| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Molecular Biology Program (R.D.H.) Department of Chemistry (B.G.B.) and Department of Physiology (D.A.R.) Colorado State University Fort Collins, Colorado 80523
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Despite considerable effort by a number of investigators, little is known about the molecular mechanisms by which LHR desensitization occurs. Desensitization for the ß-adrenergic receptor has served as the model for most G protein-coupled receptors (9). However, unlike the ß-adrenergic receptor, phosphorylation of the LHR is observed to accompany, but may not be required for, desensitization (8, 10). Nonetheless, LHR desensitization may also involve physical interactions between the receptor and other proteins including ß-arrestin (11) and/or segregation of the receptor into membrane domains or membrane rafts containing proteins needed for signaling.
We hypothesize that the desensitized LHR is self-associated within large, slowly diffusing structures that must dissipate before the receptor can again respond to hormone. To test this hypothesis, we have examined the lateral motions of the receptor and fluorescence energy transfer (FET) between receptors after brief exposure to either LH or hCG. These studies made use of the fluorescence properties of enhanced green fluorescent protein (GFP) and its red-shifted variant, yellow fluorescent protein (YFP). Both these proteins were coupled to rat LHR at its C terminus and stably expressed either singly or together in Chinese hamster ovary (CHO) cells. We have previously shown that hormone binding to GFP-LHR-wt,1 which is effectively expressed on the plasma membrane, results in cAMP accumulation and slower GFP-LHR-wt lateral diffusion (12). Here we examine both LHR lateral diffusion and receptor self-association during times (14 h) when the receptor is desensitized but before substantial internalization has occurred. Results from these studies, together with fluorescence images of GFP-receptor distribution in the membrane during desensitization, suggest that desensitized LHRs are self-associated within large, slowly diffusing complexes. Dissociation of the self-associated receptors as well as the slowly diffusing complexes must occur before LHRs are again responsive to binding of hormone.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
FET Occurs between GFP-LHR-wt and YFP-LHR-wt during Receptor
Desensitization
We have previously shown that LHR-wt receptors on 293 cells are
self-associated after binding of LH or hCG (14). To investigate whether
this occurs only in response to hormone binding and whether receptors
remain self-associated while desensitized, we measured the FET between
hCG-treated LHRs coupled to either GFP and YFP. Before binding of hCG
there was no significant energy transfer between GFP-LHR-wt and
YFP-LHR-wt fusion proteins (Fig. 3
).
After desensitization of the receptor by 30 min exposure to 10
nM hCG and hormone removal, energy transfer efficiency
between unoccupied LHRs increased to 18 ± 1% at 1 h. Values
for energy transfer efficiency between unoccupied, desensitized LHRs
decreased over the next 3 h but did not reach 0 until after 5
h when receptors were again responsive to hCG challenge.
|
|
| DISCUSSION |
|---|
|
|
|---|
In FPR measurements of receptors occupied by TrITC-derivatized
hormones, the mobile fractions for receptors desensitized by LH or hCG
were characteristic of the desensitizing hormone complex regardless of
which hormone was subsequently used as a receptor probe at 1 h
(Table 1
). Thus, any additional interactions between LHRs and, as
examples, membrane lectins (15) or the cytoskeleton (16), must occur as
the receptor-containing complex is forming. Once receptor-containing
complexes have formed, the structure of these complexes seems to be
unaffected by hormone rebinding until the complexes have dissociated at
approximately 5 h. At early times after desensitization by LH or
hCG, the diffusion coefficients measured for GFP-LHR-wt were similar to
those of LH and hCG-occupied receptors on ovine (17) and rat (18)
luteal cells. In spot FPR measurements of LHRs on ovine luteal cells,
most hCG-occupied receptors were immobile on the cell surface,
exhibiting less than 20% fluorescence recovery after photobleaching
(17). The few mobile LHRs occupied by hCG had a 7-fold slower diffusion
coefficient than did LH-occupied receptors (19). Although more ovine LH
(oLH)-occupied receptors were mobile, fluorescence recovery after
photobleaching was only about 30% (17), which is considerably less
than the 60% fluorescence recovery typical of most membrane proteins
(20).
Desensitization of the LHR occurred in less than 1 h, independent of the type of hormone used to desensitize the receptor. At 1 h, after desensitization by either LH or hCG, there was no response to hormone challenge, a result consistent with in vitro studies by Hunzicker-Dunn and co-workers (6), who have demonstrated in a cell-free system that LHRs on pig Graafian follicles are fully uncoupled from adenylate cyclase within 30 min. Similarly, Segaloff and co-workers (21) have shown in intact cells that rat wild-type LHR expressed in 293 cells is desensitized within 1 h.
Resensitization of the GFP-LHR-wt and LHR-wt is slow, requiring about 5 h. This rate is comparable to that reported by Ulaner et al. (22) for rat LHRs transfected in Y-1 cells and treated with either LH or hCG. Interestingly, resensitization of LHRs is significantly slower than that of the ß-adrenergic receptors, which occurs within 1520 min following removal of hormone agonist with low pH buffer (23). Although LHR desensitization has been studied in vivo, it cannot be examined independently of down-regulation of receptor number (24) and degradation of mRNA transcripts (25, 26). Thus, the reappearance in vivo of functional LHRs on the plasma membrane is slow with times varying from 72 h (27) to 7 days (24), depending on cell type. This in vivo phenomenon must thus involve receptor replenishment through a very different mechanism than is involved in LHR resensitization in this study.
FET between receptors is indicative of dimerization or oligomerization of the receptor, a process that occurs in response to hCG binding and persists while the LHR is nonresponsive. Hebert and co-workers (28) have suggested that dimerization of the ß-adrenergic receptor is essential for receptor signaling. Nonfunctional receptors can be rescued by antibody-induced receptor dimerization (29), which is mediated by a dimerization sequence in the sixth transmembrane domain (28). Conn and co-workers (30) have shown that antibody-mediated dimerization of GnRH receptors is sufficient to stimulate LH secretion by pituitary cells. As is the case for ß-adrenergic receptor, self-association of LHRs may be required for receptor signaling. Rat LHRs containing a specific single point mutation are able to bind LH or hCG but do not signal or have measurable levels of FET between receptors after hormone binding (14).
There are, however, critical differences between the extent of LHR and ß-adrenergic receptor self-association. The ß-adrenergic receptor apparently forms discrete homodimers (28) that appear in unresolved small, punctate structures in fluorescence micrographs (31). In contrast, the LHR, which lacks this dimerization sequence in its TM6 domain, is present in larger clusters after binding of hormone. Luborsky et al. (32) have observed clusters of about 1020 receptors on rat granulosa cells using electron microscopy after binding of high concentrations of LH. In addition, LHRs desensitized by hCG appear in larger scale macroscopic patches on the membranes of rat granulosa cells (33). The components of the large molecular weight complexes formed during receptor desensitization are not known, but it likely that these structures contain other nonreceptor proteins. LHRs exhibit very slow rotational motion in time-resolved phosphorescence anisotropy studies on ovine and bovine luteal cell membranes (34), and these slower motions are observed only when the hormone-receptor pair is functional, i.e. capable of activating adenylate cyclase (35). LHRs on bovine luteal cell plasma membranes are associated with a family of nonreceptor proteins (36), and this is presumably true in other species. On membranes from porcine granulosa cells, a number of signaling molecules, including, notably, ß-arrestin, must also be available for desensitization of the receptor (11).
We speculate that ligand binding to LHRs may also be associated with a
redistribution of receptors in the membrane into small membrane domains
in which signaling and/or receptor desensitization can occur. However,
it does not appear that desensitized receptors are sequestered in
membrane vesicles. First, there was no decrease in the number of LHRs
on the plasma membrane either 1 or 5 h following brief hormone
treatment, suggesting that there was no significant internalization of
receptors. Second, although sequestration of LHRs is suggested by
aggregation of the receptor into fluorescent clusters (Fig. 4
), many
LH-treated receptors remain laterally mobile after hormone treatment.
If receptors were clustered into small vesicles, there would be
essentially no receptor diffusion measured on the time scale of our
experiments and no measurable recovery of fluorescence after
photobleaching. Finally, the process initiated by exposure to either LH
or hCG was reversible. The observed decreases in the rate of receptor
lateral diffusion and the fraction of mobile receptors were transient
and, upon recovery from receptor desensitization, receptor lateral
diffusion was fast and the fraction of mobile receptors was high.
Together these results suggest that the LHR forms clusters on the
membrane that dissipate over time but that receptors present in these
clusters are not internalized within membrane vesicles.
LHR dimerization or oligomerization may arguably be the initial step in signal transduction, although the sequence of events after binding of hormone to receptor is not clear. This could be followed by the movement of LHRs into membrane regions containing proteins required for signaling including, for example, G proteins, effector proteins, and proteins for desensitization or, alternatively, signal transduction could occur outside of membrane domains and be followed by movement of receptors into membrane domains containing proteins necessary for desensitization of the receptor. In addition to interactions with ß- arrestins, clustering of receptors into very large complexes may, as Amsterdam et al. (33) have suggested, interfere with receptor response to hormone. In either case, one would predict that the fraction of immobile receptors would increase upon desensitization of the receptor as we, in fact, observe. Dissociation of the receptor from complexes would result in an increase in the fraction of mobile receptors and the average diffusion coefficient for the receptor population. However, there is no productive signaling until a sufficiently large population of freely diffusing receptors and/or molecules necessary for signal transduction were again available outside specialized membrane domains.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines
Dr. Tae Ji kindly provided 293 cells stably transfected with the
wild-type rat LHR (LHR-wt cells). These cells, as well as untransfected
293 cells, were maintained in DMEM containing 10% horse serum, 100 U
penicillin, 1,000 µg/ml streptomycin, and 10 mM HEPES, pH
7.4. Medium for LHR-wt cells was supplemented with 400 µg/ml
geneticin. Untransfected CHO cells were maintained in DMEM supplemented
with 4,500 µg/ml glucose and containing 10% FBS, 100 U/ml
penicillin, 100 µg/ml streptomycin, and 1x MEM nonessential amino
acids (Sigma).
Four CHO cell lines were used in this study including 1) untransfected cells; 2) cells expressing GFP-LHR-wt; 3) cells expressing YFP-LHR-wt; and 4) both GFP-LHR-wt and YFP-LHR-wt. Cells stably transfected with the GFP-LHR-wt construct were prepared as described previously (12) and maintained in CHO cell medium containing 200 µ g/ml G418. CHO cells expressing YFP-LHR-wt alone or expressing TFP-LHR-wt and GFP-LHR-wt were prepared using the same strategy described in detail for GFP-LHR-wt (12). To construct the YFP-LHR vector, the full-length receptor cDNA for rat LHR (rLHR), a gift from Dr. Deborah Segaloff, was subcloned into enhanced EYFP-N2 vector (CLONTECH Laboratories, Inc. Palo Alto, CA). A fragment of the LHR beginning at the intrinsic ScaI site (ACTATAACCACGCCATAGAC) and ending at the receptor 3'-end was removed, thus removing an intrinsic stop codon, and replaced with an in-frame BamHI site (underlined) at the 3'-end (CGGGATCCAACGCTCTCGGTGGTATGG). This fragment was amplified by PCR. The PCR product was digested with BamHI, as was the eYFP-N2plasmid, and ligated into ScaI and BamHI plasmid. The final fusion protein DNA sequence consisted of rLHR, a spacer sequence of the amino acids IHRPVAT, and enhanced YFP. The ScaI/BamHI fragment was confirmed by cDNA sequencing by Macromolecular Resources (Fort Collins, CO). CHO cells expressing YFP-LHR-wt alone were transfected with 1 µg of the rLHR-YFP vector using Lipofectamine-Plus (Life Technologies, Inc.) according to the manufacturers instructions. CHO cells coexpressing both GFP-LHR-wt and YFP-LHR-wt were transfected with 0.4 µg of GFP-LHR-wt and 1.2 µg of YFP-LHR-wt. After overnight culture, transfected cells were transferred into 150-mm plates and cultured with CHO cell medium containing 600 µg/ml G418 (Gemini Biological Products, Woodland CA) for 7 days. At this time, cells were washed with PBS and cloned by limiting dilution in 96-well plates (ISC BioExpress, Kaysville, UT) where they were incubated for 2 weeks before selection of fluorescent colonies and expansion of those colonies.
Preparation of TrITC and ErITC-Derivatized Hormones
Hormones were derivatized with ErITC or TrITC using a
modification of methods described by Brinkley et al. (37)
and described in detail elsewhere (34). The molar ratios for
dye-hormone were determined spectrophotometrically. Hormone
preparations used in these experiments had 1.01.5 mol of ErITC or
TrITC per mole of oLH or hCG. Before use, all derivatized hormones in
PBS were centrifuged at 130,000 x g for 10 min in a
Beckman Coulter, Inc. Airfuge (Beckman Coulter, Inc., Palo Alto, CA) to remove any protein aggregates formed
during storage at 4 C.
LHR Desensitization
LHRs were desensitized using a protocol that has been described
in detail by others (21). Briefly, CHO cells or 293 cells expressing
LHRs were incubated for 30 min with 10 nM LH or hCG at 37 C
and then treated for 5 min at 4 C with 50 mM glycine, 100
mM NaCl, pH 3.0, PBS to remove hormone bound to the LHR.
The cells were centrifuged at 300 x g and resuspended
in fresh PBS. The extent of LHR desensitization was evaluated by
measuring cellular cAMP production. At 1-h intervals after the time 0
when hormone was initially introduced to cell samples, either LH or hCG
was again added for 1 h to cell suspensions containing 1 x
106 cells. At the end of this incubation,
cellular cAMP was measured using a TiterFluor cAMP EIA kit
(Perkin-Elmer Corp., Norwalk, CT) according to the
manufacturers instructions. To reduce well-to-well variations in
measured levels of cAMP, 96-well plates coated with antirabbit IgG were
obtained from Pierce Chemical Co. (Rockford, IL) and were
substituted for those provided in the TiterFluor cAMP kits.
After hormone treatment to desensitize the LHR, we verified that receptor number was unchanged and receptors were able to rebind hormone. This was done by measuring the phosphorescence intensity from ErITC-derivatized hormones bound to LHRs on LHR-wt cells. Cells were incubated with 10 nM ErITC-hCG or ErITC-LH for 1 h and washed two times by centrifugation at 300 x g for 3 min in balanced salt solution (BSS) to remove any unbound ligand. The sample was then deoxygenated for 15 min by purging with argon gas to eliminate phosphorescence quenching caused by O2 and placed in a 5-mm Suprasil quartz cuvette (Helma Cells, Inc., Jamaica, NY), which was inserted in a thermostatted cuvette holder. The frequency-doubled 532-nm output of a Spectra-Physics DCR-11 Nd:YAG laser was used to excite ErITC. The laser was operated at 10 Hz with a vertically polarized TEM00 output of 0.19 mJ and a beam 1/e2 radius of 2.5 mm at the sample. Phosphorescence emission from the sample was collected by an EMI 9816A photomultiplier tube, amplified by a Tektronix 476 oscilloscope (Tektronix, Inc., Beaverton, OR) and a 35 MHZ buffer amplifier, and digitized by a Nicolet 12/70 signal averager (Nicolet Instrument Corp., Madison, WI). After data acquisition was complete, the data were downloaded into a Pentium II microcomputer (Santa Clara, CA) (34). In a typical experiment, 105 cells labeled with ErITC-oLH or ErITC-hCG exhibited phosphorescence intensity of 5.8 ± 0.4 and 6.2 ± 0.1 in arbitrary units, respectively, while untreated cells had only 0.5 ± 0.3 U phosphorescence. Treating cells with low pH buffer removed hormone from the receptor as indicated by a decrease in the phosphorescence signal to baseline values (0.530.57). Rebinding ErTIC-LH or ErITC-hCG to LHRs at 1 h and 5 h after removal of hormone with low pH buffer increased the signals to 4.6 ± 1.5 and 6.2 ± 0.1, respectively, which did not differ significantly from signals measured after initial binding of either ErITC-LH or ErITC-hCG. To verify that there were no nonspecific interactions of the ErITC-hormones with human kidney 293 cells, 293 cells that did not contain expression vectors for the LHR were treated with 10 nM ErITC-rLH or -hCG. To determine whether binding of the ErITC-derivatized hormones was specific, cells were preincubated with excess oLH before labeling with ErITC-oLH in some experiments. In both cases, there was no detectable phosphorescence signal from the cell sample.
Spot and Fringe FPR Measurements
The optical system for spot and fringe FPR measurements and the
methods used for data analysis have been described in detail (38). The
microscope objective used in these studies was a 40x objective of
NA 0.65 (Carl Zeiss, Thornwood, NY). Standard
Carl Zeiss filter and dichroic mirror sets for fluorescein
isothiocyanate (FITC) and TrITC fluorescence were used. Cells were
examined under coverslip on well slides while temperature was
maintained by a thermal stage with a temperature range of 0 C to 40 C.
For spot measurements of unoccupied GFP-LHR-wt lateral diffusion, an
attenuated Coherent Radiation Innova 100 argon ion laser beam at 488 nm
was focused to a spot on the plasma membrane of 0.41 µm
1/e2 radius. Bleaching and probe beam powers were
1.4 mW and 1.7 µW, respectively. Data were acquired at 50 msec/point
for 20 sec before, and for 30 sec after, a 150 msec bleaching pulse.
For fringe measurements of TrITC-LH or TrITC-hCG lateral diffusion, the
region illuminated at the sample had a 1/e2
radius of at least 18 µm, and the photometer acceptance region was
large enough to encompass the entire cell. The fringe spacing used in
these experiments was 2.3 µm. Because of the large interrogated area,
1.3 W in the bleaching pulse and 3 mW in the probe beam were used.
Unadjusted raw data were represented directly in terms of the various
parameters associated with a given measurement including the prebleach
and immediate postbleach fluorescence levels and a function
representing the recovery kinetics in terms of a decay half-time. The
desired diffusion coefficient and the extent of fluorophores mobile on
the timescale of the experiment were evaluated directly by a nonlinear
least-squares procedure and from the measured time
t1/2 at which fluorescence recovery was
half-complete and from the known optical parameters evaluated (38, 39, 40).
A detailed comparison of the methods used to analyze results from spot
and fringe FPR measurements is presented in Munnelly et al.
(40). A review of biophysical methods for measuring translational
diffusion is presented by Jovin and Vaz (41). Each data point presented
in either spot or fringe FPR measurements represented a total of 60
measurements with 20 measurements made on three different days.
Single Cell FET
Slower rates of fluorescence decay for cells expressing both
GFP-LHR donor and YFP-LHR acceptor (D+A) than for cells expressing
GFP-GnRHR only (D) were indicative of energy transfer from fluorescence
donor to acceptor. For this donor-acceptor pair, Försters
r0 is calculated to be 56 A (42); therefore,
energy transfer occurs to a measurable extent only when the donor and
acceptor are separated by distances less than about 100 A. FET
measurements were made using a fluorescence microscope photometer based
on an inverted-configuration Carl Zeiss Axiomat microscope
and associated components used for spot FPR measurements. Fluorescence
excitation was provided by a Coherent Innova 100 argon ion laser
(Coherent, Inc., Santa Clara, CA) operating under light control at 488
nm. The intensity of the laser radiation focused on the cell was 45 mW,
and this was held constant between measurements on LHR-GFP cells or on
LHR-GFP/YFP expressing cells. The 1/e2 Gaussian
spot diameter was 18 µm. Donor fluorescence from GFP was isolated
with a standard fluorescein filter set together including a short pass
fluorescein-selective filter to remove yellow fluorescence contributed
by YFP-LHR-wt. This combination was highly effective in rejecting YFP
fluorescence. In individual experiments, cells were identified and
centered in the microscope field. At time zero, an electronically
controlled shutter was opened to allow laser radiation to illuminate
the cell. Simultaneously, a computer program was activated to record
the output of the photomultiplier measuring membrane fluorescence. Data
were collected at 0.01-sec intervals for 10 sec. Typically about 20
cells in each sample were photobleached in this manner. In each
experiment, four sets of identically handled cells were examined
including untransfected CHO cells, CHO cells expressing GFP-LHR-wt
alone, CHO cells expressing YFP-LHR-wt alone, and cells expressing both
GFP-LHR-wt and YFP-LHR-wt. Cells expressing LHR-YFP alone produced
signals that did not differ significantly from those of untransfected
CHO cells using the fluorescein-selective filter set. Signal from CHO
cells expressing LHR-GFP or LHR-GFP/YFP was greater than 8-fold higher
than background levels. Thus, the rate constants for photobleaching of
GFP on cells expressing LHR-GFP alone (kD) or
LHR-GFP/YFP (kDA) were analyzed from data traces
as described in detail previously (43). The energy transfer efficiency
was expressed as a percent (%E) and was calculated from these rate
constants using %E = (1 -
kDA/kD) x 100
(44).
Fluorescence Imaging of GFP-LHR-wt
GFP-LHR-wt fluorescence from individual cells was
measured on a Carl Zeiss Axiovert microscope
equipped with a 1.4 NA oil immersion condenser and a 1.3 NA 63x
Plan-Apochromat objective. A 100 W arc lamp was used to excite the
sample and a standard FITC filter set was used to isolate the green
(GFP) signal. Fluorescent images were obtained using a Dage-MTI CCD300
digital camera (Dage-MTI, Inc., Michigan City, IN) using an
integration time of 30 sec, digitized, pseudo-colored via Metamorph
imaging software (Universal Imaging, West Chester, PA), and exported to
Adobe PhotoShop (Adobe Systems, Inc., San Jose, CA) for further image
processing. On two separate days, a minimum of 10 cells for each sample
were imaged and analyzed.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by NIH Grants HD-23236 and HD-01067 (D.A.R.).
1 Abbreviations: LHR-wt, 293 human embryonic
kidney cells with an expression vector for the wild-type LH receptor;
GFP-LHR-wt, CHO cells expressing the rat LH receptor-GFP fusion
protein; YFP-LHR-wt, CHO cells expressing the rat LH receptor-YFP
fusion protein. ![]()
Revision received December 27, 2000. Accepted for publication January 2, 2001.
| REFERENCES |
|---|
|
|
|---|
and
ferritin-LH. Endocrinology 115:22172225This article has been cited by other articles:
![]() |
R. Guan, X. Feng, X. Wu, M. Zhang, X. Zhang, T. E. Hebert, and D. L. Segaloff Bioluminescence Resonance Energy Transfer Studies Reveal Constitutive Dimerization of the Human Lutropin Receptor and a Lack of Correlation between Receptor Activation and the Propensity for Dimerization J. Biol. Chem., March 20, 2009; 284(12): 7483 - 7494. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Thomas, C. A. Nechamen, J. E. Mazurkiewicz, M. Muda, S. Palmer, and J. A. Dias Follice-Stimulating Hormone Receptor Forms Oligomers and Shows Evidence of Carboxyl-Terminal Proteolytic Processing Endocrinology, May 1, 2007; 148(5): 1987 - 1995. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Pin, R. Neubig, M. Bouvier, L. Devi, M. Filizola, J. A. Javitch, M. J. Lohse, G. Milligan, K. Palczewski, M. Parmentier, et al. International Union of Basic and Clinical Pharmacology. LXVII. Recommendations for the Recognition and Nomenclature of G Protein-Coupled Receptor Heteromultimers Pharmacol. Rev., March 1, 2007; 59(1): 5 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Navratil, T. A. Farmerie, J. Bogerd, T. M. Nett, and C. M. Clay Differential Impact of Intracellular Carboxyl Terminal Domains on Lipid Raft Localization of the Murine Gonadotropin-Releasing Hormone Receptor Biol Reprod, May 1, 2006; 74(5): 788 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. L. Smith, Y. Lei, J. Liu, M. E. Cahill, G. M. Hagen, B. G. Barisas, and D. A. Roess Luteinizing Hormone Receptors Translocate to Plasma Membrane Microdomains after Binding of Human Chorionic Gonadotropin Endocrinology, April 1, 2006; 147(4): 1789 - 1795. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Costagliola, E. Urizar, F. Mendive, and G. Vassart Specificity and promiscuity of gonadotropin receptors Reproduction, September 1, 2005; 130(3): 275 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cezanne, S. Lecat, B. Lagane, C. Millot, J.-Y. Vollmer, H. Matthes, J.-L. Galzi, and A. Lopez Dynamic Confinement of NK2 Receptors in the Plasma Membrane: IMPROVED FRAP ANALYSIS AND BIOLOGICAL RELEVANCE J. Biol. Chem., October 22, 2004; 279(43): 45057 - 45067. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Roess and S. M.L. Smith Self-Association and Raft Localization of Functional Luteinizing Hormone Receptors Biol Reprod, December 1, 2003; 69(6): 1765 - 1770. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hunzicker-Dunn, G. Barisas, J. Song, and D. A. Roess Membrane Organization of Luteinizing Hormone Receptors Differs between Actively Signaling and Desensitized Receptors J. Biol. Chem., October 31, 2003; 278(44): 42744 - 42749. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Latif, P. Graves, and T. F. Davies Ligand-dependent Inhibition of Oligomerization at the Human Thyrotropin Receptor J. Biol. Chem., November 15, 2002; 277(47): 45059 - 45067. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Overton and K. J. Blumer The Extracellular N-terminal Domain and Transmembrane Domains 1 and 2 Mediate Oligomerization of a Yeast G Protein-coupled Receptor J. Biol. Chem., October 25, 2002; 277(44): 41463 - 41472. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ji, C. Lee, Y. Song, P. M. Conn, and T. H. Ji Cis- and Trans-Activation of Hormone Receptors: the LH Receptor Mol. Endocrinol., June 1, 2002; 16(6): 1299 - 1308. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |