including steroid hormone receptors, shuttle between the cytoplasm and nucleus (3, 4, 5, 22). Nuclear export, like nuclear import, occurs by multiple pathways (13). The balance between nuclear import and export of transcription factors provides an additional level of control in the regulation of gene expression (22). For example, an NLS that is necessary for nuclear import may not be sufficient for nuclear retention of a regulatory protein, unless activation of import signals is coupled to the suppression of export signals (22, 23). Nuclear retention of shuttling proteins, and small proteins that enter and exit the nucleus by passive diffusion, may also depend upon the availability of intranuclear binding sites (3, 18, 21, 24, 25, 26).

In the present study, we explored the molecular mechanisms regulating nuclear localization and retention of TR{alpha}1 (hereafter referred to as TR{alpha} for simplicity). To further investigate the complexity of the cellular response to T3, we used a complementary approach of Xenopus oocyte microinjection and transient transfection in conjunction with interspecies heterokaryons. Unexpectedly, we found that nuclear import of TR{alpha} in Xenopus oocytes can proceed by two different coexisting mechanisms, either through a passive diffusion pathway, or a signal-mediated process. Importantly, although TR{alpha} accumulates in the nucleus at steady state, the receptor shuttles rapidly between the cytoplasm and nucleus in both Xenopus oocytes and mammalian cells. We show that two dominant negative mutants of TR, with defects in DNA binding and transactivation, accumulate in the cytoplasm at steady state, illustrating that even single amino acid changes in functional domains may lead to a dramatic shift in the subcellular distribution of TR. The oncoprotein v-ErbA, which is found in both the cytoplasm and nucleus at steady state, is also a shuttling protein, but in contrast to TR{alpha} and other nuclear receptors, v-ErbA follows a CRM1-mediated export pathway.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Enhanced Nuclear Retention of Ligand-Bound TR{alpha} in Xenopus Oocytes
To explore the molecular mechanisms regulating nuclear localization and retention of TR{alpha}, we began by using Xenopus oocyte microinjection assays. Xenopus oocytes are well suited to addressing these questions for a number of reasons. First, oocyte microinjection assays have contributed significantly to advances in understanding of transcriptional regulation by TR (27, 28), Second, since it is possible to inject labeled proteins into the cytoplasm or nucleus of Xenopus oocytes and manually dissect both subcellular compartments, this assay offers the possibility of studying both nuclear import and export processes in quantitative terms. Finally, the low levels of endogenous TR present in oocytes are unlikely to compete with microinjected TR. TR mRNA and TR{alpha} protein are present at all stages of oogenesis, but the majority of maternal transcripts are not translated and are stored for use later in embryogenesis (27, 29).

It was anticipated, based on the literature regarding TR localization and function in avian and mammalian cells (1, 2, 6, 7, 8, 9, 10), that TR{alpha} would be entirely localized to the nucleus of Xenopus oocytes; however, we found that microinjected TR{alpha} localized in both the cytoplasm and nucleus. After microinjection into the oocyte cytoplasm, only approximately 40% of in vitro-translated 35S-labeled rat TR{alpha} was localized to the oocyte nucleus (Fig. 1Go, lane 2). A successful cytoplasmic injection was scored by the absence of a red nucleus (colored by hemoglobin present in the reticulocyte lysate) (see Materials and Methods). To ensure that nonsaturating concentrations of 35S-TR{alpha} were injected, the nucleocytoplasmic distribution of 50, 100, and 200 pg of 35S-TR{alpha} per oocyte was analyzed. No difference was observed in the nucleocytoplasmic distribution patterns within this range of concentrations (data not shown); thus 100 pg per oocyte were used in subsequent experiments. To determine the optimal time at which to perform nucleocytoplasmic transport assays, the kinetics of nuclear import for TR{alpha} were analyzed at intervals between 2 h and 12 h (data not shown). Steady state was reached at approximately 6 h post injection.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Nucleocytoplasmic Distribution of Rat and Xenopus TR{alpha} in Xenopus Oocytes

Approximately 100 pg of in vitro synthesized 35S-labeled rat TR{alpha} (rTR{alpha}, lanes 1 and 2) or Xenopus TR{alpha} (xTR{alpha}, lanes 3 and 4) were microinjected into the oocyte cytoplasm, and oocytes were incubated at 20 C for 6 h. After manual dissection of the oocytes, proteins were extracted from six pooled cytoplasmic (C) or nuclear (N) fractions and separated by electrophoresis on 12% discontinuous polyacrylamide gels containing SDS (SDS-PAGE), followed by fluorography.

 
One possible interpretation of the finding that TR{alpha} was not entirely localized to the nucleus is that fewer intranuclear binding sites are available for rat TR{alpha} in Xenopus oocytes. To rule out the possibility that our use of a heterologous assay was skewing the localization pattern, we also analyzed the nucleocytoplasmic distribution of cytoplasmically injected 35S-labeled Xenopus TR{alpha} (Fig. 1Go, lanes 3 and 4). The distribution was comparable for the two receptors, indicating that our results cannot simply be explained as a species-specific difference.

Since TR is not entirely localized to the nucleus in Xenopus oocytes, these large cells provide an excellent system for reconstituting regulatory networks affecting nuclear retention of TR{alpha}. We thus sought to determine whether the nucleocytoplasmic distribution pattern differs between liganded and unliganded receptor. No detectable levels of T3 are present in Xenopus oocytes (27). In the absence of T3, on average 39% of cytoplasmically injected 35S-TR{alpha} was localized to the oocyte nucleus (Table 1Go and Fig. 2AGo). In the presence of T3, the amount of 35S-TR{alpha} localized to the nucleus after cytoplasmic injection increased significantly to 51% (P < 0.001, Table 1Go; Fig. 2AGo, compare lanes 1–2 with 3–4). Ligand-enhanced nuclear retention was also observed for nuclear-injected 35S-TR{alpha}; in the absence of T3, only 62% of TR{alpha} was retained in the nucleus, compared with 85% retention in the presence of T3 (P < 0.001, Table 1Go; Fig. 2AGo, compare lanes 5–6 with 7–8). A successful nuclear injection was scored by the presence of a red nucleus (colored by hemoglobin present in the reticulocyte lysate) (see Materials and Methods). This significant increase in the amount of 35S-TR{alpha} localized to the nucleus in the presence of ligand suggested that a greater number of intranuclear binding sites is available for interaction with T3-bound receptor.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Nucleocytoplasmic Distribution of TR{alpha} in Xenopus Oocytes1

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Enhanced Nuclear Retention of Ligand-Bound TR{alpha} in Xenopus Oocytes

A, Nuclear retention of TR{alpha} is enhanced in the presence of T3. 35S-labeled TR{alpha} was microinjected into the oocyte cytoplasm (lanes 1–4) or nucleus (lanes 5–8), and oocytes were incubated at 18–20 C in O-R2 medium, or O-R2 supplemented with 100 nM T3 (as indicated), for 5–6 h before manual dissection of the oocytes. Subsequently, the nucleocytoplasmic distribution was analyzed by SDS-PAGE and fluorography as described in Fig. 1Go. B, Ligand has no effect on the nuclear import of ribosomal protein L5. Experiments were as described in panel A, except oocytes were cytoplasmically injected with 35S-labeled ribosomal protein L5 as a control. C, Cytoplasmic fractions; N, nuclear fractions.

 
To confirm that the change in TR{alpha} distribution was attributable to hormone binding, rather than a nonspecific effect, oocytes were cytoplasmically injected with 35S-labeled ribosomal protein L5, and nuclear localization was assayed in the presence or absence of T3. As expected, incubation in T3 did not result in an increase in the amount of 35S-labeled ribosomal protein L5 localized to the oocyte nucleus (Fig. 2BGo, compare lanes 1–2 with 3–4); in fact, a slight reduction in nuclear ribosomal protein L5 was observed (Table 2Go). As ribosomal protein L5 does not bind T3, this confirms that enhanced nuclear retention of TR{alpha} is a specific effect, attributable to ligand binding.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of Nucleocytoplasmic Distribution of Ribosomal Protein L5 (Control) in Xenopus Oocytes1

 
Nuclear Import of TR{alpha} Can Occur by Passive Diffusion in Xenopus Oocytes
TR (molecular mass 46 kDa) is, in principle, within the size limits for passive diffusion through the central channel of the NPC. To determine through which mechanisms nuclear import of TR{alpha} occurs, several criteria for distinguishing passive diffusion from signal-mediated import were assessed (13): 1) Is TR{alpha} import energy- and temperature-dependent or independent? 2) Is TR{alpha} import inhibited by wheat germ agglutinin (WGA), a lectin that binds to NPC proteins, thereby inhibiting signal-mediated nuclear import without affecting passive diffusion? 3) Is TR{alpha} import competed by excess NLS-bearing substrates? Competition would indicate that nuclear entry shares saturable components with a certain NLS receptor-mediated pathway.

First, we tested whether nuclear import of TR{alpha} in Xenopus oocytes is temperature-dependent. Surprisingly, import of in vitro-generated 35S-TR{alpha} was not inhibited in chilled oocytes (P > 0.1, Table 1Go; Fig. 3AGo, compare lanes 1–2 with 3–4), suggesting that TR can enter the oocyte nucleus by passive diffusion through the NPCs. A possible alternative explanation for these findings is that partitioning of TR to the nuclear fraction represents TR bound to the cytoplasmic face of the NPC, but unable to carry out the second, temperature-dependent step of signal-mediated translocation through the NPC into the interior of the nucleus (30). To ensure that 35S-TR{alpha} had, in fact, accumulated within the interior of the nucleus in chilled oocytes, isolated nuclei were washed extensively with 1% Triton X-100 to release any proteins associated with the outer nuclear membrane. Amounts of 35S-TR{alpha} extracted from nuclei of either chilled or warm oocytes dissected in the presence of detergent were comparable to those from nuclei dissected in the absence of detergent (data not shown). These observations suggest that, in both chilled and warm oocytes, the majority of 35S-TR{alpha} is located in the interior of the nucleus and that 35S-TR{alpha} does not accumulate at the cytoplasmic face of the NPCs.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Nuclear Import of TR{alpha} Can Occur by Passive Diffusion in Xenopus Oocytes

A, Nuclear import of TR{alpha} is temperature-independent. Oocytes were cytoplasmically microinjected with 35S-TR{alpha} (lanes 1–6) or with 35S-labeled ribosomal protein L5, as a control for signal-mediated import (lanes 7–12), and incubated for 6 h at 18–20 C or 0–4 C, or for 6 h at 0–4 C followed by 6 h at 18–20 C (0 C + 20 C), as indicated. Subsequently, the nucleocytoplasmic distribution was analyzed by SDS-PAGE and fluorography as described in Fig. 1Go. B, Nuclear import of TR{alpha} is energy-independent. After either no preinjection (-Apy) or preinjection with apyrase (intracellular concentration of 100 U/ml) (+Apy), oocytes were incubated for 30 min, followed by cytoplasmic microinjection with 35S-TR{alpha} (lanes 1–4) or 35S-L5 (lanes 5–8), and analysis for nuclear import. C, Nuclear import of TR{alpha} is Ran-independent. Oocytes were coinjected into the cytoplasm with either wild-type Ran (+Ran) or a GTPase-deficient mutant (+RanQ69L) (intracellular concentration of 0.3–1.0 µM), together with either 35S-TR{alpha} (lanes 1–4) or 35S-L5 (lanes 5–8), as indicated, and analyzed for nuclear import. D, Nuclear import of TR{alpha} is not sensitive to WGA. After either no preinjection (-WGA) or preinjection with WGA (intracellular concentration of 0.5 mg/ml) (+WGA), oocytes were incubated for 3 h before cytoplasmic injection with 35S-TR{alpha} (lanes 1–4) or 35S-L5 (lanes 5–8). Five to six hours post injection, oocytes were analyzed for nucleocytoplasmic distribution. E, Nuclear import of TR{alpha} is not competed by histone H1 or ribosomal protein L5. Lanes 1–6: Oocytes were injected into the cytoplasm with 100 pg 35S-TR{alpha} alone (none), or together with histone H1, to intracellular concentrations of 750 µM [low] or 900 µM [high], as indicated. Lanes 7–12: Oocytes were injected into the cytoplasm with 100 pg 35S-TR{alpha} alone (TR{alpha}) or together with 100 pg of 35S-labeled ribosomal protein L5 (L5 + TR{alpha}), or 100 pg of 35S-labeled ribosomal protein L5 alone (L5), as indicated. Lanes 13–22: For control competition experiments, oocytes were injected with 100 pg 35S-labeled ribosomal protein L5 alone or together with either histone H1 or 100 pg unlabeled ribosomal protein L5, as indicated. Five to 6 h post injection, oocytes were processed and analyzed for nucleocytoplasmic distribution. C, Cytoplasmic fractions; N, nuclear fractions. Concentration of 100 U/ml) (+Apy), oocytes were incubated for 30 min, followed by cytoplasmic microinjection with GST-TR{alpha} and analysis for nuclear import. E, Nuclear import of GST-tagged TR{alpha} is sensitive to WGA. After either no preinjection (-WGA), or preinjection with WGA (+WGA) or PBS as a control, 5 ng of GST-TR{alpha} were microinjected into the oocyte cytoplasm. After 3 h incubation, the nucleocytoplasmic distribution was analyzed by Western blot. F, Nuclear import of GST-TR{alpha} is competed by histone H1. Oocytes were injected into the cytoplasm with 5 ng GST-TR{alpha} alone (-H1) or together with excess competitor histone H1 (+H1). Three hours post injection, oocytes were processed and analyzed for nucleocytoplasmic distribution. G, Nuclear accumulation of GST-TR{alpha} is not enhanced in the presence of ligand. GST-TR{alpha} was microinjected into the oocyte cytoplasm and oocytes were incubated at 20 C in O-R2 medium (-T3), or O-R2 supplemented with 100 nM T3 (+T3), for 3 h before manual dissection of the oocytes and analysis of nucleocytoplasmic distribution by western blot.

 
As an additional control for the integrity of the transport machinery and efficacy of treatments, in each batch of oocytes parallel injections were carried out with 35S-labeled ribosomal protein L5 (molecular mass 34 kDa). Nuclear import of this small ribosomal protein was previously shown to occur by a signal-mediated process in Xenopus oocytes (31, 32). Before ribosome assembly, L5 forms a stable ribonucleoprotein complex with 5S rRNA, which shuttles between the nucleus and cytoplasm in Xenopus oocytes (31, 32). As expected, nuclear import of 35S-L5 was significantly inhibited by chilling (P < 0.001, Table 2Go; Fig. 3Go, compare lanes 8 and 10). Competence of L5 import was restored when oocytes were further incubated for 6 h at 18–20 C (compare lanes 8 and 12).

A passive diffusion mechanism of TR{alpha} import is further supported by our next finding that import is energy-independent. In oocytes treated with apyrase, which depletes cellular ATP (and GTP), import of TR{alpha} was not significantly inhibited (P > 0.1, Table 1Go; Fig. 3BGo, compare lanes 1–2 with 3–4). In contrast, import of the control protein, ribosomal protein L5, was significantly inhibited (P < 0.001, Table 2Go; Fig. 3BGo, compare lanes 6 and 8).

Treatment with apyrase does not distinguish between a requirement for ATP vs. GTP hydrolysis during nuclear import. In most cases studied so far, signal-mediated protein import is functionally linked to the Ran-GTPase cycle (13); however, there are exceptions. For example, nuclear import of the U1A and U2B'' spliceosome proteins requires ATP hydrolysis, but is Ran-independent (33). Similarly, nuclear import of I{kappa}B{alpha} (inhibitor of {kappa}B{alpha}) occurs by an ATP-dependent and Ran-independent pathway (34). Typically, to distinguish between ATP-dependent and GTP-dependent import pathways, nonhydrolyzable NTP analogs are tested for their ability to support import. However, these analogs are highly toxic to oocytes, resulting in irreversible changes in cell morphology and rapid mortality (35). Thus, to indirectly test whether TR{alpha} nuclear import is functionally linked to GTP hydrolysis, we assessed the effect of perturbation of the Ran-GTP-ase system. For this purpose we used both wild-type Ran and a mutated derivative in which the glutamine at position 69 has been substituted for leucine (RanQ69L) (36). Because this mutant is deficient for GTP hydrolysis activity, import processes that are either linked to, or dependent on, Ran-mediated GTP hydrolysis should be inhibited by the addition of RanQ69L. Both wild-type Ran and mutant Ran can be microinjected into Xenopus oocytes without subsequent loss of viability (37).

The import potential of TR{alpha} was determined after cytoplasmic injection of 35S-TR{alpha} together with wild-type Ran or RanQ69L. Neither excess wild-type Ran nor RanQ69L had a significant effect on 35S-TR{alpha} import (P > 0.1, Table 1Go; Fig. 3CGo, compare lanes 1–2 and 3–4), suggesting that TR{alpha} import does not require Ran-mediated GTP hydrolysis. In contrast, nuclear import of 35S-labeled ribosomal protein L5 was inhibited to a significant degree in the presence of RanQ69L (P < 0.01, Table 2Go; Fig. 3CGo, compare lanes 6 and 8). The findings for L5 are consistent with the observation that complex formation of this small ribosomal protein with import receptors is strongly inhibited in the presence of RanQ69L (32).

Next we assessed whether specific interaction with the NPC is required for nuclear import of TR{alpha}, by testing for sensitivity to WGA. WGA binds to N-acetylglucosamine-containing proteins present in the NPCs and inhibits signal-mediated import. Passive diffusion is not inhibited, since WGA does not physically occlude the nuclear pores (31). TR{alpha} import was not significantly inhibited in oocytes preinjected with WGA (P > 0.1, Table 1Go; Fig. 3DGo, compare lanes 2 and 4). As expected for a protein imported via a NPC-mediated pathway, ribosomal protein L5 import was significantly inhibited in oocytes preinjected with WGA (P < 0.001, Table 2Go; Fig. 3DGo, compare lanes 6 and 8). WGA inhibition reduced the percentage of nuclear L5 from 33% to 5%; a similar reduction to 4% was observed for energy depletion assays.

Signal-mediated transport pathways are saturable; thus, as an additional criterion for characterizing the import pathway of TR{alpha}, competition assays with histone H1 and ribosomal protein L5 were performed. The rationale for these competition experiments is that import kinetics of TR{alpha} would be at a reduced level if histone H1 (15) or L5 (31, 32), acting as direct competitors of signal-mediated processes, were imported by the same mechanisms as TR{alpha}. Such a reduction would be indicative of competition for shared transport factors. Members of the importin ß superfamily of transport receptors account for all interactions with the NPC required for passage into the nucleus. In some cases, importin ß-type receptors need an adapter molecule to interact with NLS-bearing cargo (13). For example, import of proteins that carry a classical NLS is mediated by an importin {alpha}/importin ß heterodimer, whereas histone H1 is imported by an importin 7/importin ß heterodimer (13, 15). Thus, even if a different adapter is used, competitor cargo may still compete for use of importin ß and docking sites at the NPC.

To ascertain histone H1 concentrations at which inhibition of signal-mediated transport occurred, 35S-labeled ribosomal protein L5 was competed against excess histone H1 at two intracellular concentrations. Both low and high concentrations of histone H1 were shown to inhibit the nuclear import of 35S-L5 (P < 0.001, Table 2Go; Fig. 3EGo, compare lanes 14, 16, and 18). In contrast, 35S-TR{alpha} import was not inhibited by coinjection with histone H1, at either low or high intracellular concentrations (P > 0.1, Table 1Go; Fig. 3EGo, compare lanes 2, 4, and 6).

Nuclear import of 35S-labeled ribosomal protein L5 was inhibited by equimolar amounts of unlabeled L5 (P < 0.001, Table 2Go; Fig. 3EGo, compare lanes 20 and 22). In contrast, coinjection with 35S-labeled ribosomal protein L5 did not lead to an alteration in the nucleocytoplasmic distribution of 35S-TR{alpha} (P > 0.1, Table 1Go; Fig. 3EGo, compare lanes 8 and 10). The lack of competition observed with TR{alpha} by ribosomal protein L5 suggests that independent mechanisms of transport are in operation for these two proteins. This is of particular interest since the NLS of ribosomal protein L5 is able to interact directly with multiple import receptors, including importin {alpha}, importin ß, transportin, importin 5 (RanBP5), and importin 7 (RanBP7) (32, 38).

In summary, we have shown that 35S-TR{alpha} import in Xenopus oocytes is temperature- and energy-independent and is not blocked by the dominant negative RanQ69L protein, WGA, or the presence of excess NLS-bearing substrates. This lack of sensitivity to general inhibitors of signal-mediated import is consistent with a passive diffusion mechanism for nuclear entry of TR{alpha}.

Nuclear Retention of TR{alpha} Is Temperature Dependent in Xenopus Oocytes
By definition, the steady state levels attained by passive diffusion would be expected to be equal in both directions through the NPC; however, we observed differences in the percentage of TR{alpha} in the nucleus after cytoplasmic vs. nuclear injection (Table 1Go and Fig. 2AGo), suggesting a more complex scenario. Thus, having shown that nuclear import of TR{alpha} can occur by simple diffusion in Xenopus oocytes, we next sought to ascertain whether nuclear export of TR{alpha} also can follow a passive diffusion pathway. To this end, export competence of nuclear-injected 35S-TR{alpha} was assessed in chilled oocytes. Nuclear retention of TR{alpha} was significantly increased by chilling: 86% of TR{alpha} was retained in the nucleus of chilled oocytes, compared with 62% in oocytes at physiological temperature (P < 0.001, Table 1Go; Fig. 4Go, compare lanes 3–4 with 5–6). Lastly, nuclear retention of the control protein, ribosomal protein L5, was also increased by low-temperature incubations (P < 0.001, Table 2Go; Fig. 4Go, compare lanes 9–10 with 11–12). In summary, these data suggest that there is a temperature-dependent step in the nuclear export/retention pathway of TR{alpha}.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Nuclear Retention of TR{alpha} Is Temperature-Dependent

Oocytes were microinjected into the nucleus with 35S-TR{alpha} (lanes 1–6) or 35S-labeled ribosomal protein L5 as a control for signal-mediated export (lanes 7–12) and incubated for 6 h at 18–20 C or 0–4 C, as indicated. Subsequently, the nucleocytoplasmic distribution was analyzed by SDS-PAGE and fluorography as described in Fig. 1Go. T0, initial time point performed after microinjection to show the absence of leakage from the nucleus during the injection process. C, Cytoplasmic fractions; N, nuclear fractions.

 
Alternative Pathways for Nuclear Import of TR{alpha} in Xenopus Oocytes
The preceding results suggest that simple diffusion is not sufficient to explain all aspects of TR{alpha} translocation through the NPC in Xenopus oocytes. Thus, we next asked the question whether alternative pathways for nuclear import of TR exist. We tested whether import of TR{alpha} tagged with glutathione-S-transferase (GST) is sensitive to transport inhibitors. GST-TR{alpha} interacts specifically with target DNA sequences in an electrophoretic gel mobility shift assay (data not shown), suggesting that the tag does not interfere with DNA binding. The GST-TR{alpha} fusion protein was used because this molecule should be too large (molecular mass 73 kDa) to enter the nucleus by passive diffusion. When a similar experiment was performed with GST-tagged catalytic subunit of cAMP-dependent protein kinase, the fusion protein was restricted to the cytoplasm while the wild-type subunit freely diffused through the NPC (16).

First, we showed by Western blot analysis that GST alone remains localized exclusively in the oocyte cytoplasm after cytoplasmic injection (Fig. 5AGo). When fused to TR{alpha}, however, the full-length fusion protein accumulated in the oocyte nucleus after cytoplasmic injection (Fig. 5BGo, lane 5). Four predominant bands were present in the injectate, including full-length GST-TR{alpha} (73 kDa) and three degradation products (Fig. 5BGo, lane 1). Interestingly, the largest degradation product present in the sample of injected GST-TR{alpha} did not localize to the nucleus (Fig. 5BGo, compare lanes 4 and 5). When Western blots were probed with an antibody specific for the extreme C terminus of TR{alpha}, this band was not recognized by the antibody, suggesting that the shorter fusion protein lacks the C-terminal sequence of TR{alpha} (data not shown). This degradation product served as a convenient internal control for the site of injection and for fractionation.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Alternative Signal-Mediated Import Pathway for TR{alpha} in Xenopus Oocytes

A, GST alone is not targeted to the oocyte nucleus. Oocytes were cytoplasmically microinjected with 5 ng GST. After 3 h incubation at either 20 C or 0–4 C as indicated, proteins were extracted from three pooled nuclear (N) and cytoplasmic (C) fractions and analyzed by Western blotting with anti-GST antibodies and chemiluminescent detection. Samples of uninjected oocytes (uninj) were processed as controls to reveal any nonspecific binding of the antiserum to endogenous oocyte proteins. B, Full-length GST-TR{alpha} accumulates in the oocyte nucleus. Oocytes were cytoplasmically microinjected with 5 ng GST-TR{alpha}. The injectate (I) was composed of full-length GST-TR{alpha} (73 kDa) and three smaller degradation products, the largest of which is restricted to the cytoplasm. After 3 h incubation at 20 C, proteins were extracted from three pooled nuclear and cytoplasmic fractions and analyzed by Western blotting with anti-GST-TR{alpha} antibodies and chemiluminescent detection. The location of protein molecular mass markers are shown. C, Nuclear import of GST-tagged TR{alpha} is temperature-dependent. Oocytes were cytoplasmically microinjected with 5 ng GST-TR{alpha}. After 3 h incubation at either 20 C or 0–4 C, or 3 h at 0–4 C followed by 3 h at 20 C (0 C + 20 C), proteins were extracted from nuclear and cytoplasmic fractions, and analyzed by Western blot. Only the distribution of full-length GST-TR{alpha} and the largest degradation product, which served as an internal control, are shown. D, Nuclear import of TR{alpha} is energy-independent. After either no preinjection (-Apy) or preinjection with apyrase (intracellular

 
Nuclear import of full-length GST-tagged TR{alpha} was inhibited in chilled oocytes (~75% inhibition, n = 4), with transport competence restored by subsequent incubation at 20 C (Fig. 5CGo, compare lanes 2, 4, and 6). Reversible inhibition suggests that chilling blocked GST-TR{alpha} import by inhibiting the activity of specific components of the transport machinery, rather than by preventing import by way of nonspecific cellular damage. Import was completely inhibited by treatment with apyrase to deplete cellular ATP (n = 3; Fig. 5DGo, compare lanes 4 and 6) and was inhibited to varying degrees by WGA (~65% inhibition, n = 4; Fig. 5EGo, compare lanes 2, 4, and 6) and competitor histone H1 (~35% inhibition, n = 6; Fig. 5FGo, compare lanes 2 and 4). Unlike the ligand-enhanced nuclear retention observed for 35S-TR{alpha}, nuclear accumulation of the GST-TR{alpha} fusion protein was not significantly enhanced in the presence of T3 (~10% increase, n = 3; Fig. 3GGo, compare lanes 2 and 4). It is not known, however, whether GST-TR{alpha} binds T3 with the same affinity as the native receptor.

Interestingly, nuclear import of GST-TR{alpha} was not inhibited in the presence of RanQ69L (data not shown). It is possible that in these assays, RanQ69L was not injected at high enough concentrations to out-compete endogenous Ran. Alternatively, GST-TR{alpha} may follow an ATP-dependent, Ran-independent nuclear import pathway; or, since GTP hydrolysis by Ran is not required for passage of cargo into the nucleus (39), GST-TR{alpha} may have undergone one round of import and then been trapped in the nucleus, yielding a distribution similar to the pattern achieved by nucleocytoplasmic shuttling of TR. Further experimentation under defined conditions (i.e. in vitro nuclear import assays using permeabilized mammalian cells) will be required to distinguish between these possibilities.

In summary, these findings show that TR{alpha} has the necessary sequence information for nuclear targeting of a fusion protein that is too large to enter the nucleus by passive diffusion. Import of the GST-TR{alpha} fusion protein was temperature and energy-dependent, and blocked by WGA and competitor NLS-bearing substrate. This sensitivity to general inhibitors of signal-mediated import is consistent with a signal-mediated mechanism for nuclear entry of GST-TR{alpha}. Taken together with the results described in the preceding sections, these data suggest that a signal-mediated import pathway, although not absolutely necessary, contributes to nuclear entry of normal TR{alpha} in Xenopus oocytes.

Nuclear Localization of Green Fluorescent Protein (GFP)-Tagged TR{alpha} in Mammalian Cells
Our finding that TR{alpha} can undergo nucleocytoplasmic shuttling in Xenopus oocytes was intriguing but could be interpreted as simply an unusual species- or cell-specific difference. To follow up on these observations, we investigated the nucleocytoplasmic distribution of GFP-tagged TR{alpha} in transfected mammalian cells.

GFP has been effectively used as a tag to investigate transport and localization of a variety of proteins, including the nuclear receptors for glucocorticoids (40), estrogen (41), androgen (42), and mineralocorticoids (43), and, while this study was underway, one of the other major isoforms of the thyroid hormone receptor, TRß1 (12). To ensure that the GFP tag did not significantly alter the functional characteristics of TR{alpha}, we evaluated the DNA binding, transactivation, and nucleocytoplasmic distribution characteristics of GFP-TR{alpha}.

First, we showed by electrophoretic gel mobility shift assay that GFP-TR{alpha} interacts specifically with target DNA sequences, demonstrating that the tags do not interfere with DNA binding (data not shown). Second, we examined the transcriptional activity of GFP-TR{alpha} in transfected COS-1 cells, using a CAT reporter system under control of a TRE (Fig. 6Go). The levels of CAT protein produced were lower for ligand-dependent reporter activation by GFP-TR{alpha} compared with untagged TR{alpha}; however, it is not possible to make a direct comparison between the two assays. Untagged TR{alpha} and GFP-TR{alpha} constructs are under control of different promoters (Rous sarcoma virus and cytomegalovirus, respectively); thus a difference in the levels of CAT protein may simply reflect lower levels of expression of GFP-TR{alpha} compared with untagged TR{alpha}. Importantly, what we did demonstrate is that GFP-TR{alpha}, like native (untagged) TR{alpha}, stimulates transcription from a TRE-CAT reporter construct in the presence of T3 (Fig. 6Go).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 6. GFP-Tagged TR{alpha} Transactivates Reporter Gene Expression

COS-1 cells were cotransfected with 5 µg tk-TREp-CAT reporter plasmid plus 5 µg pGFP::TR3 (GFP-TR) or RS-rTR{alpha} (rTR) expression plasmids in the presence of 100 nM T3 (black bar) or in the absence of T3 (white bar). Reporter gene expression is quantified in ng/ml protein, based on measurements of CAT protein levels by ELISA. The basal level of reporter gene expression in COS-1 cells transfected with 5 µg tk-TREp-CAT reporter plasmid plus 5 µg empty vector (pUC18) was T3-independent (data not shown). Error bars indicate the SEMs.

 
Finally, we tested the ability of the fusion protein to be targeted to the nucleus, using transient transfection assays in NIH/3T3 (mouse) cells. We examined the nucleocytoplasmic distribution of GFP-TR{alpha} in both living cells and fixed specimens. In contrast to the distribution of TR{alpha} in Xenopus oocytes, GFP-TR{alpha} appears to localize entirely to the nucleus in mouse cells (Fig. 7Go, A and B). GFP-TR{alpha} is distributed diffusely throughout the nucleus in both live (Fig. 7AGo) and fixed (Fig. 7BGo) preparations. No alteration in the nucleocytoplasmic distribution of GFP-TR{alpha} in living cells was observed in response to treatment with ligand; complete localization to the nucleus was maintained in the presence or absence of T3 concentrations ranging from 10-9 M to 10-3 M (Fig. 7AGo and Table 3Go). As expected, when not fused to TR{alpha}, GFP was distributed throughout the cell (Fig. 7CGo). The nuclear localization characteristics of GFP-TR{alpha} are thus comparable to those described in the literature for native TR{alpha} (6, 7, 8, 9, 10). Taken together with our finding that GFP-TR{alpha} is transcriptionally competent and hormone responsive, we can therefore conclude that GFP-TR{alpha} is a valid probe to study the subcellular trafficking of TR{alpha}.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 7. Nuclear Localization of GFP-Tagged TR{alpha} in Mammalian Cells

A, Subcellular distribution in live NIH/3T3 cells transfected with pGFP::TR (GFP-TR{alpha}). For hormone treatment, cells were incubated in DMEM containing 10% charcoal-stripped FBS, supplemented with 10-9 M T3 (+T3). At 24–48 h post transfection, cells were incubated in culture medium containing 50 µg/ml cycloheximide to prevent de novo protein synthesis, at 37 C (warm), on ice (chilled) for 3 h, or in the presence of 6 mM 2-deoxyglucose and 50 µM oligomycin (energy-depleted) for 4 h. Living cells were rinsed with D-PBS and visualized by epifluorescence microscopy or a combination of epifluorescence and bright-field (phase) to visualize the whole cell. B, Subcellular distribution of GFP-TR{alpha} in fixed cells. NIH/3T3 cells were transfected with pGFP::TR (GFP-TR{alpha}) and incubated under the following conditions, 24 h post transfection: warm, chilled for 4 h, or energy-depleted for 4 h. Cells were then fixed, stained with the DNA stain DAPI to reveal the nucleus, and visualized by epifluorescence microscopy. C, Subcellular distribution of GFP in fixed cells. NIH/3T3 cells were transfected with pEGFP (GFP) and analyzed as described in panel B. Bar, 20 µm.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Summary of Nucleocytoplasmic Distribution of GFP-TR{alpha} in Living NIH/3T3 (Mouse) Cells1

 
Given that by conventional single-cell analysis GFP-TR{alpha} appears to be exclusively nuclear in NIH/3T3 cells, it is possible to examine nuclear export characteristics, but not nuclear import by this type of assay. To determine whether nuclear retention of GFP-TR{alpha} was temperature- and energy-dependent, cells were incubated under chilled and energy-depleted conditions for 3–4 h, in the presence of cycloheximide to prevent de novo protein synthesis. Under these conditions, in the majority of cells GFP-TR{alpha} remained entirely localized to the nucleus (Fig. 7Go, A and B, and Table 3Go). These data are consistent with our findings in Xenopus oocytes and indicate that some aspect of nuclear retention occurs by an active process.

GFP-Tagged TR{alpha} and Native TR{alpha} Undergo Nucleocytoplasmic Shuttling in Mammalian Cells
Although it is well established that nuclear receptors for steroid hormones undergo nucleocytoplasmic shuttling (3, 4, 5, 40, 42), it is not known whether all nuclear receptors for nonsteroid hormones share this property. The dual role of TR as a repressor of specific genes in the absence of ligand and an activator of these same genes in the presence of ligand had led to the view that TR is exclusively in the nucleus and is a stable constituent of chromatin (2). Having validated the use of GFP-tagged TR{alpha} as a probe and having completed analysis of receptor localization in single cells, we returned to our primary question: can TR{alpha} shuttle in mammalian cells? To this end, we used a very powerful and elegant method—a transient transfection interspecies heterokaryon assay (44). The strength of this method lies in its sensitivity; it is possible to detect rapid nucleocytoplasmic shuttling of proteins that by other methods would appear to be retained in the nucleus at all times (Fig. 8AGo).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 8. TR{alpha} Shuttles Rapidly between the Nucleus and Cytoplasm in Mammalian Cells

A, Schematic diagram of a transient transfection interspecies heterokaryon assay. B, Shuttling of GFP-tagged and untagged TR{alpha}. NIH/3T3 (mouse) cells were transfected with GFP-TR{alpha} or untagged TR{alpha} expression vectors. Subsequently, HeLa (human) cells were seeded onto the same coverslip in medium containing cycloheximide to prevent de novo protein synthesis. Cells were fused in the presence of 50% polyethylene glycol to form heterokaryons in which human and mouse nuclei share a common cytoplasm. Fused cells were incubated for 1 h at 37 C in culture medium containing cycloheximide. Human nuclei (diffuse staining, indicated by white arrows) are distinguished from mouse nuclei (speckled) by differential coloration with Hoechst 33258 DNA stain, and to some extent by their size. GFP-TR{alpha} shuttling was visualized by direct epifluorescence microscopy (lower panel). Untagged TR localization was analyzed by indirect immunofluorescence microscopy (upper panel). Middle panel, Field of view showing both untransfected and transfected mouse cells, human cells, and a heterokaryon; endogenous TR{alpha} is not detectable in untransfected mouse cells or in human cells. Cells were stained for actin with rhodamine-phalloidin to visualize the borders of heterokaryons. Approximately 20 heterokaryons were analyzed per experiment, with 13 replicate experiments for GFP-TR{alpha} and 8 replicate experiments for untagged TR{alpha}. Bar, 20 µm.

 
We fused transfected mouse cells with untransfected human cells to form heterokaryons that contain multiple nuclei from both species in a common cytoplasm. Before fusion, the cells were treated with cycloheximide, so that no further protein synthesis takes place in the heterokaryons. To distinguish the mouse and human nuclei, the cells were stained with the dye Hoechst 33258, which gives a characteristic staining of intranuclear bodies ("speckles") in the mouse nuclei. After incubation at 37 C for as little as 1 h, GFP-TR{alpha} (Fig. 8BGo, lower panel) and native TR{alpha} (Fig. 8BGo, upper panel) both rapidly accumulated in the human nuclei in heterokaryons, demonstrating export of TR from the mouse nucleus and reimport into the human nucleus. In mouse and human nuclei, both GFP-TR{alpha} and untagged TR{alpha} appeared to distribute diffusely throughout the nucleus. In nuclei with less intense fluorescence, the receptor appeared to be excluded from nucleoli. Only exogenous TR{alpha} expressed in successfully transfected mouse cells was stained with the anti-TR{alpha} antibody; neither cell line contains detectable levels of endogenous TR{alpha} (Fig. 8BGo, middle panel).

GFP-TR{alpha} (molecular mass 76 kDa) is above the size limits for passive diffusion. Thus, the possibility exists that, in the single-cell analysis described in the previous section, GFP-TR{alpha} was retained in the nucleus, while the smaller untagged receptor would have been capable of nuclear export by simple diffusion. To investigate the overall mechanism for nucleocytoplasmic shuttling, we performed heterokaryon assays under conditions that would permit passive diffusion but inhibit active transport processes. In both chilled and energy-depleted cells, neither GFP-TR{alpha} nor untagged TR{alpha} accumulated in the human nuclei in heterokaryons (Fig. 9Go). Chilled and energy-depleted heterokaryons appeared smaller, slightly rounded up, and the actin filaments were less distinct (Fig. 9Go). Since an extended period of chilling or energy depletion (>90 min) had detrimental effects on heterokaryon viability (data not shown), we limited our analyses to periods of 60–90 min. Conceivably, this time frame may be insufficient to reveal relatively slow nuclear export. However, we feel this is unlikely since shuttling occurs rapidly under physiological conditions (within 1 h). Furthermore, in single-cell analyses in which prolonged treatment was possible, after 4 h of energy depletion or chilling no cytoplasmic accumulation of TR{alpha} was observed (Fig. 7Go). Inhibition of TR{alpha} shuttling suggests that release from intranuclear binding sites is temperature- and energy-dependent and/or export occurs by a signal-mediated process. These findings are consistent with our results in Xenopus oocytes, where nuclear retention of microinjected TR{alpha} also was shown to be temperature-dependent.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 9. Shuttling of GFP-Tagged and Untagged TR{alpha} Is Temperature and Energy-Dependent

Heterokaryons were prepared and visualized as described in Fig. 8Go. Fused cells were incubated in cycloheximide-containing medium on ice (chilled), or in the presence of 2-deoxyglucose and oligomycin (energy-depleted) for 1 h. For hormone treatment, cells were incubated in DMEM containing 10% charcoal-stripped FBS alone (-T3) or supplemented with 100 nM T3 (+T3). Approximately 20 heterokaryons were analyzed per experiment, for the following numbers of replicate experiments (n): GFP-TR{alpha}, chilled, n = 9 replicates; energy-depleted, n = 6; -T3, n = 4; +T3, n = 4. Untagged TR, chilled, n = 6; energy-depleted, n = 3; -T3, n = 3; +T3, n = 2. White arrows, HeLa (human) nuclei in heterokaryons. Bar, 20 µm.

 
Since more nuclear retention sites appear to become available to ligand-bound TR{alpha} in Xenopus oocytes as shown in the present study, and in CV1 cells overexpressing GFP-TRß1 (12), it was of interest to determine whether the presence or absence of ligand would influence the direction and extent of nucleocytoplasmic shuttling of TR{alpha} in heterokaryons. We showed, however, that there was no apparent difference in the rapidity or extent of nuclear export from mouse nuclei and import into human nuclei in heterokaryons: shuttling of GFP-TR{alpha} and untagged TR{alpha} occurred in the presence and absence of T3 (Fig. 9Go).

In summary, our data from mammalian cell studies show that TR{alpha} accumulates in the nucleus at steady state but, surprisingly, the receptor shuttles rapidly between the nucleus and cytoplasm. Shuttling of TR{alpha} is energy- and temperature-dependent, but apparently not ligand-dependent. These findings reveal an additional checkpoint in control of gene expression by TR{alpha} and pave the way for future studies on the role of nucleocytoplasmic shuttling in gene regulation.

Nuclear Export of TR{alpha} Is Not Mediated by the Export Receptor CRM1
To begin to elucidate the mechanism for TR{alpha} shuttling, we sought to ascertain whether TR nuclear export is facilitated by the export receptor CRM1 (13). For this purpose, we prepared heterokaryons by fusing mouse cells transfected with GFP-TR{alpha} with untransfected human cells. Subsequently, heterokaryons were treated with the CRM1-specific inhibitor, leptomycin B (3, 45, 46). In both the presence and absence of leptomycin B, GFP-TR{alpha} rapidly accumulated in the human nuclei in heterokaryons (Fig. 10Go, upper left panels), suggesting that TR{alpha} does not require the CRM1 pathway to exit the nucleus.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 10. Nucleocytoplasmic Distribution of GFP-Tagged TR{alpha} and Variants in Control and Leptomycin B-Treated Cells

Upper panels, For the preparation of heterokaryons, NIH/3T3 cells were transfected with GFP-TR{alpha} or p53-GFP (control) expression vectors, as indicated. Fused cells were incubated at 37 C in culture medium containing cycloheximide to prevent de novo protein synthesis, and in the absence (-LMB) or presence of 50 ng/ml leptomycin B (+LMB). Comparable results were obtained with 10 ng/ml LMB (data not shown). Human nuclei (diffuse staining, white arrows) are distinguished from mouse nuclei (speckled) by differential coloration with Hoechst 33258 DNA stain. To visualize heterokaryons, cells were stained for actin with rhodamine-phalloidin (Molecular Probes, Inc.). GFP-tagged TR{alpha} and p53 shuttling were viewed by epifluorescence microscopy. Approximately 20 heterokaryons were analyzed per experiment for several replicate experiments. Lower panels, For single-cell analysis, NIH/3T3 cells were transfected with expression vectors for GFP fusion proteins of the transactivation mutant G121A, the DNA-binding mutant C122A, or the oncoprotein v-ErbA, as indicated. Twenty hours post transfection, cells were treated with leptomycin B as described above. To visualize nuclei, cells were stained for DNA with DAPI. The nucleocytoplasmic distribution of GFP-tagged TR variants was visualized by epifluorescence microscopy. Approximately 100 transfected cells were analyzed per experiment for several replicate experiments. Examples of either one or two representative cells are shown. White arrows, HeLa (human) nuclei in heterokaryons. Bar, 20 µm.

 
To ensure that the leptomycin B used in our assays was chemically active, we also tested the effect of leptomycin B on the shuttling ability of p53-GFP, a transcription factor that follows a CRM1-mediated export pathway (47). As anticipated, nuclear export of p53-GFP was sensitive to leptomycin B. In the presence of the drug, p53-GFP remained localized to the mouse nuclei, whereas in the absence of leptomycin B, p53-GFP accumulated in the human nuclei in heterokaryons (Fig. 10Go, upper right panels).

Dominant Negative Mutants of TR Have Altered Subcellular Distribution Patterns
To further investigate the shuttling and nuclear retention properties of TR, we assessed the relative importance of DNA-binding and transactivation domains on the nucleocytoplasmic distribution pattern of TR. For this purpose, we employed three dominant negative mutants of TR: C122A, G121A, and v-ErbA. C122A is a synthetic DNA-binding deficient mutant of TRß. In this mutant, alanine was substituted for the coordinating cysteine at residue 122 in the recognition {alpha}-helix of the first zinc finger in the DNA-binding domain (27, 48). In G121A, another synthetic mutant derived from TRß, alanine was substituted for glycine at residue 121 of the first zinc finger. The G121A mutant is able to bind DNA but is defective in transcriptional activation activity (48). Due to an N-terminal fusion with retroviral gag sequences, v-ErbA, the viral oncogenic homolog of TR{alpha}, lacks the first 12 amino acids of TR{alpha}. In addition, the viral protein lacks nine amino acids close to the C terminus and has 13 amino acid changes: 2 in the DNA-binding domain and the other 11 distributed along the molecule in the hinge region (domain D) and ligand-binding domain (2, 49). The oncoprotein is unable to bind ligand and acts as a constitutive repressor of transcription regulated by TR.

In transient transfection assays in NIH/3T3 cells, both untagged and GFP-tagged DNA-binding mutant C122A and transactivation mutant G121A show either diffuse whole cell staining at steady state, or exclusion from the nucleus with punctate cytoplasmic foci or discrete aggregates particularly around the nuclear periphery (Fig. 10Go, lower left panels, and data not shown). Interestingly, these distribution patterns are very similar to the patterns described for a TR{alpha} mutant in which the entire D domain was deleted (8). The subcellular distribution of the virally derived oncogenic homolog of TR{alpha} was similar to the distribution pattern of the synthetic mutants tested. GFP-tagged and untagged v-ErbA localized both in the nucleus and the cytoplasm, showing either diffuse whole cell staining or a distinct punctate nucleocytoplasmic distribution at steady state (Fig. 10Go, lower right panels, and data not shown). These observations for GFP-v-ErbA are in agreement with previous studies of the distribution of native v-ErbA in transfected cells, in which the oncoprotein also was detected in both the nucleus and cytoplasm (9, 50). Similarly, in Xenopus oocytes, 35S-labeled C122A and v-ErbA both showed a nucleocytoplasmic distribution; approximately 40% of C122A and 20% of v-ErbA accumulated in the nucleus after cytoplasmic microinjection (data not shown).

In summary, the data presented here show that even single amino acid changes in functional domains of TR may lead to a dramatic shift in the balance between nuclear retention and cytoplasmic accumulation. These findings highlight the importance of DNA-binding and transcriptional activation activity in nuclear localization of TR.

Nuclear Export of the Oncoprotein v-ErbA is CRM1-Dependent
To follow up on our observation that nuclear export of TR{alpha} is leptomycin B-insensitive, we tested the effect of the drug on the subcellular distribution of the TR mutants described in the preceding section, using single-cell analysis. There was no change in the nucleocytoplasmic distribution of TRß mutants G121A and C122A after treatment with leptomycin B (Fig. 10Go, lower left panels), suggesting that the transactivation mutant and the DNA-binding mutant do not require the CRM1 pathway to exit the nucleus.

In contrast, nuclear export of both untagged and GFP-tagged v-ErbA was sensitive to leptomycin B (Fig. 10Go, lower right panels, and data not shown). In control cells, the oncoprotein v-ErbA is distributed in both the nuclear and cytoplasmic compartments; however, in cells treated with leptomycin B there was a dramatic shift in the distribution pattern. Upon treatment with the CRM1-specific inhibitor, v-ErbA was entirely localized to the nucleus in 100% of transfected cells (Fig. 10Go, lower right panels), suggesting that the oncoprotein was imported into the nucleus and subsequently trapped in the nuclear interior by the block to the export pathway. These striking findings demonstrate that not only is v-ErbA a shuttling protein but, in contrast to TR{alpha} and other nuclear receptors, v-ErbA follows a CRM1-mediated export pathway.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have used Xenopus oocyte microinjection and transient transfection in conjunction with interspecies heterokaryons to investigate aspects of the subcellular trafficking of TR{alpha}. Our data provide new insights into the molecular mechanisms regulating nuclear localization and retention of TR{alpha}. We find that nuclear import of TR{alpha} proceeds by one of two coexisting mechanisms in Xenopus oocytes, a passive diffusion pathway or signal-mediated translocation through the NPC. We have also determined that, although TR{alpha} accumulates in the nucleus at steady state, the receptor can shuttle rapidly between the cytoplasm and nucleus in both Xenopus oocytes and mammalian cells. Although there is an energy-requiring step in the nuclear retention/export pathway, nuclear export of TR{alpha} is not mediated by the export receptor CRM1. Dominant negative variants of TR do not accumulate in the nucleus at steady state, highlighting the importance of intact DNA-binding, hormone-binding, and transactivation domains for nuclear retention. The oncoprotein v-ErbA has acquired the ability to follow a CRM1-mediated pathway, suggesting that acquisition of altered nuclear export capabilities has contributed to the oncogenic conversion of TR{alpha}.

Alternative Pathways for Nuclear Import
We showed, by the following three lines of evidence, that nuclear import of 35S-labeled TR{alpha} in Xenopus oocytes can occur by simple passive diffusion: 1) import was energy and temperature-independent; 2) import was not inhibited by WGA; 3) import was not competed by excess NLS-bearing substrates, indicating that TR nuclear entry does not share saturable components with certain NLS receptor-mediated pathways. Some exceptions to the typical signal-mediated pathway for nuclear entry have been reported. For example, calmodulin (CaM) appears to be imported by simple diffusion, with CaM-binding proteins in the nucleus acting as a sink for nuclear retention of CaM upon an increase in intracellular free Ca2+ (21); nuclear accumulation of the U1 snRNP-specific protein C is due to diffusion and retention in the nucleus upon incorporation of the protein into the U1 snRNP (18); and, import characteristics of the free catalytic subunit of cAMP-dependent protein kinase are consistent with simple diffusion (16).

With our subsequent observation that nuclear retention of untagged TR{alpha} in both Xenopus oocytes and transfected mammalian cells was temperature-dependent, it became apparent that simple diffusion was not sufficient to explain all aspects of TR{alpha} translocation through the NPC. This finding suggested that a signal-mediated pathway is followed for transport out of the nucleus and/or that release from intranuclear binding sites is an active process. Different energy requirements for bidirectional transport across the nuclear envelope have been reported for steroid hormone receptors. For this case, import is temperature- and energy-dependent, while export is not inhibited by energy depletion or chilling (46, 51). Before export, however, the glucocorticoid receptor must be released from association with the nuclear matrix, and this step in the nuclear export pathway is energy-dependent (51).

Finally, we showed that nuclear import of a GST-TR{alpha} fusion protein in Xenopus oocytes is sensitive to transport inhibitors, suggesting that an alternative signal-mediated import pathway can be followed by TR{alpha}. There is precedence for such alternative import pathways. A recent report shows that there are two coexisting mechanisms for nuclear entry of mitogen-activated protein kinase (MAPK) (45 kDa): one is passive diffusion and the other is active transport, the latter being dependent upon the formation of a MAPK dimer (20). It is possible that the signal-mediated import mechanism is required for rapid nuclear translocation (20). TR{alpha} is known to carry out its function primarily as a heterodimer, in association with the retinoid X receptor {alpha} (RXR{alpha}) both in vitro and in vivo (1, 2). It is possible that, similar to MAPK, RXR{alpha}/TR{alpha} heterodimers or TR{alpha}/TR{alpha} homodimers are formed predominantly in the cytoplasm and, since they are too large for passive diffusion, are imported by a regulated, signal-mediated pathway. In this model, since the two pathways coexist, TR{alpha} monomers could utilize either an active or passive mode of nuclear entry. The inter-oocyte variability in response to general inhibitors of signal-mediated transport (see Table 1Go) may reflect partial inhibition of TR{alpha} nuclear accumulation due to the general inhibitors blocking access to the signal-mediated pathway.

In addition to heterodimerization with RXR{alpha}, TR{alpha} also interacts with histone deacetylases and corepressors such as N-CoR (nuclear receptor corepressor) and SMRT (silencing mediator for retinoid and thyroid hormone receptors) in the absence of T3, and coactivators such as members of the p160 family and p300/CBP in the presence of T3 (1, 28). It will be of interest to determine whether binding of TR to transcriptional corepressors and coactivators, and subsequent interaction of TR with the chromatin infrastructure, are important determinants for the mode of nuclear import, and the nuclear retention and shuttling characteristics of TR.

It remains to be determined whether alternative import pathways are available in mammalian cells. Given that GFP-TR{alpha} enters mammalian cell nuclei, we can conclude that a signal-mediated pathway is followed, since the fusion protein is above the size limits for diffusion. However, fusion protein import could occur by facilitated diffusion, which requires interactions with the NPC, but is energy-independent (13). Since both untagged and GFP-tagged TR{alpha} rapidly accumulate in the nucleus at steady state and export is temperature- and energy-dependent, there was no detectable cytoplasmic population of TR{alpha} before, during, or after chilling or energy-depletion experiments. Therefore, it was not possible to determine the general mechanism of nuclear import using single-cell or heterokaryon transient transfection assays. Studies using alternative approaches to investigate the nuclear import pathway followed by TR{alpha} in mammalian cells are underway. In summary, data presented here suggest that a signal-mediated import pathway, although not absolutely necessary, contributes to nuclear entry of normal TR{alpha}.

Nuclear Localization and Nuclear Retention Sequences in TR
A temperature- and energy-dependent import pathway for TR implies a receptor-mediated process, which would be expected to require a specific NLS. Other research groups have attempted to define a NLS for TR, but direct proof of nuclear localization domains has been difficult to unambiguously establish since other functional activities, such as DNA and ligand-binding and protein-protein interactions can also be impaired by structural modifications (the present study and Refs. 8, 11, 50, 52, 53, 54).

The length and primary structure of domain D (hinge region) between the DNA-binding domain (domain C) and ligand-binding domain (domain E) are conserved in all TR isoforms, suggesting that the integrity of this domain is important for receptor function. A highly basic amino acid sequence in domain D can inefficiently target a proportion of a 250-kDa cytoplasmic protein (pyruvate kinase) to the nucleus, but is not sufficient for complete nuclear localization and retention (52). Further evidence of the importance of the D domain in nuclear targeting comes from mutational analysis (8, 12, 50). For example, when sequences in this region were mutated in TR{alpha} (8) or in a GFP-TRß fusion protein (12), the mutant receptors were detected in both the nucleus and cytoplasm. However, some of the D domain mutants tested, in addition to being defective in nuclear import, also showed very weak DNA-binding activity and had lost ligand-binding activity, despite the DNA and ligand-binding domains being unaltered (8, 50). Recently, a sequence in the D domain (hinge region) C-terminal of the basic region was shown to be critical for interaction with the corepressor N-CoR (53). Although the D domain sequence motif is apparently necessary for nuclear localization, it is not sufficient for exclusive nuclear localization and nuclear retention and is only one of the factors involved in determining the final subcellular distribution of TR.

Data presented here further indicate the importance of the first zinc finger in the DNA-binding domain for nuclear retention of TR. Studies of the DNA-binding mutant C122A and the mutant G121A, which binds DNA but is defective in transcriptional activation activity, emphasize that even single amino acid changes in functional domains of TR may lead to a striking shift in the balance between nuclear retention and cytoplasmic accumulation. Our findings highlight the complexity of the nuclear retention signals present in TR: the ability to bind DNA is not sufficient for nuclear retention of TR, but a DNA-binding mutant is not entirely excluded from the nucleus. A degradation product of GST-TR{alpha} that is apparently lacking the extreme C-terminal region of TR was excluded from the oocyte nucleus in microinjection assays, suggesting that the C-terminal domain of TR, which plays a role in transcriptional silencing (55), may also be required for nuclear accumulation. Adding to the complexity, an N-terminal domain of TR{alpha}, absent in the oncoprotein v-ErbA, has also been implicated in directing exclusive nuclear localization, as shown in the present study and in a previous report (9).

TR belongs to a receptor superfamily of ancient origins, which includes receptors for steroid hormones, retinoids, and vitamin D (1, 56). Members of the superfamily have a modular organization, making it interesting to speculate that a NLS module evolved in large nuclear receptors and is a dispensable evolutionary remnant in the relatively small TR. More important than the NLS module may be functional domains of TR that promote nuclear retention, including sequences within the N terminus, the DNA-binding domain, the hinge region (D domain), the ligand-binding domain, and the extreme C terminus.

Ligand-Enhanced Nuclear Localization
Two lines of evidence suggest that TR function may, in part, be regulated by T3-induced nuclear import. First, the present results show that in Xenopus oocytes nuclear localization and retention of 35S-labeled TR{alpha} are enhanced in the presence of ligand. Second, a recent study of TRß1, one of the other major isoforms of TR, showed that a GFP-TRß1 fusion protein was predominantly localized to the nucleus in transfected mammalian cells in the presence of T3, but in the absence of T3 some receptor localized to the cytoplasm (12). In the latter study, hormone-induced nuclear import in living cells was visualized using laser scanning confocal microscopy. Taken together, these findings provide support for a model in which the direction of shuttling is ligand-dependent. Hormone binding may allow receptor molecules to associate with additional intranuclear binding sites. The increased affinity for these sites may be due to the alteration in receptor conformation induced by ligand binding (1).

In our studies in mammalian cells, the absence of ligand did not affect the localization of untagged or GFP-tagged TR{alpha}, and had no apparent effect on the direction or extent of nucleocytoplasmic shuttling of TR{alpha} in heterokaryons. It is not entirely apparent why our data for GFP-tagged rat TR{alpha} differ from the report of Zhu et al. (12) for GFP-tagged human placenta TRß1. In addition to utilizing a different TR isoform, their study differs from ours in numerous methodological details, including the cell type used (CV1, African green monkey kidney fibroblasts) and the use of confocal microscopy. Time-lapse confocal microscopy of living cells and higher resolution studies may reveal ligand-dependent effects on shuttling and subnuclear trafficking that are not apparent by conventional microscopy. For example, GFP-tagged estrogen receptor shows a change from a reticular pattern evenly distributed throughout the nucleus to a punctate and highly structured distribution in the nucleus in the presence of ligand (41), and ligand-bound glucocorticoid and mineralocorticoid receptors are localized in discrete subnuclear compartments (5, 57). A recent report has shown that in the absence of hormone, untagged TRß1 is located exclusively in the nucleus of CV1 cells in a homogenous staining pattern, while in the presence of hormone a significant proportion of TR appears to be reorganized into a nuclear dot pattern (10).

TR{alpha} Is a Shuttling Protein
Our studies reveal that TR{alpha}, formerly thought to reside solely in the nucleus tightly bound to chromatin, actually undergoes rapid nucleocytoplasmic shuttling. A number of cellular and viral proteins are known to shuttle continuously between the nucleus and the cytoplasm. These include, but are not limited to, certain hnRNP and other mRNA-binding proteins (13), SR proteins required for mRNA splicing (58), nucleolar proteins (59), steroid hormone receptors, such as the progesterone receptor (46), and the glucocorticoid receptor (3), the HIV-1 Rev protein (60), the p53 tumor suppressor (47), the hdm2 oncoprotein (61), the U1 snRNP-specific polypeptide U1A (24), and the Engrailed homeoprotein (62).

The short residence time of TR{alpha} in the cytoplasm makes it difficult to identify it as a shuttling protein by conventional single-cell analysis, but in interspecies heterokaryon assays, the human nuclei act as a trap for any TR{alpha} that appears, however transiently, in the shared cytoplasm after export from mouse nuclei. In the heterokaryons, an equilibrium distribution was reached quickly, such that the mouse and human nuclei gave comparable fluorescence intensities in most cases, by 1 h post fusion. The shuttling of TR{alpha} between the nucleus and cytoplasm is a rapid process, comparable to rates observed for SR proteins (58), Engrailed homeoprotein (62), and the hdm2 oncoprotein (60). In contrast, other shuttling proteins may translocate across the nuclear envelope more slowly; for example, nucleolin does not reach equilibrium until 72 h after fusion (59), and steroid receptors require 4–12 h to reach equilibrium (46).

Shuttling also occurs in Xenopus oocytes; however, there was a shift in the balance between nuclear import and export. Microinjected rat and Xenopus TR{alpha} were found in both the oocyte nucleus and cytoplasm, suggesting that nuclear retention was not as efficient as in mammalian cells, or that nuclear import occurred more slowly. Cytoplasmically injected 35S-labeled TR{alpha} reached a steady state nucleocytoplasmic distribution in oocytes at approximately 6 h after microinjection, and this steady state was maintained throughout a 12-h period. One possible explanation for this distribution pattern is that intranuclear binding sites were saturated; however, no difference in TR{alpha} distribution was observed when increasing concentrations of microinjected protein were used. In addition, when the same amount of protein was introduced into the nuclear compartment, a greater proportion was retained in the nucleus. This observation suggests that if cytoplasmically introduced TR{alpha} had entered the nucleus to a greater extent than that observed, a greater proportion of receptor would have been retained in the nucleus. As this was not the case, our findings suggest that nuclear retention sites are available for further binding and that nuclear accumulation was not saturated. This conclusion is supported by our finding that in the presence of ligand, a greater amount of TR{alpha} accumulated in the nucleus. It is possible that a proportion of the in vitro-translated protein was misfolded and nonfunctional and thus remained cytoplasmic, contributing, in part, to the cytoplasmic population observed in Xenopus oocytes even in the presence of ligand.

The precise functions of nucleocytoplasmic shuttling are not well understood. This process may reflect the role of shuttling proteins as carriers for the delivery of cargo between the nucleus and cytoplasm (e.g. mRNA), or for coordinating the activity and degradation of cell cycle control factors, and for allowing proteins that are primarily localized in one compartment to respond to signals transduced by proteins present in the other compartment (13, 22). Shuttling may also provide an additional level of control for gene regulation. The activities of several transcription factors are regulated by nucleocytoplasmic shuttling, thereby adding to the specificity of the response to signaling cascades. For example, NF-{kappa}B translocates to the nucleus after phosphorylation and degradation of its inhibitor I{kappa}B{alpha}, a protein that is also able to shuttle between the cytoplasm and nucleus (34); nuclear import of NF-AT4 is mediated by the opposing actions of kinases and phosphatases (22); and stress (such as UV and heat-shock) induces active nuclear export and exclusion of Net, a strong repressor of transcription, through a pathway that involves kinase activity, thus releasing genes from Net repression (63).

The interaction of regulatory proteins with target DNA sequences may be a more dynamic process than previously believed. The classical view of steroid hormone receptors is that they bind to a recognition site and remain at that site for as long as the ligand is present. However, a recent report shows that, in fact, the glucocorticoid receptor exchanges rapidly between a hormone response element and the nucleoplasmic compartment in hormone-stimulated cells, suggesting that the receptor is continuously available for modification by secondary signaling pathways such as phosphorylation events mediated through protein kinase cascades (64). Interestingly, another recent report describes cross-talk between Stat5 (signal transducer and activation of transcription 5) and TRß1 (65). Data suggest that TRß1 can be associated with Stat5 in the cytoplasm and may be involved in Stat5 nuclear translocation. Shuttling of TR could thus serve to mediate receptor cross-talk signaling pathways between cellular compartments. Alternatively, shuttling may play a role in receptor turnover via the ubiquitin-proteosome degradation pathway (66).

Oncogenic Conversion of TR{alpha}
A striking difference between TR{alpha} and its oncogenic homolog v-ErbA is that a subpopulation of v-ErbA, but not of TR{alpha}, exists in a cytoplasmic complex with heat shock protein 90 (hsp90) (2, 50, 67). The significance of the association of v-ErbA with hsp90 remains unclear. Current models for v-ErbA action (2, 28, 68) do not address the potential contribution of differential subcellular trafficking to dominant negative activity. Initially we thought that the distribution of v-ErbA in both nuclear and cytoplasmic compartments represented altered cytoplasmic and nuclear retention signals, e.g., association with hsp90 in the cytoplasm and altered DNA-binding specificity of v-ErbA (2, 50, 67). However, this interpretation does not take into account our new data showing that v-ErbA follows a different export pathway than TR{alpha}. Nuclear export of TR{alpha} was not affected by leptomycin B, while v-ErbA export was leptomycin B-sensitive.

CRM1-independent nuclear export is a characteristic of TR{alpha} shared with the steroid receptors (3, 42). Interestingly, although hormone withdrawal leads to a rapid release of glucocorticoid receptors from chromatin, unliganded receptors are delayed in their export. Fusion of a heterologous leucine-rich CRM1-dependent nuclear export signal (NES) on the glucocorticoid receptor increased the export rate, suggesting that a strong NES can override signals present on the glucocorticoid receptor that limit its nuclear export rate (3). The viral oncoprotein v-ErbA has apparently acquired a relatively stronger NES through mutation that counteracts nuclear import and retention signals present in cellular TR{alpha}. Acquisition of this strong NES thus may have contributed significantly to genesis of the oncogenic properties of v-ErbA.

In summary, our studies reveal that TR{alpha}, formerly thought to reside solely in the nucleus tightly bound to chromatin, actually undergoes rapid nucleocytoplasmic shuttling. The challenge for the future will be to determine the functional significance of shuttling of TR{alpha}. Further characterization of the shuttling properties of TR{alpha} and dominant negative variants will contribute to integrating understanding of gene regulation at the level of DNA-protein interactions with additional levels of control made possible by compartmentalization of eukaryotic cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Gene Constructs
RS-rTR{alpha}, tk-TREp-CAT, and pGEX-KG, a GST expression vector (69), were gifts from R. Evans (Salk Institute for Biological Studies, La Jolla, CA). RS-rTR{alpha} contains the rat TR{alpha}1 cDNA under transcriptional control of the Rous sarcoma virus (RSV) long terminal repeat (LTR) (27). tk-TREp-CAT contains a synthetic palindromic thyroid hormone-responsive element (TRE) linked to a herpes simplex virus thymidine kinase (tk)-chloramphenicol acetyltransferase (CAT) fusion gene (27). pT3-rTR{alpha}, an expression vector for rat TR{alpha}1 under control of the T3 RNA polymerase promoter (70), was a gift from M. Lazar (University of Pennsylvania School of Medicine, Philadelphia, PA). pSP6-L5, which contains the Xenopus ribosomal protein L5 cDNA under control of the SP6 RNA polymerase promoter (31), was a gift from W. M. Wormington (University of Virginia, Charlottesville, VA). pSP6-xTR{alpha}, a Xenopus TR{alpha}1 SP6-expression vector (71), was obtained from J. Tata (National Institute for Medical Research, London, UK). The p53-GFP expression vector, encoding p53 fused to the N terminus of GFP (47), was a gift from J. Stommel (Salk Institute for Biological Studies, La Jolla, CA). GST expression vectors for Ran and RanQ69L (36) were obtained from R. Truant (McMaster University, Ontario, Canada).

The plasmid pGFP::TR3 encodes a functional GFP::TR{alpha} fusion protein expressed under cytomegalovirus (CMV) promoter control. The plasmid was made by ligating a PCR product encoding the rat TR{alpha}1 cDNA into the enhanced (red-shifted) GFP plasmid pEGFP-C1 (CLONTECH Laboratories, Inc. Palo Alto, CA), cut with SacI and BamHI. The TR{alpha}1 cDNA was PCR amplified from RS-rTR{alpha} with primers TR-L (CCGAGCTCGAATGGAACAGAAGCC) and TR-R (GGTGGATCCTTAGACTTCCTGATCC), containing engineered SacI and BamHI sites (underlined), to produce receptor fused to the C terminus of GFP.

The plasmids pGFP::C122A and pGFP::G121A encode functional GFP::C122A and GFP::G121A fusion proteins, made by ligating PCR products encoding the human TRß mutants C122A and G121A into pEFGP-C1, cut with EcoRI and BamHI. The mutant sequences were PCR amplified from RS-hTRß-C122>A or RS-hTRß-G121>A (48) (generous gift from P. Romaniuk, University of Victoria, British Columbia, Canada) with primers C122A-L (CCCGAATTCGATGACAGAAAA TGGCC) and C122A-R (GGTGGATCCCTAATCCTCGAACACTTCC), containing engineered EcoRI and BamHI sites (underlined), to produce mutant receptor fused to the C terminus of GFP.

The plasmid pGFP::v-ErbA encodes a functional GFP::v-ErbA fusion protein, made by ligating the PCR product encoding viral Gag-v-ErbA into pEGFP-C1, cut with HindIII and EcoRI. The Gag-v-ErbA sequence was PCR amplified from SP6-v-ErbA (72) (generous gift from M. Privalsky, University of California, Davis, CA) with primers v-ErbA-L (CCCCAAGCTTGGATGGAAACCGTCA TAAAGG) and v-ErbA-R (TGCAGAATTCTACACCTCCTGGGG), containing engineered HindIII and EcoRI sites (underlined), to produce Gag-v-ErbA fused to the C terminus of GFP. Constructs were sequenced to check for correct insertion and fidelity of amplification.

In Vitro Synthesis of 35S-Labeled Proteins
35S-labeled proteins were synthesized in vitro from pT3-rTR{alpha}, pSP6-xTR{alpha}, or pSP6-L5 templates using a rabbit reticulocyte lysate-coupled transcription-translation system (Promega Corp., Madison, WI) in the presence of 40 µCi L-[35S]methionine (1,000 Ci/mmol, in vivo cell labeling grade; Amersham Pharmacia Biotech, Auckland, New Zealand or Arlington Heights, IL).

Analysis of Nucleocytoplasmic Distribution in Xenopus Oocytes
Ovarian lobes were surgically removed from adult female Xenopus laevis, according to procedures approved by the institutional Research on Animal Subjects Committee and processed as described (27, 31). Microinjections were performed according to published methods (31). Twenty to 50 nl of 35S-labeled TR{alpha} or L5 solution (in the rabbit reticulocyte lysate) were microinjected into the cytoplasm or nucleus of stage V–VI fully grown oocytes.

To inhibit the synthesis of 35S-labeled endogenous proteins from unincorporated [35S]methionine remaining in the lysate solution, microinjected oocytes were incubated in O-R2 medium (27) containing 100 µg/ml cycloheximide (Sigma, St. Louis, MO). Cycloheximide does not interfere with protein import in oocytes (31). Oocytes were manually dissected in Nucleus Isolation Buffer [25 mM Tris-HCl, pH 8.0; 5 mM MgCl2; 2 mM dithiothreitol (DTT); 10% glycerol]. A successful cytoplasmic injection was scored by the absence of a red nucleus (colored by hemoglobin present in the reticulocyte lysate), while a successful nuclear injection was scored by the presence of a red nucleus. The inability to release a soluble protein from nuclei by detergent extraction is a criterion that this protein is inside the nucleus instead of associated with the outer nuclear membrane. Thus, for some experiments, 1% Triton X-100 was included in the Nucleus Isolation Buffer. Six nuclei and their six corresponding "cytoplasms" (enucleated oocytes) were separately pooled per sample and homogenized in Homogenization Buffer [1% Triton X-100; 100 mM NaCl; 20 mM Tris-HCl, pH 7.6, and 0.4 mM Pefabloc (Roche Molecular Biochemicals, Auckland, New Zealand) or 1 mM phenylmethylsulfonyl fluoride (PMSF)]. The cytoplasmic sample was cleared of lipid, yolk, and pigment by centrifugation at 10,000 x g for 5 min at 4 C. Proteins were precipitated overnight in acetone at -80 C, centrifuged for 15 min at 10,000 x g, and resuspended in Sample Buffer (2% SDS; 10% glycerol; 0.6 mM Tris-HCl, pH 6.8; 0.005% bromophenol blue; 0.1 mM DTT). Samples were resolved by 12% SDS-PAGE, followed by fluorography as described previously (31). Dried gels were exposed to x-ray film at -80 C for 1–2 weeks. Exposed films were scanned and quantified by NIH Image, version alpha 9 (Scion Corp., Frederick, MD). The densities of the bands of full-length TR{alpha} in the cytoplasmic and nuclear lanes were determined by the Gelplot2 macro. The nuclear density was compared with the sum of the cytoplasmic and nuclear densities to quantify the amount of nuclear-localized full-length TR{alpha}. Nuclear accumulation was expressed as a percentage. Mean sample results from replicate batches of oocytes were analyzed for significant difference by two-tailed Student’s t tests.

For chilling assays, oocytes were incubated on ice for 30 min, microinjected with in vitro synthesized protein, and incubated at 0–4 C for an additional 6 h. To determine whether transport competence was restored at physiological temperatures, microinjected oocytes were incubated for 6 h on ice followed by 6 h at 18–20 C. After incubation, oocytes were assayed for nucleocytoplasmic distribution, as described above.

For ATP depletion assays, oocytes were preinjected with apyrase (Grade VIII, Sigma) 30 min before microinjection of 35S-TR{alpha}. Fifty nanoliters of 1 U/µl apyrase in PBS were delivered to give an intracellular concentration of 100 U/ml. This results in a rapid decrease of cellular ATP from 2 mM to 10 µM (31). After 6 h incubation at 18–20 C, oocytes were manually dissected and assayed as described above.

Recombinant wild-type Ran and RanQ69L were expressed in Escherichia coli BL21 cells as GST fusion proteins (36). After extraction in B-PER reagent (Pierce Chemical Co., Rockford, IL), proteins were purified on glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) as described previously (36), dialyzed in Storage Buffer (10 mM HEPES, pH 7.9, 100 mM NaCl, 1 mM DTT, 10% glycerol), and frozen in single-use aliquots at -80 C.

Fifty nanoliters of WGA (from Triticum vulgaris, Sigma) in PBS were injected to give a final intracellular concentration of 500 µg/ml, 3 h before microinjection of 35S-TR. After 6 h incubation at 18–20 C, oocytes were assayed for nuclear transport.

For kinetic competition assays, histone H1 (Roche Molecular Biochemicals, Indianapolis, IN) was preinjected into oocytes to give final intracellular concentrations of 750 µM (low) or 900 µM (high), before injection of labeled protein. Ribosomal protein L5 was also used as a competitor in similar experiments. Equal quantities of 35S-labeled and unlabeled L5 (100 pg of each per oocyte) were microinjected. The concentration of unlabeled L5 in the translation mix was estimated by SDS-PAGE and staining with 0.25% Coomassie blue R250. Microinjected oocytes were analyzed for nuclear transport as described above.

For hormone treatment, microinjected oocytes were incubated in O-R2 supplemented with 100 nM T3 (Sigma) for 6 h at 18–20 C. Protein was isolated from manually dissected oocytes and the nucleocytoplasmic distribution of 35S-TR{alpha} was analyzed. Results were compared with control incubations made in the absence of T3.

Analysis of GST-TR{alpha} in Xenopus Oocytes
GST was expressed in bacteria transformed with pGEX-KG and purified using a B-PER GST Fusion Protein Purfication Kit (Pierce Chemical Co.), according to the manufacturer’s instructions. GST-tagged chicken TR{alpha} (GST-TR{alpha}) was commercially prepared (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Five nanograms of GST-TR{alpha} or GST alone were microinjected into the oocyte cytoplasm. After 3 h incubation, oocytes were manually dissected in 1% trichloroacetic acid (TCA) for the chilling and WGA experiments, or in Nucleus Isolation Buffer for all other experiments. Oocytes were homogenized in Homogenization Buffer (containing 1 mM PMSF). An equal volume of Sample Buffer was added directly to three pooled nuclear fractions, and the cleared supernatants of the three corresponding cytoplasmic fractions. Samples were separated by 10% SDS-PAGE. Nuclear fractions and one oocyte-equivalent (by volume) from each cytoplasmic sample were loaded on the gel, along with a lane of protein molecular mass markers (Kaleidoscope Pre-Stained Standards, Bio-Rad Laboratories, Inc., Hercules, CA). Proteins were transferred to Immobilon-P PVDF membrane (Millipore Corp., Bedford, MA) by semidry electroblotting at 2.5 mA/cm2 for 30 min. Blots were probed with anti-TR{alpha} (rabbit polyclonal to full-length chicken TR{alpha}; FL-408; Santa Cruz Biotechnology, Inc.) at 1:1,000, or anti-GST polyclonal antibodies (Z-5, Santa Cruz Biotechnology, Inc.) at 1:1000, and horseradish peroxidase-conjugated secondary antibodies (Blotting grade, Bio-Rad Laboratories, Inc.) at 1:10,000. GST-TR{alpha} and GST alone were visualized by chemiluminescent detection (ECL, Amersham Pharmacia Biotech). When 5 ng of GST-TR{alpha} were injected into oocytes, the full-length GST-TR{alpha} band on Western blots was clearly distinguishable from bands resulting from nonspecific antibody binding to endogenous oocyte proteins in the cytoplasmic and nuclear fractions with similar mobility to full-length GST-TR{alpha}.

Cell Culture and Transfections
NIH/3T3 cells [NIH Swiss mouse embryo fibroblasts, American Type Culture Collection (ATCC, Manassas, VA) CRL-1658] were cultured in DMEM containing 10% calf serum (CS), 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc., Gaithersburg, MD), at 37 C under 5% CO2 and 98% humidity. HeLa cells (human cervix epithelioid carcinoma, ATCC, CCL-2) were grown in MEM, supplemented with 10% FBS, and antibiotics. COS-1 cells (African green monkey SV40-transformed kidney fibroblasts, ATCC, CRL-1650) were grown in DMEM supplemented with 10% FBS and antibiotics.

For transient transfections, trypsinized cells were seeded at 1–3 x 105 cells per well onto Lab-Tek four-well chamber slides or onto sterile 22-mm coverslips in six-well multidishes (Nalge Nunc International, Rochester, NY). Twenty-four hours after reseeding, cells at 50–60% confluence were transfected with 2 µg plasmid DNA and 10 µl LipofectAmine in Opti-MEM I Reduced Serum Medium, according to the manufacturer’s instructions (Life Technologies, Inc.). For 100-mm dishes, cells were transfected with 10 µg of plasmid DNA in the presence of 50 µl of LipofectAmine. Reduced serum medium was replaced with complete medium 16 to 20 h post transfection.

CAT Enzyme-Linked Immunosorbent Assay (ELISA)
COS-1 cells were plated in 100-mm dishes and transfected with 5 µg of CAT reporter plasmid tk-TREp-CAT plus either 5 µg of pUC18 (empty vector), 5 µg RS-rTR{alpha}, or 5 µg pGFP::TR3. Eighteen hours post transfection, medium was replaced with DMEM containing 10% charcoal-dextran stripped FBS (HyClone Laboratories, Inc. Logan, UT) supplemented or not with 100 nM T3. Cells were lysed, a cell extract was prepared, and the extract was used in the determination of CAT expression levels by ELISA according to the manufacturer’s specifications (Roche Molecular Biochemicals). In brief, protein concentration was determined by the Bradford assay (Bio-Rad Laboratories, Inc.), and the concentration of each extract was adjusted to the same amount of total protein (3.52 mg per well). Microwells coated with anti-CAT antibodies were incubated with cell extracts and pure CAT standards. Digoxygenin (DIG)-tagged secondary antibody to CAT was then bound to the primary antibody-antigen complex. After washing, bound DIG-tagged antibody was quantitated colorimetrically by incubation with peroxidase-conjugated anti-DIG and ABTS (2, 2'-azino-di-[3-ethylbenzthiazoline sulfonate(6)]) as substrate. The wells were read at 405 nm against a reagent blank in a microtiter well reader. For each assay, a standard curve utilizing four pure protein standards was prepared, to ensure that CAT concentrations of sample extracts fell within the linear range of the assay. Replicate samples were assayed.

Analysis of Nucleocytoplasmic Distribution in Mammalian Cells
For treatment with ligand, calf serum was stripped of any endogenous T3 with 5% AG1-X8 resin (Bio-Rad Laboratories, Inc.) for 12 h at 4 C. Sixteen to 20 h post transfection, the reduced serum medium was replaced with T3-depleted medium, or with medium supplemented with a range of concentrations of T3 (10-9 M, 10-6 M, 10-3 M). Cells were examined for GFP expression after a further 24 h incubation at 37 C.

For chilling assays 24–48 h post transfection, cells were incubated in medium containing 50 µg/ml cycloheximide (cell culture-tested, Sigma) for 30 min to prevent de novo protein synthesis. A further replacement was made with cycloheximide-containing medium, and cells were incubated at 0–4 C for 3–4 h.

For energy depletion, cells were pretreated with cycloheximide as described above, and then incubated for 3–4 h in glucose minus DMEM, supplemented with 50 µg/ml cycloheximide, 6 mM 2-deoxyglucose (Sigma), a nonhydrolyzable analog of glucose, and 50 µM oligomycin (types A, B, and C; Sigma), an inhibitor of mitochondrial ATPase and phosphoryl group transfer.

GFP Fluorescence Microscopy
For analysis of GFP-TR{alpha} expression in live cells, 48 h post transfection, chamber slides were washed gently in Dulbecco’s-modified PBS (D-PBS: 2.7 mM KCl; 1.5 mM KH2PO4; 136.9 mM NaCl; 8 mM Na2HPO4). Cells were mounted in fresh D-PBS, covered with glass coverslips, and maintained at 37 C until immediately before viewing. Slides were examined on a Leitz Orthoplan epifluorescence microscope under both bright field and fluorescence, using the fluorescein isothiocyanate (FITC) filter to visualize GFP. Photography was performed with a Leitz Orthomat camera and Fujichrome Provia 400 Daylight slide film (Fuji Photo Film Co., Ltd., Cypress, CA). Replicate slides were examined and distributions of GFP fusion proteins were recorded qualitatively.

For analysis of GFP-TR{alpha} expression in fixed cells, 24 h post-transfection cells were fixed in 3.7% formaldehyde. Coverslips were mounted in Vectashield containing 4',6'-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Inc. Burlingame, CA). Slides were examined on an epifluorescence microscope (Olympus Corp., Lake Success, NY) , using the FITC filter (NB) for GFP and UV filter (NU) for DAPI. Cells were photographed with Kodak Select Series Elitechrome 400 ASA slide film (Eastman Kodak, Rochester, NY).

Heterokaryon Assays
For the preparation of heterokaryons, mouse (NIH/3T3) cells were seeded at 2.0–2.8 x 105 cells per well onto coverslips in six-well multidishes. Subsequently, the cells were transfected with GFP-tagged or untagged TR{alpha} expression vectors. Twenty-four to 48 h post transfection of the mouse cells, human (HeLa) cells were trypsinized, resuspended in Heterokaryon Growth Medium (70% DMEM, 10% FBS, 20% sterile ddH20), and plated on the same coverslips at a density of 6.6–7.6 x 105 cells per well, to optimize heterologous fusion. After 3 h at 37 C in Heterokaryon Growth Medium containing 50 µg/ml cycloheximide, the medium was replaced with fresh Heterokaryon Growth Medium containing 100 µg/ml cycloheximide, 30 min before fusion. Subsequently, cells were rinsed twice with D-PBS. For cell fusion, coverslips were placed on a 100 µl drop of prewarmed 50% polyethylene glycol 1500 (sterile, cell fusion-tested, Roche Molecular Biochemicals) and incubated for exactly 2 min. The coverslip was then immediately rinsed twice in D-PBS and placed back into the six-well plate in pre-warmed Heterokaryon Growth Medium containing 100 µg/ml cycloheximide. Cells were incubated at 37 C, on ice, or in the presence of 2-deoxyglucose and oligomycin for 1–2 h after fusion. For treatment with ligand, 24 h post transfection of the mouse cells, medium was replaced with DMEM containing 10% charcoal-dextran stripped FBS (HyClone Laboratories, Inc.), supplemented or not with 100 nM T3. For analysis of CRM1 dependence, cells were incubated with 10 or 50 ng/ml leptomycin B (or an equivalent volume of ethanol as a control) in culture medium containing cycloheximide for 2.5 h before fusion and for 1.5 h after fusion. For single cell analysis, cells were incubated for 5 h in leptomycin B, 16–18 h post transfection. Leptomycin B (10 µg/ml in ethanol; stored at -20 C) was a generous gift from M. Yoshida (University of Tokyo, Japan).

GFP-TR{alpha} shuttling was visualized by direct epifluorescence microscopy, and untagged TR{alpha} shuttling was visualized by indirect immunofluorescence microscopy. In brief, cells were fixed in 4% paraformaldehyde (or 3.7% formaldehyde), permeabilized in 0.2% Triton X-100, and probed with anti-TR{alpha} antibodies (1:50, polyclonal against the extreme C terminus of rat TR{alpha}1, PA1–211A, Affinity BioReagents, Inc., Golden, CO) and fluorescein-conjugated goat antirabbit secondary antibodies (1:200, Vector Laboratories, Inc.). To visualize heterokaryons, cells were stained for DNA with 10 µg/ml Hoechst 33258 (bisBenzimide) (Sigma) for 15 min, and for actin with 2–4 U/ml rhodamine-phalloidin (Molecular Probes, Inc., Eugene, OR) for 20 min at room temperature. Coverslips were mounted in Vectashield (Vector Laboratories, Inc.). Slides were examined on an Olympus Corp. epifluorescence microscope, using the FITC filter (NB) for GFP, the UV filter (NU) for Hoechst, and the rhodamine filter (NG) for rhodamine-phalloidin. Cells were photographed with Kodak Select Series Elitechrome 400 ASA slide film.


    ACKNOWLEDGMENTS
 
We thank R. Evans, M. Lazar, P. Romaniuk, J. Stommel, J. Tata, R. Truant, and W. M. Wormington for expression plasmids, and M. Yoshida for the leptomycin B. We thank N. Hollingshead and H. Luo for constructing GFP::G121A and GFP::v-ErbA, respectively, and, along with B. Gwinn, for the initial characterization of the subcellular distribution of mutant receptors. We thank P. Zwollo and anonymous reviewers for critical reading of the manuscript.


    FOOTNOTES
 
Address requests for reprints to: Lizabeth A. Allison, Ph.D., Department of Biology, College of William and Mary, P.O. Box 8795, Williamsburg, Virginia 23187-8795. E-mail: laalli{at}wm.edu

This work was supported in part by research grants from the Health Research Council of New Zealand (HRC 94/470) and the Jeffress Memorial Trust to L.A.A. (J-477), and by a Howard Hughes Medical Institute grant through the Undergraduate Biological Sciences Education Program to the College of William and Mary (HHMI 71199518302). C.F.B. was the recipient of a Sadie Balkind Award from the New Zealand Federation of University Women and a predoctoral Sargood Bequest Cancer Research Training Scholarship from the Cancer Society of New Zealand.

Received for publication May 26, 2000. Revision received November 27, 2000. Accepted for publication December 22, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Zhang J, Lazar MA 2000 The mechanism of action of thyroid hormones. Annu Rev Physiol 62:439–466[CrossRef][Medline]
  2. Wolffe AP, Collingwood TN, Li Q, Yee J, Urnov F, Shi Y-B 2000 Thyroid hormone receptor, v-ErbA, and chromatin. Vitam Horm 58:449–492[CrossRef][Medline]
  3. Liu J, DeFranco DB 2000 Protracted nuclear export of glucocorticoid receptor limits its turnover and does not require the exportin 1/CRM1-directed nuclear export pathway. Mol Endocrinol 14:40–51[Abstract/Free Full Text]
  4. Guiochon-Mantel A, Delabre K, Lescop P, Milgrom E 1996 Intracellular traffic of steroid hormone receptors. J Steroid Biochem Mol Biol 56:3–9[CrossRef][Medline]
  5. DeFranco DB 1997 Subnuclear trafficking of steroid receptors. Biochem Soc Trans 25:592–597[Medline]
  6. Kumara-Siri MH, Shapiro LE, Surks MI 1986 Association of the 3,5,3'-triiodo-L-thyronine nuclear receptor with the nuclear matrix of cultured growth hormone-producing rat pituitary tumor cells (GC cells). J Biol Chem 261:2844–2852[Abstract/Free Full Text]
  7. Macchia E, Falcone M, Giorgilli G, Bogazzi F, Antonangeli L, Baccarini S, Fontanini G, Torresani J, DeGroot LJ, Pinchera A 1992 Site-specific anti-c-erb A antibodies recognizing native thyroid hormone receptors: their use to detect the expression and localization of {alpha} and ß c-erb A proteins in rat liver. J Recept Res 12:201–215[Medline]
  8. Lee Y, Mahdavi V 1993 The D domain of the thyroid hormone receptor {alpha}1 specifies positive and negative transcriptional regulation functions. J Biol Chem 268:2021–2028[Abstract/Free Full Text]
  9. Andersson ML, Vennström B 1997 Chicken thyroid hormone receptor {alpha} requires the N-terminal amino acids for exclusive nuclear localization. FEBS Lett 416:291–296[CrossRef][Medline]
  10. Chen Y, Chen P, Chen C, Sharp ZD, Lee W 1999 Thyroid hormone, T3-dependent phosphorylation and translocation of Trip230 from the Golgi complex to the nucleus. Proc Natl Acad Sci USA 96:4443–4448[Abstract/Free Full Text]
  11. Horowitz ZD, Yang C, Forman BM, Casanova J, Samuels HH 1989 Characterization of the domain structure of chick c-erbA by deletion mutation: in vitro translation and cell transfection studies. Mol Endocrinol 3:148–156[Abstract/Free Full Text]
  12. Zhu X, Hanover JA, Hager GL, Cheng S 1998 Hormone-induced translocation of thyroid hormone receptors in living cells visualized using a receptor green fluorescent protein chimera. J Biol Chem 273:27058–27063[Abstract/Free Full Text]
  13. Görlich D, Kutay U 1999 Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol 15:607–660[CrossRef][Medline]
  14. Rout MP, Aitchison JD, Suprapto A, Hjertaas K, Zhao Y, Chait BT 2000 The yeast nuclear pore complex: composition, architecture, and transport mechanism. J Cell Biol 148:635–651[Abstract/Free Full Text]
  15. Jäkel S, Albig W, Kutay U, Bischoff FR, Schwamborn K, Doenecke D, Görlich D 1999 The importin ß/importin 7 heterodimer is a functional nuclear import receptor for histone H1. EMBO J 18:2411–2423[CrossRef][Medline]
  16. Harootunian AT, Adams SR, Wen W, Meinkoth JL, Taylor SS, Tsien RY 1993 Movement of the free catalytic subunit of cAMP-dependent protein kinase into and out of the nucleus can be explained by diffusion. Mol Biol Cell 4:993–1002[Abstract]
  17. Pruschy M, Ju Y, Spitz L, Carafoli E, Goldfarb DS 1994 Facilitated nuclear transport of calmodulin in tissue culture cells. J Cell Biol 127:1527–1536[Abstract/Free Full Text]
  18. Klein Gunnewiek JMT, van Aarssen Y, van der Kemp A, Nelissen R, Pruijn GJM, van Venrooij WJ 1997 Nuclear accumulation of the U1 snRNP-specific protein C is due to diffusion and retention in the nucleus. Exp Cell Res 235:265–273[CrossRef][Medline]
  19. Schmalz D, Hucho F, Buchner K 1998 Nuclear import of protein kinase C occurs by a mechanism distinct from the mechanism used by proteins with a classical nuclear localization signal. J Cell Sci 111:1823–1830[Abstract]
  20. Adachi M, Fukuda M, Nishida E 1999 Two co-existing mechanisms for nuclear import of MAP kinase: passive diffusion of a monomer and active transport of a dimer. EMBO J 18:5347–5358[CrossRef][Medline]
  21. Liao B, Paschal BM, Luby-Phelps K 1999 Mechanism of Ca2+-dependent nuclear accumulation of calmodulin. Proc Natl Acad Sci USA 96:6217–6222[Abstract/Free Full Text]
  22. Kaffman A, O’Shea EK 1999 Regulation of nuclear localization: a key to a door. Annu Rev Cell Dev Biol 15:291–339[CrossRef][Medline]
  23. Abu-Shaar M, Ryou HD, Mann RS 1999 Control of the nuclear localization of extradenticle by competing nuclear import and export signals. Genes Dev 13:935–945[Abstract/Free Full Text]
  24. Kambach C, Mattaj IW 1992 Intracellular distribution of the U1A protein depends on active transport and nuclear binding to U1 snRNA. J Cell Biol 118:11–21[Abstract/Free Full Text]
  25. Nakielny S, Dreyfuss G 1996 The hnRNP C proteins contain a nuclear retention sequence that can override nuclear export signals. J Cell Biol 134:1365–1373[Abstract/Free Full Text]
  26. Sackey FNA, Haché RJG, Reich T, Kwast-Welfeld J, Lefebvre YA 1996 Determinants of subcellular distribution of the glucocorticoid receptor. Mol Endocrinol 10:1191–1205[Abstract/Free Full Text]
  27. Nagl SB, Nelson CC, Romaniuk PJ, Allison LA 1995 Constitutive transactivation by the thyroid hormone receptor and a novel pattern of activity of its oncogenic homolog v-ErbA in Xenopus oocytes. Mol Endocrinol 9:1522–1532[Abstract/Free Full Text]
  28. Urnov FD, Yee J, Sachs L, Collingwood TN, Bauer A, Beug H, Shi Y, Wolffe AP 2000 Targeting of N-CoR and histone deacetylase 3 by the oncoprotein v-ErbA yields a chromatin infrastructure-dependent transcriptional repression pathway. EMBO J 19:4074–4090[CrossRef][Medline]
  29. Eliceiri BP, Brown DD 1994 Quantitation of endogenous thyroid hormone receptors {alpha} and ß during embryogenesis and metamorphosis in Xenopus laevis. J Biol Chem 269:24459–24465[Abstract/Free Full Text]
  30. Panté N, Aebi U 1996 Sequential binding of import ligands to distinct nucleopore regions during their nuclear import. Science 273:1729–1732[Abstract/Free Full Text]
  31. Murdoch KJ, Allison LA 1996 A role for ribosomal protein L5 in the nuclear import of 5S rRNA in Xenopus oocytes. Exp Cell Res 227:332–343[CrossRef][Medline]
  32. Claußen M, Rudt F, Pieler T 1999 Functional modules in ribosomal protein L5 for ribonucleoprotein complex formation and nucleocytoplasmic transport. J Biol Chem 274:33951–33958[Abstract/Free Full Text]
  33. Hetzer M, Mattaj IW 2000 An ATP-dependent, Ran-independent mechanism for nuclear import of the U1A and U2B'' spliceosome proteins. J Cell Biol 148:293–303[Abstract/Free Full Text]
  34. Sachdev S, Bagchi S, Zhang DD, Mings AC, Hannink M 2000 Nuclear import of I{kappa}B{alpha} is accomplished by a Ran-independent transport pathway. Mol Cell Biol 20:1571–1582[Abstract/Free Full Text]
  35. Allison LA 1999 Use of the Xenopus oocyte system to study RNA transport. In: Lacal JC, Perona R, Feramisco J (eds) Microinjection. Birkhäuser Verlag, Basel, pp 187–198
  36. Truant R, Cullen BR 1999 The arginine-rich domains present in human immunodeficiency virus type 1 Tat and Rev function as direct importin ß-dependent nuclear localization signals. Mol Cell Biol 19:1210–1217[Abstract/Free Full Text]
  37. Fischer U, Pollard VW, Lührmann R, Teufel M, Michael MW, Dreyfuss G, Malim MH 1999 Rev-mediated nuclear export of RNA is dominant over nuclear retention and is coupled to the Ran-GTPase cycle. Nucleic Acids Res 27:4128–4134[Abstract/Free Full Text]
  38. Jäkel S, Görlich D 1998 Importin ß, transportin, RanBP5, and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J 17:4491–4502[CrossRef][Medline]
  39. Schwoebel ED, Talcott B, Cushman I, Moore MS 1998 Ran-dependent signal-mediated nuclear import does not require GTP hydrolysis by Ran. J Biol Chem 273:35170–35175[Abstract/Free Full Text]
  40. Htun H, Barsony J, Renyi I, Gould DL, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850[Abstract/Free Full Text]
  41. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization of the human estrogen receptor {alpha} reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471–486[Abstract/Free Full Text]
  42. Tyagi RK, Lavrovsky Y, Ahn SC, Song CS, Chatterjee B, Roy AK 2000 Dynamics of intracellular movement and nucleocytoplasmic recycling of the ligand-activated androgen receptor in living cells. Mol Endocrinol 14:1162–1174[Abstract/Free Full Text]
  43. Fejes-Tóth G, Pearce D, Náray-Fejes-Tóth A 1998 Subcellular localization of mineralocorticoid receptors in living cells: effects of receptor agonists and antagonists. Proc Natl Acad Sci USA 95:2973–2978[Abstract/Free Full Text]
  44. Spector DL, Goldman RD, Leinwand LA 1998 Analysis of nucleocytoplasmic shuttling using transient interspecies heterokaryons. In: Cells. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, vol 1:46.1–46.5
  45. Kudo N, Matsumori N, Taoka H, Fujiwara D, Schreiner EP, Wolff B, Yoshida M, Horinouchi S 1999 Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc Natl Acad Sci USA 96:9112–9117[Abstract/Free Full Text]
  46. Tyagi RK, Amazit L, Lescop P, Milgrom E, Guiochon-Mantel A 1998 Mechanisms of progesterone export from nuclei: role of nuclear localization signal, nuclear export signal, and Ran guanosine triphosphate. Mol Endocrinol 12:1684–1695[Abstract/Free Full Text]
  47. Stommel JM, Marchenko ND, Jimenez GS, Moll UM, Hope TJ, Wahl GM 1999 A leucine-rich nuclear export signal in the p53 tetramerization domain: regulation of subcellular localization and p53 activity by NES masking. EMBO J 18:1660–1672[CrossRef][Medline]
  48. Nelson CC, Faris JS, Hendy SC, Romaniuk PJ 1993 Functional analysis of the amino acids in the DNA recognition {alpha}-helix of the human thyroid hormone receptor. Mol Endocrinol 7:1185–1195[Abstract/Free Full Text]
  49. Sap J, Muñoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Beug H, Vennström B 1986 The c-erb-A protein is a high affinity receptor for thyroid hormone. Nature 324:635–640[CrossRef][Medline]
  50. Boucher P, Koning A, Privalsky ML 1988 The avian erythroblastosis virus erbA oncogene encodes a DNA-binding protein exhibiting distinct nuclear and cytoplasmic subcellular localizations. J Virol 62:534–544[Abstract/Free Full Text]
  51. Tang Y, DeFranco DB 1996 ATP-dependent release of glucocorticoid receptors from the nuclear matrix. Mol Cell Biol 16:1989–2001[Abstract]
  52. Dang CV, Lee WMF 1989 Nuclear and nucleolar targeting sequences of c-erbA, c-myb, N-myc, p53, HSP70, and HIV tat proteins. J Biol Chem 264:18019–18023[Abstract/Free Full Text]
  53. Hörlein AJ, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Söderström M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  54. LaCasse EC, Lefebvre YA 1995 Nuclear localization signals overlap DNA- or RNA-binding domains in nucleic acid-binding proteins. Nucleic Acids Res 23:1647–1656[Free Full Text]
  55. Nishiyama K, Matsushita A, Natsume H, Mikami T, Genma R 2000 Differences between the silencing-related properties of the extreme carboxyl-terminal regions of thyroid hormone receptors {alpha}1 and ß1. J Endocrinol 167:219–227[Abstract]
  56. Escriva H, Safi R, Hänni C, Langlois M, Saumitou-Laprade P, Stehelin D, Capron A, Pierce R, Laudet V 1997 Ligand binding was acquired during evolution of nuclear receptors. Proc Natl Acad Sci USA 94:6803–6808[Abstract/Free Full Text]
  57. van Steensel B, van Binnendijk EP, Hornsby CD, van der Voort HTM, Krozowski ZS, de Kloet ER, van Driel R 1996 Partial colocalization of glucocorticoid and mineralocorticoid receptors in discrete compartments in nuclei of rat hippocampus neurons. J Cell Sci 109:787–792[Abstract]
  58. Cáceres JF, Screaton GR, Krainer AR 1998 A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev 12:55–66[Abstract/Free Full Text]
  59. Borer RA, Lehner CF, Eppenberger HM, Nigg EA 1989 Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 56:379–390[CrossRef][Medline]
  60. Meyer BE, Malim MH 1994 The HIV-1 Rev trans-activator shuttles between the nucleus and the cytoplasm. Genes Dev 8:1538–1547[Abstract/Free Full Text]
  61. Roth J, Dobbelstein M, Freedman DA, Shenk T, Levine A 1998 Nucleocytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein. EMBO J 17:554–564[CrossRef][Medline]
  62. Maizel A, Bensaude O, Prochiantz A, Joliot A 1999 A short region of its homeodomain is necessary for engrailed nuclear export and secretion. Development 126:3183–3190[Abstract]
  63. Ducret C, Maira S, Dierich A, Wasylyk B 1999 The Net repressor is regulated by nuclear export in response to anisomycin, UV, and heat shock. Mol Cell Biol 19:7076–7087[Abstract/Free Full Text]
  64. McNally JG, Müller WG, Walker D, Wolford R, Hager GL 2000 The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262–1265[Abstract/Free Full Text]
  65. Favre-Young H, Dif F, Roussille F, Demeneix BA, Kelly PA, Edery M, deLuze A 2000 Cross-talk between signal transducer and activator of transcription (Stat5) and thyroid hormone receptor-ß1 (TRß1) signaling pathways. Mol Endocrinol 14:1411–1424[Abstract/Free Full Text]
  66. Dace A, Zhao L, Park KS, Furuno T, Takamura N, Nakanishi M, West BL, Hanover JA, Cheng S 2000 Hormone binding induces rapid proteasome-mediated degradation of thyroid hormone receptors. Proc Natl Acad Sci USA 97:8985–8990[Abstract/Free Full Text]
  67. Privalsky ML 1991 A subpopulation of the v-erbA oncogene protein, a derivative of a thyroid hormone receptor, associates with heat shock protein 90. J Biol Chem 266:1456–1462[Abstract/Free Full Text]
  68. Bauer A, Mikulits W, Lagger G, Stengl G, Brosch G, Beug H 1998 The thyroid hormone receptor functions as a ligand-operated developmental switch between proliferation and differentiation of erythroid progenitors. EMBO J 17:4291–4303[CrossRef][Medline]
  69. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  70. Lazar MA, Berrodin TJ, Harding HP 1991 Differential DNA binding by monomeric, homodimeric, and potentially heteromeric forms of the thyroid hormone receptor. Mol Cell Biol 11:5005–5015[Abstract/Free Full Text]
  71. Machuca I, Esslemont G, Fairclough L, Tata JR 1995 Analysis of structure and expression of the Xenopus thyroid hormone receptor-ß gene to explain its autoinduction. Mol Endocrinol 9:96–107[Abstract/Free Full Text]
  72. Nagl SB, Bunn CF, Allison LA 1997 v-erbA oncogene initiates ultrastructural changes characteristic of early and intermediate events of meiotic maturation in Xenopus oocytes. J Cell Biochem 67:184–200[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. E. Grespin, G. M. C. Bonamy, V. R. Roggero, N. G. Cameron, L. E. Adam, A. P. Atchison, V. M. Fratto, and L. A. Allison
Thyroid Hormone Receptor {alpha}1 Follows a Cooperative CRM1/Calreticulin-mediated Nuclear Export Pathway
J. Biol. Chem., September 12, 2008; 283(37): 25576 - 25588.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. T. Kesler, D. Gioeli, M. R. Conaway, M. J. Weber, and B. M. Paschal
Subcellular Localization Modulates Activation Function 1 Domain Phosphorylation in the Androgen Receptor
Mol. Endocrinol., September 1, 2007; 21(9): 2071 - 2084.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Sun, V. Montana, K. Chellappa, Y. Brelivet, D. Moras, Y. Maeda, V. Parpura, B. M. Paschal, and F. M. Sladek
Phosphorylation of a Conserved Serine in the Deoxyribonucleic Acid Binding Domain of Nuclear Receptors Alters Intracellular Localization
Mol. Endocrinol., June 1, 2007; 21(6): 1297 - 1311.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M.-B. Poirier, G. Hamann, M.-E. Domingue, M. Roy, T. Bardati, and M.-F. Langlois
General Receptor for Phosphoinositides 1, a Novel Repressor of Thyroid Hormone Receptor Action that Prevents Deoxyribonucleic Acid Binding
Mol. Endocrinol., August 1, 2005; 19(8): 1991 - 2005.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Kinugawa, M. Y. Jeong, M. R. Bristow, and C. S. Long
Thyroid Hormone Induces Cardiac Myocyte Hypertrophy in a Thyroid Hormone Receptor {alpha}1-Specific Manner that Requires TAK1 and p38 Mitogen-Activated Protein Kinase
Mol. Endocrinol., June 1, 2005; 19(6): 1618 - 1628.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. N. Feige, L. Gelman, C. Tudor, Y. Engelborghs, W. Wahli, and B. Desvergne
Fluorescence Imaging Reveals the Nuclear Behavior of Peroxisome Proliferator-activated Receptor/Retinoid X Receptor Heterodimers in the Absence and Presence of Ligand
J. Biol. Chem., May 6, 2005; 280(18): 17880 - 17890.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison
Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors
Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
L. Schneider, C. El-Yazidi, A. Dace, M. Maraninchi, R. Planells, A. Margotat, and J. Torresani
Expression of the 1,25-(OH)2 vitamin D3 receptor gene during the differentiation of mouse Ob17 preadipocytes and cross talk with the thyroid hormone receptor signalling pathway
J. Mol. Endocrinol., February 1, 2005; 34(1): 221 - 235.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Kenessey and K. Ojamaa
Ligand-mediated decrease of thyroid hormone receptor-{alpha}1 in cardiomyocytes by proteosome-dependent degradation and altered mRNA stability
Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H813 - H821.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Cao, W. Liu, F. Lin, H. Li, S. K. Kolluri, B. Lin, Y.-h. Han, M. I. Dawson, and X.-k. Zhang
Retinoid X Receptor Regulates Nur77/Thyroid Hormone Receptor 3-Dependent Apoptosis by Modulating Its Nuclear Export and Mitochondrial Targeting
Mol. Cell. Biol., November 15, 2004; 24(22): 9705 - 9725.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
X.-F. Lin, B.-X. Zhao, H.-Z. Chen, X.-F. Ye, C.-Y. Yang, H.-Y. Zhou, M.-Q. Zhang, S.-C. Lin, and Q. Wu
RXR{alpha} acts as a carrier for TR3 nuclear export in a 9-cis retinoic acid-dependent manner in gastric cancer cells
J. Cell Sci., November 1, 2004; 117(23): 5609 - 5621.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Xu and R. J. Koenig
An RNA-binding Domain in the Thyroid Hormone Receptor Enhances Transcriptional Activation
J. Biol. Chem., August 6, 2004; 279(32): 33051 - 33056.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. DeLong, G. M. C. Bonamy, E. N. Fink, and L. A. Allison
Nuclear Export of the Oncoprotein v-ErbA Is Mediated by Acquisition of a Viral Nuclear Export Sequence
J. Biol. Chem., April 9, 2004; 279(15): 15356 - 15367.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. E. Black, M. J. Vitto, D. Gioeli, A. Spencer, N. Afshar, M. R. Conaway, M. J. Weber, and B. M. Paschal
Transient, Ligand-Dependent Arrest of the Androgen Receptor in Subnuclear Foci Alters Phosphorylation and Coactivator Interactions
Mol. Endocrinol., April 1, 2004; 18(4): 834 - 850.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Maruvada, N. I. Dmitrieva, J. East-Palmer, and P. M. Yen
Cell Cycle-dependent Expression of Thyroid Hormone Receptor-{beta} Is a Mechanism for Variable Hormone Sensitivity
Mol. Biol. Cell, April 1, 2004; 15(4): 1895 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen
Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors
J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Onda, D. Li, S. Suzuki, I. Nakamura, S. Takenoshita, C.-H. Brogren, S. Stampanoni, and N. Rampino
Expansion of Microsatellite in the Thyroid Hormone Receptor-{alpha}1 Gene Linked to Increased Receptor Expression and Less Aggressive Thyroid Cancer
Clin. Cancer Res., September 1, 2002; 8(9): 2870 - 2874.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Prufer and J. Barsony
Retinoid X Receptor Dominates the Nuclear Import and Export of the Unliganded Vitamin D Receptor
Mol. Endocrinol., August 1, 2002; 16(8): 1738 - 1751.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bunn, C. F.
Right arrow Articles by Allison, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bunn, C. F.
Right arrow Articles by Allison, L. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals