| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biology (J.A.N., K.E.F., T.A.S., B.S.W., L.A.A.)
College of William and Mary Williamsburg, Virginia, 23187
Department of Zoology (C.F.B., J. M., L.A.A.) University
of Canterbury Christchurch, New Zealand 8001
| ABSTRACT |
|---|
|
|
|---|
(TR
) exhibits
a dual role as an activator or repressor of gene transcription in
response to thyroid hormone (T3). Our studies
show that TR
, formerly thought to reside solely in the nucleus
tightly bound to DNA, actually shuttles rapidly between the nucleus and
cytoplasm. The finding that TR
shuttles reveals an additional
checkpoint in receptor control of gene expression. Using
Xenopus oocyte microinjection assays, we show that there
are two coexisting mechanisms for nuclear entry of TR
. First,
nuclear import of TR
(molecular mass 46 kDa) was not
sensitive to general inhibitors of signal-mediated transport,
indicating that TR
can enter the oocyte nucleus by passive
diffusion. Second, when TR
was tagged with
glutathione-S-transferase, import of the fusion protein
(molecular mass 73 kDa) was completely blocked by these inhibitors,
demonstrating that an alternative, signal-mediated import pathway
exists for TR
. Nuclear retention of TR
in oocytes is enhanced in
the presence of T3, suggesting that more
intranuclear binding sites are available for the ligand-bound receptor.
Using mammalian cells, we show that shuttling of green fluorescent
protein (GFP)-tagged and untagged TR
is inhibited in both chilled
and energy-depleted cells, suggesting that there is an
energy-requiring step in the nuclear retention/export process. Nuclear
export of TR
is not blocked by leptomycin B, a specific inhibitor of
the export receptor CRM1, indicating that TR
does not require the
CRM1 pathway to exit the nucleus. Dominant negative mutants of TR with
defects in DNA binding and transactivation accumulate in the cytoplasm
at steady state, illustrating that even single amino acid changes in
functional domains may alter the subcellular distribution of TR. In
contrast to TR
, nuclear export of its oncogenic homolog v-ErbA is
sensitive to leptomycin B, suggesting that the oncoprotein follows a
CRM1-mediated export pathway. Acquisition of altered nuclear export
capabilities may contribute to the oncogenic properties of v-ErbA. | INTRODUCTION |
|---|
|
|
|---|
1, TRß1, and TRß2, exhibit similar ligand-dependent regulation
of gene activity, whereas a fourth isoform, TR
2, produced by
differential splicing of the TR
primary transcript, lacks the
ligand-binding and transactivation domains (1). In addition,
v-erbA, a mutated viral derivative of the cellular
locus encoding TR
1 (c-erbA
), has acquired oncogenic
properties. The v-ErbA oncoprotein is unable to bind ligand and acts as
a constitutive dominant repressor of transcription regulated by TR in
mammalian and avian cells (2).
Most members of the nuclear receptor superfamily require ligand binding
for functional activity. For example, the unliganded glucocorticoid
receptor resides in the cytoplasm, while the liganded receptor
undergoes rapid nuclear translocation and promotes gene activation (3),
and, although unliganded receptors for progesterone, estrogen, and
retinoic acid are primarily intranuclear, ligand binding is required
for these receptors to interact with target genes (4, 5). TR is unusual
in that it is bound to target genes both in the presence and absence of
ligand (1). The dual role of TR as a repressor (or activator in some
cases) of specific genes in the absence of ligand and an activator (or
repressor) of these same genes in the presence of ligand implies
constitutive nuclear localization. Most studies, although limited in
their resolution, have provided evidence in favor of this restricted
subcellular distribution for TR (1, 2, 6, 7, 8, 9, 10); however, when
overexpressed, some TR
1 (11) and TRß1 (12) may localize to the
cytoplasm.
The nucleus forms a discrete compartment in eukaryotic cells. This allows gene expression to be regulated by altering the nucleocytoplasmic distribution of transcription factors in response to external stimuli. To fully understand the cellular response to T3, investigation of all levels of receptor control is essential, including mechanisms for transport of TR across the nuclear envelope and its subsequent nuclear retention.
In recent years, there has been a tremendous increase in our mechanistic understanding of how macromolecules enter and exit the nucleus. After synthesis in the cytoplasm, nuclear proteins are imported into the nucleus exclusively through large proteinaceous structures of approximately 125 MDa in size called nuclear pore complexes (NPCs) (13, 14). The majority of nuclear proteins contain a short amino acid motif called a nuclear localization signal (NLS), which interacts with soluble receptor and NPC-associated proteins in a multistep, energy-dependent import process. There is a diversity of import receptors that recognize different classes of NLS (13).
In addition to serving as a gated entry point for large proteins, the NPC also provides a passive diffusion channel for ions and metabolites and, in principle, for proteins smaller than 60 kDa (13). However, in most cases, small proteins, like larger proteins, enter the nucleus by an energy-dependent and receptor-mediated process (13, 15). There are only a few known exceptions to this general rule (16, 17, 18, 19, 20, 21). It was originally thought that the process of translocation through the central channel of the NPC was the energy-requiring step in nuclear import. Recent data suggest, however, that translocation occurs in the absence of energy and that cytoplasmic hydrolysis of GTP by Ran during receptor recycling may be the only energy-consuming event in nuclear transport (13).
A number of proteins, including steroid hormone receptors, shuttle between the cytoplasm and nucleus (3, 4, 5, 22). Nuclear export, like nuclear import, occurs by multiple pathways (13). The balance between nuclear import and export of transcription factors provides an additional level of control in the regulation of gene expression (22). For example, an NLS that is necessary for nuclear import may not be sufficient for nuclear retention of a regulatory protein, unless activation of import signals is coupled to the suppression of export signals (22, 23). Nuclear retention of shuttling proteins, and small proteins that enter and exit the nucleus by passive diffusion, may also depend upon the availability of intranuclear binding sites (3, 18, 21, 24, 25, 26).
In the present study, we explored the molecular mechanisms regulating
nuclear localization and retention of TR
1 (hereafter referred to as
TR
for simplicity). To further investigate the complexity of the
cellular response to T3, we used a complementary
approach of Xenopus oocyte microinjection and transient
transfection in conjunction with interspecies heterokaryons.
Unexpectedly, we found that nuclear import of TR
in
Xenopus oocytes can proceed by two different coexisting
mechanisms, either through a passive diffusion pathway, or a
signal-mediated process. Importantly, although TR
accumulates in the
nucleus at steady state, the receptor shuttles rapidly between the
cytoplasm and nucleus in both Xenopus oocytes and mammalian
cells. We show that two dominant negative mutants of TR, with defects
in DNA binding and transactivation, accumulate in the cytoplasm at
steady state, illustrating that even single amino acid changes in
functional domains may lead to a dramatic shift in the subcellular
distribution of TR. The oncoprotein v-ErbA, which is found in both the
cytoplasm and nucleus at steady state, is also a shuttling protein, but
in contrast to TR
and other nuclear receptors, v-ErbA follows a
CRM1-mediated export pathway.
| RESULTS |
|---|
|
|
|---|
in
Xenopus Oocytes
, we began by using
Xenopus oocyte microinjection assays. Xenopus
oocytes are well suited to addressing these questions for a number of
reasons. First, oocyte microinjection assays have contributed
significantly to advances in understanding of transcriptional
regulation by TR (27, 28), Second, since it is possible to inject
labeled proteins into the cytoplasm or nucleus of Xenopus
oocytes and manually dissect both subcellular compartments, this assay
offers the possibility of studying both nuclear import and export
processes in quantitative terms. Finally, the low levels of endogenous
TR present in oocytes are unlikely to compete with microinjected TR. TR
mRNA and TR
protein are present at all stages of oogenesis, but the
majority of maternal transcripts are not translated and are stored for
use later in embryogenesis (27, 29).
It was anticipated, based on the literature regarding TR localization
and function in avian and mammalian cells (1, 2, 6, 7, 8, 9, 10), that TR
would be entirely localized to the nucleus of Xenopus
oocytes; however, we found that microinjected TR
localized in both
the cytoplasm and nucleus. After microinjection into the oocyte
cytoplasm, only approximately 40% of in vitro-translated
35S-labeled rat TR
was localized to the oocyte
nucleus (Fig. 1
, lane 2). A successful
cytoplasmic injection was scored by the absence of a red nucleus
(colored by hemoglobin present in the reticulocyte lysate) (see
Materials and Methods). To ensure that nonsaturating
concentrations of 35S-TR
were injected, the
nucleocytoplasmic distribution of 50, 100, and 200 pg of
35S-TR
per oocyte was analyzed. No difference
was observed in the nucleocytoplasmic distribution patterns within this
range of concentrations (data not shown); thus 100 pg per oocyte were
used in subsequent experiments. To determine the optimal time at which
to perform nucleocytoplasmic transport assays, the kinetics of nuclear
import for TR
were analyzed at intervals between 2 h and
12 h (data not shown). Steady state was reached at approximately
6 h post injection.
|
was not entirely
localized to the nucleus is that fewer intranuclear binding sites are
available for rat TR
in Xenopus oocytes. To rule out the
possibility that our use of a heterologous assay was skewing the
localization pattern, we also analyzed the nucleocytoplasmic
distribution of cytoplasmically injected
35S-labeled Xenopus TR
(Fig. 1
Since TR is not entirely localized to the nucleus in Xenopus
oocytes, these large cells provide an excellent system for
reconstituting regulatory networks affecting nuclear retention of
TR
. We thus sought to determine whether the nucleocytoplasmic
distribution pattern differs between liganded and unliganded receptor.
No detectable levels of T3 are present in
Xenopus oocytes (27). In the absence of
T3, on average 39% of cytoplasmically injected
35S-TR
was localized to the oocyte nucleus
(Table 1
and Fig. 2A
). In the presence of
T3, the amount of 35S-TR
localized to the nucleus after cytoplasmic injection increased
significantly to 51% (P < 0.001, Table 1
; Fig. 2A
, compare lanes 12 with 34). Ligand-enhanced nuclear retention was
also observed for nuclear-injected 35S-TR
; in
the absence of T3, only 62% of TR
was
retained in the nucleus, compared with 85% retention in the presence
of T3 (P < 0.001, Table 1
; Fig. 2A
, compare lanes 56 with 78). A successful nuclear injection was
scored by the presence of a red nucleus (colored by hemoglobin present
in the reticulocyte lysate) (see Materials and Methods).
This significant increase in the amount of
35S-TR
localized to the nucleus in the
presence of ligand suggested that a greater number of intranuclear
binding sites is available for interaction with
T3-bound receptor.
|
|
distribution was attributable to
hormone binding, rather than a nonspecific effect, oocytes were
cytoplasmically injected with 35S-labeled
ribosomal protein L5, and nuclear localization was assayed in the
presence or absence of T3. As expected,
incubation in T3 did not result in an increase in
the amount of 35S-labeled ribosomal protein L5
localized to the oocyte nucleus (Fig. 2B
is a specific effect, attributable to ligand
binding.
|
Can Occur by Passive Diffusion in
Xenopus Oocytes
occurs,
several criteria for distinguishing passive diffusion from
signal-mediated import were assessed (13): 1) Is TR
import energy-
and temperature-dependent or independent? 2) Is TR
import inhibited
by wheat germ agglutinin (WGA), a lectin that binds to NPC proteins,
thereby inhibiting signal-mediated nuclear import without affecting
passive diffusion? 3) Is TR
import competed by excess NLS-bearing
substrates? Competition would indicate that nuclear entry shares
saturable components with a certain NLS receptor-mediated pathway.
First, we tested whether nuclear import of TR
in Xenopus
oocytes is temperature-dependent. Surprisingly, import of in
vitro-generated 35S-TR
was not inhibited
in chilled oocytes (P > 0.1, Table 1
; Fig. 3A
, compare lanes 12 with 34),
suggesting that TR can enter the oocyte nucleus by passive diffusion
through the NPCs. A possible alternative explanation for these findings
is that partitioning of TR to the nuclear fraction represents TR bound
to the cytoplasmic face of the NPC, but unable to carry out the second,
temperature-dependent step of signal-mediated translocation through the
NPC into the interior of the nucleus (30). To ensure that
35S-TR
had, in fact, accumulated within the
interior of the nucleus in chilled oocytes, isolated nuclei were washed
extensively with 1% Triton X-100 to release any proteins associated
with the outer nuclear membrane. Amounts of
35S-TR
extracted from nuclei of either chilled
or warm oocytes dissected in the presence of detergent were comparable
to those from nuclei dissected in the absence of detergent (data not
shown). These observations suggest that, in both chilled and warm
oocytes, the majority of 35S-TR
is located in
the interior of the nucleus and that 35S-TR
does not accumulate at the cytoplasmic face of the NPCs.
|
A passive diffusion mechanism of TR
import is further supported by
our next finding that import is energy-independent. In oocytes treated
with apyrase, which depletes cellular ATP (and GTP), import of TR
was not significantly inhibited (P > 0.1, Table 1
;
Fig. 3B
, compare lanes 12 with 34). In contrast, import of the
control protein, ribosomal protein L5, was significantly inhibited
(P < 0.001, Table 2
; Fig. 3B
, compare lanes 6 and
8).
Treatment with apyrase does not distinguish between a requirement for
ATP vs. GTP hydrolysis during nuclear import. In most cases
studied so far, signal-mediated protein import is functionally linked
to the Ran-GTPase cycle (13); however, there are exceptions. For
example, nuclear import of the U1A and U2B'' spliceosome proteins
requires ATP hydrolysis, but is Ran-independent (33). Similarly,
nuclear import of I
B
(inhibitor of
B
) occurs by an
ATP-dependent and Ran-independent pathway (34). Typically, to
distinguish between ATP-dependent and GTP-dependent import pathways,
nonhydrolyzable NTP analogs are tested for their ability to support
import. However, these analogs are highly toxic to oocytes, resulting
in irreversible changes in cell morphology and rapid mortality (35).
Thus, to indirectly test whether TR
nuclear import is functionally
linked to GTP hydrolysis, we assessed the effect of perturbation
of the Ran-GTP-ase system. For this purpose we used both wild-type
Ran and a mutated derivative in which the glutamine at position 69 has
been substituted for leucine (RanQ69L) (36). Because this mutant is
deficient for GTP hydrolysis activity, import processes that are either
linked to, or dependent on, Ran-mediated GTP hydrolysis should be
inhibited by the addition of RanQ69L. Both wild-type Ran and mutant Ran
can be microinjected into Xenopus oocytes without subsequent
loss of viability (37).
The import potential of TR
was determined after cytoplasmic
injection of 35S-TR
together with wild-type
Ran or RanQ69L. Neither excess wild-type Ran nor RanQ69L had a
significant effect on 35S-TR
import
(P > 0.1, Table 1
; Fig. 3C
, compare lanes 12 and
34), suggesting that TR
import does not require Ran-mediated GTP
hydrolysis. In contrast, nuclear import of
35S-labeled ribosomal protein L5 was inhibited to
a significant degree in the presence of RanQ69L (P <
0.01, Table 2
; Fig. 3C
, compare lanes 6 and 8). The findings for L5 are
consistent with the observation that complex formation of this small
ribosomal protein with import receptors is strongly inhibited in the
presence of RanQ69L (32).
Next we assessed whether specific interaction with the NPC is required
for nuclear import of TR
, by testing for sensitivity to WGA. WGA
binds to N-acetylglucosamine-containing proteins present in
the NPCs and inhibits signal-mediated import. Passive diffusion is not
inhibited, since WGA does not physically occlude the nuclear pores
(31). TR
import was not significantly inhibited in oocytes
preinjected with WGA (P > 0.1, Table 1
; Fig. 3D
, compare lanes 2 and 4). As expected for a protein imported via a
NPC-mediated pathway, ribosomal protein L5 import was significantly
inhibited in oocytes preinjected with WGA (P < 0.001,
Table 2
; Fig. 3D
, compare lanes 6 and 8). WGA inhibition reduced the
percentage of nuclear L5 from 33% to 5%; a similar reduction to 4%
was observed for energy depletion assays.
Signal-mediated transport pathways are saturable; thus, as an
additional criterion for characterizing the import pathway of TR
,
competition assays with histone H1 and ribosomal protein L5 were
performed. The rationale for these competition experiments is that
import kinetics of TR
would be at a reduced level if histone H1 (15)
or L5 (31, 32), acting as direct competitors of signal-mediated
processes, were imported by the same mechanisms as TR
. Such a
reduction would be indicative of competition for shared transport
factors. Members of the importin ß superfamily of transport receptors
account for all interactions with the NPC required for passage into the
nucleus. In some cases, importin ß-type receptors need an adapter
molecule to interact with NLS-bearing cargo (13). For example, import
of proteins that carry a classical NLS is mediated by an importin
/importin ß heterodimer, whereas histone H1 is imported by an
importin 7/importin ß heterodimer (13, 15). Thus, even if a different
adapter is used, competitor cargo may still compete for use of importin
ß and docking sites at the NPC.
To ascertain histone H1 concentrations at which inhibition of
signal-mediated transport occurred, 35S-labeled
ribosomal protein L5 was competed against excess histone H1 at two
intracellular concentrations. Both low and high concentrations of
histone H1 were shown to inhibit the nuclear import of
35S-L5 (P < 0.001, Table 2
; Fig. 3E
, compare lanes 14, 16, and 18). In contrast,
35S-TR
import was not inhibited by coinjection
with histone H1, at either low or high intracellular concentrations
(P > 0.1, Table 1
; Fig. 3E
, compare lanes 2, 4, and
6).
Nuclear import of 35S-labeled ribosomal
protein L5 was inhibited by equimolar amounts of unlabeled L5
(P < 0.001, Table 2
; Fig. 3E
, compare lanes 20 and
22). In contrast, coinjection with 35S-labeled
ribosomal protein L5 did not lead to an alteration in the
nucleocytoplasmic distribution of 35S-TR
(P > 0.1, Table 1
; Fig. 3E
, compare lanes 8 and 10).
The lack of competition observed with TR
by ribosomal protein L5
suggests that independent mechanisms of transport are in operation for
these two proteins. This is of particular interest since the NLS of
ribosomal protein L5 is able to interact directly with multiple import
receptors, including importin
, importin ß, transportin, importin
5 (RanBP5), and importin 7 (RanBP7) (32, 38).
In summary, we have shown that 35S-TR
import
in Xenopus oocytes is temperature- and energy-independent
and is not blocked by the dominant negative RanQ69L protein, WGA, or
the presence of excess NLS-bearing substrates. This lack of sensitivity
to general inhibitors of signal-mediated import is consistent with a
passive diffusion mechanism for nuclear entry of TR
.
Nuclear Retention of TR
Is Temperature Dependent in
Xenopus Oocytes
By definition, the steady state levels attained by passive
diffusion would be expected to be equal in both directions through the
NPC; however, we observed differences in the percentage of TR
in the
nucleus after cytoplasmic vs. nuclear injection (Table 1
and
Fig. 2A
), suggesting a more complex scenario. Thus, having shown that
nuclear import of TR
can occur by simple diffusion in
Xenopus oocytes, we next sought to ascertain whether nuclear
export of TR
also can follow a passive diffusion pathway. To this
end, export competence of nuclear-injected
35S-TR
was assessed in chilled oocytes.
Nuclear retention of TR
was significantly increased by chilling:
86% of TR
was retained in the nucleus of chilled oocytes, compared
with 62% in oocytes at physiological temperature (P <
0.001, Table 1
; Fig. 4
, compare lanes
34 with 56). Lastly, nuclear retention of the control protein,
ribosomal protein L5, was also increased by low-temperature incubations
(P < 0.001, Table 2
; Fig. 4
, compare lanes 910 with
1112). In summary, these data suggest that there is a
temperature-dependent step in the nuclear export/retention pathway of
TR
.
|
in
Xenopus Oocytes
translocation through the
NPC in Xenopus oocytes. Thus, we next asked the question
whether alternative pathways for nuclear import of TR exist. We tested
whether import of TR
tagged with
glutathione-S-transferase (GST) is sensitive to transport
inhibitors. GST-TR
interacts specifically with target DNA sequences
in an electrophoretic gel mobility shift assay (data not shown),
suggesting that the tag does not interfere with DNA binding. The
GST-TR
fusion protein was used because this molecule should be too
large (molecular mass 73 kDa) to enter the nucleus by passive
diffusion. When a similar experiment was performed with GST-tagged
catalytic subunit of cAMP-dependent protein kinase, the fusion protein
was restricted to the cytoplasm while the wild-type subunit freely
diffused through the NPC (16).
First, we showed by Western blot analysis that GST alone remains
localized exclusively in the oocyte cytoplasm after cytoplasmic
injection (Fig. 5A
). When fused to TR
,
however, the full-length fusion protein accumulated in the oocyte
nucleus after cytoplasmic injection (Fig. 5B
, lane 5). Four predominant
bands were present in the injectate, including full-length GST-TR
(73 kDa) and three degradation products (Fig. 5B
, lane 1).
Interestingly, the largest degradation product present in the sample of
injected GST-TR
did not localize to the nucleus (Fig. 5B
, compare
lanes 4 and 5). When Western blots were probed with an antibody
specific for the extreme C terminus of TR
, this band was not
recognized by the antibody, suggesting that the shorter fusion protein
lacks the C-terminal sequence of TR
(data not shown). This
degradation product served as a convenient internal control for the
site of injection and for fractionation.
|
was inhibited in chilled
oocytes (
75% inhibition, n = 4), with transport competence
restored by subsequent incubation at 20 C (Fig. 5C
import by inhibiting the activity of specific components of the
transport machinery, rather than by preventing import by way of
nonspecific cellular damage. Import was completely inhibited by
treatment with apyrase to deplete cellular ATP (n = 3; Fig. 5D
65% inhibition, n = 4; Fig. 5E
35% inhibition, n = 6; Fig. 5F
, nuclear accumulation of
the GST-TR
fusion protein was not significantly enhanced in the
presence of T3 (
10% increase, n = 3;
Fig. 3G
binds T3 with the same affinity as the
native receptor.
Interestingly, nuclear import of GST-TR
was not inhibited in the
presence of RanQ69L (data not shown). It is possible that in these
assays, RanQ69L was not injected at high enough concentrations to
out-compete endogenous Ran. Alternatively, GST-TR
may follow an
ATP-dependent, Ran-independent nuclear import pathway; or, since GTP
hydrolysis by Ran is not required for passage of cargo into the nucleus
(39), GST-TR
may have undergone one round of import and then been
trapped in the nucleus, yielding a distribution similar to the pattern
achieved by nucleocytoplasmic shuttling of TR. Further experimentation
under defined conditions (i.e. in vitro nuclear
import assays using permeabilized mammalian cells) will be required to
distinguish between these possibilities.
In summary, these findings show that TR
has the necessary sequence
information for nuclear targeting of a fusion protein that is too large
to enter the nucleus by passive diffusion. Import of the GST-TR
fusion protein was temperature and energy-dependent, and blocked by WGA
and competitor NLS-bearing substrate. This sensitivity to general
inhibitors of signal-mediated import is consistent with a
signal-mediated mechanism for nuclear entry of GST-TR
. Taken
together with the results described in the preceding sections, these
data suggest that a signal-mediated import pathway, although not
absolutely necessary, contributes to nuclear entry of normal TR
in
Xenopus oocytes.
Nuclear Localization of Green Fluorescent Protein (GFP)-Tagged
TR
in Mammalian Cells
Our finding that TR
can undergo nucleocytoplasmic shuttling in
Xenopus oocytes was intriguing but could be interpreted as
simply an unusual species- or cell-specific difference. To follow up on
these observations, we investigated the nucleocytoplasmic distribution
of GFP-tagged TR
in transfected mammalian
cells.
GFP has been effectively used as a tag to investigate transport and
localization of a variety of proteins, including the nuclear receptors
for glucocorticoids (40), estrogen (41), androgen (42), and
mineralocorticoids (43), and, while this study was underway, one of the
other major isoforms of the thyroid hormone receptor, TRß1
(12). To ensure that the GFP tag did not significantly alter the
functional characteristics of TR
, we evaluated the DNA binding,
transactivation, and nucleocytoplasmic distribution characteristics of
GFP-TR
.
First, we showed by electrophoretic gel mobility shift assay that
GFP-TR
interacts specifically with target DNA sequences,
demonstrating that the tags do not interfere with DNA binding (data not
shown). Second, we examined the transcriptional activity of GFP-TR
in transfected COS-1 cells, using a CAT reporter system under control
of a TRE (Fig. 6
). The levels of CAT
protein produced were lower for ligand-dependent reporter activation by
GFP-TR
compared with untagged TR
; however, it is not possible to
make a direct comparison between the two assays. Untagged TR
and
GFP-TR
constructs are under control of different promoters (Rous
sarcoma virus and cytomegalovirus, respectively); thus a difference in
the levels of CAT protein may simply reflect lower levels of expression
of GFP-TR
compared with untagged TR
. Importantly, what we did
demonstrate is that GFP-TR
, like native (untagged) TR
, stimulates
transcription from a TRE-CAT reporter construct in the presence of
T3 (Fig. 6
).
|
in
both living cells and fixed specimens. In contrast to the distribution
of TR
in Xenopus oocytes, GFP-TR
appears to localize
entirely to the nucleus in mouse cells (Fig. 7
is
distributed diffusely throughout the nucleus in both live (Fig. 7A
in living cells was observed in response to
treatment with ligand; complete localization to the nucleus was
maintained in the presence or absence of T3
concentrations ranging from 10-9
M to 10-3
M (Fig. 7A
,
GFP was distributed throughout the cell (Fig. 7C
are thus comparable to those
described in the literature for native TR
(6, 7, 8, 9, 10). Taken together
with our finding that GFP-TR
is transcriptionally competent and
hormone responsive, we can therefore conclude that GFP-TR
is a valid
probe to study the subcellular trafficking of
TR
.
|
|
appears to be
exclusively nuclear in NIH/3T3 cells, it is possible to examine nuclear
export characteristics, but not nuclear import by this type of assay.
To determine whether nuclear retention of GFP-TR
was temperature-
and energy-dependent, cells were incubated under chilled and
energy-depleted conditions for 34 h, in the presence of cycloheximide
to prevent de novo protein synthesis. Under these
conditions, in the majority of cells GFP-TR
remained entirely
localized to the nucleus (Fig. 7
GFP-Tagged TR
and Native TR
Undergo Nucleocytoplasmic
Shuttling in Mammalian Cells
Although it is well established that nuclear receptors for steroid
hormones undergo nucleocytoplasmic shuttling (3, 4, 5, 40, 42), it is not
known whether all nuclear receptors for nonsteroid hormones share this
property. The dual role of TR as a repressor of specific genes in the
absence of ligand and an activator of these same genes in the presence
of ligand had led to the view that TR is exclusively in the nucleus and
is a stable constituent of chromatin (2). Having validated the use of
GFP-tagged TR
as a probe and having completed analysis of receptor
localization in single cells, we returned to our primary question: can
TR
shuttle in mammalian cells? To this end, we used a very powerful
and elegant methoda transient transfection interspecies heterokaryon
assay (44). The strength of this method lies in its sensitivity; it is
possible to detect rapid nucleocytoplasmic shuttling of proteins that
by other methods would appear to be retained in the nucleus at all
times (Fig. 8A
).
|
(Fig. 8B
(Fig. 8B
and untagged TR
appeared to distribute diffusely
throughout the nucleus. In nuclei with less intense fluorescence, the
receptor appeared to be excluded from nucleoli. Only exogenous TR
expressed in successfully transfected mouse cells was stained with the
anti-TR
antibody; neither cell line contains detectable levels of
endogenous TR
(Fig. 8B
GFP-TR
(molecular mass 76 kDa) is above the size limits for passive
diffusion. Thus, the possibility exists that, in the single-cell
analysis described in the previous section, GFP-TR
was retained in
the nucleus, while the smaller untagged receptor would have been
capable of nuclear export by simple diffusion. To investigate the
overall mechanism for nucleocytoplasmic shuttling, we performed
heterokaryon assays under conditions that would permit passive
diffusion but inhibit active transport processes. In both chilled and
energy-depleted cells, neither GFP-TR
nor untagged TR
accumulated
in the human nuclei in heterokaryons (Fig. 9
). Chilled and energy-depleted
heterokaryons appeared smaller, slightly rounded up, and the actin
filaments were less distinct (Fig. 9
). Since an extended period of
chilling or energy depletion (>90 min) had detrimental effects on
heterokaryon viability (data not shown), we limited our analyses to
periods of 6090 min. Conceivably, this time frame may be insufficient
to reveal relatively slow nuclear export. However, we feel this is
unlikely since shuttling occurs rapidly under physiological conditions
(within 1 h). Furthermore, in single-cell analyses in which
prolonged treatment was possible, after 4 h of energy depletion or
chilling no cytoplasmic accumulation of TR
was observed (Fig. 7
).
Inhibition of TR
shuttling suggests that release from intranuclear
binding sites is temperature- and energy-dependent and/or export occurs
by a signal-mediated process. These findings are consistent with our
results in Xenopus oocytes, where nuclear retention of
microinjected TR
also was shown to be temperature-dependent.
|
in Xenopus oocytes as shown in the
present study, and in CV1 cells overexpressing GFP-TRß1 (12), it was
of interest to determine whether the presence or absence of ligand
would influence the direction and extent of nucleocytoplasmic shuttling
of TR
in heterokaryons. We showed, however, that there was no
apparent difference in the rapidity or extent of nuclear export from
mouse nuclei and import into human nuclei in heterokaryons: shuttling
of GFP-TR
and untagged TR
occurred in the presence and absence of
T3 (Fig. 9
In summary, our data from mammalian cell studies show that TR
accumulates in the nucleus at steady state but, surprisingly, the
receptor shuttles rapidly between the nucleus and cytoplasm. Shuttling
of TR
is energy- and temperature-dependent, but apparently not
ligand-dependent. These findings reveal an additional checkpoint in
control of gene expression by TR
and pave the way for future studies
on the role of nucleocytoplasmic shuttling in gene regulation.
Nuclear Export of TR
Is Not Mediated by the Export Receptor
CRM1
To begin to elucidate the mechanism for TR
shuttling, we sought
to ascertain whether TR nuclear export is facilitated by the export
receptor CRM1 (13). For this purpose, we prepared heterokaryons by
fusing mouse cells transfected with GFP-TR
with untransfected human
cells. Subsequently, heterokaryons were treated with the CRM1-specific
inhibitor, leptomycin B (3, 45, 46). In both the presence and absence
of leptomycin B, GFP-TR
rapidly accumulated in the human nuclei in
heterokaryons (Fig. 10
, upper
left panels), suggesting that TR
does not require the CRM1
pathway to exit the nucleus.
|
Dominant Negative Mutants of TR Have Altered Subcellular
Distribution Patterns
To further investigate the shuttling and nuclear retention
properties of TR, we assessed the relative importance of DNA-binding
and transactivation domains on the nucleocytoplasmic distribution
pattern of TR. For this purpose, we employed three dominant negative
mutants of TR: C122A, G121A, and v-ErbA. C122A is a synthetic
DNA-binding deficient mutant of TRß. In this mutant, alanine was
substituted for the coordinating cysteine at residue 122 in the
recognition
-helix of the first zinc finger in the DNA-binding
domain (27, 48). In G121A, another synthetic mutant derived from TRß,
alanine was substituted for glycine at residue 121 of the first zinc
finger. The G121A mutant is able to bind DNA but is defective in
transcriptional activation activity (48). Due to an N-terminal fusion
with retroviral gag sequences, v-ErbA, the viral oncogenic homolog of
TR
, lacks the first 12 amino acids of TR
. In addition, the viral
protein lacks nine amino acids close to the C terminus and has 13 amino
acid changes: 2 in the DNA-binding domain and the other 11 distributed
along the molecule in the hinge region (domain D) and ligand-binding
domain (2, 49). The oncoprotein is unable to bind ligand and acts as a
constitutive repressor of transcription regulated by TR.
In transient transfection assays in NIH/3T3 cells, both untagged and
GFP-tagged DNA-binding mutant C122A and transactivation mutant G121A
show either diffuse whole cell staining at steady state, or exclusion
from the nucleus with punctate cytoplasmic foci or discrete aggregates
particularly around the nuclear periphery (Fig. 10
, lower left
panels, and data not shown). Interestingly, these distribution
patterns are very similar to the patterns described for a TR
mutant
in which the entire D domain was deleted (8). The subcellular
distribution of the virally derived oncogenic homolog of TR
was
similar to the distribution pattern of the synthetic mutants tested.
GFP-tagged and untagged v-ErbA localized both in the nucleus and the
cytoplasm, showing either diffuse whole cell staining or a distinct
punctate nucleocytoplasmic distribution at steady state (Fig. 10
, lower right panels, and data not shown). These observations
for GFP-v-ErbA are in agreement with previous studies of the
distribution of native v-ErbA in transfected cells, in which the
oncoprotein also was detected in both the nucleus and cytoplasm (9, 50). Similarly, in Xenopus oocytes,
35S-labeled C122A and v-ErbA both showed a
nucleocytoplasmic distribution; approximately 40% of C122A and 20% of
v-ErbA accumulated in the nucleus after cytoplasmic microinjection
(data not shown).
In summary, the data presented here show that even single amino acid changes in functional domains of TR may lead to a dramatic shift in the balance between nuclear retention and cytoplasmic accumulation. These findings highlight the importance of DNA-binding and transcriptional activation activity in nuclear localization of TR.
Nuclear Export of the Oncoprotein v-ErbA is CRM1-Dependent
To follow up on our observation that nuclear export of TR
is
leptomycin B-insensitive, we tested the effect of the drug on the
subcellular distribution of the TR mutants described in the preceding
section, using single-cell analysis. There was no change in the
nucleocytoplasmic distribution of TRß mutants G121A and C122A after
treatment with leptomycin B (Fig. 10
, lower left panels),
suggesting that the transactivation mutant and the DNA-binding mutant
do not require the CRM1 pathway to exit the nucleus.
In contrast, nuclear export of both untagged and GFP-tagged v-ErbA was
sensitive to leptomycin B (Fig. 10
, lower right panels, and
data not shown). In control cells, the oncoprotein v-ErbA is
distributed in both the nuclear and cytoplasmic compartments; however,
in cells treated with leptomycin B there was a dramatic shift in the
distribution pattern. Upon treatment with the CRM1-specific inhibitor,
v-ErbA was entirely localized to the nucleus in 100% of transfected
cells (Fig. 10
, lower right panels), suggesting that the
oncoprotein was imported into the nucleus and subsequently trapped in
the nuclear interior by the block to the export pathway. These striking
findings demonstrate that not only is v-ErbA a shuttling protein but,
in contrast to TR
and other nuclear receptors, v-ErbA follows a
CRM1-mediated export pathway.
| DISCUSSION |
|---|
|
|
|---|
. Our
data provide new insights into the molecular mechanisms regulating
nuclear localization and retention of TR
. We find that nuclear
import of TR
proceeds by one of two coexisting mechanisms in
Xenopus oocytes, a passive diffusion pathway or
signal-mediated translocation through the NPC. We have also determined
that, although TR
accumulates in the nucleus at steady state, the
receptor can shuttle rapidly between the cytoplasm and nucleus in both
Xenopus oocytes and mammalian cells. Although there is an
energy-requiring step in the nuclear retention/export pathway, nuclear
export of TR
is not mediated by the export receptor CRM1. Dominant
negative variants of TR do not accumulate in the nucleus at steady
state, highlighting the importance of intact DNA-binding,
hormone-binding, and transactivation domains for nuclear retention. The
oncoprotein v-ErbA has acquired the ability to follow a CRM1-mediated
pathway, suggesting that acquisition of altered nuclear export
capabilities has contributed to the oncogenic conversion of TR
.
Alternative Pathways for Nuclear Import
We showed, by the following three lines of evidence, that nuclear
import of 35S-labeled TR
in Xenopus
oocytes can occur by simple passive diffusion: 1) import was energy
and temperature-independent; 2) import was not inhibited by WGA; 3)
import was not competed by excess NLS-bearing substrates, indicating
that TR nuclear entry does not share saturable components with certain
NLS receptor-mediated pathways. Some exceptions to the typical
signal-mediated pathway for nuclear entry have been reported. For
example, calmodulin (CaM) appears to be imported by simple diffusion,
with CaM-binding proteins in the nucleus acting as a sink for nuclear
retention of CaM upon an increase in intracellular free
Ca2+ (21); nuclear accumulation of the U1
snRNP-specific protein C is due to diffusion and retention in the
nucleus upon incorporation of the protein into the U1 snRNP (18); and,
import characteristics of the free catalytic subunit of cAMP-dependent
protein kinase are consistent with simple diffusion (16).
With our subsequent observation that nuclear retention of untagged
TR
in both Xenopus oocytes and transfected mammalian
cells was temperature-dependent, it became apparent that simple
diffusion was not sufficient to explain all aspects of TR
translocation through the NPC. This finding suggested that a
signal-mediated pathway is followed for transport out of the nucleus
and/or that release from intranuclear binding sites is an active
process. Different energy requirements for bidirectional transport
across the nuclear envelope have been reported for steroid hormone
receptors. For this case, import is temperature- and energy-dependent,
while export is not inhibited by energy depletion or chilling (46, 51).
Before export, however, the glucocorticoid receptor must be released
from association with the nuclear matrix, and this step in the nuclear
export pathway is energy-dependent (51).
Finally, we showed that nuclear import of a GST-TR
fusion protein in
Xenopus oocytes is sensitive to transport inhibitors,
suggesting that an alternative signal-mediated import pathway can be
followed by TR
. There is precedence for such alternative import
pathways. A recent report shows that there are two coexisting
mechanisms for nuclear entry of mitogen-activated protein kinase (MAPK)
(45 kDa): one is passive diffusion and the other is active transport,
the latter being dependent upon the formation of a MAPK dimer (20). It
is possible that the signal-mediated import mechanism is required for
rapid nuclear translocation (20). TR
is known to carry out its
function primarily as a heterodimer, in association with the retinoid X
receptor
(RXR
) both in vitro and in vivo
(1, 2). It is possible that, similar to MAPK, RXR
/TR
heterodimers
or TR
/TR
homodimers are formed predominantly in the cytoplasm
and, since they are too large for passive diffusion, are imported by a
regulated, signal-mediated pathway. In this model, since the two
pathways coexist, TR
monomers could utilize either an active or
passive mode of nuclear entry. The inter-oocyte variability in response
to general inhibitors of signal-mediated transport (see Table 1
) may
reflect partial inhibition of TR
nuclear accumulation due to the
general inhibitors blocking access to the signal-mediated pathway.
In addition to heterodimerization with RXR
, TR
also interacts
with histone deacetylases and corepressors such as N-CoR (nuclear
receptor corepressor) and SMRT (silencing mediator for retinoid and
thyroid hormone receptors) in the absence of T3,
and coactivators such as members of the p160 family and p300/CBP in the
presence of T3 (1, 28). It will be of interest to
determine whether binding of TR to transcriptional corepressors and
coactivators, and subsequent interaction of TR with the chromatin
infrastructure, are important determinants for the mode of nuclear
import, and the nuclear retention and shuttling characteristics of
TR.
It remains to be determined whether alternative import pathways are
available in mammalian cells. Given that GFP-TR
enters mammalian
cell nuclei, we can conclude that a signal-mediated pathway is
followed, since the fusion protein is above the size limits for
diffusion. However, fusion protein import could occur by facilitated
diffusion, which requires interactions with the NPC, but is
energy-independent (13). Since both untagged and GFP-tagged TR
rapidly accumulate in the nucleus at steady state and export is
temperature- and energy-dependent, there was no detectable cytoplasmic
population of TR
before, during, or after chilling or
energy-depletion experiments. Therefore, it was not possible to
determine the general mechanism of nuclear import using single-cell or
heterokaryon transient transfection assays. Studies using alternative
approaches to investigate the nuclear import pathway followed by TR
in mammalian cells are underway. In summary, data presented here
suggest that a signal-mediated import pathway, although not absolutely
necessary, contributes to nuclear entry of normal TR
.
Nuclear Localization and Nuclear Retention Sequences in TR
A temperature- and energy-dependent import pathway for TR implies
a receptor-mediated process, which would be expected to require a
specific NLS. Other research groups have attempted to define a NLS for
TR, but direct proof of nuclear localization domains has been difficult
to unambiguously establish since other functional activities, such as
DNA and ligand-binding and protein-protein interactions can also be
impaired by structural modifications (the present study and Refs. 8, 11, 50, 52, 53, 54).
The length and primary structure of domain D (hinge region) between the
DNA-binding domain (domain C) and ligand-binding domain (domain E) are
conserved in all TR isoforms, suggesting that the integrity of this
domain is important for receptor function. A highly basic amino acid
sequence in domain D can inefficiently target a proportion of a 250-kDa
cytoplasmic protein (pyruvate kinase) to the nucleus, but is not
sufficient for complete nuclear localization and retention (52).
Further evidence of the importance of the D domain in nuclear targeting
comes from mutational analysis (8, 12, 50). For example, when sequences
in this region were mutated in TR
(8) or in a GFP-TRß fusion
protein (12), the mutant receptors were detected in both the nucleus
and cytoplasm. However, some of the D domain mutants tested, in
addition to being defective in nuclear import, also showed very weak
DNA-binding activity and had lost ligand-binding activity, despite the
DNA and ligand-binding domains being unaltered (8, 50). Recently, a
sequence in the D domain (hinge region) C-terminal of the basic region
was shown to be critical for interaction with the corepressor N-CoR
(53). Although the D domain sequence motif is apparently necessary for
nuclear localization, it is not sufficient for exclusive nuclear
localization and nuclear retention and is only one of the factors
involved in determining the final subcellular distribution of TR.
Data presented here further indicate the importance of the first zinc
finger in the DNA-binding domain for nuclear retention of TR. Studies
of the DNA-binding mutant C122A and the mutant G121A, which binds DNA
but is defective in transcriptional activation activity, emphasize that
even single amino acid changes in functional domains of TR may lead to
a striking shift in the balance between nuclear retention and
cytoplasmic accumulation. Our findings highlight the complexity of the
nuclear retention signals present in TR: the ability to bind DNA is not
sufficient for nuclear retention of TR, but a DNA-binding mutant is not
entirely excluded from the nucleus. A degradation product of GST-TR
that is apparently lacking the extreme C-terminal region of TR was
excluded from the oocyte nucleus in microinjection assays, suggesting
that the C-terminal domain of TR, which plays a role in transcriptional
silencing (55), may also be required for nuclear accumulation. Adding
to the complexity, an N-terminal domain of TR
, absent in the
oncoprotein v-ErbA, has also been implicated in directing exclusive
nuclear localization, as shown in the present study and in a previous
report (9).
TR belongs to a receptor superfamily of ancient origins, which includes receptors for steroid hormones, retinoids, and vitamin D (1, 56). Members of the superfamily have a modular organization, making it interesting to speculate that a NLS module evolved in large nuclear receptors and is a dispensable evolutionary remnant in the relatively small TR. More important than the NLS module may be functional domains of TR that promote nuclear retention, including sequences within the N terminus, the DNA-binding domain, the hinge region (D domain), the ligand-binding domain, and the extreme C terminus.
Ligand-Enhanced Nuclear Localization
Two lines of evidence suggest that TR function may, in part, be
regulated by T3-induced nuclear import. First,
the present results show that in Xenopus oocytes nuclear
localization and retention of 35S-labeled TR
are enhanced in the presence of ligand. Second, a recent study of
TRß1, one of the other major isoforms of TR, showed that a GFP-TRß1
fusion protein was predominantly localized to the nucleus in
transfected mammalian cells in the presence of
T3, but in the absence of
T3 some receptor localized to the cytoplasm (12).
In the latter study, hormone-induced nuclear import in living cells was
visualized using laser scanning confocal microscopy. Taken together,
these findings provide support for a model in which the direction of
shuttling is ligand-dependent. Hormone binding may allow receptor
molecules to associate with additional intranuclear binding sites. The
increased affinity for these sites may be due to the alteration in
receptor conformation induced by ligand binding (1).
In our studies in mammalian cells, the absence of ligand did not
affect the localization of untagged or GFP-tagged TR
, and had
no apparent effect on the direction or extent of nucleocytoplasmic
shuttling of TR
in heterokaryons. It is not entirely apparent why
our data for GFP-tagged rat TR
differ from the report of Zhu
et al. (12) for GFP-tagged human placenta TRß1. In
addition to utilizing a different TR isoform, their study differs from
ours in numerous methodological details, including the cell type used
(CV1, African green monkey kidney fibroblasts) and the use of confocal
microscopy. Time-lapse confocal microscopy of living cells and higher
resolution studies may reveal ligand-dependent effects on shuttling and
subnuclear trafficking that are not apparent by conventional
microscopy. For example, GFP-tagged estrogen receptor shows a change
from a reticular pattern evenly distributed throughout the nucleus to a
punctate and highly structured distribution in the nucleus in the
presence of ligand (41), and ligand-bound glucocorticoid and
mineralocorticoid receptors are localized in discrete subnuclear
compartments (5, 57). A recent report has shown that in the absence of
hormone, untagged TRß1 is located exclusively in the nucleus of CV1
cells in a homogenous staining pattern, while in the presence of
hormone a significant proportion of TR appears to be reorganized into a
nuclear dot pattern (10).
TR
Is a Shuttling Protein
Our studies reveal that TR
, formerly thought to reside solely
in the nucleus tightly bound to chromatin, actually undergoes rapid
nucleocytoplasmic shuttling. A number of cellular and viral proteins
are known to shuttle continuously between the nucleus and the
cytoplasm. These include, but are not limited to, certain hnRNP and
other mRNA-binding proteins (13), SR proteins required for mRNA
splicing (58), nucleolar proteins (59), steroid hormone receptors, such
as the progesterone receptor (46), and the glucocorticoid receptor (3),
the HIV-1 Rev protein (60), the p53 tumor suppressor (47), the hdm2
oncoprotein (61), the U1 snRNP-specific polypeptide U1A (24), and the
Engrailed homeoprotein (62).
The short residence time of TR
in the cytoplasm makes it difficult
to identify it as a shuttling protein by conventional single-cell
analysis, but in interspecies heterokaryon assays, the human nuclei act
as a trap for any TR
that appears, however transiently, in the
shared cytoplasm after export from mouse nuclei. In the heterokaryons,
an equilibrium distribution was reached quickly, such that the mouse
and human nuclei gave comparable fluorescence intensities in most
cases, by 1 h post fusion. The shuttling of TR
between the
nucleus and cytoplasm is a rapid process, comparable to rates observed
for SR proteins (58), Engrailed homeoprotein (62), and the hdm2
oncoprotein (60). In contrast, other shuttling proteins may translocate
across the nuclear envelope more slowly; for example, nucleolin does
not reach equilibrium until 72 h after fusion (59), and steroid
receptors require 412 h to reach equilibrium (46).
Shuttling also occurs in Xenopus oocytes; however, there was
a shift in the balance between nuclear import and export. Microinjected
rat and Xenopus TR
were found in both the oocyte nucleus
and cytoplasm, suggesting that nuclear retention was not as efficient
as in mammalian cells, or that nuclear import occurred more slowly.
Cytoplasmically injected 35S-labeled TR
reached a steady state nucleocytoplasmic distribution in oocytes at
approximately 6 h after microinjection, and this steady state was
maintained throughout a 12-h period. One possible explanation for this
distribution pattern is that intranuclear binding sites were saturated;
however, no difference in TR
distribution was observed when
increasing concentrations of microinjected protein were used. In
addition, when the same amount of protein was introduced into the
nuclear compartment, a greater proportion was retained in the nucleus.
This observation suggests that if cytoplasmically introduced TR
had
entered the nucleus to a greater extent than that observed, a greater
proportion of receptor would have been retained in the nucleus. As this
was not the case, our findings suggest that nuclear retention sites are
available for further binding and that nuclear accumulation was not
saturated. This conclusion is supported by our finding that in the
presence of ligand, a greater amount of TR
accumulated in the
nucleus. It is possible that a proportion of the in
vitro-translated protein was misfolded and nonfunctional and thus
remained cytoplasmic, contributing, in part, to the cytoplasmic
population observed in Xenopus oocytes even in the presence
of ligand.
The precise functions of nucleocytoplasmic shuttling are not well
understood. This process may reflect the role of shuttling proteins as
carriers for the delivery of cargo between the nucleus and cytoplasm
(e.g. mRNA), or for coordinating the activity and
degradation of cell cycle control factors, and for allowing proteins
that are primarily localized in one compartment to respond to signals
transduced by proteins present in the other compartment (13, 22).
Shuttling may also provide an additional level of control for gene
regulation. The activities of several transcription factors are
regulated by nucleocytoplasmic shuttling, thereby adding to the
specificity of the response to signaling cascades. For example, NF-
B
translocates to the nucleus after phosphorylation and degradation of
its inhibitor I
B
, a protein that is also able to shuttle between
the cytoplasm and nucleus (34); nuclear import of NF-AT4 is mediated by
the opposing actions of kinases and phosphatases (22); and stress (such
as UV and heat-shock) induces active nuclear export and exclusion of
Net, a strong repressor of transcription, through a pathway that
involves kinase activity, thus releasing genes from Net repression
(63).
The interaction of regulatory proteins with target DNA sequences may be a more dynamic process than previously believed. The classical view of steroid hormone receptors is that they bind to a recognition site and remain at that site for as long as the ligand is present. However, a recent report shows that, in fact, the glucocorticoid receptor exchanges rapidly between a hormone response element and the nucleoplasmic compartment in hormone-stimulated cells, suggesting that the receptor is continuously available for modification by secondary signaling pathways such as phosphorylation events mediated through protein kinase cascades (64). Interestingly, another recent report describes cross-talk between Stat5 (signal transducer and activation of transcription 5) and TRß1 (65). Data suggest that TRß1 can be associated with Stat5 in the cytoplasm and may be involved in Stat5 nuclear translocation. Shuttling of TR could thus serve to mediate receptor cross-talk signaling pathways between cellular compartments. Alternatively, shuttling may play a role in receptor turnover via the ubiquitin-proteosome degradation pathway (66).
Oncogenic Conversion of TR
A striking difference between TR
and its oncogenic homolog
v-ErbA is that a subpopulation of v-ErbA, but not of TR
, exists in a
cytoplasmic complex with heat shock protein 90 (hsp90) (2, 50, 67). The
significance of the association of v-ErbA with hsp90 remains unclear.
Current models for v-ErbA action (2, 28, 68) do not address the
potential contribution of differential subcellular trafficking to
dominant negative activity. Initially we thought that the distribution
of v-ErbA in both nuclear and cytoplasmic compartments represented
altered cytoplasmic and nuclear retention signals, e.g.,
association with hsp90 in the cytoplasm and altered DNA-binding
specificity of v-ErbA (2, 50, 67). However, this interpretation does
not take into account our new data showing that v-ErbA follows a
different export pathway than TR
. Nuclear export of TR
was not
affected by leptomycin B, while v-ErbA export was leptomycin
B-sensitive.
CRM1-independent nuclear export is a characteristic of TR
shared
with the steroid receptors (3, 42). Interestingly, although hormone
withdrawal leads to a rapid release of glucocorticoid receptors from
chromatin, unliganded receptors are delayed in their export. Fusion of
a heterologous leucine-rich CRM1-dependent nuclear export signal (NES)
on the glucocorticoid receptor increased the export rate,
suggesting that a strong NES can override signals present on the
glucocorticoid receptor that limit its nuclear export rate (3). The
viral oncoprotein v-ErbA has apparently acquired a relatively stronger
NES through mutation that counteracts nuclear import and retention
signals present in cellular TR
. Acquisition of this strong NES thus
may have contributed significantly to genesis of the oncogenic
properties of v-ErbA.
In summary, our studies reveal that TR
, formerly thought to reside
solely in the nucleus tightly bound to chromatin, actually undergoes
rapid nucleocytoplasmic shuttling. The challenge for the future will be
to determine the functional significance of shuttling of TR
. Further
characterization of the shuttling properties of TR
and dominant
negative variants will contribute to integrating understanding of gene
regulation at the level of DNA-protein interactions with additional
levels of control made possible by compartmentalization of eukaryotic
cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, tk-TREp-CAT, and pGEX-KG, a GST expression
vector (69), were gifts from R. Evans (Salk Institute for Biological
Studies, La Jolla, CA). RS-rTR
contains the rat TR
1 cDNA under
transcriptional control of the Rous sarcoma virus (RSV) long terminal
repeat (LTR) (27). tk-TREp-CAT contains a synthetic
palindromic thyroid hormone-responsive element (TRE) linked to a herpes
simplex virus thymidine kinase (tk)-chloramphenicol
acetyltransferase (CAT) fusion gene (27). pT3-rTR
, an expression
vector for rat TR
1 under control of the T3 RNA polymerase promoter
(70), was a gift from M. Lazar (University of Pennsylvania School of
Medicine, Philadelphia, PA). pSP6-L5, which contains the
Xenopus ribosomal protein L5 cDNA under control of the SP6
RNA polymerase promoter (31), was a gift from W. M. Wormington
(University of Virginia, Charlottesville, VA). pSP6-xTR
, a
Xenopus TR
1 SP6-expression vector (71), was obtained from
J. Tata (National Institute for Medical Research, London, UK). The
p53-GFP expression vector, encoding p53 fused to the N terminus of GFP
(47), was a gift from J. Stommel (Salk Institute for Biological
Studies, La Jolla, CA). GST expression vectors for Ran and RanQ69L (36)
were obtained from R. Truant (McMaster University, Ontario,
Canada).
The plasmid pGFP::TR3 encodes a functional
GFP::TR
fusion protein expressed under cytomegalovirus
(CMV) promoter control. The plasmid was made by ligating a PCR product
encoding the rat TR
1 cDNA into the enhanced (red-shifted) GFP
plasmid pEGFP-C1 (CLONTECH Laboratories, Inc. Palo Alto,
CA), cut with SacI and BamHI. The TR
1 cDNA was
PCR amplified from RS-rTR
with primers TR-L
(CCGAGCTCGAATGGAACAGAAGCC) and TR-R
(GGTGGATCCTTAGACTTCCTGATCC), containing engineered
SacI and BamHI sites (underlined), to
produce receptor fused to the C terminus of GFP.
The plasmids pGFP::C122A and pGFP::G121A encode functional GFP::C122A and GFP::G121A fusion proteins, made by ligating PCR products encoding the human TRß mutants C122A and G121A into pEFGP-C1, cut with EcoRI and BamHI. The mutant sequences were PCR amplified from RS-hTRß-C122>A or RS-hTRß-G121>A (48) (generous gift from P. Romaniuk, University of Victoria, British Columbia, Canada) with primers C122A-L (CCCGAATTCGATGACAGAAAA TGGCC) and C122A-R (GGTGGATCCCTAATCCTCGAACACTTCC), containing engineered EcoRI and BamHI sites (underlined), to produce mutant receptor fused to the C terminus of GFP.
The plasmid pGFP::v-ErbA encodes a functional GFP::v-ErbA fusion protein, made by ligating the PCR product encoding viral Gag-v-ErbA into pEGFP-C1, cut with HindIII and EcoRI. The Gag-v-ErbA sequence was PCR amplified from SP6-v-ErbA (72) (generous gift from M. Privalsky, University of California, Davis, CA) with primers v-ErbA-L (CCCCAAGCTTGGATGGAAACCGTCA TAAAGG) and v-ErbA-R (TGCAGAATTCTACACCTCCTGGGG), containing engineered HindIII and EcoRI sites (underlined), to produce Gag-v-ErbA fused to the C terminus of GFP. Constructs were sequenced to check for correct insertion and fidelity of amplification.
In Vitro Synthesis of
35S-Labeled Proteins
35S-labeled proteins were synthesized
in vitro from pT3-rTR
, pSP6-xTR
, or pSP6-L5 templates
using a rabbit reticulocyte lysate-coupled transcription-translation
system (Promega Corp., Madison, WI) in the presence of 40
µCi L-[35S]methionine
(1,000 Ci/mmol, in vivo cell labeling grade; Amersham Pharmacia Biotech, Auckland, New Zealand or Arlington Heights,
IL).
Analysis of Nucleocytoplasmic Distribution
in Xenopus Oocytes
Ovarian lobes were surgically removed from adult female
Xenopus laevis, according to procedures approved by the
institutional Research on Animal Subjects Committee and processed as
described (27, 31). Microinjections were performed according to
published methods (31). Twenty to 50 nl of
35S-labeled TR
or L5 solution (in the rabbit
reticulocyte lysate) were microinjected into the cytoplasm or nucleus
of stage VVI fully grown oocytes.
To inhibit the synthesis of 35S-labeled
endogenous proteins from unincorporated
[35S]methionine remaining in the lysate
solution, microinjected oocytes were incubated in O-R2 medium (27)
containing 100 µg/ml cycloheximide (Sigma, St. Louis,
MO). Cycloheximide does not interfere with protein import in oocytes
(31). Oocytes were manually dissected in Nucleus Isolation Buffer [25
mM Tris-HCl, pH 8.0; 5 mM
MgCl2; 2 mM dithiothreitol (DTT);
10% glycerol]. A successful cytoplasmic injection was scored by the
absence of a red nucleus (colored by hemoglobin present in the
reticulocyte lysate), while a successful nuclear injection was scored
by the presence of a red nucleus. The inability to release a soluble
protein from nuclei by detergent extraction is a criterion that this
protein is inside the nucleus instead of associated with the outer
nuclear membrane. Thus, for some experiments, 1% Triton X-100 was
included in the Nucleus Isolation Buffer. Six nuclei and their six
corresponding "cytoplasms" (enucleated oocytes) were separately
pooled per sample and homogenized in Homogenization Buffer [1% Triton
X-100; 100 mM NaCl; 20 mM Tris-HCl, pH 7.6, and
0.4 mM Pefabloc (Roche Molecular Biochemicals,
Auckland, New Zealand) or 1 mM phenylmethylsulfonyl
fluoride (PMSF)]. The cytoplasmic sample was cleared of lipid, yolk,
and pigment by centrifugation at 10,000 x g for 5 min
at 4 C. Proteins were precipitated overnight in acetone at -80 C,
centrifuged for 15 min at 10,000 x g, and resuspended
in Sample Buffer (2% SDS; 10% glycerol; 0.6 mM
Tris-HCl, pH 6.8; 0.005% bromophenol blue; 0.1
mM DTT). Samples were resolved by 12% SDS-PAGE,
followed by fluorography as described previously (31). Dried gels were
exposed to x-ray film at -80 C for 12 weeks. Exposed films were
scanned and quantified by NIH Image, version alpha 9 (Scion Corp.,
Frederick, MD). The densities of the bands of full-length TR
in the
cytoplasmic and nuclear lanes were determined by the Gelplot2 macro.
The nuclear density was compared with the sum of the cytoplasmic and
nuclear densities to quantify the amount of nuclear-localized
full-length TR
. Nuclear accumulation was expressed as a percentage.
Mean sample results from replicate batches of oocytes were analyzed for
significant difference by two-tailed Students t tests.
For chilling assays, oocytes were incubated on ice for 30 min, microinjected with in vitro synthesized protein, and incubated at 04 C for an additional 6 h. To determine whether transport competence was restored at physiological temperatures, microinjected oocytes were incubated for 6 h on ice followed by 6 h at 1820 C. After incubation, oocytes were assayed for nucleocytoplasmic distribution, as described above.
For ATP depletion assays, oocytes were preinjected with apyrase (Grade
VIII, Sigma) 30 min before microinjection of
35S-TR
. Fifty nanoliters of 1 U/µl apyrase
in PBS were delivered to give an intracellular concentration of 100
U/ml. This results in a rapid decrease of cellular ATP from 2
mM to 10 µM (31). After 6 h incubation
at 1820 C, oocytes were manually dissected and assayed as described
above.
Recombinant wild-type Ran and RanQ69L were expressed in Escherichia coli BL21 cells as GST fusion proteins (36). After extraction in B-PER reagent (Pierce Chemical Co., Rockford, IL), proteins were purified on glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) as described previously (36), dialyzed in Storage Buffer (10 mM HEPES, pH 7.9, 100 mM NaCl, 1 mM DTT, 10% glycerol), and frozen in single-use aliquots at -80 C.
Fifty nanoliters of WGA (from Triticum vulgaris, Sigma) in PBS were injected to give a final intracellular concentration of 500 µg/ml, 3 h before microinjection of 35S-TR. After 6 h incubation at 1820 C, oocytes were assayed for nuclear transport.
For kinetic competition assays, histone H1 (Roche Molecular Biochemicals, Indianapolis, IN) was preinjected into oocytes to give final intracellular concentrations of 750 µM (low) or 900 µM (high), before injection of labeled protein. Ribosomal protein L5 was also used as a competitor in similar experiments. Equal quantities of 35S-labeled and unlabeled L5 (100 pg of each per oocyte) were microinjected. The concentration of unlabeled L5 in the translation mix was estimated by SDS-PAGE and staining with 0.25% Coomassie blue R250. Microinjected oocytes were analyzed for nuclear transport as described above.
For hormone treatment, microinjected oocytes were incubated in O-R2
supplemented with 100 nM T3
(Sigma) for 6 h at 1820 C. Protein was isolated
from manually dissected oocytes and the nucleocytoplasmic distribution
of 35S-TR
was analyzed. Results were compared
with control incubations made in the absence of
T3.
Analysis of GST-TR
in Xenopus Oocytes
GST was expressed in bacteria transformed with pGEX-KG and
purified using a B-PER GST Fusion Protein Purfication Kit (Pierce Chemical Co.), according to the manufacturers instructions.
GST-tagged chicken TR
(GST-TR
) was commercially prepared
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Five
nanograms of GST-TR
or GST alone were microinjected into the oocyte
cytoplasm. After 3 h incubation, oocytes were manually dissected
in 1% trichloroacetic acid (TCA) for the chilling and WGA experiments,
or in Nucleus Isolation Buffer for all other experiments. Oocytes were
homogenized in Homogenization Buffer (containing 1 mM
PMSF). An equal volume of Sample Buffer was added directly to three
pooled nuclear fractions, and the cleared supernatants of the three
corresponding cytoplasmic fractions. Samples were separated by 10%
SDS-PAGE. Nuclear fractions and one oocyte-equivalent (by volume) from
each cytoplasmic sample were loaded on the gel, along with a lane of
protein molecular mass markers (Kaleidoscope Pre-Stained Standards,
Bio-Rad Laboratories, Inc., Hercules, CA). Proteins were
transferred to Immobilon-P PVDF membrane (Millipore Corp.,
Bedford, MA) by semidry electroblotting at 2.5
mA/cm2 for 30 min. Blots were probed with
anti-TR
(rabbit polyclonal to full-length chicken TR
; FL-408;
Santa Cruz Biotechnology, Inc.) at 1:1,000, or anti-GST
polyclonal antibodies (Z-5, Santa Cruz Biotechnology, Inc.) at 1:1000, and horseradish peroxidase-conjugated secondary
antibodies (Blotting grade, Bio-Rad Laboratories, Inc.) at
1:10,000. GST-TR
and GST alone were visualized by chemiluminescent
detection (ECL, Amersham Pharmacia Biotech). When 5 ng of
GST-TR
were injected into oocytes, the full-length GST-TR
band on
Western blots was clearly distinguishable from bands resulting from
nonspecific antibody binding to endogenous oocyte proteins in the
cytoplasmic and nuclear fractions with similar mobility to full-length
GST-TR
.
Cell Culture and Transfections
NIH/3T3 cells [NIH Swiss mouse embryo fibroblasts,
American Type Culture Collection (ATCC,
Manassas, VA) CRL-1658] were cultured in DMEM containing 10% calf
serum (CS), 100 U/ml penicillin, and 100 µg/ml streptomycin
(Life Technologies, Inc., Gaithersburg, MD), at 37 C under
5% CO2 and 98% humidity. HeLa cells (human
cervix epithelioid carcinoma, ATCC, CCL-2) were grown in
MEM, supplemented with 10% FBS, and antibiotics. COS-1 cells (African
green monkey SV40-transformed kidney fibroblasts, ATCC,
CRL-1650) were grown in DMEM supplemented with 10% FBS and
antibiotics.
For transient transfections, trypsinized cells were seeded at 13 x 105 cells per well onto Lab-Tek four-well chamber slides or onto sterile 22-mm coverslips in six-well multidishes (Nalge Nunc International, Rochester, NY). Twenty-four hours after reseeding, cells at 5060% confluence were transfected with 2 µg plasmid DNA and 10 µl LipofectAmine in Opti-MEM I Reduced Serum Medium, according to the manufacturers instructions (Life Technologies, Inc.). For 100-mm dishes, cells were transfected with 10 µg of plasmid DNA in the presence of 50 µl of LipofectAmine. Reduced serum medium was replaced with complete medium 16 to 20 h post transfection.
CAT Enzyme-Linked Immunosorbent Assay (ELISA)
COS-1 cells were plated in 100-mm dishes and transfected with 5
µg of CAT reporter plasmid tk-TREp-CAT plus either 5 µg of pUC18
(empty vector), 5 µg RS-rTR
, or 5 µg pGFP::TR3.
Eighteen hours post transfection, medium was replaced with DMEM
containing 10% charcoal-dextran stripped FBS (HyClone Laboratories, Inc. Logan, UT) supplemented or not with 100
nM T3. Cells were lysed, a cell
extract was prepared, and the extract was used in the determination of
CAT expression levels by ELISA according to the manufacturers
specifications (Roche Molecular Biochemicals). In brief,
protein concentration was determined by the Bradford assay
(Bio-Rad Laboratories, Inc.), and the concentration of
each extract was adjusted to the same amount of total protein (3.52 mg
per well). Microwells coated with anti-CAT antibodies were incubated
with cell extracts and pure CAT standards. Digoxygenin (DIG)-tagged
secondary antibody to CAT was then bound to the primary
antibody-antigen complex. After washing, bound DIG-tagged antibody
was quantitated colorimetrically by incubation with
peroxidase-conjugated anti-DIG and ABTS (2,
2'-azino-di-[3-ethylbenzthiazoline sulfonate(6)]) as substrate. The
wells were read at 405 nm against a reagent blank in a microtiter well
reader. For each assay, a standard curve utilizing four pure protein
standards was prepared, to ensure that CAT concentrations of sample
extracts fell within the linear range of the assay. Replicate samples
were assayed.
Analysis of Nucleocytoplasmic Distribution in Mammalian Cells
For treatment with ligand, calf serum was stripped of any
endogenous T3 with 5% AG1-X8 resin
(Bio-Rad Laboratories, Inc.) for 12 h at 4 C. Sixteen
to 20 h post transfection, the reduced serum medium was replaced
with T3-depleted medium, or with medium
supplemented with a range of concentrations of T3
(10-9 M, 10-6
M, 10-3 M). Cells were
examined for GFP expression after a further 24 h incubation at 37
C.
For chilling assays 2448 h post transfection, cells were incubated in medium containing 50 µg/ml cycloheximide (cell culture-tested, Sigma) for 30 min to prevent de novo protein synthesis. A further replacement was made with cycloheximide-containing medium, and cells were incubated at 04 C for 34 h.
For energy depletion, cells were pretreated with cycloheximide as described above, and then incubated for 34 h in glucose minus DMEM, supplemented with 50 µg/ml cycloheximide, 6 mM 2-deoxyglucose (Sigma), a nonhydrolyzable analog of glucose, and 50 µM oligomycin (types A, B, and C; Sigma), an inhibitor of mitochondrial ATPase and phosphoryl group transfer.
GFP Fluorescence Microscopy
For analysis of GFP-TR
expression in live cells, 48 h
post transfection, chamber slides were washed gently in
Dulbeccos-modified PBS (D-PBS: 2.7 mM KCl; 1.5
mM KH2PO4;
136.9 mM NaCl; 8 mM
Na2HPO4). Cells were
mounted in fresh D-PBS, covered with glass coverslips, and maintained
at 37 C until immediately before viewing. Slides were examined on a
Leitz Orthoplan epifluorescence microscope under both
bright field and fluorescence, using the fluorescein isothiocyanate
(FITC) filter to visualize GFP. Photography was performed with a
Leitz Orthomat camera and Fujichrome Provia 400 Daylight
slide film (Fuji Photo Film Co., Ltd., Cypress, CA).
Replicate slides were examined and distributions of GFP fusion proteins
were recorded qualitatively.
For analysis of GFP-TR
expression in fixed cells, 24 h
post-transfection cells were fixed in 3.7% formaldehyde. Coverslips
were mounted in Vectashield containing 4',6'-diamidino-2-phenylindole
(DAPI) (Vector Laboratories, Inc. Burlingame, CA). Slides
were examined on an epifluorescence microscope (Olympus Corp., Lake Success, NY) , using the FITC filter (NB) for GFP
and UV filter (NU) for DAPI. Cells were photographed with
Kodak Select Series Elitechrome 400 ASA slide film
(Eastman Kodak, Rochester, NY).
Heterokaryon Assays
For the preparation of heterokaryons, mouse (NIH/3T3) cells were
seeded at 2.02.8 x 105 cells per well
onto coverslips in six-well multidishes. Subsequently, the cells were
transfected with GFP-tagged or untagged TR
expression vectors.
Twenty-four to 48 h post transfection of the mouse cells, human
(HeLa) cells were trypsinized, resuspended in Heterokaryon Growth
Medium (70% DMEM, 10% FBS, 20% sterile ddH20),
and plated on the same coverslips at a density of 6.67.6 x
105 cells per well, to optimize heterologous
fusion. After 3 h at 37 C in Heterokaryon Growth Medium containing
50 µg/ml cycloheximide, the medium was replaced with fresh
Heterokaryon Growth Medium containing 100 µg/ml cycloheximide, 30 min
before fusion. Subsequently, cells were rinsed twice with D-PBS. For
cell fusion, coverslips were placed on a 100 µl drop of prewarmed
50% polyethylene glycol 1500 (sterile, cell fusion-tested, Roche Molecular Biochemicals) and incubated for exactly 2 min. The
coverslip was then immediately rinsed twice in D-PBS and placed back
into the six-well plate in pre-warmed Heterokaryon Growth Medium
containing 100 µg/ml cycloheximide. Cells were incubated at 37 C, on
ice, or in the presence of 2-deoxyglucose and oligomycin for 12 h
after fusion. For treatment with ligand, 24 h post transfection of
the mouse cells, medium was replaced with DMEM containing 10%
charcoal-dextran stripped FBS (HyClone Laboratories, Inc.), supplemented or not with 100 nM
T3. For analysis of CRM1 dependence, cells were
incubated with 10 or 50 ng/ml leptomycin B (or an equivalent volume of
ethanol as a control) in culture medium containing cycloheximide for
2.5 h before fusion and for 1.5 h after fusion. For single
cell analysis, cells were incubated for 5 h in leptomycin B,
1618 h post transfection. Leptomycin B (10 µg/ml in ethanol; stored
at -20 C) was a generous gift from M. Yoshida (University of Tokyo,
Japan).
GFP-TR
shuttling was visualized by direct epifluorescence
microscopy, and untagged TR
shuttling was visualized by indirect
immunofluorescence microscopy. In brief, cells were fixed in 4%
paraformaldehyde (or 3.7% formaldehyde), permeabilized in 0.2% Triton
X-100, and probed with anti-TR
antibodies (1:50, polyclonal against
the extreme C terminus of rat TR
1, PA1211A, Affinity BioReagents, Inc., Golden, CO) and fluorescein-conjugated goat
antirabbit secondary antibodies (1:200, Vector Laboratories, Inc.). To visualize heterokaryons, cells were stained for DNA
with 10 µg/ml Hoechst 33258 (bisBenzimide) (Sigma) for
15 min, and for actin with 24 U/ml rhodamine-phalloidin
(Molecular Probes, Inc., Eugene, OR) for 20 min at room
temperature. Coverslips were mounted in Vectashield (Vector Laboratories, Inc.). Slides were examined on an Olympus Corp. epifluorescence microscope, using the FITC filter (NB) for
GFP, the UV filter (NU) for Hoechst, and the rhodamine filter (NG) for
rhodamine-phalloidin. Cells were photographed with Kodak
Select Series Elitechrome 400 ASA slide film.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported in part by research grants from the Health Research Council of New Zealand (HRC 94/470) and the Jeffress Memorial Trust to L.A.A. (J-477), and by a Howard Hughes Medical Institute grant through the Undergraduate Biological Sciences Education Program to the College of William and Mary (HHMI 71199518302). C.F.B. was the recipient of a Sadie Balkind Award from the New Zealand Federation of University Women and a predoctoral Sargood Bequest Cancer Research Training Scholarship from the Cancer Society of New Zealand.
Received for publication May 26, 2000. Revision received November 27, 2000. Accepted for publication December 22, 2000.
| REFERENCES |
|---|
|
|
|---|
and ß c-erb A proteins in rat liver. J
Recept Res 12:201215[Medline]
1 specifies positive and negative transcriptional
regulation functions. J Biol Chem 268:20212028
requires the N-terminal amino acids for exclusive
nuclear localization. FEBS Lett 416:291296[CrossRef][Medline]
and ß during embryogenesis and
metamorphosis in Xenopus laevis. J Biol Chem 269:2445924465
B
is accomplished by a Ran-independent
transport pathway. Mol Cell Biol 20:15711582
reveals a role
for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471486
-helix of
the human thyroid hormone receptor. Mol Endocrinol 7:11851195
1 and
ß1. J Endocrinol 167:219227[Abstract]
This article has been cited by other articles:
![]() |
M. E. Grespin, G. M. C. Bonamy, V. R. Roggero, N. G. Cameron, L. E. Adam, A. P. Atchison, V. M. Fratto, and L. A. Allison Thyroid Hormone Receptor {alpha}1 Follows a Cooperative CRM1/Calreticulin-mediated Nuclear Export Pathway J. Biol. Chem., September 12, 2008; 283(37): 25576 - 25588. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Kesler, D. Gioeli, M. R. Conaway, M. J. Weber, and B. M. Paschal Subcellular Localization Modulates Activation Function 1 Domain Phosphorylation in the Androgen Receptor Mol. Endocrinol., September 1, 2007; 21(9): 2071 - 2084. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sun, V. Montana, K. Chellappa, Y. Brelivet, D. Moras, Y. Maeda, V. Parpura, B. M. Paschal, and F. M. Sladek Phosphorylation of a Conserved Serine in the Deoxyribonucleic Acid Binding Domain of Nuclear Receptors Alters Intracellular Localization Mol. Endocrinol., June 1, 2007; 21(6): 1297 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-B. Poirier, G. Hamann, M.-E. Domingue, M. Roy, T. Bardati, and M.-F. Langlois General Receptor for Phosphoinositides 1, a Novel Repressor of Thyroid Hormone Receptor Action that Prevents Deoxyribonucleic Acid Binding Mol. Endocrinol., August 1, 2005; 19(8): 1991 - 2005. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kinugawa, M. Y. Jeong, M. R. Bristow, and C. S. Long Thyroid Hormone Induces Cardiac Myocyte Hypertrophy in a Thyroid Hormone Receptor {alpha}1-Specific Manner that Requires TAK1 and p38 Mitogen-Activated Protein Kinase Mol. Endocrinol., June 1, 2005; 19(6): 1618 - 1628. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Feige, L. Gelman, C. Tudor, Y. Engelborghs, W. Wahli, and B. Desvergne Fluorescence Imaging Reveals the Nuclear Behavior of Peroxisome Proliferator-activated Receptor/Retinoid X Receptor Heterodimers in the Absence and Presence of Ligand J. Biol. Chem., May 6, 2005; 280(18): 17880 - 17890. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Schneider, C. El-Yazidi, A. Dace, M. Maraninchi, R. Planells, A. Margotat, and J. Torresani Expression of the 1,25-(OH)2 vitamin D3 receptor gene during the differentiation of mouse Ob17 preadipocytes and cross talk with the thyroid hormone receptor signalling pathway J. Mol. Endocrinol., February 1, 2005; 34(1): 221 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kenessey and K. Ojamaa Ligand-mediated decrease of thyroid hormone receptor-{alpha}1 in cardiomyocytes by proteosome-dependent degradation and altered mRNA stability Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H813 - H821. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cao, W. Liu, F. Lin, H. Li, S. K. Kolluri, B. Lin, Y.-h. Han, M. I. Dawson, and X.-k. Zhang Retinoid X Receptor Regulates Nur77/Thyroid Hormone Receptor 3-Dependent Apoptosis by Modulating Its Nuclear Export and Mitochondrial Targeting Mol. Cell. Biol., November 15, 2004; 24(22): 9705 - 9725. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-F. Lin, B.-X. Zhao, H.-Z. Chen, X.-F. Ye, C.-Y. Yang, H.-Y. Zhou, M.-Q. Zhang, S.-C. Lin, and Q. Wu RXR{alpha} acts as a carrier for TR3 nuclear export in a 9-cis retinoic acid-dependent manner in gastric cancer cells J. Cell Sci., November 1, 2004; 117(23): 5609 - 5621. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Xu and R. J. Koenig An RNA-binding Domain in the Thyroid Hormone Receptor Enhances Transcriptional Activation J. Biol. Chem., August 6, 2004; 279(32): 33051 - 33056. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. DeLong, G. M. C. Bonamy, E. N. Fink, and L. A. Allison Nuclear Export of the Oncoprotein v-ErbA Is Mediated by Acquisition of a Viral Nuclear Export Sequence J. Biol. Chem., April 9, 2004; 279(15): 15356 - 15367. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Black, M. J. Vitto, D. Gioeli, A. Spencer, N. Afshar, M. R. Conaway, M. J. Weber, and B. M. Paschal Transient, Ligand-Dependent Arrest of the Androgen Receptor in Subnuclear Foci Alters Phosphorylation and Coactivator Interactions Mol. Endocrinol., April 1, 2004; 18(4): 834 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maruvada, N. I. Dmitrieva, J. East-Palmer, and P. M. Yen Cell Cycle-dependent Expression of Thyroid Hormone Receptor-{beta} Is a Mechanism for Variable Hormone Sensitivity Mol. Biol. Cell, April 1, 2004; 15(4): 1895 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maruvada, C. T. Baumann, G. L. Hager, and P. M. Yen Dynamic Shuttling and Intranuclear Mobility of Nuclear Hormone Receptors J. Biol. Chem., March 28, 2003; 278(14): 12425 - 12432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Onda, D. Li, S. Suzuki, I. Nakamura, S. Takenoshita, C.-H. Brogren, S. Stampanoni, and N. Rampino Expansion of Microsatellite in the Thyroid Hormone Receptor-{alpha}1 Gene Linked to Increased Receptor Expression and Less Aggressive Thyroid Cancer Clin. Cancer Res., September 1, 2002; 8(9): 2870 - 2874. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Prufer and J. Barsony Retinoid X Receptor Dominates the Nuclear Import and Export of the Unliganded Vitamin D Receptor Mol. Endocrinol., August 1, 2002; 16(8): 1738 - 1751. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |