| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Subunit of the Epithelial Sodium Channel Is an Aldosterone-Induced Transcript in Mammalian Collecting Ducts, and This Transcriptional Response Is Mediated via Distinct cis-Elements in the 5'-Flanking Region of the Gene
Department of Internal Medicine (V.E.M., O.A.I., R.W.L., R.F.H., C.P.T.) Department of Physiology and Biophysics (T.J.S.), University of Iowa College of Medicine and the Veterans Affairs Medical Center (C.P.T.) Iowa City, Iowa 52242
| ABSTRACT |
|---|
|
|
|---|
ENaC mRNA expression in mammalian kidney, suggesting that
the
ENaC gene is a target for aldosterone action in the distal
nephron. To determine whether aldosterone increases
ENaC gene
transcription, a portion of the
ENaC 5'- flanking region coupled to
luciferase was transfected into MDCK-C7 cells, a collecting duct cell
line with aldosterone-stimulated Na+ transport.
Both dexamethasone and aldosterone stimulated
ENaC-coupled reporter
gene activity via the glucocorticoid receptor (GR), and this response
correlated with the effect of these hormones on endogenous
ENaC
expression. The aldosterone-stimulated
ENaC expression was blocked
by actinomycin D, and aldosterone had no effect on
ENaC mRNA decay,
confirming a transcriptional effect. In HT-29 cells, a
GR/mineralocorticoid receptor (MR)-deficient colonic cell line with
constitutive
ENaC expression, cotransfection with GR or MR restored
aldosterone-stimulated
ENaC gene transcription, although aldosterone
had a functional preference for MR. Analysis of deletion constructs
confirmed that a single imperfect glucocorticoid response element (GRE)
is necessary and sufficient to confer the aldosterone responsiveness to
the
ENaC gene promoter in MDCK-C7 and HT-29 cells. These results
confirm that
ENaC is an aldosterone- induced transcript in the
collecting duct and delineates the molecular mechanism for this effect. | INTRODUCTION |
|---|
|
|
|---|
, ß, and
,
that have now been cloned from several species (1). These channels
provide the final regulatory control for Na+
homeostasis, and activating mutations in channel subunits, which alter
the rate of Na+ transport, can cause hypertension
with hypokalemia and alkalosis (2, 3). Increased circulating
mineralocorticoids, as seen in primary hyperaldosteronism, also lead to
hypertension with hypokalemic alkalosis from increased reabsorption of
Na+ via ENaC.
Corticosteroids are among the best known regulators of
amiloride-sensitive Na+ transport in the
collecting ducts, distal colon, and in airway epithelia. In these
tissues, long-term corticosteroid treatment leads to increased
expression of one or more ENaC subunits. In cultured rat lung
epithelial cells, inner medullary collecting duct cells (IMCD), and
cortical collecting duct (CCD) cells, dexamethasone- and
aldosterone-stimulated Na+ transport is
associated with an increase in steady-state
ENaC mRNA levels (4, 5).
The effects of corticosteroids on ENaC expression in renal tissues have
also been studied in vivo. While Renard et al.
(6) initially reported that dexamethasone infusion in rats had
no effect on ENaC expression in kidney cortex, several subsequent
studies have reported that either dexamethasone or aldosterone infusion
lead to increased expression of
ENaC mRNA in the renal cortex and
medulla, without effects on other subunits (7, 8, 9). Recent studies have
clearly demonstrated that elevated circulating aldosterone levels
increase the abundance of the
ENaC protein in the connecting tubule
and in the principal cells of the CCD (10, 11). We have shown that
dexamethasone increases amiloride-sensitive Na+
transport in a human bronchiolar epithelial cell and a mouse CCD line
and that this correlates temporally with an increased expression of
ENaC (12). The glucocorticoid-mediated increase in
ENaC mRNA is
transcriptionally regulated, does not require protein synthesis, and
involves the activation of a glucocorticoid response element (GRE) in
the 5'-flanking region of the human
ENaC (h
ENaC) gene, a finding
that has been confirmed by others in human and rat epithelia
(12, 13, 14).
Aldosterone, like glucocorticoids, binds to cytosolic receptors, which
then translocate to the nucleus where the hormone-receptor complex
enhances transcription of target genes (15, 16). There has been
considerable debate, however, about the mechanism of
aldosterone-mediated increase in Na+ transport in
mineralocorticoid-responsive epithelia. In a well studied model of
Na+ transport, the A6 cell line, there is some
evidence for an early aldosterone effect on Na+
conductance that is transcription independent (17). The later effect of
aldosterone on Na+ conductance appears to require
transcription and translation of intermediate molecules that modify the
function of preexisting Na+ channels. For
example, aldosterone has been shown to stimulate carboxymethylation of
ßENaC in A6 cells, a process that might involve the regulation of
S-adenosyl-L-homocysteine hydrolase
activity (18, 19). Using subtractive hybridization and differential
display techniques, several investigators have begun to identify
aldosterone-induced proteins in A6 cells and in mammalian collecting
duct cells (20, 21, 22). One of these, a serum- and
glucocorticoid-regulated kinase 1 (sgk1), is an early
aldosterone-induced gene that enhances Na+
current when coexpressed with ENaC cDNAs in Xenopus oocytes
(21, 22). While the target protein(s) for this kinase is not known,
aldosterone has been shown to increase phosphorylation of serine and
threonine residues on ß- and
ENaC subunits when these subunits are
heterologously expressed in MDCK cells (23). Another aldosterone-
induced gene product in the toad kidney, Kras2A, also enhances
Na+ transport in A6 cells and in heterologous
expression systems (20, 24).
Since aldosterone increases ENaC mRNA and protein levels in certain
tissues, components of the ENaC complex may themselves be
aldosterone-induced proteins. The molecular basis for the aldosterone-
mediated increase in
ENaC mRNA and protein has previously been
unknown. In this paper we show that aldosterone increases
ENaC
expression in collecting duct epithelia solely via an increase in
transcription of the
ENaC gene. We also show that aldosterone can
signal via glucocorticoid receptor (GR) or mineralocorticoid receptor
(MR) in a cell-specific manner and confirm that a hormone response
element in the
ENaC 5'-flanking region is required for the
aldosterone- mediated transcription of
ENaC.
| RESULTS |
|---|
|
|
|---|
ENaC gene and have begun to characterize transcriptional regulatory
elements in its 5'- flanking region. The h
ENaC gene has two
transcription start sites, defining the 5' end of alternate first exons
that are under the control of separate promoters P1 and P2 (12). The P1
promoter is TATA and CAAT-less but contains several transcription
factor binding motifs including AP1, AP2, GAGA, CREB, NFE1, Sp1, TTF,
and the response elements for retinoic acid (RARE), serum, metals
(MRE), and glucocorticoids (GRE) (Fig. 1
ENaC gene transcription in lung and in the
collecting duct via a GRE at -157 to -142 in the h
ENaC promoter
(12).
|
ENaC mRNA expression, we screened two mammalian collecting duct
cell lines for aldosterone-regulated Na+
transport. The M-1 cell line established from the mouse CCD has
glucocorticoid-regulated Na+ transport (12, 25, 26), and the MDCK-C7 cell line established from the canine distal
nephron exhibits aldosterone- and glucocorticoid- regulated
Na+ transport (27). M-1 cells, when grown on
filters and stimulated with 100 nM aldosterone for 24
h, showed a small increase in short-circuit current (Isc) compared with
that in control filters. As we have previously reported, dexamethasone
robustly increased Isc after 24 h (Fig. 2A
ENaC expression may have a transcriptional basis,
the
ENaC promoter containing genomic sequence from 1,388 to +55
(Fig. 2D
ENaC genomic fragments in both cell lines while aldosterone
stimulated luciferase expression only in MDCK-C7 cells (Fig. 2
|
ENaC gene
transcription was receptor mediated, we tested the effects of the GR
antagonist, RU38486, and the MR antagonist, spironolactone. While
dexamethasone stimulation was abolished by RU38486, either RU38486 or
spironolactone (Fig. 3A
ENaC gene transcription in a dose-dependent manner (Fig. 3
ENaC were not contained
within this construct. Using a standard radioligand receptor-binding
assay, we then determined whether GR and MR protein were present in
MDCK-C7 cytosolic extracts. These studies indicated that binding
consistent with GR was present within MDCK-C7 cytosolic extracts, while
no specific aldosterone binding was detected (Fig. 3D
ENaC
gene transcription. These results also indicated that aldosterone
binding and trans- activation via GR were cell specific
as M-1 cells, despite having a classic GR response on the
ENaC
promoter, do not exhibit an aldosterone response (Fig. 2E).
|
ENaC
mRNA expression in MDCK-C7 cells, we cloned the canine
ENaC
(c
ENaC) cDNA. First, mRNA from dexamethasone and aldosterone-treated
MDCK-C7 cells was reverse transcribed and then amplified by PCR using
primers designed to regions of the
ENaC mRNA that are highly
conserved between human and rat (28, 29). A specific 612-bp fragment
was amplified, cloned into pCR-XLTOPO, and sequenced (GenBank accession
number AF209748). The canine
ENaC cDNA has 91% homology with the
human sequence and 85% homology with the rat sequence, while the
translated sequence is 89% identical to the human and 87% identical
to the rat sequence (data not shown).
The effects of aldosterone and dexamethasone on steady state
ENaC
mRNA levels in MDCK-C7 cells were studied by ribonuclease protection
assay (RPA). Both aldosterone and dexamethasone increase
ENaC
expression in these cells (Fig. 4
). As
with the transfected
ENaC promoter constructs,
aldosterone-stimulated
ENaC expression was blocked by ZK98299 while
the dexamethasone-stimulated
ENaC expression was not inhibited by
RU28318. Furthermore, the effect of these corticosteroids on
ENaC
expression correlated well with their effects on
ENaC gene
transcription, suggesting that the corticosteroid-mediated increases in
mRNA expression may be mediated solely by an increase in transcription
of
ENaC mRNA.
|
ENaC mRNA levels, Isc and
ENaC mRNA levels were
measured at various time periods after the addition of 100
nM aldosterone. Aldosterone-stimulated
ENaC expression
was first evident at 2 h, increased by 4 h, and peaked by
48 h (Fig. 5
ENaC mRNA levels may
contribute to the increase in Na+ transport. To
determine whether sgk1, another component of the sodium transport
pathway, was also regulated by aldosterone in these cells, we cloned
the canine sgk1 cDNA (Genbank accession number AF317416) and examined
sgk1 mRNA expression. Our results demonstrate that sgk1 expression is
increased within 1 h of aldosterone stimulation (Fig. 5D
|
ENaC mRNA
were via an increase in transcription, we evaluated the effect of 1
µM actinomycin D, an inhibitor of transcription, on the
steroid responses (Fig. 6
ENaC is an aldosterone- and glucocorticoid-induced
transcript in the canine collecting duct. To determine whether
aldosterone had an independent effect on
ENaC mRNA stability, we
measured
ENaC mRNA decay in MDCK-C7 cells with aldosterone or
vehicle in the presence of actinomycin D to block continued
transcription (Fig. 6C
ENaC
transcript was remarkably similar with aldosterone or vehicle (aldo
t1/2 = 14.6 h vs. ctrl t1/2 = 14.02 h),
suggesting that aldosterone had no effect on mRNA turnover.
|
ENaC promoter
constructs into M-1 cells and then treated these cells with
aldosterone. The results indicate that aldosterone can stimulate
ENaC gene transcription in M-1 cells when MR is transiently
expressed in these cells (Fig. 7A
|
ENaC gene
transcription, we used a colonic cell line, HT-29, where we had noted
that although
ENaC was constitutively expressed, a corticosteroid
response was not seen (data not shown). This finding suggested that
neither GR nor MR was expressed in this epithelial cell model. Receptor
binding studies confirmed these findings (Fig. 7B
ENaC gene transcription. When the
ENaC-luciferase construct was transiently transfected into these
cells, aldosterone and dexamethasone increased
ENaC gene
transcription but only in the presence of coexpressed MR or GR (Fig. 7C
ENaC transcription was further
examined in a dose-response study (Fig. 7D
ENaC gene
transcription via MR was 10 nM compared with 66
nM via GR, indicating a higher affinity of
aldosterone for MR. These results suggest that at lower concentrations
the effect of aldosterone on
ENaC expression is likely to occur via
the MR in tissues that express the receptor, and that at higher
concentrations aldosterone can signal via the GR to achieve similar
downstream effects.
We then determined the cis-element(s) within the
ENaC
5'-flanking region that is required for the effects of aldosterone by
using a series of deletion constructs. The proximal 5'-flanking region
of h
ENaC contains at least two imperfect GREs (Up-GRE and Dn-GRE)
that are potential aldosterone-responsive enhancers. We have previously
shown that the more proximal GRE (Dn-GRE) was sufficient and necessary
for glucocorticoid-mediated trans-activation of
ENaC
transcription in lung epithelial cells (12). To date, no specific
aldosterone-responsive elements have been identified, and experiments
on classic glucocorticoid-responsive promoters such as the mouse
mammary tumor virus (MMTV) promoter and the tyrosine amino-transferase
(TAT) promoter and on isolated GREs have suggested that GREs also
function as aldosterone-responsive elements (30, 31). Since
ENaC is
an authentic aldosterone-responsive gene, we asked whether this
paradigm would also be true in this instance. Progressive 5'-deletions
of the
ENaC promoter demonstrated that the 5'-flanking region
remained aldosterone responsive until the Dn-GRE was removed (Fig. 8B
, cf. Dn/-141+55 and -141+55).
Selective removal of the Up-GRE did not diminish the magnitude of the
aldosterone response (Fig. 8B
, cf. -287+55 and -248+55), and
replacing the Dn-GRE with the Up-GRE abolished the aldosterone response
(Fig. 8B
, cf. Up/-141+55 and Dn/-141+55). Both the Up-GRE and the
Dn-GRE appeared to stimulate basal luciferase activity when the region
immediately 5' to the Dn-GRE was removed, suggesting that a
constitutive negative regulatory element was present in this region.
Importantly, these results suggested that the Dn-GRE was required for
aldosterone stimulation of
ENaC expression in MDCK-C7 cells (Fig. 8B
). To confirm the role of the Dn-GRE in mediating the aldosterone
effect on
ENaC expression, a 3-bp mutation, predicted to abolish
steroid receptor binding, was introduced into the full-length (-287
+55) construct by site-directed mutagenesis. This construct was
unresponsive to aldosterone, confirming that, at least in this cell
line, aldosterone when bound to GR signals via this GRE on the
ENaC
promoter (Fig. 8C
). To determine the enhancer elements within the
ENaC promoter required for the MR-dependent aldosterone effect on
ENaC gene transcription, the effects of various deletions were also
tested in HT-29 cells when either GR or MR were exogenously expressed
(Fig. 8D
). The aldosterone response appeared to localize to the Dn-GRE
when bound to GR or MR. These studies indicated that aldosterone, when
bound to GR or MR, increased
ENaC gene transcription via the Dn-GRE
in both cell lines. A very small, but statistically significant,
increase in
ENaC gene transcription was seen with dexamethasone and
GR in the -141+55 construct where both GREs were deleted. This
increase in luciferase activity was inconsistent and was never seen in
MDCK-C7 cells (Fig. 8B
) or in H441 cells (12).
|
| DISCUSSION |
|---|
|
|
|---|
ENaC mRNA levels in the collecting duct raises the
possibility that
ENaC is itself an aldosterone-induced protein. In a
murine CCD cell line, mpkCCDc14, the aldosterone-mediated increase in
ENaC mRNA was accompanied by a similar increase in
ENaC protein
levels (35). To test the hypothesis that
ENaC is an
aldosterone-induced transcript, we have used the C7 subclone of MDCK, a
cell line that appears to exhibit many characteristics of the principal
cells of the collecting duct including the presence of
aldosterone-regulated electrogenic Na+ transport
(Fig. 2B
ENaC promoter, indicating that this cell line contained the required
transcriptional machinery for the aldosterone effect. Further analysis
of the aldosterone effect on the
ENaC promoter in MDCK-C7 cells
indicated that the effect was dose-dependent and mediated via the GR.
Aldosterone also stimulated
ENaC mRNA expression in MDCK-C7 cells
via the GR, and this increase correlated with its effects on the
ENaC promoter. Additionally, the effect on
ENaC expression
preceded the increase in Isc and was abolished by concurrent treatment
with actinomycin D. A separate effect on
ENaC mRNA turnover was
excluded by measurement of the
ENaC mRNA half-life in the presence
and absence of aldosterone.
Having confirmed that aldosterone increases
ENaC mRNA levels
exclusively via an increase in transcription, we next used a receptor
null epithelial cell line, HT-29, to reconstitute GR- and MR-dependent
trans-activation pathways. In this cell line, both
aldosterone- and dexamethasone-stimulated
ENaC gene transcription
occurs via the MR or the GR. Aldosterone acting via either receptor
stimulated a lower rate of transcription compared with dexamethasone
when acting via the GR, and this response is similar to that reported
for the MMTV promoter, a well studied glucocorticoid-regulated promoter
(36, 37). Our studies indicate that this is also true for aldosterone-
regulated genes. Importantly, these results and those seen in
MDCK-C7 cells also suggest that under certain conditions aldosterone
can effectively signal via the GR to activate target genes. The lack of
an aldosterone response via the GR in M-1 cells suggests several
possibilities. A cell-specific positively regulating cofactor required
for effective interaction of aldosterone with GR may be absent from M-1
cells. Alternatively, the GR may be constrained from interacting with
aldosterone by a corepressor in M-1 cells.
The dose-response curves for aldosterone via either receptor in HT29
cells indicate that aldosterone has a higher affinity for the MR
compared with GR with an EC50 of 10
nM. The EC50 for GR is similar to
that reported in an amphibian transporting epithelial cell, A6 (38).
The EC50 for MR is somewhat higher than that
reported for MR interacting with the MMTV promoter, and there are at
least two possible reasons for these results (31, 37). The first
possibility is that transfection efficiency was such that a fraction of
transfected cells contained either the luciferase vector or the
receptor expression vector but not both, thus effectively shifting the
dose-response curve. The second possibility is that the efficiency of
activation of the MMTV GRE may be different from that on the
ENaC
GRE because of cooperative interactions with other
trans-acting factors that bind to distinct
cis-elements on the
ENaC gene. Unlike the MMTV promoter
and the TAT promoter, which are classic glucocorticoid-regulated genes
that have been used to model aldosterone action, the
ENaC gene is
arguably one of the first endogenous aldosterone-regulated genes, and
further studies on this and other aldosterone-responsive genes will be
required to clarify this effect.
Deletional analysis of the
ENaC gene indicated that aldosterone,
like dexamethasone, stimulates
ENaC gene transcription via a single
imperfect GRE (Dn-GRE) in the
ENaC 5'-flanking region. The minimal
elements required for stimulation via the MR or GR were not different
when examined after heterologous expression of either receptor in HT29
cells.
Does the aldosterone-mediated activation of
ENaC gene transcription
leading to an increase in
ENaC mRNA levels have biological
significance? With the identification of sgk1 as an early
aldosterone-induced transcript and the demonstration that coexpression
of sgk1 and ENaC mRNAs in Xenopus oocytes leads to an
enhancement of ENaC-dependent Na+ transport, sgk1
became a candidate mediator for the early aldosterone-stimulated
increase in Na+ transport (21, 22, 39). This
increase in Na+ transport, at least in A6
amphibian cells, occurs before an increase in transcription of ENaC
subunits become evident but follows the increase in sgk1 expression
(21). However, in a clonal mammalian CCD cell line,
mpkCCDc14, aldosterone increased
ENaC mRNA and
protein expression within 2 h, the earliest time point tested, and
this correlated well with the increase in Na+
transport seen with aldosterone (35). We have examined the time course
for the aldosterone effect in MDCK-C7 cells and show that the
aldosterone-mediated increase in
ENaC expression appears to precede
the observed increase in Na+ transport,
similar to the effect of glucocorticoids in a lung epithelial cell
line, H441 (C.P. Thomas, unpublished observations). Based on our
earlier studies on
ENaC expression and Na+
transport and this study, it appears reasonable to suggest that the
late effects on Na+ transport require an increase
in transcription of the
ENaC gene to sustain the increase in
transport seen with continued corticosteroid exposure (Fig. 9
). Conclusive evidence for this model
will require targeted mutation of the
ENaC GRE in the genome of an
experimental animal or in a cell culture model, and the subsequent
evaluation of corticosteroid effects.
|
ENaC mRNA in renal cortex were not different in MR-/- mice
compared with MR+/+ mice, suggesting that
ENaC mRNA levels were
being maintained by elevated circulating aldosterone or corticosterone
acting via the GR. These studies indicate that the MR is not absolutely
necessary for life and suggest that in certain circumstances
aldosterone may mediate its actions via the GR or by other
non-receptor-mediated pathways (46, 47). | MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]UTP was from NEN Life Science Products (Boston, MA). Stock solutions of all corticosteroids
and receptor antagonists were made in ethanol while actinomycin D was
made in Me2SO.
Tissue Culture and Short-Circuit Current (Isc)
Measurements
MDCK-C7, a subclone of the MDCK cell line (gift from B.
Blazer-Yost and H. Oberleithner), was maintained in MEM with 10% FBS
(27). The M-1 CCD cell line and the human colon carcinoma cell line,
HT-29, were cultured as previously described (12). In preparation for
MDCK-C7 Na+ transport measurements, cells were
seeded on 12-mm Millicel PCF filters (Millipore Corp.,
Bedford, MA), which had been pretreated with human placental collagen.
They were then grown for 3 days in MEM supplemented with 5 µg/ml
insulin, 5 µg/ml transferrin, 5 nM triiodothyronine, 50
nM hydrocortisone, 10 nM sodium selenite, 50
µg/ml gentamicin, 10 mg/ml BSA, and 5 nM dexamethasone
and for an additional day in MEM without albumin or steroids. For
measurement of ion transport, filters were placed in specially designed
chambers (Jims Instruments, Iowa City, IA) and transepithelial
voltage, Isc, and resistance (RT) were recorded
at 37 C as previously described (48). Cells were then treated with
fresh supplemented media (without albumin) with 100 nM
dexamethasone, 100 nM aldosterone, or vehicle and peak Isc
measured at various time periods. In some cases, the effect of 10
µM benzamil on Isc was also measured. M-1 cells were
grown and measured under the same conditions as MDCK-C7, except that
DMEM-F12 medium was used instead of MEM. Cultures were used only if the
resistances before and during the experiments were more than 500
/cm2 for M-1 cells and more than 1000
/cm2 for MDCK-C7 cells.
Transient Transfection and Functional Analysis
The organization of the 5'-end of the h
ENaC gene has
previously been described (49). An approximately 1,400 nucleotide (nt)
fragment of the h
ENaC 5'-flanking region was amplified from human
placental genomic DNA using primers 5'- ACCCAGCACCCAGAGAGCAGACGAA and
5'-TCAGGCCCTGCAGAGAAGAGAGAAGAGGTC. The amplified fragment was cloned
into pCR 2.1 (Invitrogen, Carlsbad, CA) and sequenced in
both directions. To examine aldosterone regulation of
ENaC, a region
that extended from 1,388 to +55 was subcloned upstream of the firefly
luciferase coding region at the SacIXhoI site
of pGL3basic (Promega Corp., Madison, WI). This construct
was transiently transfected into various cell lines along with a
control plasmid to correct for differences in transfection efficiency
and in recovery of cytosolic extracts. The control plasmid used was
either pSVß-gal, where the Escherichia coli lacZ gene is
cloned downstream of the SV40 promoter (Promega Corp.), or
pRL-SV40, where the Renilla reniformis luciferase gene is
cloned downstream of the SV40 promoter (Promega Corp.).
M-1, MDCK-C7, and HT-29 cells were grown in 12- or 24-well plates until
subconfluent, and then 1 µg of the
ENaC-luciferase construct and 1
µg of pRL-SV40 or pSVß-gal were transiently transfected into cell
monolayers using LipofectAMINE Plus (Life Technologies, Inc.). In some experiments, 0.5 µg of an expression vector for
the GR or MR or an empty plasmid, pCDNA3 (Invitrogen), was
cotransfected along with 0.5 µg of the
ENaC-luciferase construct
and 0.5 µg of the control plasmid. To identify aldosterone-responsive
cis-elements in the
ENaC 5'-flanking region, various
deletion constructs of
ENaC were derived by restriction digestion or
by separate PCR amplification (12) and then transfected into MDCK-C7 or
HT-29 cells.
The putative aldosterone-responsive enhancer in the 5'-flanking region
of h
ENaC, AGAACAgaaTGTCCT, was mutated to AGTCTAgaaTGTCCT
using the Quikchange Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA) and primers
5'-CAGTGTAAAGAAGTCTAGAATGTCCTAGGGCCC and
5'-GGGCCCTAGGACATTCTAGA CTTCTTTACACTG. Briefly, the -287
+55 construct in pGL3basic was annealed with the above primers and
extended with Pfu DNA polymerase; the parental plasmid was
then digested with DpnI and the extended circular
double-stranded DNA molecule (-287 +55/mutdnGRE) was recovered by
transformation into bacteria.
Starting the day after transfection, cells were treated for 24 h with various corticosteroids, or vehicle in serum-free medium. To help determine corticosteroid-signaling pathways, the steroid receptor antagonists RU28318, RU38486, spironolactone, or ZK98299 (all 10 µM), were used in some experiments. Preparation of cell lysates and measurement of reporter gene activity were performed as previously described (12). Data from several experiments were combined and analyzed by Students t test.
Receptor Binding Assays
To quantitate GR and MR levels in MDCK-C7 and HT-29 cell lines,
cytosolic receptor binding assays were performed. Monolayers of these
two cell lines were harvested and the cell pellets were washed with
PBS. The cell pellets were then homogenized in 3 ml of buffer (10
mM Tris, 2 mM dithiothreitol, 10 mM
Na2MoO4, pH 7.5) using a
Polytron Homogenizer (Brinkmann Instruments, Inc.
Westbury, NY). Molybdate has been previously show to stabilize the
ligand binding domain of GR and MR (50, 51). The crude homogenates were
centrifuged for 1 h at 4 C and 100,000 x g and
the resulting supernatants were used immediately for binding assays.
The cytosolic extracts were preincubated for 2 h at 4 C with a
250-fold molar excess of RU28318 (MR antagonist) to block cross-over
binding of labeled dexamethasone to MR, or with RU28362 (GR antagonist)
to block cross-over binding of labeled aldosterone to GR. For
quantitation of GR binding levels, aliquots of the RU28318-preincubated
cytosol were incubated overnight at 4 C with 30
nM [3H]-dexamethasone in
the absence or presence of a 500-fold molar excess of cold
dexamethasone. For quantitation of MR binding levels, aliquots of the
RU 28362-preincubated cytosol were incubated overnight with 10
nM [3H]-aldosterone in
the absence or presence of a 500-fold molar excess of cold aldosterone.
Specific binding to either the GR or MR was quantitated via the
hydroxylapatite batch assay followed by liquid scintillation
spectroscopy (52). Cytosolic GR and MR binding levels were then
expressed as specifically bound dpm per mg of cytosolic protein. As a
positive control for the binding assays, specific GR and MR binding
levels were also quantitated in cytosolic extracts prepared from rat
liver and colon.
RT-PCR and Cloning of c
ENaC and csgk cDNA
Total RNA was prepared from MDCK-C7 cells treated with 100
nM dexamethasone and aldosterone for 24 h. One hundred
nanograms of MDCK-C7 RNA were reverse transcribed at 42 C for 60 min
with oligo-dT and 50 U of M-MLV RT (Life Technologies, Inc.) in a 20 µl reaction mixture that also contained 50
mM KCl; 10 mM Tris-HCl, pH 8.0; 1
mM deoxynucleoside triphosphates (dNTPs); 5
mM MgCl2; and
0.5 µl RNAsin (Promega Corp.). For PCR the following
primers were used: can
(F): 5'-GGATGAACCTGCCTTTATGG and can
(R):
5'-CCGAACCACAGGCTCCACTG. For PCR of canine sgk1 (csgk1) a two-step
strategy was used. First, primers, 5'-AAGATTACTCCCCCTTTTAACC and
5'-CGCTCGTTTCAGAGATAGC, corresponding to human sgk1 sequence, were used
to amplify a 440-bp fragment from canine cDNA (53). Next, internal
primers, 5'-AAGAGCCAGTCCCCAAC- TCC and 5'-TCCTTCAAGACCAACCCTCG,
corresponding to csgk1 were synthesized and used to amplify a 150-bp
PCR fragment. Two microliters of first-strand cDNA were combined with
25 pmol of each primer, 50 mM KCl, 10 mM
Tris-HCl, 1.5 mM MgCl2, and 1
mM dNTPs and subjected to 35 cycles at 95 C for 30 sec, 58
C for 30 sec, and 72 C for 3 min. Amplified products were cloned into
pCRXL-TOPO (Invitrogen) and sequenced in both
directions.
RNA Preparation and RPA
MDCK-C7 cells were grown to subconfluence in 100 mm petri
dishes, switched to serum-free media, and incubated with 100
nM aldosterone, dexamethasone, or vehicle in the presence
or absence of ZK98299 or RU28318 (10 µM). In some cases,
1 µM Actinomycin D, a transcription inhibitor, was added
simultaneously with corticosteroid hormones or vehicle. RNA from
cultured cells was prepared with the RNeasy Mini Kit
(QIAGEN, Valencia, CA) following the manufacturers
recommendations. To determine mRNA turnover, MDCK-C7 cells were
stimulated with 100 nM aldosterone for 24 h and then
treated with aldosterone or vehicle for various times in the presence
of 1 µM actinomycin D. For RPA of
ENaC, a template
containing the cloned
ENaC PCR fragment was linearized with
DdeI and a 266-nt antisense cRNA probe synthesized with
[32P]UTP and T7 polymerase. For RPA of sgk1, a
template containing the cloned sgk1 fragment was digested with
BamHI and a 195-nt antisense cRNA probe was synthesized. To
control for RNA loading an 18S rRNA template (pTR1 RNA 18S,
Ambion, Inc. Austin, TX) was also used to generate an
antisense cRNA probe. RNA samples were cohybridized overnight and
digested as described previously (12). The size of the
nuclease-protected fragments was determined from a radiolabeled 50-bp
DNA ladder (Life Technologies, Inc.) run alongside these
samples.
To quantitate mRNA expression, autoradiograms were scanned and the
density of individual bands was measured using Kodak Digital Science
Image Analysis Software (Eastman Kodak Co, Rochester, NY).
The
ENaC band was normalized for the density of the 18S rRNA band,
and the data from three experiments were pooled and analyzed by
Students t test. For calculation of mRNA half-life, data
points were plotted on a semilogarithmic scale and exponential
regression lines were derived for vehicle and aldosterone-treated
samples.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was presented at the 1999 American Society of Nephrology and Experimental Biology annual meeting and has been published in abstract form.
This work was supported by the NIH (Grant DK-54348), and the March of Dimes Foundation (6-FY99444). C. P. Thomas is an Established Investigator of the American Heart Association.
The sequences reported in this paper have been submitted to GenBank with accession numbers AF209748, U81961, and AF317416.
Received for publication March 24, 2000. Revision received November 20, 2000. Accepted for publication December 20, 2000.
| REFERENCES |
|---|
|
|
|---|
, ß and
subunits of the amiloride-sensitive Na+ channel
in colon, lung and kidney. Pfluegers Arch 430:299307[CrossRef][Medline]
, ß, and
subunit
proteins in rat kidney. J Clin Invest 104:R1923
subunit
gene. J Biol Chem 274:1243112437
-subunit is regulated by antagonistic effects between glucocorticoid
hormone and ras pathways in salivary epithelial cells. J Biol Chem 274:2154421554
-subunit of the rat amiloride-sensitive epithelial sodium channel.
Am J Respir Cell Mol Biol 20:10281040
subunit mRNA leads to distinct NH2-terminal
variant proteins. Am J Physiol 274:C13121323
This article has been cited by other articles:
![]() |
L. R. Stow, M. L. Gumz, I. J. Lynch, M. M. Greenlee, A. Rudin, B. D. Cain, and C. S. Wingo Aldosterone Modulates Steroid Receptor Binding to the Endothelin-1 Gene (edn1) J. Biol. Chem., October 30, 2009; 284(44): 30087 - 30096. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Martinerie, S. Viengchareun, A.-L. Delezoide, F. Jaubert, M. Sinico, S. Prevot, P. Boileau, G. Meduri, and M. Lombes Low Renal Mineralocorticoid Receptor Expression at Birth Contributes to Partial Aldosterone Resistance in Neonates Endocrinology, September 1, 2009; 150(9): 4414 - 4424. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Jesse, J. McCartney, X. Feng, E. M. Richards, C. E. Wood, and M. Keller-Wood Expression of ENaC subunits, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R453 - R461. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhang, S. Li, P. Cruz, and B. C. Kone Sirtuin 1 Functionally and Physically Interacts with Disruptor of Telomeric Silencing-1 to Regulate {alpha}-ENaC Transcription in Collecting Duct J. Biol. Chem., July 31, 2009; 284(31): 20917 - 20926. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hu, E. A. Oboukhova, S. Kumar, M. Sturek, and A. G. Obukhov Canonical Transient Receptor Potential Channels Expression Is Elevated in a Porcine Model of Metabolic Syndrome Mol. Endocrinol., May 1, 2009; 23(5): 689 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Gerber, K. Masuno, and M. I. Diamond Discovery of selective glucocorticoid receptor modulators by multiplexed reporter screening PNAS, March 24, 2009; 106(12): 4929 - 4934. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Musch, A. Lucioni, and E. B. Chang Aldosterone regulation of intestinal Na absorption involves SGK-mediated changes in NHE3 and Na+ pump activity Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G909 - G919. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Schoner and G. Scheiner-Bobis Role of endogenous cardiotonic steroids in sodium homeostasis Nephrol. Dial. Transplant., September 1, 2008; 23(9): 2723 - 2729. [Full Text] [PDF] |
||||
![]() |
J. Zhou, R. H. Oakley, and J. A. Cidlowski DAX-1 (Dosage-Sensitive Sex Reversal-Adrenal Hypoplasia Congenita Critical Region on the X-Chromosome, Gene 1) Selectively Inhibits Transactivation But Not Transrepression Mediated by the Glucocorticoid Receptor in a LXXLL-Dependent Manner Mol. Endocrinol., July 1, 2008; 22(7): 1521 - 1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, J. I. Andrews, and K. Z. Liu Intronic polyadenylation signal sequences and alternate splicing generate human soluble Flt1 variants and regulate the abundance of soluble Flt1 in the placenta FASEB J, December 1, 2007; 21(14): 3885 - 3895. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hitomi, H. Kiyomoto, A. Nishiyama, T. Hara, K. Moriwaki, K. Kaifu, G. Ihara, Y. Fujita, T. Ugawa, and M. Kohno Aldosterone Suppresses Insulin Signaling Via the Downregulation of Insulin Receptor Substrate-1 in Vascular Smooth Muscle Cells Hypertension, October 1, 2007; 50(4): 750 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Boyd and A. Naray-Fejes-Toth Steroid-Mediated Regulation of the Epithelial Sodium Channel Subunits in Mammary Epithelial Cells Endocrinology, August 1, 2007; 148(8): 3958 - 3967. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yokota, H. Shibata, I. Kurihara, S. Kobayashi, N. Suda, A. Murai-Takeda, I. Saito, H. Kitagawa, S. Kato, T. Saruta, et al. Coactivation of the N-terminal Transactivation of Mineralocorticoid Receptor by Ubc9 J. Biol. Chem., January 19, 2007; 282(3): 1998 - 2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nagata, M. Takahashi, K. Sawai, T. Tagami, T. Usui, A. Shimatsu, Y. Hirata, and M. Naruse Molecular Mechanism of the Inhibitory Effect of Aldosterone on Endothelial NO Synthase Activity Hypertension, July 1, 2006; 48(1): 165 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, X. Xia, M. R. Reisenauer, C. S. Hemenway, and B. C. Kone Dot1a-AF9 Complex Mediates Histone H3 Lys-79 Hypermethylation and Repression of ENaC{alpha} in an Aldosterone-sensitive Manner J. Biol. Chem., June 30, 2006; 281(26): 18059 - 18068. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, X. Xia, D. I. Jalal, T. Kuncewicz, W. Xu, G. D. Lesage, and B. C. Kone Aldosterone-sensitive repression of ENaC{alpha} transcription by a histone H3 lysine-79 methyltransferase Am J Physiol Cell Physiol, March 1, 2006; 290(3): C936 - C946. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, K. Z. Liu, and H. S. Vats Medroxyprogesterone acetate binds the glucocorticoid receptor to stimulate {alpha}-ENaC and sgk1 expression in renal collecting duct epithelia Am J Physiol Renal Physiol, February 1, 2006; 290(2): F306 - F312. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney Hypertension, October 1, 2005; 46(4): 787 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Z. Jaffe and M. E. Mendelsohn Angiotensin II and Aldosterone Regulate Gene Transcription Via Functional Mineralocortocoid Receptors in Human Coronary Artery Smooth Muscle Cells Circ. Res., April 1, 2005; 96(6): 643 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1 Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, R. W. Loftus, and K. Z. Liu AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene Am J Physiol Renal Physiol, September 1, 2004; 287(3): F460 - F468. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grossmann, R. Freudinger, S. Mildenberger, A. W. Krug, and M. Gekle Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1226 - F1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, Y. Li, J. Dietz, and D. S. Lala Repression of p65 Transcriptional Activation by the Glucocorticoid Receptor in the Absence of Receptor-Coactivator Interactions Mol. Endocrinol., January 1, 2004; 18(1): 53 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, J. R. Campbell, J. Herrero, P. M. Snyder, and C. P. Thomas Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains Am J Physiol Renal Physiol, November 1, 2003; 285(5): F916 - F929. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, K. L. Cornish, K. Z. Liu, and C. P. Thomas Cycloheximide increases glucocorticoid-stimulated alpha -ENaC mRNA in collecting duct cells by p38 MAPK-dependent pathway Am J Physiol Renal Physiol, April 1, 2003; 284(4): F778 - F787. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, J. Zhou, K. Z. Liu, V. E. Mick, E. MacLaughlin, and M. Knowles Systemic Pseudohypoaldosteronism from Deletion of the Promoter Region of the Human {beta} Epithelial Na+ Channel Subunit Am. J. Respir. Cell Mol. Biol., September 1, 2002; 27(3): 314 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Schafer Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct Am J Physiol Renal Physiol, August 1, 2002; 283(2): F221 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kitagawa, J. Yanagisawa, H. Fuse, S. Ogawa, Y. Yogiashi, A. Okuno, H. Nagasawa, T. Nakajima, T. Matsumoto, and S. Kato Ligand-Selective Potentiation of Rat Mineralocorticoid Receptor Activation Function 1 by a CBP-Containing Histone Acetyltransferase Complex Mol. Cell. Biol., June 1, 2002; 22(11): 3698 - 3706. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Stockand New ideas about aldosterone signaling in epithelia Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, S. D. Auerbach, R. F. Husted, K. A. Volk, S. Ageloff, M. A. Knepper, J. B. Stokes, and C. P. Thomas Alveolar Epithelial Ion and Fluid Transport: Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L631 - L641. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, R. W. Loftus, K. Z. Liu, and O. A. Itani Genomic organization of the 5' end of human beta -ENaC and preliminary characterization of its promoter Am J Physiol Renal Physiol, May 1, 2002; 282(5): F898 - F909. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |