Molecular Endocrinology 15 (4): 575-588
Copyright © 2001 by The Endocrine Society
The
-Subunit of the Epithelial Sodium Channel Is an Aldosterone-Induced Transcript in Mammalian Collecting Ducts, and This Transcriptional Response Is Mediated via Distinct cis-Elements in the 5'-Flanking Region of the Gene
Verity E. Mick,
Omar A. Itani,
Randy W. Loftus,
Russell F. Husted,
Thomas J. Schmidt and
Christie P. Thomas
Department of Internal Medicine (V.E.M., O.A.I., R.W.L., R.F.H.,
C.P.T.) Department of Physiology and Biophysics (T.J.S.),
University of Iowa College of Medicine and the Veterans Affairs
Medical Center (C.P.T.) Iowa City, Iowa 52242
 |
ABSTRACT
|
|---|
Aldosterone stimulates Na+
reabsorption in the collecting ducts by increasing the activity of the
epithelial sodium channel, ENaC. Systemic administration of aldosterone
increases
ENaC mRNA expression in mammalian kidney, suggesting that
the
ENaC gene is a target for aldosterone action in the distal
nephron. To determine whether aldosterone increases
ENaC gene
transcription, a portion of the
ENaC 5'- flanking region coupled to
luciferase was transfected into MDCK-C7 cells, a collecting duct cell
line with aldosterone-stimulated Na+ transport.
Both dexamethasone and aldosterone stimulated
ENaC-coupled reporter
gene activity via the glucocorticoid receptor (GR), and this response
correlated with the effect of these hormones on endogenous
ENaC
expression. The aldosterone-stimulated
ENaC expression was blocked
by actinomycin D, and aldosterone had no effect on
ENaC mRNA decay,
confirming a transcriptional effect. In HT-29 cells, a
GR/mineralocorticoid receptor (MR)-deficient colonic cell line with
constitutive
ENaC expression, cotransfection with GR or MR restored
aldosterone-stimulated
ENaC gene transcription, although aldosterone
had a functional preference for MR. Analysis of deletion constructs
confirmed that a single imperfect glucocorticoid response element (GRE)
is necessary and sufficient to confer the aldosterone responsiveness to
the
ENaC gene promoter in MDCK-C7 and HT-29 cells. These results
confirm that
ENaC is an aldosterone- induced transcript in the
collecting duct and delineates the molecular mechanism for this effect.
 |
INTRODUCTION
|
|---|
Na+ is reabsorbed in the cortical and
medullary collecting ducts of the mammalian kidney via the apical
amiloride-sensitive epithelial sodium channel (ENaC). The ENaC complex
is composed of at least three different subunits,
, ß, and
,
that have now been cloned from several species (1). These channels
provide the final regulatory control for Na+
homeostasis, and activating mutations in channel subunits, which alter
the rate of Na+ transport, can cause hypertension
with hypokalemia and alkalosis (2, 3). Increased circulating
mineralocorticoids, as seen in primary hyperaldosteronism, also lead to
hypertension with hypokalemic alkalosis from increased reabsorption of
Na+ via ENaC.
Corticosteroids are among the best known regulators of
amiloride-sensitive Na+ transport in the
collecting ducts, distal colon, and in airway epithelia. In these
tissues, long-term corticosteroid treatment leads to increased
expression of one or more ENaC subunits. In cultured rat lung
epithelial cells, inner medullary collecting duct cells (IMCD), and
cortical collecting duct (CCD) cells, dexamethasone- and
aldosterone-stimulated Na+ transport is
associated with an increase in steady-state
ENaC mRNA levels (4, 5).
The effects of corticosteroids on ENaC expression in renal tissues have
also been studied in vivo. While Renard et al.
(6) initially reported that dexamethasone infusion in rats had
no effect on ENaC expression in kidney cortex, several subsequent
studies have reported that either dexamethasone or aldosterone infusion
lead to increased expression of
ENaC mRNA in the renal cortex and
medulla, without effects on other subunits (7, 8, 9). Recent studies have
clearly demonstrated that elevated circulating aldosterone levels
increase the abundance of the
ENaC protein in the connecting tubule
and in the principal cells of the CCD (10, 11). We have shown that
dexamethasone increases amiloride-sensitive Na+
transport in a human bronchiolar epithelial cell and a mouse CCD line
and that this correlates temporally with an increased expression of
ENaC (12). The glucocorticoid-mediated increase in
ENaC mRNA is
transcriptionally regulated, does not require protein synthesis, and
involves the activation of a glucocorticoid response element (GRE) in
the 5'-flanking region of the human
ENaC (h
ENaC) gene, a finding
that has been confirmed by others in human and rat epithelia
(12, 13, 14).
Aldosterone, like glucocorticoids, binds to cytosolic receptors, which
then translocate to the nucleus where the hormone-receptor complex
enhances transcription of target genes (15, 16). There has been
considerable debate, however, about the mechanism of
aldosterone-mediated increase in Na+ transport in
mineralocorticoid-responsive epithelia. In a well studied model of
Na+ transport, the A6 cell line, there is some
evidence for an early aldosterone effect on Na+
conductance that is transcription independent (17). The later effect of
aldosterone on Na+ conductance appears to require
transcription and translation of intermediate molecules that modify the
function of preexisting Na+ channels. For
example, aldosterone has been shown to stimulate carboxymethylation of
ßENaC in A6 cells, a process that might involve the regulation of
S-adenosyl-L-homocysteine hydrolase
activity (18, 19). Using subtractive hybridization and differential
display techniques, several investigators have begun to identify
aldosterone-induced proteins in A6 cells and in mammalian collecting
duct cells (20, 21, 22). One of these, a serum- and
glucocorticoid-regulated kinase 1 (sgk1), is an early
aldosterone-induced gene that enhances Na+
current when coexpressed with ENaC cDNAs in Xenopus oocytes
(21, 22). While the target protein(s) for this kinase is not known,
aldosterone has been shown to increase phosphorylation of serine and
threonine residues on ß- and
ENaC subunits when these subunits are
heterologously expressed in MDCK cells (23). Another aldosterone-
induced gene product in the toad kidney, Kras2A, also enhances
Na+ transport in A6 cells and in heterologous
expression systems (20, 24).
Since aldosterone increases ENaC mRNA and protein levels in certain
tissues, components of the ENaC complex may themselves be
aldosterone-induced proteins. The molecular basis for the aldosterone-
mediated increase in
ENaC mRNA and protein has previously been
unknown. In this paper we show that aldosterone increases
ENaC
expression in collecting duct epithelia solely via an increase in
transcription of the
ENaC gene. We also show that aldosterone can
signal via glucocorticoid receptor (GR) or mineralocorticoid receptor
(MR) in a cell-specific manner and confirm that a hormone response
element in the
ENaC 5'-flanking region is required for the
aldosterone- mediated transcription of
ENaC.
 |
RESULTS
|
|---|
We have determined the genomic organization of the 5'-end of the
h
ENaC gene and have begun to characterize transcriptional regulatory
elements in its 5'- flanking region. The h
ENaC gene has two
transcription start sites, defining the 5' end of alternate first exons
that are under the control of separate promoters P1 and P2 (12). The P1
promoter is TATA and CAAT-less but contains several transcription
factor binding motifs including AP1, AP2, GAGA, CREB, NFE1, Sp1, TTF,
and the response elements for retinoic acid (RARE), serum, metals
(MRE), and glucocorticoids (GRE) (Fig. 1
). We have previously shown that
glucocorticoids increase
ENaC gene transcription in lung and in the
collecting duct via a GRE at -157 to -142 in the h
ENaC promoter
(12).

View larger version (55K):
[in this window]
[in a new window]
|
Figure 1. Nucleotide Sequence of the 5'-Flanking Region of
h EnaC
Potential transcription factor binding motifs are boxed.
GREs are named as referred to in this paper (Up-GRE and Dn-GRE). The
transcription initiation site for h ENaC-1, identified by RPA, is
indicated by a bent arrow. The extent of the longest cDNA
clone identified by 5'-RACE in human kidney is indicated by an
asterisk (49 ).
|
|
To begin to identify the molecular basis for the effect of aldosterone
on
ENaC mRNA expression, we screened two mammalian collecting duct
cell lines for aldosterone-regulated Na+
transport. The M-1 cell line established from the mouse CCD has
glucocorticoid-regulated Na+ transport (12, 25, 26), and the MDCK-C7 cell line established from the canine distal
nephron exhibits aldosterone- and glucocorticoid- regulated
Na+ transport (27). M-1 cells, when grown on
filters and stimulated with 100 nM aldosterone for 24
h, showed a small increase in short-circuit current (Isc) compared with
that in control filters. As we have previously reported, dexamethasone
robustly increased Isc after 24 h (Fig. 2A
). In contrast to the M-1 cell line,
MDCK-C7 cells showed a significant increase in aldosterone and
dexamethasone-stimulated Isc (Fig. 2B
). This Isc was
benzamil-sensitive, suggesting that the corticosteroid-mediated
increase in ion transport occurred via the amiloride-inhibitable
epithelial Na+ channel (Fig. 2C
). These results
also suggested that the MDCK-C7 cell line was a suitable model to
evaluate mechanisms of aldosterone action. To test whether the effect
of aldosterone on
ENaC expression may have a transcriptional basis,
the
ENaC promoter containing genomic sequence from 1,388 to +55
(Fig. 2D
) coupled to luciferase was transfected into these cell lines
and then exposed to 100 nM dexamethasone, aldosterone, or
vehicle for 24 h. Dexamethasone stimulated luciferase expression
from
ENaC genomic fragments in both cell lines while aldosterone
stimulated luciferase expression only in MDCK-C7 cells (Fig. 2
, E and
F). These results were consistent with the Na+ transport
measurements and suggested that the cis-elements required
for aldosterone action are contained within this genomic sequence.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Corticosteroid-Stimulated Electrogenic
Na+ Transport and ENaC Gene Transcription in MDCK-C7
Cells
Panels A and B, Short-circuit current in M-1 cells (panel A) and
MDCK-C7 cells (panel B) treated with 100 nM aldosterone,
dexamethasone, or vehicle (control) for 24 h (n = 36
± SEM; *, P < 0.0005; @,
P < 0.001; $, P <
0.05 compared with control Isc at 24 h). Panel C, Effect of 10
µM benzamil on vehicle and aldosterone-regulated Isc,
n = 4 ± SEM; *, P < 0.0005
compared with control Isc, #, P <
0.0005 compared with Isc in the presence of benzamil. The
benzamil-insensitive current did not differ between the two groups.
Panel D, Schematic of the ENaC promoter-luciferase construct used
for transient transfections in mammalian cell lines. Panel E and F, M-1
cells (panel E) and MDCK-C7 cells (panel F) treated with 100
nM aldosterone, dexamethasone, or vehicle (control) for
24 h following transfection with the ENaC promoter-luciferase
construct (n = 36 ± SEM; *,
P < 0.0005; #,
P < 0.01 compared with vehicle).
|
|
To determine whether the effect of aldosterone on
ENaC gene
transcription was receptor mediated, we tested the effects of the GR
antagonist, RU38486, and the MR antagonist, spironolactone. While
dexamethasone stimulation was abolished by RU38486, either RU38486 or
spironolactone (Fig. 3A
) could
significantly inhibit stimulation by aldosterone. As RU38486 is a
partial GR agonist and spironolactone may also block the GR, we
evaluated the dose-response curve for aldosterone in the presence and
absence of a specific GR antagonist, ZK98299. We also evaluated the
response to RU28362, a GR-specific agonist in the presence and absence
of a specific MR antagonist, RU28318. Both aldosterone and RU28362
increase
ENaC gene transcription in a dose-dependent manner (Fig. 3
, B and C). In the presence of a GR antagonist, ZK98299, the aldosterone
response is markedly shifted to the right, suggesting that the
aldosterone effect is mediated, predominantly, via the GR. In the
presence of a MR antagonist, RU28318, the RU28362 response is
unchanged, confirming that this effect is also mediated via the GR.
These results indicated that either functional MRs are absent from
these cells or that the cis-elements required for
MR-dependent trans-activation of
ENaC were not contained
within this construct. Using a standard radioligand receptor-binding
assay, we then determined whether GR and MR protein were present in
MDCK-C7 cytosolic extracts. These studies indicated that binding
consistent with GR was present within MDCK-C7 cytosolic extracts, while
no specific aldosterone binding was detected (Fig. 3D
). Taken together,
these results indicated that functional MR was absent in MDCK-C7 cells
and that aldosterone binding to GR was sufficient to activate
ENaC
gene transcription. These results also indicated that aldosterone
binding and trans- activation via GR were cell specific
as M-1 cells, despite having a classic GR response on the
ENaC
promoter, do not exhibit an aldosterone response (Fig. 2E).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3. Steroid Receptors and ENaC Gene Transcription in
MDCK-C7 Cells
Panel A, Effect of steroid receptor antagonists, RU38486 or
spironolactone (1 µM), on aldosterone- or
dexamethasone-mediated (100 nM) ENaC gene transcription
in MDCK-C7 cells (n = 6 ± SD; *,
P < 0.01 compared with vehicle; #,
P < 0.05 compared with absence of antagonist;
@, P < 0.001 compared with vehicle;
$, P < 0.001 compared with absence of
antagonist). Panel B, Effect of MR agonist aldosterone is
dose-dependent and can be blocked by 1 µM of GR
antagonist, ZK98299. Each point represents the average
of two values and is representative of other experiments. Panel C,
Effect of GR agonist RU28362 is dose-dependent and is not blocked by 1
µM of MR antagonist, RU28318. Each point
represents the average of two values and is representative of
other experiments. Panel E, Receptor binding assay shows that MDCK-C7
cells contain GR but do not contain MR.
|
|
To enable us to study the effects of aldosterone on endogenous
ENaC
mRNA expression in MDCK-C7 cells, we cloned the canine
ENaC
(c
ENaC) cDNA. First, mRNA from dexamethasone and aldosterone-treated
MDCK-C7 cells was reverse transcribed and then amplified by PCR using
primers designed to regions of the
ENaC mRNA that are highly
conserved between human and rat (28, 29). A specific 612-bp fragment
was amplified, cloned into pCR-XLTOPO, and sequenced (GenBank accession
number AF209748). The canine
ENaC cDNA has 91% homology with the
human sequence and 85% homology with the rat sequence, while the
translated sequence is 89% identical to the human and 87% identical
to the rat sequence (data not shown).
The effects of aldosterone and dexamethasone on steady state
ENaC
mRNA levels in MDCK-C7 cells were studied by ribonuclease protection
assay (RPA). Both aldosterone and dexamethasone increase
ENaC
expression in these cells (Fig. 4
). As
with the transfected
ENaC promoter constructs,
aldosterone-stimulated
ENaC expression was blocked by ZK98299 while
the dexamethasone-stimulated
ENaC expression was not inhibited by
RU28318. Furthermore, the effect of these corticosteroids on
ENaC
expression correlated well with their effects on
ENaC gene
transcription, suggesting that the corticosteroid-mediated increases in
mRNA expression may be mediated solely by an increase in transcription
of
ENaC mRNA.
To determine whether the increase in aldosterone-stimulated
Na+ transport in MDCK-C7 cells followed the
increase in
ENaC mRNA levels, Isc and
ENaC mRNA levels were
measured at various time periods after the addition of 100
nM aldosterone. Aldosterone-stimulated
ENaC expression
was first evident at 2 h, increased by 4 h, and peaked by
48 h (Fig. 5
, A and B). The effect of
aldosterone on Isc was only clearly evident after 6 h (Fig. 5C
).
These results suggest that the increase in
ENaC mRNA levels may
contribute to the increase in Na+ transport. To
determine whether sgk1, another component of the sodium transport
pathway, was also regulated by aldosterone in these cells, we cloned
the canine sgk1 cDNA (Genbank accession number AF317416) and examined
sgk1 mRNA expression. Our results demonstrate that sgk1 expression is
increased within 1 h of aldosterone stimulation (Fig. 5D
), similar
to what has been described in cultured primary rabbit CCD cells
(22).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 5. Time Course for Aldosterone-Mediated Increase in
ENaC, sgk1, and Isc
Panels A and B, Effect of 100 nM aldosterone for indicated
time periods on c ENaC expression in MDCK-C7 cells. Representative
RPA shown above and quantitated data shown below (n = 4 ±
SEM; *, P < 0.005 compared with
control). Panel C, Effect of 100 nM aldosterone for various
time periods on measured Isc in MDCK-C7 cells (n = 4 ±
SEM; *, P < 0.02 compared with
corresponding control. Panel D, Effect of 100 nM
aldosterone for indicated time periods on csgk1 expression in MDCK-C7
cells.
|
|
To confirm that the increases in steady state levels of
ENaC mRNA
were via an increase in transcription, we evaluated the effect of 1
µM actinomycin D, an inhibitor of transcription, on the
steroid responses (Fig. 6
, A and B).
Simultaneous treatment of MDCK-C7 cells with actinomycin D and either
steroid hormone abolished the steroid response, providing further
evidence that
ENaC is an aldosterone- and glucocorticoid-induced
transcript in the canine collecting duct. To determine whether
aldosterone had an independent effect on
ENaC mRNA stability, we
measured
ENaC mRNA decay in MDCK-C7 cells with aldosterone or
vehicle in the presence of actinomycin D to block continued
transcription (Fig. 6C
). The calculated half-life of the
ENaC
transcript was remarkably similar with aldosterone or vehicle (aldo
t1/2 = 14.6 h vs. ctrl t1/2 = 14.02 h),
suggesting that aldosterone had no effect on mRNA turnover.
Since aldosterone normally signals through the MR to exert its genomic
effects, we wondered whether the lack of an aldosterone response in M-1
cells was due to the lack of a functional MR. To test this hypothesis,
we cotransfected a MR expression vector with the
ENaC promoter
constructs into M-1 cells and then treated these cells with
aldosterone. The results indicate that aldosterone can stimulate
ENaC gene transcription in M-1 cells when MR is transiently
expressed in these cells (Fig. 7A
).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 7. Effect of Cotransfected MR and GR Expression on
ENaC Gene Transcription in M-1 and HT-29 Cells
Panel A, M-1 cells transfected with 1,388+55 ENaC construct alone
or with rMR were treated with 100 nM aldosterone or 100
nM dexamethasone for 24 h and compared with vehicle
(n = 3 ± SD; *, P < 0.001;
#, P < 0.005 compared with absence of
agonist). The data are representative of other experiments. Panel B,
Receptor binding assay shows that HT-29 colonic epithelial cells are
MR- and GR-deficient. Rat liver is used as a positive control for GR
binding. Panel C, HT-29 cells transfected with 1,388+55 ENaC
construct alone or with hMR or hGR were treated with 100 nM
aldosterone or 100 nM dexamethasone for 24 h and
compared with vehicle (*, P < 0.02 compared with
absence of agonist; #, P < 0.001
compared with absence of agonist). The data are representative of other
experiments. Panel D, Dose-response of aldosterone effect on ENaC
expression in HT-29 cells cotransfected with hGR or hMR shows that
aldosterone can function through both receptors but has an
EC50 of 10 nM in MR and 66 nM in
GR. A maximal response via MR was elicited by
10-7.5 M aldosterone and a maximal
repsonse via GR was elicited by 10-6
M aldosterone.
|
|
To determine the relative role of GR and MR in increasing
ENaC gene
transcription, we used a colonic cell line, HT-29, where we had noted
that although
ENaC was constitutively expressed, a corticosteroid
response was not seen (data not shown). This finding suggested that
neither GR nor MR was expressed in this epithelial cell model. Receptor
binding studies confirmed these findings (Fig. 7B
), thereby identifying
the HT29 cell line as a suitable null cell for reconstituting the MR-
and GR-dependent effects on
ENaC gene transcription. When the
ENaC-luciferase construct was transiently transfected into these
cells, aldosterone and dexamethasone increased
ENaC gene
transcription but only in the presence of coexpressed MR or GR (Fig. 7C
). The dexamethasone-stimulated luciferase activity was significantly
greater with coexpressed GR than with MR. Aldosterone stimulated
luciferase activity in HT29 cells when either MR or GR was coexpressed,
but the magnitude of the aldosterone-induced response was only
approximately 25% of the response seen when dexamethasone stimulated
luciferase activity via GR. The aldosterone-steroid receptor-mediated
trans-activation of
ENaC transcription was further
examined in a dose-response study (Fig. 7D
). The
EC50 for aldosterone stimulation of
ENaC gene
transcription via MR was 10 nM compared with 66
nM via GR, indicating a higher affinity of
aldosterone for MR. These results suggest that at lower concentrations
the effect of aldosterone on
ENaC expression is likely to occur via
the MR in tissues that express the receptor, and that at higher
concentrations aldosterone can signal via the GR to achieve similar
downstream effects.
We then determined the cis-element(s) within the
ENaC
5'-flanking region that is required for the effects of aldosterone by
using a series of deletion constructs. The proximal 5'-flanking region
of h
ENaC contains at least two imperfect GREs (Up-GRE and Dn-GRE)
that are potential aldosterone-responsive enhancers. We have previously
shown that the more proximal GRE (Dn-GRE) was sufficient and necessary
for glucocorticoid-mediated trans-activation of
ENaC
transcription in lung epithelial cells (12). To date, no specific
aldosterone-responsive elements have been identified, and experiments
on classic glucocorticoid-responsive promoters such as the mouse
mammary tumor virus (MMTV) promoter and the tyrosine amino-transferase
(TAT) promoter and on isolated GREs have suggested that GREs also
function as aldosterone-responsive elements (30, 31). Since
ENaC is
an authentic aldosterone-responsive gene, we asked whether this
paradigm would also be true in this instance. Progressive 5'-deletions
of the
ENaC promoter demonstrated that the 5'-flanking region
remained aldosterone responsive until the Dn-GRE was removed (Fig. 8B
, cf. Dn/-141+55 and -141+55).
Selective removal of the Up-GRE did not diminish the magnitude of the
aldosterone response (Fig. 8B
, cf. -287+55 and -248+55), and
replacing the Dn-GRE with the Up-GRE abolished the aldosterone response
(Fig. 8B
, cf. Up/-141+55 and Dn/-141+55). Both the Up-GRE and the
Dn-GRE appeared to stimulate basal luciferase activity when the region
immediately 5' to the Dn-GRE was removed, suggesting that a
constitutive negative regulatory element was present in this region.
Importantly, these results suggested that the Dn-GRE was required for
aldosterone stimulation of
ENaC expression in MDCK-C7 cells (Fig. 8B
). To confirm the role of the Dn-GRE in mediating the aldosterone
effect on
ENaC expression, a 3-bp mutation, predicted to abolish
steroid receptor binding, was introduced into the full-length (-287
+55) construct by site-directed mutagenesis. This construct was
unresponsive to aldosterone, confirming that, at least in this cell
line, aldosterone when bound to GR signals via this GRE on the
ENaC
promoter (Fig. 8C
). To determine the enhancer elements within the
ENaC promoter required for the MR-dependent aldosterone effect on
ENaC gene transcription, the effects of various deletions were also
tested in HT-29 cells when either GR or MR were exogenously expressed
(Fig. 8D
). The aldosterone response appeared to localize to the Dn-GRE
when bound to GR or MR. These studies indicated that aldosterone, when
bound to GR or MR, increased
ENaC gene transcription via the Dn-GRE
in both cell lines. A very small, but statistically significant,
increase in
ENaC gene transcription was seen with dexamethasone and
GR in the -141+55 construct where both GREs were deleted. This
increase in luciferase activity was inconsistent and was never seen in
MDCK-C7 cells (Fig. 8B
) or in H441 cells (12).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 8. Identification of cis-Elements
Required for Aldosterone-Mediated ENaC Gene Transcription
Panel A, Deletion constructs of 5'-flanking region of h ENaC used in
transfections to determine the cis-elements necessary
for aldosterone action. Panel B, MDCK-C7 cells transfected with
indicated deletion constructs and treated with 100 nM
aldosterone, dexamethasone, or vehicle for 24 h (n =
47 ± SEM *, P < 0.0005;
#, P < 0.01 compared with vehicle).
Panel C, Mutation of the Dn-GRE abolished the dexamethasone and
aldosterone response in MDCK-C7 cells. Panel D, HT-29 cells
cotransfected with the deletion constructs and hMR or hGR and treated
with 100 nM aldosterone, dexamethasone, or vehicle for
24 h (n = 4 ± SD; #,
P < 0.005; @, P
< 0.0005 compared with vehicle). The results demonstrate that the
constructs containing the Dn-GRE but not the Up-GRE are necessary and
sufficient to confer aldosterone- and dexamethasone-responsiveness to
the promoter in both MDCK-C7 and HT-29 cells.
|
|
 |
DISCUSSION
|
|---|
One of the more important physiological effects of aldosterone is
to increase Na+ reabsorption in the cortical and
medullary collecting ducts of the kidney. The early phase of
aldosterone action on Na+ transport occurs within
1 h in some renal cell models, which is suggestive of a
posttranscriptional effect on the collecting duct sodium channel, ENaC
(32, 33). The subsequent effect of aldosterone occurs over several
hours and can be blocked by actinomycin D, suggesting that
transcription of certain target molecules is required for this phase of
action (33, 34). The identity of these aldosterone-induced proteins was
previously unknown but the observation that aldosterone increases the
steady state
ENaC mRNA levels in the collecting duct raises the
possibility that
ENaC is itself an aldosterone-induced protein. In a
murine CCD cell line, mpkCCDc14, the aldosterone-mediated increase in
ENaC mRNA was accompanied by a similar increase in
ENaC protein
levels (35). To test the hypothesis that
ENaC is an
aldosterone-induced transcript, we have used the C7 subclone of MDCK, a
cell line that appears to exhibit many characteristics of the principal
cells of the collecting duct including the presence of
aldosterone-regulated electrogenic Na+ transport
(Fig. 2B
). In contrast to the M-1 cell line, the MDCK-C7 cells
supported aldosterone-stimulated trans-activation of the
ENaC promoter, indicating that this cell line contained the required
transcriptional machinery for the aldosterone effect. Further analysis
of the aldosterone effect on the
ENaC promoter in MDCK-C7 cells
indicated that the effect was dose-dependent and mediated via the GR.
Aldosterone also stimulated
ENaC mRNA expression in MDCK-C7 cells
via the GR, and this increase correlated with its effects on the
ENaC promoter. Additionally, the effect on
ENaC expression
preceded the increase in Isc and was abolished by concurrent treatment
with actinomycin D. A separate effect on
ENaC mRNA turnover was
excluded by measurement of the
ENaC mRNA half-life in the presence
and absence of aldosterone.
Having confirmed that aldosterone increases
ENaC mRNA levels
exclusively via an increase in transcription, we next used a receptor
null epithelial cell line, HT-29, to reconstitute GR- and MR-dependent
trans-activation pathways. In this cell line, both
aldosterone- and dexamethasone-stimulated
ENaC gene transcription
occurs via the MR or the GR. Aldosterone acting via either receptor
stimulated a lower rate of transcription compared with dexamethasone
when acting via the GR, and this response is similar to that reported
for the MMTV promoter, a well studied glucocorticoid-regulated promoter
(36, 37). Our studies indicate that this is also true for aldosterone-
regulated genes. Importantly, these results and those seen in
MDCK-C7 cells also suggest that under certain conditions aldosterone
can effectively signal via the GR to activate target genes. The lack of
an aldosterone response via the GR in M-1 cells suggests several
possibilities. A cell-specific positively regulating cofactor required
for effective interaction of aldosterone with GR may be absent from M-1
cells. Alternatively, the GR may be constrained from interacting with
aldosterone by a corepressor in M-1 cells.
The dose-response curves for aldosterone via either receptor in HT29
cells indicate that aldosterone has a higher affinity for the MR
compared with GR with an EC50 of 10
nM. The EC50 for GR is similar to
that reported in an amphibian transporting epithelial cell, A6 (38).
The EC50 for MR is somewhat higher than that
reported for MR interacting with the MMTV promoter, and there are at
least two possible reasons for these results (31, 37). The first
possibility is that transfection efficiency was such that a fraction of
transfected cells contained either the luciferase vector or the
receptor expression vector but not both, thus effectively shifting the
dose-response curve. The second possibility is that the efficiency of
activation of the MMTV GRE may be different from that on the
ENaC
GRE because of cooperative interactions with other
trans-acting factors that bind to distinct
cis-elements on the
ENaC gene. Unlike the MMTV promoter
and the TAT promoter, which are classic glucocorticoid-regulated genes
that have been used to model aldosterone action, the
ENaC gene is
arguably one of the first endogenous aldosterone-regulated genes, and
further studies on this and other aldosterone-responsive genes will be
required to clarify this effect.
Deletional analysis of the
ENaC gene indicated that aldosterone,
like dexamethasone, stimulates
ENaC gene transcription via a single
imperfect GRE (Dn-GRE) in the
ENaC 5'-flanking region. The minimal
elements required for stimulation via the MR or GR were not different
when examined after heterologous expression of either receptor in HT29
cells.
Does the aldosterone-mediated activation of
ENaC gene transcription
leading to an increase in
ENaC mRNA levels have biological
significance? With the identification of sgk1 as an early
aldosterone-induced transcript and the demonstration that coexpression
of sgk1 and ENaC mRNAs in Xenopus oocytes leads to an
enhancement of ENaC-dependent Na+ transport, sgk1
became a candidate mediator for the early aldosterone-stimulated
increase in Na+ transport (21, 22, 39). This
increase in Na+ transport, at least in A6
amphibian cells, occurs before an increase in transcription of ENaC
subunits become evident but follows the increase in sgk1 expression
(21). However, in a clonal mammalian CCD cell line,
mpkCCDc14, aldosterone increased
ENaC mRNA and
protein expression within 2 h, the earliest time point tested, and
this correlated well with the increase in Na+
transport seen with aldosterone (35). We have examined the time course
for the aldosterone effect in MDCK-C7 cells and show that the
aldosterone-mediated increase in
ENaC expression appears to precede
the observed increase in Na+ transport,
similar to the effect of glucocorticoids in a lung epithelial cell
line, H441 (C.P. Thomas, unpublished observations). Based on our
earlier studies on
ENaC expression and Na+
transport and this study, it appears reasonable to suggest that the
late effects on Na+ transport require an increase
in transcription of the
ENaC gene to sustain the increase in
transport seen with continued corticosteroid exposure (Fig. 9
). Conclusive evidence for this model
will require targeted mutation of the
ENaC GRE in the genome of an
experimental animal or in a cell culture model, and the subsequent
evaluation of corticosteroid effects.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 9. Schematic of Aldosterone-Induced Proteins That May
Facilitate Epithelial Na+ Transport
Aldosterone increases ENaC mRNA by stimulating ENaC gene
transcription, presumably leading to an increase in the number of
channels synthesized. The aldosterone-stimulated increase in sgk1
stimulates Na+ channel activity at a posttranscriptional
step, perhaps by interacting with ENaC subunit proteins.
|
|
Another central question that this study poses is the relevance of
aldosterone signaling via GR to mediate its biological effects. It is
now becoming clear that even when the MR is expressed and functional,
aldosterone-dependent Na+ transport occurs by
activation of the MR and GR in certain systems (35, 40, 41). The A6
cell line, which continues to be a vigorous model for the study of
aldosterone-dependent Na+ transport, does not
appear to express MR and many of its actions in this cell line are
mediated via GR (38, 42). In systems where both receptors are
expressed, the EC50 for the MR-dependent actions
of aldosterone is at least 1 order of magnitude below that for GR,
suggesting that at very low concentrations of aldosterone, its effects
are mediated primarily, if not entirely, via MR. However, under
conditions where circulating levels of mineralocorticoids are much
higher, GR-dependent activation of target genes may become important.
It has been known, for example, that stress doses of cortisol induce
renal Na+ retention independently of MR in
healthy human volunteers (43). Recent evidence from MR gene deletion
experiments in mice also provides some support for this concept. While
untreated MR -/- mice die in the early neonatal period, these animals
can be rescued by forced Na+ administration until
weaning, after which they appear to maintain their circulating volume
and their serum K+ and pH within normal limits
and to develop normally (44, 45). Despite the absence of MR, levels of
ENaC mRNA in renal cortex were not different in MR-/- mice
compared with MR+/+ mice, suggesting that
ENaC mRNA levels were
being maintained by elevated circulating aldosterone or corticosterone
acting via the GR. These studies indicate that the MR is not absolutely
necessary for life and suggest that in certain circumstances
aldosterone may mediate its actions via the GR or by other
non-receptor-mediated pathways (46, 47).
 |
MATERIALS AND METHODS
|
|---|
Materials
Dexamethasone, aldosterone, and spironolactone were purchased
from Sigma (St. Louis, MO). RU28318, RU 28362, and RU38486
were generous gifts from Roussel Uclaf (Romainville, France), and
ZK98299 was a generous gift from Schering AG (Berlin,
Germany). Actinomycin D was obtained from Roche Molecular Biochemicals (Indianapolis, IN), and culture materials were from
Life Technologies, Inc. (Gaithersburg, MD).
[1,2,4-3H]Dexamethasone and
[1,2,6,7-3H]aldosterone were from
Amersham Pharmacia Biotech (Arlington Heights, IL) and
[
-32P]UTP was from NEN Life Science Products (Boston, MA). Stock solutions of all corticosteroids
and receptor antagonists were made in ethanol while actinomycin D was
made in Me2SO.
Tissue Culture and Short-Circuit Current (Isc)
Measurements
MDCK-C7, a subclone of the MDCK cell line (gift from B.
Blazer-Yost and H. Oberleithner), was maintained in MEM with 10% FBS
(27). The M-1 CCD cell line and the human colon carcinoma cell line,
HT-29, were cultured as previously described (12). In preparation for
MDCK-C7 Na+ transport measurements, cells were
seeded on 12-mm Millicel PCF filters (Millipore Corp.,
Bedford, MA), which had been pretreated with human placental collagen.
They were then grown for 3 days in MEM supplemented with 5 µg/ml
insulin, 5 µg/ml transferrin, 5 nM triiodothyronine, 50
nM hydrocortisone, 10 nM sodium selenite, 50
µg/ml gentamicin, 10 mg/ml BSA, and 5 nM dexamethasone
and for an additional day in MEM without albumin or steroids. For
measurement of ion transport, filters were placed in specially designed
chambers (Jims Instruments, Iowa City, IA) and transepithelial
voltage, Isc, and resistance (RT) were recorded
at 37 C as previously described (48). Cells were then treated with
fresh supplemented media (without albumin) with 100 nM
dexamethasone, 100 nM aldosterone, or vehicle and peak Isc
measured at various time periods. In some cases, the effect of 10
µM benzamil on Isc was also measured. M-1 cells were
grown and measured under the same conditions as MDCK-C7, except that
DMEM-F12 medium was used instead of MEM. Cultures were used only if the
resistances before and during the experiments were more than 500
/cm2 for M-1 cells and more than 1000
/cm2 for MDCK-C7 cells.
Transient Transfection and Functional Analysis
The organization of the 5'-end of the h
ENaC gene has
previously been described (49). An approximately 1,400 nucleotide (nt)
fragment of the h
ENaC 5'-flanking region was amplified from human
placental genomic DNA using primers 5'- ACCCAGCACCCAGAGAGCAGACGAA and
5'-TCAGGCCCTGCAGAGAAGAGAGAAGAGGTC. The amplified fragment was cloned
into pCR 2.1 (Invitrogen, Carlsbad, CA) and sequenced in
both directions. To examine aldosterone regulation of
ENaC, a region
that extended from 1,388 to +55 was subcloned upstream of the firefly
luciferase coding region at the SacIXhoI site
of pGL3basic (Promega Corp., Madison, WI). This construct
was transiently transfected into various cell lines along with a
control plasmid to correct for differences in transfection efficiency
and in recovery of cytosolic extracts. The control plasmid used was
either pSVß-gal, where the Escherichia coli lacZ gene is
cloned downstream of the SV40 promoter (Promega Corp.), or
pRL-SV40, where the Renilla reniformis luciferase gene is
cloned downstream of the SV40 promoter (Promega Corp.).
M-1, MDCK-C7, and HT-29 cells were grown in 12- or 24-well plates until
subconfluent, and then 1 µg of the
ENaC-luciferase construct and 1
µg of pRL-SV40 or pSVß-gal were transiently transfected into cell
monolayers using LipofectAMINE Plus (Life Technologies, Inc.). In some experiments, 0.5 µg of an expression vector for
the GR or MR or an empty plasmid, pCDNA3 (Invitrogen), was
cotransfected along with 0.5 µg of the
ENaC-luciferase construct
and 0.5 µg of the control plasmid. To identify aldosterone-responsive
cis-elements in the
ENaC 5'-flanking region, various
deletion constructs of
ENaC were derived by restriction digestion or
by separate PCR amplification (12) and then transfected into MDCK-C7 or
HT-29 cells.
The putative aldosterone-responsive enhancer in the 5'-flanking region
of h
ENaC, AGAACAgaaTGTCCT, was mutated to AGTCTAgaaTGTCCT
using the Quikchange Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA) and primers
5'-CAGTGTAAAGAAGTCTAGAATGTCCTAGGGCCC and
5'-GGGCCCTAGGACATTCTAGA CTTCTTTACACTG. Briefly, the -287
+55 construct in pGL3basic was annealed with the above primers and
extended with Pfu DNA polymerase; the parental plasmid was
then digested with DpnI and the extended circular
double-stranded DNA molecule (-287 +55/mutdnGRE) was recovered by
transformation into bacteria.
Starting the day after transfection, cells were treated for 24 h
with various corticosteroids, or vehicle in serum-free medium. To help
determine corticosteroid-signaling pathways, the steroid receptor
antagonists RU28318, RU38486, spironolactone, or ZK98299 (all 10
µM), were used in some experiments. Preparation of cell
lysates and measurement of reporter gene activity were performed as
previously described (12). Data from several experiments were combined
and analyzed by Students t test.
Receptor Binding Assays
To quantitate GR and MR levels in MDCK-C7 and HT-29 cell lines,
cytosolic receptor binding assays were performed. Monolayers of these
two cell lines were harvested and the cell pellets were washed with
PBS. The cell pellets were then homogenized in 3 ml of buffer (10
mM Tris, 2 mM dithiothreitol, 10 mM
Na2MoO4, pH 7.5) using a
Polytron Homogenizer (Brinkmann Instruments, Inc.
Westbury, NY). Molybdate has been previously show to stabilize the
ligand binding domain of GR and MR (50, 51). The crude homogenates were
centrifuged for 1 h at 4 C and 100,000 x g and
the resulting supernatants were used immediately for binding assays.
The cytosolic extracts were preincubated for 2 h at 4 C with a
250-fold molar excess of RU28318 (MR antagonist) to block cross-over
binding of labeled dexamethasone to MR, or with RU28362 (GR antagonist)
to block cross-over binding of labeled aldosterone to GR. For
quantitation of GR binding levels, aliquots of the RU28318-preincubated
cytosol were incubated overnight at 4 C with 30
nM [3H]-dexamethasone in
the absence or presence of a 500-fold molar excess of cold
dexamethasone. For quantitation of MR binding levels, aliquots of the
RU 28362-preincubated cytosol were incubated overnight with 10
nM [3H]-aldosterone in
the absence or presence of a 500-fold molar excess of cold aldosterone.
Specific binding to either the GR or MR was quantitated via the
hydroxylapatite batch assay followed by liquid scintillation
spectroscopy (52). Cytosolic GR and MR binding levels were then
expressed as specifically bound dpm per mg of cytosolic protein. As a
positive control for the binding assays, specific GR and MR binding
levels were also quantitated in cytosolic extracts prepared from rat
liver and colon.
RT-PCR and Cloning of c
ENaC and csgk cDNA
Total RNA was prepared from MDCK-C7 cells treated with 100
nM dexamethasone and aldosterone for 24 h. One hundred
nanograms of MDCK-C7 RNA were reverse transcribed at 42 C for 60 min
with oligo-dT and 50 U of M-MLV RT (Life Technologies, Inc.) in a 20 µl reaction mixture that also contained 50
mM KCl; 10 mM Tris-HCl, pH 8.0; 1
mM deoxynucleoside triphosphates (dNTPs); 5
mM MgCl2; and
0.5 µl RNAsin (Promega Corp.). For PCR the following
primers were used: can
(F): 5'-GGATGAACCTGCCTTTATGG and can
(R):
5'-CCGAACCACAGGCTCCACTG. For PCR of canine sgk1 (csgk1) a two-step
strategy was used. First, primers, 5'-AAGATTACTCCCCCTTTTAACC and
5'-CGCTCGTTTCAGAGATAGC, corresponding to human sgk1 sequence, were used
to amplify a 440-bp fragment from canine cDNA (53). Next, internal
primers, 5'-AAGAGCCAGTCCCCAAC- TCC and 5'-TCCTTCAAGACCAACCCTCG,
corresponding to csgk1 were synthesized and used to amplify a 150-bp
PCR fragment. Two microliters of first-strand cDNA were combined with
25 pmol of each primer, 50 mM KCl, 10 mM
Tris-HCl, 1.5 mM MgCl2, and 1
mM dNTPs and subjected to 35 cycles at 95 C for 30 sec, 58
C for 30 sec, and 72 C for 3 min. Amplified products were cloned into
pCRXL-TOPO (Invitrogen) and sequenced in both
directions.
RNA Preparation and RPA
MDCK-C7 cells were grown to subconfluence in 100 mm petri
dishes, switched to serum-free media, and incubated with 100
nM aldosterone, dexamethasone, or vehicle in the presence
or absence of ZK98299 or RU28318 (10 µM). In some cases,
1 µM Actinomycin D, a transcription inhibitor, was added
simultaneously with corticosteroid hormones or vehicle. RNA from
cultured cells was prepared with the RNeasy Mini Kit
(QIAGEN, Valencia, CA) following the manufacturers
recommendations. To determine mRNA turnover, MDCK-C7 cells were
stimulated with 100 nM aldosterone for 24 h and then
treated with aldosterone or vehicle for various times in the presence
of 1 µM actinomycin D. For RPA of
ENaC, a template
containing the cloned
ENaC PCR fragment was linearized with
DdeI and a 266-nt antisense cRNA probe synthesized with
[32P]UTP and T7 polymerase. For RPA of sgk1, a
template containing the cloned sgk1 fragment was digested with
BamHI and a 195-nt antisense cRNA probe was synthesized. To
control for RNA loading an 18S rRNA template (pTR1 RNA 18S,
Ambion, Inc. Austin, TX) was also used to generate an
antisense cRNA probe. RNA samples were cohybridized overnight and
digested as described previously (12). The size of the
nuclease-protected fragments was determined from a radiolabeled 50-bp
DNA ladder (Life Technologies, Inc.) run alongside these
samples.
To quantitate mRNA expression, autoradiograms were scanned and the
density of individual bands was measured using Kodak Digital Science
Image Analysis Software (Eastman Kodak Co, Rochester, NY).
The
ENaC band was normalized for the density of the 18S rRNA band,
and the data from three experiments were pooled and analyzed by
Students t test. For calculation of mRNA half-life, data
points were plotted on a semilogarithmic scale and exponential
regression lines were derived for vehicle and aldosterone-treated
samples.
 |
ACKNOWLEDGMENTS
|
|---|
The authors acknowledge the DNA synthesis and sequencing
services provided by the University of Iowa DNA core facility. The
authors thank H. Oberleithner and B. Blazer-Yost for the gift of the
MDCK-C7 cell line, R. M. Evans for gifts of the hGR and hMR
expression vectors, and David Pearce for the rMR expression vector.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Christie P Thomas, M.D., Department of Internal Medicine, E300 GH, University of Iowa, 200 Hawkins Drive, Iowa City, Iowa 52242. E-mail:
christie-thomas{at}uiowa.edu
This work was presented at the 1999 American Society of Nephrology and
Experimental Biology annual meeting and has been published in abstract
form.
This work was supported by the NIH (Grant DK-54348), and the March of
Dimes Foundation (6-FY99444). C. P. Thomas is an Established
Investigator of the American Heart Association.
The sequences reported in this paper have been submitted to GenBank
with accession numbers AF209748, U81961, and AF317416.
Received for publication March 24, 2000.
Revision received November 20, 2000.
Accepted for publication December 20, 2000.
 |
REFERENCES
|
|---|
-
Barbry P, Hofman P 1997 Molecular biology of
Na+ absorption. Am J Physiol 273:G571G585
-
Warnock DG 1999 Hypertension. Semin Nephrol 19:37480[Medline]
-
Stewart PM 1999 Mineralocorticoid hypertension. Lancet 353:13417[CrossRef][Medline]
-
Champigny G, Voilley N, Lingueglia E, Friend V, Barbry P,
Lazdunski M 1994 Regulation of expression of the lung
amiloride-sensitive Na+ channel by steroid
hormones. EMBO J 13:21772181[Medline]
-
Volk KA, Sigmund RD, Snyder PM, McDonald FJ, Welsh MJ, Stokes
JB 1995 rENaC is the predominant Na+ channel in
the apical membrane of the rat renal inner medullary collecting duct.
J Clin Invest 96:27482757
-
Asher C, Wald H, Rossier BC, Garty H 1996 Aldosterone-induced
increase in abundance of Na+ channel subunits.
Am J Physiol 271:C605C611
-
Renard S, Voilley N, Bassilana F, Lazdunski M, Barbry P 1995 Localization and regulation by steroids of the
, ß and
subunits of the amiloride-sensitive Na+ channel
in colon, lung and kidney. Pfluegers Arch 430:299307[CrossRef][Medline]
-
Stokes JB, Sigmund RD 1998 Regulation of rENaC mRNA by
dietary NaCl and steroids: organ, tissue and steroid heterogeneity.
Am J Physiol 274:C1699C1707
-
Escoubet B, Coureau C, Bonvalet J-P, Farman N 1997 Noncoordinate regulation of epithelial Na+
channel and Na+ pump subunit mRNAs in kidney and
colon by aldosterone. Am J Physiol 272:C1482C1491
-
Masilamani S, Kim GH, Mitchell C, Wade JB, Knepper MA 1999 Aldosterone-mediated regulation of ENaC
, ß, and
subunit
proteins in rat kidney. J Clin Invest 104:R1923
-
Loffing J, Pietri L, Aregger F, Bloch-Faure M, Ziegler U,
Meneton P, Rossier BC, Kaissling B 2000 Differential subcellular
localization of ENaC subunits in mouse kidney in response to high- and
low-Na diets. Am J Physiol Renal Physiol 279:F252258
-
Sayegh R, Auerbach SD, Li X, Loftus R, Husted R, Stokes JB,
Thomas CP 1999 Glucocorticoid induction of epithelial sodium channel
expression in lung and renal epithelia occurs via
trans-activation of a hormone response element in the 5'
flanking region of the human epithelial sodium channel
subunit
gene. J Biol Chem 274:1243112437[Abstract/Free Full Text]
-
Lin HH, Zentner MD, Ho H-LL, Kim K-J, Ann DK 1999 The gene
expression of the amiloride-sensitive epithelial sodium channel
-subunit is regulated by antagonistic effects between glucocorticoid
hormone and ras pathways in salivary epithelial cells. J Biol Chem 274:2154421554[Abstract/Free Full Text]
-
Otulakowski G, Rafii B, Bremner HR, OBrodovich H 1999 Structure and hormone responsiveness of the gene encoding the
-subunit of the rat amiloride-sensitive epithelial sodium channel.
Am J Respir Cell Mol Biol 20:10281040[Abstract/Free Full Text]
-
Agarwal MK 1994 Perspectives in receptor-mediated
mineralocorticoid hormone action. Pharmacol Rev 46:6787[Medline]
-
Funder JW 1997 Glucocorticoid and mineralocorticoid receptors:
biology and clinical relevance. Annu Rev Med 48:231240[CrossRef][Medline]
-
Kemendy AE, Kleyman TR, Eaton DC 1992 Aldosterone alters the
open probability of amiloride-blockable sodium channels in A6
epithelia. Am J Physiol 263:C825C837
-
Rokaw MD, Wang J-M, Edinger RS, Weisz OA, Hui D, Middleton P,
Shlyonsky V, Berdiev BK, Ismailov I, Eaton DC, Benos DJ, Johnson JP 1998 Carboxymethylation of the ß subunit of xENaC regulates
channel activity. J Biol Chem 273:2874628751[Abstract/Free Full Text]
-
Stockand J, Al-Baldawi NF, Al-Khalili OK, Worrell RT, Eaton DC 1999 S-adenosyl-l-homocysteine hydrolase regulates aldosterone-induced
Na+ transport. J Biol Chem 274:38423850[Abstract/Free Full Text]
-
Mastroberardino L, Spindler B, Forster I, Loffing J, Assandri
R, May A, Verrey F 1998 Ras pathway activates epithelial
Na+ channel and decreases its surface expression
in Xenopus oocytes. Mol Biol Cell 9:34173427[Abstract/Free Full Text]
-
Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J,
Buse P, Firestone GL, Verrey F, Pearce D 1999 Epithelial sodium channel
regulated by aldosterone- induced protein sgk. Proc Natl Acad Sci
USA 96:25142519[Abstract/Free Full Text]
-
Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G,
Fejes-Toth G 1999 sgk Is an aldosterone-induced kinase in the renal
collecting duct. J Biol Chem 274:1697316978[Abstract/Free Full Text]
-
Shimkets RA, Lifton R, Canessa CM 1998 In vivo
phosphorylation of the epithelial sodium channel. Proc Natl Acad Sci
USA 95:33013305[Abstract/Free Full Text]
-
Stockand JD, Spier BJ, Worrell RT, Yue G, Al-Baldawi N, Eaton
DC 1999 Regulation of Na+ reabsorption by the
aldosterone-induced small G protein K-Ras2A. J Biol Chem 274:3544935454[Abstract/Free Full Text]
-
Stoos B, Naray-Fejes-Toth A, Carretero O, Ito S, Fejes-Toth G 1991 Characterization of a mouse cortical collecting duct cell line.
Kidney Int 39:11681175[Medline]
-
Nakhoul N, Herring-Smith K, Gambala C, Hamm L 1998 Regulation
of sodium transport in M-1 cells. Am J Physiol 275:F998F1007
-
Blazer-Yost BL, Record RD, Oberleithner H 1996 Characterization of hormone-stimulated Na+
transport in a high-resistance clone of the MDCK cell line. Pfluegers
Arch 432:685691[CrossRef][Medline]
-
Canessa CM, Horisberger JD, Rossier BC 1993 Epithelial sodium
channel related to proteins involved in neurodegeneration. Nature 361:467470[CrossRef][Medline]
-
McDonald FJ, Snyder PM, McCray PB, Welsh MJ 1994 Cloning,
expression, and tissue distribution of a human amiloride-sensitive
Na+ channel. Am J Physiol 266:L728L734
-
Lombes M, Binart N, Oblin M, Joulin V, Baulieu E 1993 Characterization of the interaction of the human mineralocorticoid
receptor with hormone response elements. Biochem J 292:577583
-
Lim-Tio S, Keightley M-C, Fuller P 1997 Determinants of
specificity of transactivation by the mineralocorticoid or
glucocorticoid receptor. Endocrinology 138:25372543[Abstract/Free Full Text]
-
Garty H, Palmer LG 1997 Epithelial sodium channels: function
and regulation. Physiol Rev 77:359396[Abstract/Free Full Text]
-
Bonvalet J-P 1998 Regulation of sodium transport by steroid
hormones. Kidney Int 53:S49S56
-
Verrey F 1999 Early aldosterone action: toward filling the gap
between transcription and transport. Am J Physiol 277:F319F327
-
Bens M, Vallet V, Cluzeaud F, Pascual-Letallec L, Kahn A,
Rafestin-Oblin ME, Rossier BC, Vandewalle A 1999 Corticosteroid-dependent sodium transport in a novel immortalized mouse
collecting duct principal cell line. J Am Soc Nephrol 10:923934[Abstract/Free Full Text]
-
Arriza JL, Simerly RB, Swanson LW, Evans RM 1988 The neuronal
mineralocorticoid receptor as a mediator of glucocorticoid response.
Neuron 1:887900[CrossRef][Medline]
-
Rupprecht R, Arriza J, Spengler D, Reul J, Evans R, Holsboer
F, Damm K 1993 Transactivation and synergistic properties of the
mineralocorticoid receptor: relationship to the glucocorticoid
receptor. Mol Endocrinol 7:597603[Abstract]
-
Schmidt TJ, Husted RF, Stokes JB 1993 Steroid hormone
stimulation of Na+ transport in A6 cells is
mediated via glucocorticoid receptors. Am J Physiol 264:C875C884
-
de La Rosa DA, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G,
Canessa CM 1999 The serum and glucocorticoid kinase sgk increases the
abundance of epithelial sodium channels in the plasma membrane of
Xenopus oocytes. J Biol Chem 274:3783437839[Abstract/Free Full Text]
-
Geering K, Claire M, Gaeggeler HP, Rossier BC 1985 Receptor
occupancy vs. induction of
Na+-K+-ATPase and
Na+ transport by aldosterone. Am J Physiol
248:C102C108
-
Farman N 1999 Mechanisms of mineralocorticoid selectivity. In:
Grunfield J-P, Bach JF, Kreis H (eds) Advances In Nephrology. Mosby,
St. Louis, MO, vol 29:115126
-
Chen SY, Wang J, Liu W, Pearce D 1998 Aldosterone
responsiveness of A6 cells is restored by cloned rat mineralocorticoid
receptor. Am J Physiol 274:C39C46
-
Montrella-Waybill M, Clore JN, Schoolwerth AC, Watlington CO 1991 Evidence that high dose cortisol-induced Na+ retention in man is
not mediated by the mineralocorticoid receptor. J Clin Endocrinol
Metab 72:10601066[Abstract]
-
Berger SBM, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W,
Warth W, Greger R, Schutz G 1998 Mineralocorticoid receptor knockout
mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95:94249429[Abstract/Free Full Text]
-
Bleich M, Warth R, Schmidt-Hieber M, Schulz-Baldes A,
Hasselblatt P, Fisch D, Berger S, Kunzelmann K, Kriz W, Schutz G,
Greger R 1999 Rescue of the mineralocorticoid receptor knock-out mouse.
Pfluegers Arch 438:245254[CrossRef][Medline]
-
Wehling M 1997 Specific, nongenomic actions of steroid
hormones. Annu Rev Physiol 59:36593[CrossRef][Medline]
-
Haseroth K, Gerdes D, Berger S, Feuring M, Gunther A, Herbst
C, Christ M, Wehling M 1999 Rapid nongenomic effects of aldosterone in
mineralocorticoid-receptor- knockout mice. Biochem Biophys Res Commun 266:257261[CrossRef][Medline]
-
Husted RF, Laplace JR, Stokes JB 1990 Enhancement of
electrogenic Na+ transport across rat inner
medullary collecting duct by glucocorticoid and mineralocorticoid
hormones. J Clin Invest 86:498506
-
Thomas CP, Auerbach SD, Stokes JB, Volk KA 1998 5'
heterogeneity in amiloride-sensitive epithelial sodium channel
subunit mRNA leads to distinct NH2-terminal
variant proteins. Am J Physiol 274:C13121323
-
Housley PR, Sanchez ER, Westphal HM, Beato M, Pratt WB 1985 The molybdate-stabilized L-cell glucocorticoid receptor isolated by
affinity chromatography or with a monoclonal antibody is associated
with a 9092-kDa nonsteroid-binding phosphoprotein. J Biol Chem 260:1381013817[Abstract/Free Full Text]
-
Rafestin-Oblin ME, Lombes M, Lustenberger P, Blanchardie P,
Michaud A, Cornu G, Claire M 1986 Affinity of corticosteroids for
mineralocorticoid and glucocorticoid receptors of the rabbit kidney:
effect of steroid substitution. J Steroid Biochem 25:527534[CrossRef][Medline]
-
Erdos T, Best-Belpomme M, Bessada R 1970 A rapid assay for
binding estradiol to uterine receptors. Anal Biochem 37:244252[CrossRef][Medline]
-
Waldegger S, Barth P, Raber G, Lang F 1997 Cloning and
characterization of a putative human serine/threonine protein kinase
transcriptionally modified during anisotonic and isotonic alterations
of cell volume. Proc Natl Acad Sci USA 94:44404445[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
W. Schoner and G. Scheiner-Bobis
Role of endogenous cardiotonic steroids in sodium homeostasis
Nephrol. Dial. Transplant.,
September 1, 2008;
23(9):
2723 - 2729.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhou, R. H. Oakley, and J. A. Cidlowski
DAX-1 (Dosage-Sensitive Sex Reversal-Adrenal Hypoplasia Congenita Critical Region on the X-Chromosome, Gene 1) Selectively Inhibits Transactivation But Not Transrepression Mediated by the Glucocorticoid Receptor in a LXXLL-Dependent Manner
Mol. Endocrinol.,
July 1, 2008;
22(7):
1521 - 1534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. P. Thomas, J. I. Andrews, and K. Z. Liu
|