help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horvat, R. D.
Right arrow Articles by Roess, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horvat, R. D.
Right arrow Articles by Roess, D. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN
Molecular Endocrinology 15 (4): 534-542
Copyright © 2001 by The Endocrine Society

Luteinizing Hormone Receptors Are Self-Associated in Slowly Diffusing Complexes during Receptor Desensitization

Regina D. Horvat, B. George Barisas and Deborah A. Roess

Cell and Molecular Biology Program (R.D.H.) Department of Chemistry (B.G.B.) and Department of Physiology (D.A.R.) Colorado State University Fort Collins, Colorado 80523


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have previously shown that rat LH receptors (LHRs) occupied by human CG (hCG) exhibit slow receptor lateral diffusion and are self-associated. Here we have examined whether LHRs become self-associated and enter slowly diffusing structures in response to hormone binding and whether these receptors retain this organization while in the desensitized state. Before hormone exposure, wild-type rat LHRs coupled at the C terminus to enhanced green fluorescent protein (GFP-LHR-wt) exhibited fast lateral diffusion, as assessed by fluorescent photobleaching recovery (FPR) methods, and most receptors were laterally mobile. After 30 min exposure to hCG and subsequent removal of hormone by low pH wash, hormone challenge at any time within the next 4 h produced no increase in cellular cAMP levels. During this time, LHRs were either laterally immobile or exhibited slower lateral diffusion. When LHRs were again responsive to binding of hormone, the rate of receptor lateral diffusion had become significantly faster and the fraction of mobile receptors was again large. Desensitized LHRs were also self-associated and present in microscopically visible clusters on the plasma membrane. Fluorescence energy transfer (FET) methods were used to measure the extent of interaction between receptors coupled to either GFP or to yellow fluorescent protein (YFP). Before hormone treatment, there was essentially no energy transfer between LHRs. After desensitization of the receptors by 30 min exposure to hCG, energy transfer efficiency increased to 18%. Values for FET efficiency between desensitized receptors decreased over time, and receptors were responsive to hormone only after measurable energy transfer had completely disappeared. Together these results suggest that desensitized LHRs exist in large, slowly diffusing structures containing self-associated receptors and that these structures must dissipate before the receptor can again respond to hormone.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Desensitization of LH receptors (LHRs) after brief exposure to hormone is initially characterized by uncoupling of the receptor from the signal transduction machinery rather than by a decrease in receptor number. While desensitized, LHRs found on reproductive tissues including Leydig, luteal, and granulosa cells are less responsive to subsequent binding of ligand (1, 2, 3, 4, 5). This process may be important in vivo where the preovulatory surge of LH results in a time-dependent decrease in the subsequent response to hormone (6) but only if hormone doses are sufficient to cause ovulation (1). Desensitization may also be required for internalization of the receptor and receptor down- regulation (2, 7, 8).

Despite considerable effort by a number of investigators, little is known about the molecular mechanisms by which LHR desensitization occurs. Desensitization for the ß-adrenergic receptor has served as the model for most G protein-coupled receptors (9). However, unlike the ß-adrenergic receptor, phosphorylation of the LHR is observed to accompany, but may not be required for, desensitization (8, 10). Nonetheless, LHR desensitization may also involve physical interactions between the receptor and other proteins including ß-arrestin (11) and/or segregation of the receptor into membrane domains or membrane rafts containing proteins needed for signaling.

We hypothesize that the desensitized LHR is self-associated within large, slowly diffusing structures that must dissipate before the receptor can again respond to hormone. To test this hypothesis, we have examined the lateral motions of the receptor and fluorescence energy transfer (FET) between receptors after brief exposure to either LH or hCG. These studies made use of the fluorescence properties of enhanced green fluorescent protein (GFP) and its red-shifted variant, yellow fluorescent protein (YFP). Both these proteins were coupled to rat LHR at its C terminus and stably expressed either singly or together in Chinese hamster ovary (CHO) cells. We have previously shown that hormone binding to GFP-LHR-wt,1 which is effectively expressed on the plasma membrane, results in cAMP accumulation and slower GFP-LHR-wt lateral diffusion (12). Here we examine both LHR lateral diffusion and receptor self-association during times (1–4 h) when the receptor is desensitized but before substantial internalization has occurred. Results from these studies, together with fluorescence images of GFP-receptor distribution in the membrane during desensitization, suggest that desensitized LHRs are self-associated within large, slowly diffusing complexes. Dissociation of the self-associated receptors as well as the slowly diffusing complexes must occur before LHRs are again responsive to binding of hormone.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Binding of Ovine (o) LH or Human (h) CG to Receptors on GFP-LHR-wt or LHR-wt Cells Desensitizes the Receptor
To observe desensitization of LHRs on CHO and 293 cells after brief hCG exposure, cAMP levels were measured in response to subsequent hormone challenge. Cells expressing GFP-LHR-wt or LHR-wt were incubated for 30 min at 37 C with 10 nM hCG and then washed with a low pH buffer to remove the bound hormone as described in Materials and Methods. Initiation of hormone treatment is designated as t = 0. At various times beginning 1 h after this, cells were challenged with 10 nM hCG for an additional hour at 37 C. As shown in Fig. 1Go, initial treatment of cells expressing either GFP-LHR-wt (panel A) and LHR-wt (panel B) resulted in a 5- to 7-fold increase in cAMP over basal levels. After receptors were desensitized by brief exposure to hCG for 4 h, hormone challenge produced no increase in intracellular cAMP over basal levels. After 5 h, cells responded to hormone challenge with an increase in intracellular cAMP to levels comparable to those seen after initial exposure to hCG. Recovery from desensitization of LHR-wt treated with 10 nM LH was essentially identical to that of hCG-treated cells both in terms of the time required and the magnitude of the cAMP response (data not shown). The effects of LH exposure on cAMP levels in LHR-wt cells at 1 h and 5 h following desensitizing hormone treatment are shown in Table 1Go and do not differ significantly from the effects of hCG treatment at either time.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. The Time Course of Recovery of LHR Signaling for CHO Cells Expressing rLHR-GFP ({bullet}) and HEK 293 Cells Expressing Wild-Type LHR ({blacksquare}) after Receptor Desensitization

To determine initial levels of cAMP in response to hCG treatment (t = 0), GFP-LHR-wt or LHR-wt were treated with hCG for 1 h before measurement of intracellular cAMP. To measure cAMP levels after desensitization of the receptor by hormone as described in Materials and Methods, 10 nM hCG was added to the cell suspension at the indicated times (t= 1, 2, 3, 4, or 5 h) for a 1-h incubation before measurement of intracellular cAMP levels. In response to initial treatment with hCG, there was a 4- to 6-fold increase in intracellular cAMP. After desensitization of the receptor, subsequent hormone treatment for 1 h had no effect on intracellular cAMP until 5 h following removal of desensitizing hormone. Results are the average and SD for four experiments performed in triplicate.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Lateral Diffusion of LHR-wt on 293 Cells following Receptor Desensitization with LH or hCG

 
Lateral Diffusion of Desensitized GFP-LHR-wt Receptors on CHO Cells Is Slow
Before binding of ligand, GFP-LHR-wt exhibited fast lateral diffusion (16 ± 0.3 x 10-10cm2sec-1) with a high fraction of mobile receptors (% r = 58 ± 4). After desensitization of the receptor by LH, the diffusion coefficients for the unoccupied receptor were reduced more than 3-fold to 4.4 ± 1.0 x 10-10cm2sec-1 and fluorescence recovery decreased to 26 ± 3% (Fig. 2Go). Between 2 and 4 h after initial hormone treatment, lateral diffusion of the unoccupied receptor became progressively faster and the extent of fluorescence recovery increased. However, only when receptors were again hormone responsive at 5 h were the rate of receptor lateral diffusion and the fraction of laterally mobile receptors comparable to values measured on untreated cells. When receptors were desensitized by brief exposure to hCG, the fraction of mobile receptors dropped to 16% at 1 h indicating that most receptors were laterally immobile (13). At 2 and 4 h following initiation of hormone treatment, the extent of fluorescence recovery after photobleaching, and thus the relative fraction of mobile receptors, increased to 42% by 4 h. Diffusion coefficients for hCG-desensitized receptors were significantly slower than those of LH- desensitized receptors at each time point (Table 2Go). As was the case for receptors desensitized by LH, diffusion coefficients for hCG-desensitized receptors were again comparable to those of untreated receptors after 5 h.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Spot FPR Measurements of rLHR-GFP Lateral Diffusion before Hormone Binding and after oLH- ({bullet}) or hCG-Induced ({blacksquare}) Receptor Desensitization

Panel A shows the diffusion coefficient (D) for the GFP-LHR-wt over the time course of recovery from receptor desensitization. Panel B shows fluorescence recovery (%R) of GFP-LHR-wt at the corresponding times. Receptors desensitized by either ligand exhibited significantly slower D 1 h following desensitization. D increased over the next 4 h until D was indistinguishable from that of untreated LHR. %R decreased upon binding of hormone and then increased over time until 5 h when %R did not differ significantly from untreated receptor. The magnitude of the decrease in D and %R in response to receptor desensitization was dependent on whether LH or hCG was used to desensitize the receptor. Values for diffusion coefficients and % R reflect three separate repetitions of an experiment in which 20 measurements on individual cells were made on a given day.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Lateral Diffusion of rLHR-GFP on CHO Cells following Desensitization with LH or hCG

 
The Fraction of Mobile, Desensitized Receptors Depends upon the Desensitizing Hormone
We then examined the complexes formed after desensitization of LHR-wt receptors on 293 cells using fringe fluorescence photobleaching recovery (FPR) methods. We had previously shown that the fractions of mobile receptors after binding of tetramethylrhodamine isothiocyanate (TrITC)-LH or TrITC-hCG differed significantly and that values for receptor lateral diffusion were not linked to the extent of fluorescence recovery after photobleaching (14). Although the diffusion coefficients for hCG- and LH-occupied receptors on LHR-wt cells were 3–5 x 10-10cm2sec-1, the fraction of mobile LHRs, as indicated by percent mobility (%M), was significantly higher after binding of LH (69 ± 13%) when compared with hCG-occupied receptors (43 ± 3%). As shown in Table 1Go, at 1 h following initiation of hormone treatment, values for %M always reflected the hormone initially used to desensitize receptors regardless of whether LH or hCG was later used as the fluorescent probe. After 5 h, values for %M were characteristic of the fluorescent ligand bound to the receptor and, thus, were independent of the hormone used initially to desensitize the receptor. In control experiments in which cells were treated with buffer rather than hormone, acid washed, and then labeled with TrITC-LH or TrITC-hCG, the diffusion coefficients and mobile fractions for these hormones did not differ significantly from those of hormone-occupied LHRs on LHR-wt cells that had not received low pH treatment. These data suggest that the rebinding of ligand to a desensitized receptor does not induce formation of a new receptor-containing structure but rather that the complexes are stable and characteristic of the hormone used to desensitize the receptor.

FET Occurs between GFP-LHR-wt and YFP-LHR-wt during Receptor Desensitization
We have previously shown that LHR-wt receptors on 293 cells are self-associated after binding of LH or hCG (14). To investigate whether this occurs only in response to hormone binding and whether receptors remain self-associated while desensitized, we measured the FET between hCG-treated LHRs coupled to either GFP and YFP. Before binding of hCG there was no significant energy transfer between GFP-LHR-wt and YFP-LHR-wt fusion proteins (Fig. 3Go). After desensitization of the receptor by 30 min exposure to 10 nM hCG and hormone removal, energy transfer efficiency between unoccupied LHRs increased to 18 ± 1% at 1 h. Values for energy transfer efficiency between unoccupied, desensitized LHRs decreased over the next 3 h but did not reach 0 until after 5 h when receptors were again responsive to hCG challenge.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Percent Energy Transfer Efficiency (%E) between Unoccupied LHR Fusion Proteins before (0 h) and after Initiation of Receptor Desensitization (1–5 h) by 10 nM hCG

At 0 and 5 h when receptors are hormone responsive, there is no significant energy transfer between LHRs. When receptors were not hormone responsive, there was measurable energy transfer between LHRs. The results are the average and SD of a total of 40 measurements made on individual cells with 20 measurements per day made on two separate days.

 
Positive values for energy transfer efficiency were accompanied by microscopically visible clustering or patches of the GFP-LHRs. As shown in Fig. 4Go, fluorescence from GFP-LHRs was distributed uniformly in the plasma membrane before hormone binding. After treatment with 10 nM hCG to desensitize the receptor, unoccupied GFP-LHR-wt was organized in clusters that appeared largest within 1 h after initiation of hormone treatment. Over the next 3 h, the size of clusters containing GFP-LHR-wt became progressively smaller and, by 5 h, the receptors were again uniformly distributed over the cell surface.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Fluorescence Images of GFP-LHR-wt before (Untreated) and after hCG-Induced Desensitization of the Receptor

When the receptors were capable of signal transduction, fluorescence from the unoccupied receptors was diffusely distributed over the membrane (untreated, 5 h). When receptors were desensitized, fluorescence from GFP was distributed in discrete patches. At 1 and 2 h the patches appeared larger than those seen 3 and 4 h after hormone treatment. The images presented here were obtained sequentially on one day.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
These studies demonstrate that desensitized LHRs are situated in large, slowly diffusing complexes containing self-associated receptors. Before binding of hormone, GFP-LHR-wt appear to be uniformly distributed throughout the plasma membrane and are not self-associated until after brief hormone treatment. In addition, rebinding of hormone, either LH or hCG, does not alter the diffusive properties of the desensitized receptor.

In FPR measurements of receptors occupied by TrITC-derivatized hormones, the mobile fractions for receptors desensitized by LH or hCG were characteristic of the desensitizing hormone complex regardless of which hormone was subsequently used as a receptor probe at 1 h (Table 1Go). Thus, any additional interactions between LHRs and, as examples, membrane lectins (15) or the cytoskeleton (16), must occur as the receptor-containing complex is forming. Once receptor-containing complexes have formed, the structure of these complexes seems to be unaffected by hormone rebinding until the complexes have dissociated at approximately 5 h. At early times after desensitization by LH or hCG, the diffusion coefficients measured for GFP-LHR-wt were similar to those of LH and hCG-occupied receptors on ovine (17) and rat (18) luteal cells. In spot FPR measurements of LHRs on ovine luteal cells, most hCG-occupied receptors were immobile on the cell surface, exhibiting less than 20% fluorescence recovery after photobleaching (17). The few mobile LHRs occupied by hCG had a 7-fold slower diffusion coefficient than did LH-occupied receptors (19). Although more ovine LH (oLH)-occupied receptors were mobile, fluorescence recovery after photobleaching was only about 30% (17), which is considerably less than the 60% fluorescence recovery typical of most membrane proteins (20).

Desensitization of the LHR occurred in less than 1 h, independent of the type of hormone used to desensitize the receptor. At 1 h, after desensitization by either LH or hCG, there was no response to hormone challenge, a result consistent with in vitro studies by Hunzicker-Dunn and co-workers (6), who have demonstrated in a cell-free system that LHRs on pig Graafian follicles are fully uncoupled from adenylate cyclase within 30 min. Similarly, Segaloff and co-workers (21) have shown in intact cells that rat wild-type LHR expressed in 293 cells is desensitized within 1 h.

Resensitization of the GFP-LHR-wt and LHR-wt is slow, requiring about 5 h. This rate is comparable to that reported by Ulaner et al. (22) for rat LHRs transfected in Y-1 cells and treated with either LH or hCG. Interestingly, resensitization of LHRs is significantly slower than that of the ß-adrenergic receptors, which occurs within 15–20 min following removal of hormone agonist with low pH buffer (23). Although LHR desensitization has been studied in vivo, it cannot be examined independently of down-regulation of receptor number (24) and degradation of mRNA transcripts (25, 26). Thus, the reappearance in vivo of functional LHRs on the plasma membrane is slow with times varying from 72 h (27) to 7 days (24), depending on cell type. This in vivo phenomenon must thus involve receptor replenishment through a very different mechanism than is involved in LHR resensitization in this study.

FET between receptors is indicative of dimerization or oligomerization of the receptor, a process that occurs in response to hCG binding and persists while the LHR is nonresponsive. Hebert and co-workers (28) have suggested that dimerization of the ß-adrenergic receptor is essential for receptor signaling. Nonfunctional receptors can be rescued by antibody-induced receptor dimerization (29), which is mediated by a dimerization sequence in the sixth transmembrane domain (28). Conn and co-workers (30) have shown that antibody-mediated dimerization of GnRH receptors is sufficient to stimulate LH secretion by pituitary cells. As is the case for ß-adrenergic receptor, self-association of LHRs may be required for receptor signaling. Rat LHRs containing a specific single point mutation are able to bind LH or hCG but do not signal or have measurable levels of FET between receptors after hormone binding (14).

There are, however, critical differences between the extent of LHR and ß-adrenergic receptor self-association. The ß-adrenergic receptor apparently forms discrete homodimers (28) that appear in unresolved small, punctate structures in fluorescence micrographs (31). In contrast, the LHR, which lacks this dimerization sequence in its TM6 domain, is present in larger clusters after binding of hormone. Luborsky et al. (32) have observed clusters of about 10–20 receptors on rat granulosa cells using electron microscopy after binding of high concentrations of LH. In addition, LHRs desensitized by hCG appear in larger scale macroscopic patches on the membranes of rat granulosa cells (33). The components of the large molecular weight complexes formed during receptor desensitization are not known, but it likely that these structures contain other nonreceptor proteins. LHRs exhibit very slow rotational motion in time-resolved phosphorescence anisotropy studies on ovine and bovine luteal cell membranes (34), and these slower motions are observed only when the hormone-receptor pair is functional, i.e. capable of activating adenylate cyclase (35). LHRs on bovine luteal cell plasma membranes are associated with a family of nonreceptor proteins (36), and this is presumably true in other species. On membranes from porcine granulosa cells, a number of signaling molecules, including, notably, ß-arrestin, must also be available for desensitization of the receptor (11).

We speculate that ligand binding to LHRs may also be associated with a redistribution of receptors in the membrane into small membrane domains in which signaling and/or receptor desensitization can occur. However, it does not appear that desensitized receptors are sequestered in membrane vesicles. First, there was no decrease in the number of LHRs on the plasma membrane either 1 or 5 h following brief hormone treatment, suggesting that there was no significant internalization of receptors. Second, although sequestration of LHRs is suggested by aggregation of the receptor into fluorescent clusters (Fig. 4Go), many LH-treated receptors remain laterally mobile after hormone treatment. If receptors were clustered into small vesicles, there would be essentially no receptor diffusion measured on the time scale of our experiments and no measurable recovery of fluorescence after photobleaching. Finally, the process initiated by exposure to either LH or hCG was reversible. The observed decreases in the rate of receptor lateral diffusion and the fraction of mobile receptors were transient and, upon recovery from receptor desensitization, receptor lateral diffusion was fast and the fraction of mobile receptors was high. Together these results suggest that the LHR forms clusters on the membrane that dissipate over time but that receptors present in these clusters are not internalized within membrane vesicles.

LHR dimerization or oligomerization may arguably be the initial step in signal transduction, although the sequence of events after binding of hormone to receptor is not clear. This could be followed by the movement of LHRs into membrane regions containing proteins required for signaling including, for example, G proteins, effector proteins, and proteins for desensitization or, alternatively, signal transduction could occur outside of membrane domains and be followed by movement of receptors into membrane domains containing proteins necessary for desensitization of the receptor. In addition to interactions with ß- arrestins, clustering of receptors into very large complexes may, as Amsterdam et al. (33) have suggested, interfere with receptor response to hormone. In either case, one would predict that the fraction of immobile receptors would increase upon desensitization of the receptor as we, in fact, observe. Dissociation of the receptor from complexes would result in an increase in the fraction of mobile receptors and the average diffusion coefficient for the receptor population. However, there is no productive signaling until a sufficiently large population of freely diffusing receptors and/or molecules necessary for signal transduction were again available outside specialized membrane domains.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
DMEM and DMEM containing high glucose were purchased from Irvine Scientific (Santa Ana, CA). Geneticin was purchased from Life Technologies, Inc., (Gaithersburg, MD). HEPES and nonessential amino acids were purchased from Sigma (St. Louis, MO). Horse serum was purchased from Summit Biotechnology (Fort Collins, CO) and FBS was purchased from HyClone Laboratories, Inc. (Logan, UT). oLH (NIH 28) was obtained from the National Hormone and Pituitary Program, NIADDK (Baltimore, MD) and hCG was purchased from Research Diagnostics Inc. (Flanders, NJ). TrITC and erythrosin isothiocyanate (ErITC) were purchased from Molecular Probes, Inc. (Eugene, OR).

Cell Lines
Dr. Tae Ji kindly provided 293 cells stably transfected with the wild-type rat LHR (LHR-wt cells). These cells, as well as untransfected 293 cells, were maintained in DMEM containing 10% horse serum, 100 U penicillin, 1,000 µg/ml streptomycin, and 10 mM HEPES, pH 7.4. Medium for LHR-wt cells was supplemented with 400 µg/ml geneticin. Untransfected CHO cells were maintained in DMEM supplemented with 4,500 µg/ml glucose and containing 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 1x MEM nonessential amino acids (Sigma).

Four CHO cell lines were used in this study including 1) untransfected cells; 2) cells expressing GFP-LHR-wt; 3) cells expressing YFP-LHR-wt; and 4) both GFP-LHR-wt and YFP-LHR-wt. Cells stably transfected with the GFP-LHR-wt construct were prepared as described previously (12) and maintained in CHO cell medium containing 200 µ g/ml G418. CHO cells expressing YFP-LHR-wt alone or expressing TFP-LHR-wt and GFP-LHR-wt were prepared using the same strategy described in detail for GFP-LHR-wt (12). To construct the YFP-LHR vector, the full-length receptor cDNA for rat LHR (rLHR), a gift from Dr. Deborah Segaloff, was subcloned into enhanced EYFP-N2 vector (CLONTECH Laboratories, Inc. Palo Alto, CA). A fragment of the LHR beginning at the intrinsic ScaI site (ACTATAACCACGCCATAGAC) and ending at the receptor 3'-end was removed, thus removing an intrinsic stop codon, and replaced with an in-frame BamHI site (underlined) at the 3'-end (CGGGATCCAACGCTCTCGGTGGTATGG). This fragment was amplified by PCR. The PCR product was digested with BamHI, as was the eYFP-N2plasmid, and ligated into ScaI and BamHI plasmid. The final fusion protein DNA sequence consisted of rLHR, a spacer sequence of the amino acids IHRPVAT, and enhanced YFP. The ScaI/BamHI fragment was confirmed by cDNA sequencing by Macromolecular Resources (Fort Collins, CO). CHO cells expressing YFP-LHR-wt alone were transfected with 1 µg of the rLHR-YFP vector using Lipofectamine-Plus (Life Technologies, Inc.) according to the manufacturer’s instructions. CHO cells coexpressing both GFP-LHR-wt and YFP-LHR-wt were transfected with 0.4 µg of GFP-LHR-wt and 1.2 µg of YFP-LHR-wt. After overnight culture, transfected cells were transferred into 150-mm plates and cultured with CHO cell medium containing 600 µg/ml G418 (Gemini Biological Products, Woodland CA) for 7 days. At this time, cells were washed with PBS and cloned by limiting dilution in 96-well plates (ISC BioExpress, Kaysville, UT) where they were incubated for 2 weeks before selection of fluorescent colonies and expansion of those colonies.

Preparation of TrITC and ErITC-Derivatized Hormones
Hormones were derivatized with ErITC or TrITC using a modification of methods described by Brinkley et al. (37) and described in detail elsewhere (34). The molar ratios for dye-hormone were determined spectrophotometrically. Hormone preparations used in these experiments had 1.0–1.5 mol of ErITC or TrITC per mole of oLH or hCG. Before use, all derivatized hormones in PBS were centrifuged at 130,000 x g for 10 min in a Beckman Coulter, Inc. Airfuge (Beckman Coulter, Inc., Palo Alto, CA) to remove any protein aggregates formed during storage at 4 C.

LHR Desensitization
LHRs were desensitized using a protocol that has been described in detail by others (21). Briefly, CHO cells or 293 cells expressing LHRs were incubated for 30 min with 10 nM LH or hCG at 37 C and then treated for 5 min at 4 C with 50 mM glycine, 100 mM NaCl, pH 3.0, PBS to remove hormone bound to the LHR. The cells were centrifuged at 300 x g and resuspended in fresh PBS. The extent of LHR desensitization was evaluated by measuring cellular cAMP production. At 1-h intervals after the time 0 when hormone was initially introduced to cell samples, either LH or hCG was again added for 1 h to cell suspensions containing 1 x 106 cells. At the end of this incubation, cellular cAMP was measured using a TiterFluor cAMP EIA kit (Perkin-Elmer Corp., Norwalk, CT) according to the manufacturer’s instructions. To reduce well-to-well variations in measured levels of cAMP, 96-well plates coated with antirabbit IgG were obtained from Pierce Chemical Co. (Rockford, IL) and were substituted for those provided in the TiterFluor cAMP kits.

After hormone treatment to desensitize the LHR, we verified that receptor number was unchanged and receptors were able to rebind hormone. This was done by measuring the phosphorescence intensity from ErITC-derivatized hormones bound to LHRs on LHR-wt cells. Cells were incubated with 10 nM ErITC-hCG or ErITC-LH for 1 h and washed two times by centrifugation at 300 x g for 3 min in balanced salt solution (BSS) to remove any unbound ligand. The sample was then deoxygenated for 15 min by purging with argon gas to eliminate phosphorescence quenching caused by O2 and placed in a 5-mm Suprasil quartz cuvette (Helma Cells, Inc., Jamaica, NY), which was inserted in a thermostatted cuvette holder. The frequency-doubled 532-nm output of a Spectra-Physics DCR-11 Nd:YAG laser was used to excite ErITC. The laser was operated at 10 Hz with a vertically polarized TEM00 output of 0.19 mJ and a beam 1/e2 radius of 2.5 mm at the sample. Phosphorescence emission from the sample was collected by an EMI 9816A photomultiplier tube, amplified by a Tektronix 476 oscilloscope (Tektronix, Inc., Beaverton, OR) and a 35 MHZ buffer amplifier, and digitized by a Nicolet 12/70 signal averager (Nicolet Instrument Corp., Madison, WI). After data acquisition was complete, the data were downloaded into a Pentium II microcomputer (Santa Clara, CA) (34). In a typical experiment, 105 cells labeled with ErITC-oLH or ErITC-hCG exhibited phosphorescence intensity of 5.8 ± 0.4 and 6.2 ± 0.1 in arbitrary units, respectively, while untreated cells had only 0.5 ± 0.3 U phosphorescence. Treating cells with low pH buffer removed hormone from the receptor as indicated by a decrease in the phosphorescence signal to baseline values (0.53–0.57). Rebinding ErTIC-LH or ErITC-hCG to LHRs at 1 h and 5 h after removal of hormone with low pH buffer increased the signals to 4.6 ± 1.5 and 6.2 ± 0.1, respectively, which did not differ significantly from signals measured after initial binding of either ErITC-LH or ErITC-hCG. To verify that there were no nonspecific interactions of the ErITC-hormones with human kidney 293 cells, 293 cells that did not contain expression vectors for the LHR were treated with 10 nM ErITC-rLH or -hCG. To determine whether binding of the ErITC-derivatized hormones was specific, cells were preincubated with excess oLH before labeling with ErITC-oLH in some experiments. In both cases, there was no detectable phosphorescence signal from the cell sample.

Spot and Fringe FPR Measurements
The optical system for spot and fringe FPR measurements and the methods used for data analysis have been described in detail (38). The microscope objective used in these studies was a 40x objective of NA 0.65 (Carl Zeiss, Thornwood, NY). Standard Carl Zeiss filter and dichroic mirror sets for fluorescein isothiocyanate (FITC) and TrITC fluorescence were used. Cells were examined under coverslip on well slides while temperature was maintained by a thermal stage with a temperature range of 0 C to 40 C. For spot measurements of unoccupied GFP-LHR-wt lateral diffusion, an attenuated Coherent Radiation Innova 100 argon ion laser beam at 488 nm was focused to a spot on the plasma membrane of 0.41 µm 1/e2 radius. Bleaching and probe beam powers were 1.4 mW and 1.7 µW, respectively. Data were acquired at 50 msec/point for 20 sec before, and for 30 sec after, a 150 msec bleaching pulse. For fringe measurements of TrITC-LH or TrITC-hCG lateral diffusion, the region illuminated at the sample had a 1/e2 radius of at least 18 µm, and the photometer acceptance region was large enough to encompass the entire cell. The fringe spacing used in these experiments was 2.3 µm. Because of the large interrogated area, 1.3 W in the bleaching pulse and 3 mW in the probe beam were used. Unadjusted raw data were represented directly in terms of the various parameters associated with a given measurement including the prebleach and immediate postbleach fluorescence levels and a function representing the recovery kinetics in terms of a decay half-time. The desired diffusion coefficient and the extent of fluorophores mobile on the timescale of the experiment were evaluated directly by a nonlinear least-squares procedure and from the measured time t1/2 at which fluorescence recovery was half-complete and from the known optical parameters evaluated (38, 39, 40). A detailed comparison of the methods used to analyze results from spot and fringe FPR measurements is presented in Munnelly et al. (40). A review of biophysical methods for measuring translational diffusion is presented by Jovin and Vaz (41). Each data point presented in either spot or fringe FPR measurements represented a total of 60 measurements with 20 measurements made on three different days.

Single Cell FET
Slower rates of fluorescence decay for cells expressing both GFP-LHR donor and YFP-LHR acceptor (D+A) than for cells expressing GFP-GnRHR only (D) were indicative of energy transfer from fluorescence donor to acceptor. For this donor-acceptor pair, Förster’s r0 is calculated to be 56 A (42); therefore, energy transfer occurs to a measurable extent only when the donor and acceptor are separated by distances less than about 100 A. FET measurements were made using a fluorescence microscope photometer based on an inverted-configuration Carl Zeiss Axiomat microscope and associated components used for spot FPR measurements. Fluorescence excitation was provided by a Coherent Innova 100 argon ion laser (Coherent, Inc., Santa Clara, CA) operating under light control at 488 nm. The intensity of the laser radiation focused on the cell was 45 mW, and this was held constant between measurements on LHR-GFP cells or on LHR-GFP/YFP expressing cells. The 1/e2 Gaussian spot diameter was 18 µm. Donor fluorescence from GFP was isolated with a standard fluorescein filter set together including a short pass fluorescein-selective filter to remove yellow fluorescence contributed by YFP-LHR-wt. This combination was highly effective in rejecting YFP fluorescence. In individual experiments, cells were identified and centered in the microscope field. At time zero, an electronically controlled shutter was opened to allow laser radiation to illuminate the cell. Simultaneously, a computer program was activated to record the output of the photomultiplier measuring membrane fluorescence. Data were collected at 0.01-sec intervals for 10 sec. Typically about 20 cells in each sample were photobleached in this manner. In each experiment, four sets of identically handled cells were examined including untransfected CHO cells, CHO cells expressing GFP-LHR-wt alone, CHO cells expressing YFP-LHR-wt alone, and cells expressing both GFP-LHR-wt and YFP-LHR-wt. Cells expressing LHR-YFP alone produced signals that did not differ significantly from those of untransfected CHO cells using the fluorescein-selective filter set. Signal from CHO cells expressing LHR-GFP or LHR-GFP/YFP was greater than 8-fold higher than background levels. Thus, the rate constants for photobleaching of GFP on cells expressing LHR-GFP alone (kD) or LHR-GFP/YFP (kDA) were analyzed from data traces as described in detail previously (43). The energy transfer efficiency was expressed as a percent (%E) and was calculated from these rate constants using %E = (1 - kDA/kD) x 100 (44).

Fluorescence Imaging of GFP-LHR-wt
GFP-LHR-wt fluorescence from individual cells was measured on a Carl Zeiss Axiovert microscope equipped with a 1.4 NA oil immersion condenser and a 1.3 NA 63x Plan-Apochromat objective. A 100 W arc lamp was used to excite the sample and a standard FITC filter set was used to isolate the green (GFP) signal. Fluorescent images were obtained using a Dage-MTI CCD300 digital camera (Dage-MTI, Inc., Michigan City, IN) using an integration time of 30 sec, digitized, pseudo-colored via Metamorph imaging software (Universal Imaging, West Chester, PA), and exported to Adobe PhotoShop (Adobe Systems, Inc., San Jose, CA) for further image processing. On two separate days, a minimum of 10 cells for each sample were imaged and analyzed.


    ACKNOWLEDGMENTS
 
We thank the National Hormone and Pituitary Program, NIDDKD, for providing the oLH and hCG. We would also like to thank Dr. Scott Nelson for his help in the preparation of the YFP-LHR-wt cell line.


    FOOTNOTES
 
Address requests for reprints to: Dr. Deborah A. Roess, Department of Physiology, Colorado State University, Fort Collins, Colorado. E-mail: Deborah.Roess{at}ColoState.edu

This work was supported by NIH Grants HD-23236 and HD-01067 (D.A.R.).

1 Abbreviations: LHR-wt, 293 human embryonic kidney cells with an expression vector for the wild-type LH receptor; GFP-LHR-wt, CHO cells expressing the rat LH receptor-GFP fusion protein; YFP-LHR-wt, CHO cells expressing the rat LH receptor-YFP fusion protein. Back

Revision received December 27, 2000. Accepted for publication January 2, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Hunzicker-Dunn M, Birnbaumer L 1975 Adenylyl cyclase activities in ovarian tissues. IV. Gonadotropin-induced desensitization of the luteal adenylyl cyclase throughout pregnancy and pseudopregnancy in the rabbit and the rat. Endocrinology 99:211–222[Abstract/Free Full Text]
  2. Sharpe R 1976 hCG-induced decrease in availability of rat testis receptors. Nature 264:644–646[CrossRef][Medline]
  3. Catt K, Harwood J, Richert N, Conn P, Conti M, Dufau M 1979 Luteal desensitization: hormonal regulation of LH receptors, adenylate cyclase and steroidogenic response in the luteal cell. Adv Exp Med Biol 112:647–662[Medline]
  4. Hunzicker-Dunn M 1981 Rabbit follicular adenylyl cyclase activity. II. Gonadotropin-induced desensitization in granulosa cells and follicle shells. Biol Reprod 24:279–286[Abstract]
  5. Conti M, Harwood J, Dufau M, Catt KJ 1977 Effect of gonadotropin-induced receptor regulation on biological responses of isolated rat luteal cells. J Biol Chem 252:8869–8874[Free Full Text]
  6. Bockaert J, Hunzicker-Dunn M, Birnbaumer L 1976 Hormone-stimulated desensitization of hormone-dependent adenylyl cyclase. J Biol Chem 251:2653–2663[Abstract/Free Full Text]
  7. Dix CJ, Schumacher M, Cooke BA 1982 Desensitization of tumor Leydig cells by lutropin: evidence for uncoupling of the lutropin receptor from the guanine nucleotide-binding protein. Biochem J 202:739–745[Medline]
  8. Wang Z, Liu X, Ascoli M 1997 Phosphorylation of the lutropin/choriogonadotropin receptor facilitates uncoupling of the receptor from adenyl cyclase and endocytosis of the bound hormone. Mol Endocrinol 11:183–192[Abstract/Free Full Text]
  9. Lefkowitz RJ, Hausdorff WP, Caron MG 1990 Role of phosphorylation in desensitization of the B-adrenoreceptor. Trends Pharmacol Sci 11:190–194[CrossRef][Medline]
  10. Lamm M, Hunzicker-Dunn M 1994 Phosphorylation- independent desensitization of the luteinizing hormone/chorionic gonadotropin receptor in porcine follicular membranes. Mol Endocrinol 8:1537–1546[Abstract/Free Full Text]
  11. Mukherjee S, Palczewski K, Gurevich V, Hunzicker-Dunn M 1999 ß-Arrestin-dependent desensitization of luteinizing hormone/choriogonadotropin receptor is prevented by a synthetic peptide corresponding to the third intracellular loop of the receptor. J Biol Chem 274:12984–12989[Abstract/Free Full Text]
  12. Horvat RD, Nelson S, Clay CM, Barisas BG, Roess DA 1999 Intrinsically fluorescent luteinizing hormone receptor demonstrates hormone-driven aggregation. Biochem Biophys Res Commun 256:382–385
  13. Golan DE, Veatch W 1980 Lateral mobility of Band 3 in the human erythrocyte membrane studied by fluorescence photobleaching recovery: evidence for control by cytoskeletal interactions. Proc Natl Acad Sci USA 77:2537–2541[Abstract/Free Full Text]
  14. Roess DA, Horvat RD, Munnelly H, Barisas BG 2000 Luteinizing hormone receptors are self-associated in the plasma membrane of hormone-responsive cells. Endocrinology 141:4518–4528[Abstract/Free Full Text]
  15. Anderson W, Kang Y-H, Perotti M, Bramley T, Ryan R 1979 Interactions of gonadotropins with corpus luteum membranes. III. Electron microscopic localization of [125I]-hCG binding to sensitive and desensitized ovaries seven days after PMSG-hCG. Biol Reprod 20:362–376[Abstract]
  16. Roess D, Rahman NA, Munnelly H, Meiklejohn BI, Brady C, Barisas BG 1998 Luteinizing hormone receptors are associated with non-receptor plasma membrane proteins on bovine luteal cell membranes. Biochim Biophys Acta 1371:5–10[Medline]
  17. Niswender G, Roess D, Sawyer H, Silvia W, Barisas B 1985 Differences in the lateral mobility of receptors for luteinizing hormone (LH) in the luteal cell plasma membrane when occupied by ovine LH versus human chorionic gonadotropin. Endocrinology 116:164–169[Abstract/Free Full Text]
  18. Roess DA, Rahman NA, Kenny N, Barisas BG 1992 Lateral and rotational dynamics of LH receptors on rat luteal cells. Biochim Biophys Acta 1137:309–316[Medline]
  19. Roess DA, Niswender GD, Barisas BG 1988 Cytochalasins and colchicine increase the lateral mobility of human chorionic gonadotropin-occupied luteinizing hormone receptors on ovine luteal cells. Endocrinology 122:261–269[Abstract/Free Full Text]
  20. Jacobson K, Ishihara A, Inman R 1987 Lateral diffusion of proteins in membranes. Annu Rev Physiol 49:163–175[CrossRef][Medline]
  21. Sanchez-Yague J, Rodriguez MC, Segaloff DL, Ascoli M 1992 Truncation of the cytoplasmic tail of the lutropin/choriogonadotropin receptor prevents agonist-induced uncoupling. J Biol Chem 267:7217–7220[Abstract/Free Full Text]
  22. Ulaner G, Chuang J, Lin W, Woodbury D, Myers R, Moyle W 1999 Desensitization and resensitization of lutropin receptors expressed in transfected Y-1 adrenal cells. J Endocrinol 163:289–297[Abstract]
  23. Lefkowitz RJ 1998 G protein-coupled receptors. J Biol Chem 273:18677–18680[Free Full Text]
  24. Conti M, Harwood J, Dufau M, Catt K 1977 Effect of gonadotropin-induced receptor regulation on biological responses of isolated rat luteal cells. J Biol Chem 352:8869–8874
  25. Camp TA, Rahal JO, Mayo KE 1991 Cellular localization and hormonal regulation of follicle-stimulating hormone and luteinizing hormone receptor messenger RNAs in the rat ovary. Mol Endocrinol 5:1405–1417[Abstract/Free Full Text]
  26. Peng X-R, Hsueh A, LaPolt P, Bjersing L, Ny T 1991 Localization of luteinizing hormone receptor messenger ribonucleic acid expression in ovarian cell types during follicle development and ovulation. Endocrinology 129:3200–3207[Abstract/Free Full Text]
  27. Conti M, Harwood J, Hsueh A, Dufau M, Catt K 1976 Gonadotropin-induced loss of hormone receptors and desensitization of luteal adenylate cyclase in the ovary. J Biol Chem 251:7729–7731[Abstract/Free Full Text]
  28. Hebert TE, Moffett S, Morello J, Loisel TP, Bichet DG, Barret C, Bouvier M 1996 A peptide derived from a ß2-adrenergic receptor transmembrane domain inhibits both receptor dimerization and activation. J Biol Chem 271:16384–16392[Abstract/Free Full Text]
  29. Hebert TE, Loisel TP, Adam L, Ethier N, St. Onge S, Bouvier M 1998 Functional rescue of a constitutively desensitized ß2AR through receptor dimerization. Biochem J 330:287–293
  30. Conn PM, Rogers DC, Stewart JM, Niedel J, Sheffield T 1982 Conversion of a gonadotropin-releasing hormone antagonist to an agonist. Nature 296:653–655[CrossRef][Medline]
  31. von Zastrow M, Kobilka B 1992 Ligand-regulated internalization and recycling of human ß-2-adrenergic receptors between the plasma membrane and endosomes containing transferrin receptors. J Biol Chem 267:3530–3538[Abstract/Free Full Text]
  32. Luborsky J, Slater W, Behrman H 1984 Luteinizing hormone (LH) receptor aggregation: modification of ferritin-LH binding and aggregation by prostaglandin F2{alpha} and ferritin-LH. Endocrinology 115:2217–2225[Abstract/Free Full Text]
  33. Amsterdam A, Berkowitz A, Nimrod A, Kohen F 1980 Aggregation of luteinizing hormone receptors in granulosa cells: a possible mechanism for desensitization to the hormone. Proc Natl Acad Sci USA 77:3440–3445[Abstract/Free Full Text]
  34. Philpott CJ, Rahman NA, Kenny N, Barisas BG, Roess DA 1995 Rotational dynamics of luteinizing hormone receptors on bovine and ovine luteal cell plasma membranes. Biol Reprod 53:645–650
  35. Roess DA, Brady CJ, Barisas BG 2000 Biological function of the LH receptor is associated with slow receptor rotational diffusion. Biochim Biophys Acta 1464:242–250[Medline]
  36. Meiklejohn BI, Rahman NA, Roess DA, Barisas BG 1997 5-Iodonapthyl-1-azide labeling of specific plasma membrane proteins via energy transfer activation. Biochim Biophys Acta 1324:320–332[Medline]
  37. Brinkley M 1992 A brief survey of methods for preparing protein conjugates with dyes, haptens, and cross-linking reagents. Bioconjug Chem 3:2–13[CrossRef][Medline]
  38. Barisas BG, Munnelly HM, Roess DA 1997 Interferometric fringe patterns interrogate entire cell surfaces in fluorescence photobleaching recovery measurements of lateral diffusion. Proc Int Soc Optical Eng 2980:523–531
  39. Leuther M, Peacock J, Krakauer H, Barisas B 1981 Changes in lectin receptor lateral mobilities accompany lymphocyte stimulation. J Immunol 127:893–899[Abstract]
  40. Munnelly HM, Roess DA, Wade WF, Barisas BG 1998 Interferometric fringe fluorescence photobleaching recovery interrogates entire cell surfaces. Biophys J 75:1131–1138[Medline]
  41. Jovin TM, Vaz WLC 1989 Rotational and translational diffusion in membranes measured by fluorescence and phosphorescence methods. Methods Enzymol 172:471–513[Medline]
  42. Patterson GH, Piston DW, Barisas BG 2000 Förster distances between green fluorescent protein pairs. Anal Biochem 284:438–440[CrossRef][Medline]
  43. Young RM, Arnette JK, Roess DA, Barisas BG 1994 Quantitation of fluorescence energy transfer between cell surface proteins via fluorescence donor photobleaching kinetics. Biophys J 67:881–888[Medline]
  44. Lakowicz J 1983 Quenching of fluorescence. In: Principles of Fluorescence Spectroscopy, ed 1. Plenum Press, New York, pp 257–301



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. Guan, X. Feng, X. Wu, M. Zhang, X. Zhang, T. E. Hebert, and D. L. Segaloff
Bioluminescence Resonance Energy Transfer Studies Reveal Constitutive Dimerization of the Human Lutropin Receptor and a Lack of Correlation between Receptor Activation and the Propensity for Dimerization
J. Biol. Chem., March 20, 2009; 284(12): 7483 - 7494.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Thomas, C. A. Nechamen, J. E. Mazurkiewicz, M. Muda, S. Palmer, and J. A. Dias
Follice-Stimulating Hormone Receptor Forms Oligomers and Shows Evidence of Carboxyl-Terminal Proteolytic Processing
Endocrinology, May 1, 2007; 148(5): 1987 - 1995.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J.-P. Pin, R. Neubig, M. Bouvier, L. Devi, M. Filizola, J. A. Javitch, M. J. Lohse, G. Milligan, K. Palczewski, M. Parmentier, et al.
International Union of Basic and Clinical Pharmacology. LXVII. Recommendations for the Recognition and Nomenclature of G Protein-Coupled Receptor Heteromultimers
Pharmacol. Rev., March 1, 2007; 59(1): 5 - 13.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. M. Navratil, T. A. Farmerie, J. Bogerd, T. M. Nett, and C. M. Clay
Differential Impact of Intracellular Carboxyl Terminal Domains on Lipid Raft Localization of the Murine Gonadotropin-Releasing Hormone Receptor
Biol Reprod, May 1, 2006; 74(5): 788 - 797.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. M. L. Smith, Y. Lei, J. Liu, M. E. Cahill, G. M. Hagen, B. G. Barisas, and D. A. Roess
Luteinizing Hormone Receptors Translocate to Plasma Membrane Microdomains after Binding of Human Chorionic Gonadotropin
Endocrinology, April 1, 2006; 147(4): 1789 - 1795.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. Costagliola, E. Urizar, F. Mendive, and G. Vassart
Specificity and promiscuity of gonadotropin receptors
Reproduction, September 1, 2005; 130(3): 275 - 281.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Cezanne, S. Lecat, B. Lagane, C. Millot, J.-Y. Vollmer, H. Matthes, J.-L. Galzi, and A. Lopez
Dynamic Confinement of NK2 Receptors in the Plasma Membrane: IMPROVED FRAP ANALYSIS AND BIOLOGICAL RELEVANCE
J. Biol. Chem., October 22, 2004; 279(43): 45057 - 45067.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. A. Roess and S. M.L. Smith
Self-Association and Raft Localization of Functional Luteinizing Hormone Receptors
Biol Reprod, December 1, 2003; 69(6): 1765 - 1770.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hunzicker-Dunn, G. Barisas, J. Song, and D. A. Roess
Membrane Organization of Luteinizing Hormone Receptors Differs between Actively Signaling and Desensitized Receptors
J. Biol. Chem., October 31, 2003; 278(44): 42744 - 42749.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Latif, P. Graves, and T. F. Davies
Ligand-dependent Inhibition of Oligomerization at the Human Thyrotropin Receptor
J. Biol. Chem., November 15, 2002; 277(47): 45059 - 45067.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. C. Overton and K. J. Blumer
The Extracellular N-terminal Domain and Transmembrane Domains 1 and 2 Mediate Oligomerization of a Yeast G Protein-coupled Receptor
J. Biol. Chem., October 25, 2002; 277(44): 41463 - 41472.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. Ji, C. Lee, Y. Song, P. M. Conn, and T. H. Ji
Cis- and Trans-Activation of Hormone Receptors: the LH Receptor
Mol. Endocrinol., June 1, 2002; 16(6): 1299 - 1308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horvat, R. D.
Right arrow Articles by Roess, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horvat, R. D.
Right arrow Articles by Roess, D. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals