help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mick, V. E.
Right arrow Articles by Thomas, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mick, V. E.
Right arrow Articles by Thomas, C. P.
Molecular Endocrinology 15 (4): 575-588
Copyright © 2001 by The Endocrine Society

The {alpha}-Subunit of the Epithelial Sodium Channel Is an Aldosterone-Induced Transcript in Mammalian Collecting Ducts, and This Transcriptional Response Is Mediated via Distinct cis-Elements in the 5'-Flanking Region of the Gene

Verity E. Mick, Omar A. Itani, Randy W. Loftus, Russell F. Husted, Thomas J. Schmidt and Christie P. Thomas

Department of Internal Medicine (V.E.M., O.A.I., R.W.L., R.F.H., C.P.T.) Department of Physiology and Biophysics (T.J.S.), University of Iowa College of Medicine and the Veterans Affairs Medical Center (C.P.T.) Iowa City, Iowa 52242


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Aldosterone stimulates Na+ reabsorption in the collecting ducts by increasing the activity of the epithelial sodium channel, ENaC. Systemic administration of aldosterone increases {alpha}ENaC mRNA expression in mammalian kidney, suggesting that the {alpha}ENaC gene is a target for aldosterone action in the distal nephron. To determine whether aldosterone increases {alpha}ENaC gene transcription, a portion of the {alpha}ENaC 5'- flanking region coupled to luciferase was transfected into MDCK-C7 cells, a collecting duct cell line with aldosterone-stimulated Na+ transport. Both dexamethasone and aldosterone stimulated {alpha}ENaC-coupled reporter gene activity via the glucocorticoid receptor (GR), and this response correlated with the effect of these hormones on endogenous {alpha}ENaC expression. The aldosterone-stimulated {alpha}ENaC expression was blocked by actinomycin D, and aldosterone had no effect on {alpha}ENaC mRNA decay, confirming a transcriptional effect. In HT-29 cells, a GR/mineralocorticoid receptor (MR)-deficient colonic cell line with constitutive {alpha}ENaC expression, cotransfection with GR or MR restored aldosterone-stimulated {alpha}ENaC gene transcription, although aldosterone had a functional preference for MR. Analysis of deletion constructs confirmed that a single imperfect glucocorticoid response element (GRE) is necessary and sufficient to confer the aldosterone responsiveness to the {alpha}ENaC gene promoter in MDCK-C7 and HT-29 cells. These results confirm that {alpha}ENaC is an aldosterone- induced transcript in the collecting duct and delineates the molecular mechanism for this effect.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Na+ is reabsorbed in the cortical and medullary collecting ducts of the mammalian kidney via the apical amiloride-sensitive epithelial sodium channel (ENaC). The ENaC complex is composed of at least three different subunits, {alpha}, ß, and {gamma}, that have now been cloned from several species (1). These channels provide the final regulatory control for Na+ homeostasis, and activating mutations in channel subunits, which alter the rate of Na+ transport, can cause hypertension with hypokalemia and alkalosis (2, 3). Increased circulating mineralocorticoids, as seen in primary hyperaldosteronism, also lead to hypertension with hypokalemic alkalosis from increased reabsorption of Na+ via ENaC.

Corticosteroids are among the best known regulators of amiloride-sensitive Na+ transport in the collecting ducts, distal colon, and in airway epithelia. In these tissues, long-term corticosteroid treatment leads to increased expression of one or more ENaC subunits. In cultured rat lung epithelial cells, inner medullary collecting duct cells (IMCD), and cortical collecting duct (CCD) cells, dexamethasone- and aldosterone-stimulated Na+ transport is associated with an increase in steady-state {alpha}ENaC mRNA levels (4, 5). The effects of corticosteroids on ENaC expression in renal tissues have also been studied in vivo. While Renard et al. (6) initially reported that dexamethasone infusion in rats had no effect on ENaC expression in kidney cortex, several subsequent studies have reported that either dexamethasone or aldosterone infusion lead to increased expression of {alpha}ENaC mRNA in the renal cortex and medulla, without effects on other subunits (7, 8, 9). Recent studies have clearly demonstrated that elevated circulating aldosterone levels increase the abundance of the {alpha}ENaC protein in the connecting tubule and in the principal cells of the CCD (10, 11). We have shown that dexamethasone increases amiloride-sensitive Na+ transport in a human bronchiolar epithelial cell and a mouse CCD line and that this correlates temporally with an increased expression of {alpha}ENaC (12). The glucocorticoid-mediated increase in {alpha}ENaC mRNA is transcriptionally regulated, does not require protein synthesis, and involves the activation of a glucocorticoid response element (GRE) in the 5'-flanking region of the human {alpha}ENaC (h{alpha}ENaC) gene, a finding that has been confirmed by others in human and rat epithelia (12, 13, 14).

Aldosterone, like glucocorticoids, binds to cytosolic receptors, which then translocate to the nucleus where the hormone-receptor complex enhances transcription of target genes (15, 16). There has been considerable debate, however, about the mechanism of aldosterone-mediated increase in Na+ transport in mineralocorticoid-responsive epithelia. In a well studied model of Na+ transport, the A6 cell line, there is some evidence for an early aldosterone effect on Na+ conductance that is transcription independent (17). The later effect of aldosterone on Na+ conductance appears to require transcription and translation of intermediate molecules that modify the function of preexisting Na+ channels. For example, aldosterone has been shown to stimulate carboxymethylation of ßENaC in A6 cells, a process that might involve the regulation of S-adenosyl-L-homocysteine hydrolase activity (18, 19). Using subtractive hybridization and differential display techniques, several investigators have begun to identify aldosterone-induced proteins in A6 cells and in mammalian collecting duct cells (20, 21, 22). One of these, a serum- and glucocorticoid-regulated kinase 1 (sgk1), is an early aldosterone-induced gene that enhances Na+ current when coexpressed with ENaC cDNAs in Xenopus oocytes (21, 22). While the target protein(s) for this kinase is not known, aldosterone has been shown to increase phosphorylation of serine and threonine residues on ß- and {gamma}ENaC subunits when these subunits are heterologously expressed in MDCK cells (23). Another aldosterone- induced gene product in the toad kidney, Kras2A, also enhances Na+ transport in A6 cells and in heterologous expression systems (20, 24).

Since aldosterone increases ENaC mRNA and protein levels in certain tissues, components of the ENaC complex may themselves be aldosterone-induced proteins. The molecular basis for the aldosterone- mediated increase in {alpha}ENaC mRNA and protein has previously been unknown. In this paper we show that aldosterone increases {alpha}ENaC expression in collecting duct epithelia solely via an increase in transcription of the {alpha}ENaC gene. We also show that aldosterone can signal via glucocorticoid receptor (GR) or mineralocorticoid receptor (MR) in a cell-specific manner and confirm that a hormone response element in the {alpha}ENaC 5'-flanking region is required for the aldosterone- mediated transcription of {alpha}ENaC.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have determined the genomic organization of the 5'-end of the h{alpha}ENaC gene and have begun to characterize transcriptional regulatory elements in its 5'- flanking region. The h{alpha}ENaC gene has two transcription start sites, defining the 5' end of alternate first exons that are under the control of separate promoters P1 and P2 (12). The P1 promoter is TATA and CAAT-less but contains several transcription factor binding motifs including AP1, AP2, GAGA, CREB, NFE1, Sp1, TTF, and the response elements for retinoic acid (RARE), serum, metals (MRE), and glucocorticoids (GRE) (Fig. 1Go). We have previously shown that glucocorticoids increase {alpha}ENaC gene transcription in lung and in the collecting duct via a GRE at -157 to -142 in the h{alpha}ENaC promoter (12).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide Sequence of the 5'-Flanking Region of h{alpha}EnaC

Potential transcription factor binding motifs are boxed. GREs are named as referred to in this paper (Up-GRE and Dn-GRE). The transcription initiation site for h{alpha}ENaC-1, identified by RPA, is indicated by a bent arrow. The extent of the longest cDNA clone identified by 5'-RACE in human kidney is indicated by an asterisk (49 ).

 
To begin to identify the molecular basis for the effect of aldosterone on {alpha}ENaC mRNA expression, we screened two mammalian collecting duct cell lines for aldosterone-regulated Na+ transport. The M-1 cell line established from the mouse CCD has glucocorticoid-regulated Na+ transport (12, 25, 26), and the MDCK-C7 cell line established from the canine distal nephron exhibits aldosterone- and glucocorticoid- regulated Na+ transport (27). M-1 cells, when grown on filters and stimulated with 100 nM aldosterone for 24 h, showed a small increase in short-circuit current (Isc) compared with that in control filters. As we have previously reported, dexamethasone robustly increased Isc after 24 h (Fig. 2AGo). In contrast to the M-1 cell line, MDCK-C7 cells showed a significant increase in aldosterone and dexamethasone-stimulated Isc (Fig. 2BGo). This Isc was benzamil-sensitive, suggesting that the corticosteroid-mediated increase in ion transport occurred via the amiloride-inhibitable epithelial Na+ channel (Fig. 2CGo). These results also suggested that the MDCK-C7 cell line was a suitable model to evaluate mechanisms of aldosterone action. To test whether the effect of aldosterone on {alpha}ENaC expression may have a transcriptional basis, the {alpha}ENaC promoter containing genomic sequence from –1,388 to +55 (Fig. 2DGo) coupled to luciferase was transfected into these cell lines and then exposed to 100 nM dexamethasone, aldosterone, or vehicle for 24 h. Dexamethasone stimulated luciferase expression from {alpha}ENaC genomic fragments in both cell lines while aldosterone stimulated luciferase expression only in MDCK-C7 cells (Fig. 2Go, E and F). These results were consistent with the Na+ transport measurements and suggested that the cis-elements required for aldosterone action are contained within this genomic sequence.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Corticosteroid-Stimulated Electrogenic Na+ Transport and {alpha}ENaC Gene Transcription in MDCK-C7 Cells

Panels A and B, Short-circuit current in M-1 cells (panel A) and MDCK-C7 cells (panel B) treated with 100 nM aldosterone, dexamethasone, or vehicle (control) for 24 h (n = 3–6 ± SEM; *, P < 0.0005; @, P < 0.001; $, P < 0.05 compared with control Isc at 24 h). Panel C, Effect of 10 µM benzamil on vehicle and aldosterone-regulated Isc, n = 4 ± SEM; *, P < 0.0005 compared with control Isc, #, P < 0.0005 compared with Isc in the presence of benzamil. The benzamil-insensitive current did not differ between the two groups. Panel D, Schematic of the {alpha}ENaC promoter-luciferase construct used for transient transfections in mammalian cell lines. Panel E and F, M-1 cells (panel E) and MDCK-C7 cells (panel F) treated with 100 nM aldosterone, dexamethasone, or vehicle (control) for 24 h following transfection with the {alpha}ENaC promoter-luciferase construct (n = 3–6 ± SEM; *, P < 0.0005; #, P < 0.01 compared with vehicle).

 
To determine whether the effect of aldosterone on {alpha}ENaC gene transcription was receptor mediated, we tested the effects of the GR antagonist, RU38486, and the MR antagonist, spironolactone. While dexamethasone stimulation was abolished by RU38486, either RU38486 or spironolactone (Fig. 3AGo) could significantly inhibit stimulation by aldosterone. As RU38486 is a partial GR agonist and spironolactone may also block the GR, we evaluated the dose-response curve for aldosterone in the presence and absence of a specific GR antagonist, ZK98299. We also evaluated the response to RU28362, a GR-specific agonist in the presence and absence of a specific MR antagonist, RU28318. Both aldosterone and RU28362 increase {alpha}ENaC gene transcription in a dose-dependent manner (Fig. 3Go, B and C). In the presence of a GR antagonist, ZK98299, the aldosterone response is markedly shifted to the right, suggesting that the aldosterone effect is mediated, predominantly, via the GR. In the presence of a MR antagonist, RU28318, the RU28362 response is unchanged, confirming that this effect is also mediated via the GR. These results indicated that either functional MRs are absent from these cells or that the cis-elements required for MR-dependent trans-activation of {alpha}ENaC were not contained within this construct. Using a standard radioligand receptor-binding assay, we then determined whether GR and MR protein were present in MDCK-C7 cytosolic extracts. These studies indicated that binding consistent with GR was present within MDCK-C7 cytosolic extracts, while no specific aldosterone binding was detected (Fig. 3DGo). Taken together, these results indicated that functional MR was absent in MDCK-C7 cells and that aldosterone binding to GR was sufficient to activate {alpha}ENaC gene transcription. These results also indicated that aldosterone binding and trans- activation via GR were cell specific as M-1 cells, despite having a classic GR response on the {alpha}ENaC promoter, do not exhibit an aldosterone response (Fig. 2E).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Steroid Receptors and ENaC Gene Transcription in MDCK-C7 Cells

Panel A, Effect of steroid receptor antagonists, RU38486 or spironolactone (1 µM), on aldosterone- or dexamethasone-mediated (100 nM) {alpha}ENaC gene transcription in MDCK-C7 cells (n = 6 ± SD; *, P < 0.01 compared with vehicle; #, P < 0.05 compared with absence of antagonist; @, P < 0.001 compared with vehicle; $, P < 0.001 compared with absence of antagonist). Panel B, Effect of MR agonist aldosterone is dose-dependent and can be blocked by 1 µM of GR antagonist, ZK98299. Each point represents the average of two values and is representative of other experiments. Panel C, Effect of GR agonist RU28362 is dose-dependent and is not blocked by 1 µM of MR antagonist, RU28318. Each point represents the average of two values and is representative of other experiments. Panel E, Receptor binding assay shows that MDCK-C7 cells contain GR but do not contain MR.

 
To enable us to study the effects of aldosterone on endogenous {alpha}ENaC mRNA expression in MDCK-C7 cells, we cloned the canine {alpha}ENaC (c{alpha}ENaC) cDNA. First, mRNA from dexamethasone and aldosterone-treated MDCK-C7 cells was reverse transcribed and then amplified by PCR using primers designed to regions of the {alpha}ENaC mRNA that are highly conserved between human and rat (28, 29). A specific 612-bp fragment was amplified, cloned into pCR-XLTOPO, and sequenced (GenBank accession number AF209748). The canine {alpha}ENaC cDNA has 91% homology with the human sequence and 85% homology with the rat sequence, while the translated sequence is 89% identical to the human and 87% identical to the rat sequence (data not shown).

The effects of aldosterone and dexamethasone on steady state {alpha}ENaC mRNA levels in MDCK-C7 cells were studied by ribonuclease protection assay (RPA). Both aldosterone and dexamethasone increase {alpha}ENaC expression in these cells (Fig. 4Go). As with the transfected {alpha}ENaC promoter constructs, aldosterone-stimulated {alpha}ENaC expression was blocked by ZK98299 while the dexamethasone-stimulated {alpha}ENaC expression was not inhibited by RU28318. Furthermore, the effect of these corticosteroids on {alpha}ENaC expression correlated well with their effects on {alpha}ENaC gene transcription, suggesting that the corticosteroid-mediated increases in mRNA expression may be mediated solely by an increase in transcription of {alpha}ENaC mRNA.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Effect of Corticosteroids on c{alpha}ENaC Expression

MDCK-C7 cells were exposed to dexamethasone or aldosterone (100 nM) for 24 h and c{alpha}ENaC mRNA measured by RPA and compared with vehicle (ctrl). Panel A, The samples were done in triplicate alongside a radiolabeled 50-bp ladder (M). Yeast RNA control (Y) and undigested {alpha} and 18S cRNA probes are also shown. Panel B, RPA data quantitated and pooled (n = 3 ± SEM; *, P < 0.01 compared with control; #, P < 0.05 compared with aldosterone alone).

 
To determine whether the increase in aldosterone-stimulated Na+ transport in MDCK-C7 cells followed the increase in {alpha}ENaC mRNA levels, Isc and {alpha}ENaC mRNA levels were measured at various time periods after the addition of 100 nM aldosterone. Aldosterone-stimulated {alpha}ENaC expression was first evident at 2 h, increased by 4 h, and peaked by 4–8 h (Fig. 5Go, A and B). The effect of aldosterone on Isc was only clearly evident after 6 h (Fig. 5CGo). These results suggest that the increase in {alpha}ENaC mRNA levels may contribute to the increase in Na+ transport. To determine whether sgk1, another component of the sodium transport pathway, was also regulated by aldosterone in these cells, we cloned the canine sgk1 cDNA (Genbank accession number AF317416) and examined sgk1 mRNA expression. Our results demonstrate that sgk1 expression is increased within 1 h of aldosterone stimulation (Fig. 5DGo), similar to what has been described in cultured primary rabbit CCD cells (22).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Time Course for Aldosterone-Mediated Increase in {alpha}ENaC, sgk1, and Isc

Panels A and B, Effect of 100 nM aldosterone for indicated time periods on c{alpha}ENaC expression in MDCK-C7 cells. Representative RPA shown above and quantitated data shown below (n = 4 ± SEM; *, P < 0.005 compared with control). Panel C, Effect of 100 nM aldosterone for various time periods on measured Isc in MDCK-C7 cells (n = 4 ± SEM; *, P < 0.02 compared with corresponding control. Panel D, Effect of 100 nM aldosterone for indicated time periods on csgk1 expression in MDCK-C7 cells.

 
To confirm that the increases in steady state levels of {alpha}ENaC mRNA were via an increase in transcription, we evaluated the effect of 1 µM actinomycin D, an inhibitor of transcription, on the steroid responses (Fig. 6Go, A and B). Simultaneous treatment of MDCK-C7 cells with actinomycin D and either steroid hormone abolished the steroid response, providing further evidence that {alpha}ENaC is an aldosterone- and glucocorticoid-induced transcript in the canine collecting duct. To determine whether aldosterone had an independent effect on {alpha}ENaC mRNA stability, we measured {alpha}ENaC mRNA decay in MDCK-C7 cells with aldosterone or vehicle in the presence of actinomycin D to block continued transcription (Fig. 6CGo). The calculated half-life of the {alpha}ENaC transcript was remarkably similar with aldosterone or vehicle (aldo t1/2 = 14.6 h vs. ctrl t1/2 = 14.02 h), suggesting that aldosterone had no effect on mRNA turnover.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Transcription and Turnover of c{alpha}ENaC mRNA

Panels A and B, Effect of actinomycin D (act. D) on c{alpha}ENaC expression after 24 h stimulation with vehicle (C, ctrl) dexamethasone (D, dex), or aldosterone (A, aldo). Representative RPA shown above and pooled data below (n = 3; *, P < 0.0005 compared with control; #, P < 0.01 compared with dex alone; @, P < 0.02 compared with aldo alone). Panel C, Decay of {alpha}ENaC mRNA with aldosterone (aldo) or control (ctrl) in the presence of actinomycin D. The mean of duplicate samples was used to derive an exponential regression line for both sets.

 
Since aldosterone normally signals through the MR to exert its genomic effects, we wondered whether the lack of an aldosterone response in M-1 cells was due to the lack of a functional MR. To test this hypothesis, we cotransfected a MR expression vector with the {alpha}ENaC promoter constructs into M-1 cells and then treated these cells with aldosterone. The results indicate that aldosterone can stimulate {alpha}ENaC gene transcription in M-1 cells when MR is transiently expressed in these cells (Fig. 7AGo).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 7. Effect of Cotransfected MR and GR Expression on {alpha}ENaC Gene Transcription in M-1 and HT-29 Cells

Panel A, M-1 cells transfected with –1,388+55 {alpha}ENaC construct alone or with rMR were treated with 100 nM aldosterone or 100 nM dexamethasone for 24 h and compared with vehicle (n = 3 ± SD; *, P < 0.001; #, P < 0.005 compared with absence of agonist). The data are representative of other experiments. Panel B, Receptor binding assay shows that HT-29 colonic epithelial cells are MR- and GR-deficient. Rat liver is used as a positive control for GR binding. Panel C, HT-29 cells transfected with –1,388+55 {alpha}ENaC construct alone or with hMR or hGR were treated with 100 nM aldosterone or 100 nM dexamethasone for 24 h and compared with vehicle (*, P < 0.02 compared with absence of agonist; #, P < 0.001 compared with absence of agonist). The data are representative of other experiments. Panel D, Dose-response of aldosterone effect on {alpha}ENaC expression in HT-29 cells cotransfected with hGR or hMR shows that aldosterone can function through both receptors but has an EC50 of 10 nM in MR and 66 nM in GR. A maximal response via MR was elicited by 10-7.5 M aldosterone and a maximal repsonse via GR was elicited by 10-6 M aldosterone.

 
To determine the relative role of GR and MR in increasing {alpha}ENaC gene transcription, we used a colonic cell line, HT-29, where we had noted that although {alpha}ENaC was constitutively expressed, a corticosteroid response was not seen (data not shown). This finding suggested that neither GR nor MR was expressed in this epithelial cell model. Receptor binding studies confirmed these findings (Fig. 7BGo), thereby identifying the HT29 cell line as a suitable null cell for reconstituting the MR- and GR-dependent effects on {alpha}ENaC gene transcription. When the {alpha}ENaC-luciferase construct was transiently transfected into these cells, aldosterone and dexamethasone increased {alpha}ENaC gene transcription but only in the presence of coexpressed MR or GR (Fig. 7CGo). The dexamethasone-stimulated luciferase activity was significantly greater with coexpressed GR than with MR. Aldosterone stimulated luciferase activity in HT29 cells when either MR or GR was coexpressed, but the magnitude of the aldosterone-induced response was only approximately 25% of the response seen when dexamethasone stimulated luciferase activity via GR. The aldosterone-steroid receptor-mediated trans-activation of {alpha}ENaC transcription was further examined in a dose-response study (Fig. 7DGo). The EC50 for aldosterone stimulation of {alpha}ENaC gene transcription via MR was 10 nM compared with 66 nM via GR, indicating a higher affinity of aldosterone for MR. These results suggest that at lower concentrations the effect of aldosterone on {alpha}ENaC expression is likely to occur via the MR in tissues that express the receptor, and that at higher concentrations aldosterone can signal via the GR to achieve similar downstream effects.

We then determined the cis-element(s) within the {alpha}ENaC 5'-flanking region that is required for the effects of aldosterone by using a series of deletion constructs. The proximal 5'-flanking region of h{alpha}ENaC contains at least two imperfect GREs (Up-GRE and Dn-GRE) that are potential aldosterone-responsive enhancers. We have previously shown that the more proximal GRE (Dn-GRE) was sufficient and necessary for glucocorticoid-mediated trans-activation of {alpha}ENaC transcription in lung epithelial cells (12). To date, no specific aldosterone-responsive elements have been identified, and experiments on classic glucocorticoid-responsive promoters such as the mouse mammary tumor virus (MMTV) promoter and the tyrosine amino-transferase (TAT) promoter and on isolated GREs have suggested that GREs also function as aldosterone-responsive elements (30, 31). Since {alpha}ENaC is an authentic aldosterone-responsive gene, we asked whether this paradigm would also be true in this instance. Progressive 5'-deletions of the {alpha}ENaC promoter demonstrated that the 5'-flanking region remained aldosterone responsive until the Dn-GRE was removed (Fig. 8BGo, cf. Dn/-141+55 and -141+55). Selective removal of the Up-GRE did not diminish the magnitude of the aldosterone response (Fig. 8BGo, cf. -287+55 and -248+55), and replacing the Dn-GRE with the Up-GRE abolished the aldosterone response (Fig. 8BGo, cf. Up/-141+55 and Dn/-141+55). Both the Up-GRE and the Dn-GRE appeared to stimulate basal luciferase activity when the region immediately 5' to the Dn-GRE was removed, suggesting that a constitutive negative regulatory element was present in this region. Importantly, these results suggested that the Dn-GRE was required for aldosterone stimulation of {alpha}ENaC expression in MDCK-C7 cells (Fig. 8BGo). To confirm the role of the Dn-GRE in mediating the aldosterone effect on {alpha}ENaC expression, a 3-bp mutation, predicted to abolish steroid receptor binding, was introduced into the full-length (-287 +55) construct by site-directed mutagenesis. This construct was unresponsive to aldosterone, confirming that, at least in this cell line, aldosterone when bound to GR signals via this GRE on the {alpha}ENaC promoter (Fig. 8CGo). To determine the enhancer elements within the {alpha}ENaC promoter required for the MR-dependent aldosterone effect on {alpha}ENaC gene transcription, the effects of various deletions were also tested in HT-29 cells when either GR or MR were exogenously expressed (Fig. 8DGo). The aldosterone response appeared to localize to the Dn-GRE when bound to GR or MR. These studies indicated that aldosterone, when bound to GR or MR, increased {alpha}ENaC gene transcription via the Dn-GRE in both cell lines. A very small, but statistically significant, increase in {alpha}ENaC gene transcription was seen with dexamethasone and GR in the -141+55 construct where both GREs were deleted. This increase in luciferase activity was inconsistent and was never seen in MDCK-C7 cells (Fig. 8BGo) or in H441 cells (12).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 8. Identification of cis-Elements Required for Aldosterone-Mediated {alpha}ENaC Gene Transcription

Panel A, Deletion constructs of 5'-flanking region of h{alpha}ENaC used in transfections to determine the cis-elements necessary for aldosterone action. Panel B, MDCK-C7 cells transfected with indicated deletion constructs and treated with 100 nM aldosterone, dexamethasone, or vehicle for 24 h (n = 4–7 ± SEM *, P < 0.0005; #, P < 0.01 compared with vehicle). Panel C, Mutation of the Dn-GRE abolished the dexamethasone and aldosterone response in MDCK-C7 cells. Panel D, HT-29 cells cotransfected with the deletion constructs and hMR or hGR and treated with 100 nM aldosterone, dexamethasone, or vehicle for 24 h (n = 4 ± SD; #, P < 0.005; @, P < 0.0005 compared with vehicle). The results demonstrate that the constructs containing the Dn-GRE but not the Up-GRE are necessary and sufficient to confer aldosterone- and dexamethasone-responsiveness to the promoter in both MDCK-C7 and HT-29 cells.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
One of the more important physiological effects of aldosterone is to increase Na+ reabsorption in the cortical and medullary collecting ducts of the kidney. The early phase of aldosterone action on Na+ transport occurs within 1 h in some renal cell models, which is suggestive of a posttranscriptional effect on the collecting duct sodium channel, ENaC (32, 33). The subsequent effect of aldosterone occurs over several hours and can be blocked by actinomycin D, suggesting that transcription of certain target molecules is required for this phase of action (33, 34). The identity of these aldosterone-induced proteins was previously unknown but the observation that aldosterone increases the steady state {alpha}ENaC mRNA levels in the collecting duct raises the possibility that {alpha}ENaC is itself an aldosterone-induced protein. In a murine CCD cell line, mpkCCDc14, the aldosterone-mediated increase in {alpha}ENaC mRNA was accompanied by a similar increase in {alpha}ENaC protein levels (35). To test the hypothesis that {alpha}ENaC is an aldosterone-induced transcript, we have used the C7 subclone of MDCK, a cell line that appears to exhibit many characteristics of the principal cells of the collecting duct including the presence of aldosterone-regulated electrogenic Na+ transport (Fig. 2BGo). In contrast to the M-1 cell line, the MDCK-C7 cells supported aldosterone-stimulated trans-activation of the {alpha}ENaC promoter, indicating that this cell line contained the required transcriptional machinery for the aldosterone effect. Further analysis of the aldosterone effect on the {alpha}ENaC promoter in MDCK-C7 cells indicated that the effect was dose-dependent and mediated via the GR. Aldosterone also stimulated {alpha}ENaC mRNA expression in MDCK-C7 cells via the GR, and this increase correlated with its effects on the {alpha}ENaC promoter. Additionally, the effect on {alpha}ENaC expression preceded the increase in Isc and was abolished by concurrent treatment with actinomycin D. A separate effect on {alpha}ENaC mRNA turnover was excluded by measurement of the {alpha}ENaC mRNA half-life in the presence and absence of aldosterone.

Having confirmed that aldosterone increases {alpha}ENaC mRNA levels exclusively via an increase in transcription, we next used a receptor null epithelial cell line, HT-29, to reconstitute GR- and MR-dependent trans-activation pathways. In this cell line, both aldosterone- and dexamethasone-stimulated {alpha}ENaC gene transcription occurs via the MR or the GR. Aldosterone acting via either receptor stimulated a lower rate of transcription compared with dexamethasone when acting via the GR, and this response is similar to that reported for the MMTV promoter, a well studied glucocorticoid-regulated promoter (36, 37). Our studies indicate that this is also true for aldosterone- regulated genes. Importantly, these results and those seen in MDCK-C7 cells also suggest that under certain conditions aldosterone can effectively signal via the GR to activate target genes. The lack of an aldosterone response via the GR in M-1 cells suggests several possibilities. A cell-specific positively regulating cofactor required for effective interaction of aldosterone with GR may be absent from M-1 cells. Alternatively, the GR may be constrained from interacting with aldosterone by a corepressor in M-1 cells.

The dose-response curves for aldosterone via either receptor in HT29 cells indicate that aldosterone has a higher affinity for the MR compared with GR with an EC50 of 10 nM. The EC50 for GR is similar to that reported in an amphibian transporting epithelial cell, A6 (38). The EC50 for MR is somewhat higher than that reported for MR interacting with the MMTV promoter, and there are at least two possible reasons for these results (31, 37). The first possibility is that transfection efficiency was such that a fraction of transfected cells contained either the luciferase vector or the receptor expression vector but not both, thus effectively shifting the dose-response curve. The second possibility is that the efficiency of activation of the MMTV GRE may be different from that on the {alpha}ENaC GRE because of cooperative interactions with other trans-acting factors that bind to distinct cis-elements on the {alpha}ENaC gene. Unlike the MMTV promoter and the TAT promoter, which are classic glucocorticoid-regulated genes that have been used to model aldosterone action, the {alpha}ENaC gene is arguably one of the first endogenous aldosterone-regulated genes, and further studies on this and other aldosterone-responsive genes will be required to clarify this effect.

Deletional analysis of the {alpha}ENaC gene indicated that aldosterone, like dexamethasone, stimulates {alpha}ENaC gene transcription via a single imperfect GRE (Dn-GRE) in the {alpha}ENaC 5'-flanking region. The minimal elements required for stimulation via the MR or GR were not different when examined after heterologous expression of either receptor in HT29 cells.

Does the aldosterone-mediated activation of {alpha}ENaC gene transcription leading to an increase in {alpha}ENaC mRNA levels have biological significance? With the identification of sgk1 as an early aldosterone-induced transcript and the demonstration that coexpression of sgk1 and ENaC mRNAs in Xenopus oocytes leads to an enhancement of ENaC-dependent Na+ transport, sgk1 became a candidate mediator for the early aldosterone-stimulated increase in Na+ transport (21, 22, 39). This increase in Na+ transport, at least in A6 amphibian cells, occurs before an increase in transcription of ENaC subunits become evident but follows the increase in sgk1 expression (21). However, in a clonal mammalian CCD cell line, mpkCCDc14, aldosterone increased {alpha}ENaC mRNA and protein expression within 2 h, the earliest time point tested, and this correlated well with the increase in Na+ transport seen with aldosterone (35). We have examined the time course for the aldosterone effect in MDCK-C7 cells and show that the aldosterone-mediated increase in {alpha}ENaC expression appears to precede the observed increase in Na+ transport, similar to the effect of glucocorticoids in a lung epithelial cell line, H441 (C.P. Thomas, unpublished observations). Based on our earlier studies on {alpha}ENaC expression and Na+ transport and this study, it appears reasonable to suggest that the late effects on Na+ transport require an increase in transcription of the {alpha}ENaC gene to sustain the increase in transport seen with continued corticosteroid exposure (Fig. 9Go). Conclusive evidence for this model will require targeted mutation of the {alpha}ENaC GRE in the genome of an experimental animal or in a cell culture model, and the subsequent evaluation of corticosteroid effects.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 9. Schematic of Aldosterone-Induced Proteins That May Facilitate Epithelial Na+ Transport

Aldosterone increases {alpha}ENaC mRNA by stimulating {alpha}ENaC gene transcription, presumably leading to an increase in the number of channels synthesized. The aldosterone-stimulated increase in sgk1 stimulates Na+ channel activity at a posttranscriptional step, perhaps by interacting with ENaC subunit proteins.

 
Another central question that this study poses is the relevance of aldosterone signaling via GR to mediate its biological effects. It is now becoming clear that even when the MR is expressed and functional, aldosterone-dependent Na+ transport occurs by activation of the MR and GR in certain systems (35, 40, 41). The A6 cell line, which continues to be a vigorous model for the study of aldosterone-dependent Na+ transport, does not appear to express MR and many of its actions in this cell line are mediated via GR (38, 42). In systems where both receptors are expressed, the EC50 for the MR-dependent actions of aldosterone is at least 1 order of magnitude below that for GR, suggesting that at very low concentrations of aldosterone, its effects are mediated primarily, if not entirely, via MR. However, under conditions where circulating levels of mineralocorticoids are much higher, GR-dependent activation of target genes may become important. It has been known, for example, that stress doses of cortisol induce renal Na+ retention independently of MR in healthy human volunteers (43). Recent evidence from MR gene deletion experiments in mice also provides some support for this concept. While untreated MR -/- mice die in the early neonatal period, these animals can be rescued by forced Na+ administration until weaning, after which they appear to maintain their circulating volume and their serum K+ and pH within normal limits and to develop normally (44, 45). Despite the absence of MR, levels of {alpha}ENaC mRNA in renal cortex were not different in MR-/- mice compared with MR+/+ mice, suggesting that {alpha}ENaC mRNA levels were being maintained by elevated circulating aldosterone or corticosterone acting via the GR. These studies indicate that the MR is not absolutely necessary for life and suggest that in certain circumstances aldosterone may mediate its actions via the GR or by other non-receptor-mediated pathways (46, 47).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Dexamethasone, aldosterone, and spironolactone were purchased from Sigma (St. Louis, MO). RU28318, RU 28362, and RU38486 were generous gifts from Roussel Uclaf (Romainville, France), and ZK98299 was a generous gift from Schering AG (Berlin, Germany). Actinomycin D was obtained from Roche Molecular Biochemicals (Indianapolis, IN), and culture materials were from Life Technologies, Inc. (Gaithersburg, MD). [1,2,4-3H]Dexamethasone and [1,2,6,7-3H]aldosterone were from Amersham Pharmacia Biotech (Arlington Heights, IL) and [{alpha}-32P]UTP was from NEN Life Science Products (Boston, MA). Stock solutions of all corticosteroids and receptor antagonists were made in ethanol while actinomycin D was made in Me2SO.

Tissue Culture and Short-Circuit Current (Isc) Measurements
MDCK-C7, a subclone of the MDCK cell line (gift from B. Blazer-Yost and H. Oberleithner), was maintained in MEM with 10% FBS (27). The M-1 CCD cell line and the human colon carcinoma cell line, HT-29, were cultured as previously described (12). In preparation for MDCK-C7 Na+ transport measurements, cells were seeded on 12-mm Millicel PCF filters (Millipore Corp., Bedford, MA), which had been pretreated with human placental collagen. They were then grown for 3 days in MEM supplemented with 5 µg/ml insulin, 5 µg/ml transferrin, 5 nM triiodothyronine, 50 nM hydrocortisone, 10 nM sodium selenite, 50 µg/ml gentamicin, 10 mg/ml BSA, and 5 nM dexamethasone and for an additional day in MEM without albumin or steroids. For measurement of ion transport, filters were placed in specially designed chambers (Jim’s Instruments, Iowa City, IA) and transepithelial voltage, Isc, and resistance (RT) were recorded at 37 C as previously described (48). Cells were then treated with fresh supplemented media (without albumin) with 100 nM dexamethasone, 100 nM aldosterone, or vehicle and peak Isc measured at various time periods. In some cases, the effect of 10 µM benzamil on Isc was also measured. M-1 cells were grown and measured under the same conditions as MDCK-C7, except that DMEM-F12 medium was used instead of MEM. Cultures were used only if the resistances before and during the experiments were more than 500 {Omega}/cm2 for M-1 cells and more than 1000 {Omega}/cm2 for MDCK-C7 cells.

Transient Transfection and Functional Analysis
The organization of the 5'-end of the h{alpha}ENaC gene has previously been described (49). An approximately 1,400 nucleotide (nt) fragment of the h{alpha}ENaC 5'-flanking region was amplified from human placental genomic DNA using primers 5'- ACCCAGCACCCAGAGAGCAGACGAA and 5'-TCAGGCCCTGCAGAGAAGAGAGAAGAGGTC. The amplified fragment was cloned into pCR 2.1 (Invitrogen, Carlsbad, CA) and sequenced in both directions. To examine aldosterone regulation of {alpha}ENaC, a region that extended from –1,388 to +55 was subcloned upstream of the firefly luciferase coding region at the SacI–XhoI site of pGL3basic (Promega Corp., Madison, WI). This construct was transiently transfected into various cell lines along with a control plasmid to correct for differences in transfection efficiency and in recovery of cytosolic extracts. The control plasmid used was either pSVß-gal, where the Escherichia coli lacZ gene is cloned downstream of the SV40 promoter (Promega Corp.), or pRL-SV40, where the Renilla reniformis luciferase gene is cloned downstream of the SV40 promoter (Promega Corp.). M-1, MDCK-C7, and HT-29 cells were grown in 12- or 24-well plates until subconfluent, and then 1 µg of the {alpha}ENaC-luciferase construct and 1 µg of pRL-SV40 or pSVß-gal were transiently transfected into cell monolayers using LipofectAMINE Plus (Life Technologies, Inc.). In some experiments, 0.5 µg of an expression vector for the GR or MR or an empty plasmid, pCDNA3 (Invitrogen), was cotransfected along with 0.5 µg of the {alpha}ENaC-luciferase construct and 0.5 µg of the control plasmid. To identify aldosterone-responsive cis-elements in the {alpha}ENaC 5'-flanking region, various deletion constructs of {alpha}ENaC were derived by restriction digestion or by separate PCR amplification (12) and then transfected into MDCK-C7 or HT-29 cells.

The putative aldosterone-responsive enhancer in the 5'-flanking region of h{alpha}ENaC, AGAACAgaaTGTCCT, was mutated to AGTCTAgaaTGTCCT using the Quikchange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primers 5'-CAGTGTAAAGAAGTCTAGAATGTCCTAGGGCCC and 5'-GGGCCCTAGGACATTCTAGA CTTCTTTACACTG. Briefly, the -287 +55 construct in pGL3basic was annealed with the above primers and extended with Pfu DNA polymerase; the parental plasmid was then digested with DpnI and the extended circular double-stranded DNA molecule (-287 +55/mutdnGRE) was recovered by transformation into bacteria.

Starting the day after transfection, cells were treated for 24 h with various corticosteroids, or vehicle in serum-free medium. To help determine corticosteroid-signaling pathways, the steroid receptor antagonists RU28318, RU38486, spironolactone, or ZK98299 (all 10 µM), were used in some experiments. Preparation of cell lysates and measurement of reporter gene activity were performed as previously described (12). Data from several experiments were combined and analyzed by Student’s t test.

Receptor Binding Assays
To quantitate GR and MR levels in MDCK-C7 and HT-29 cell lines, cytosolic receptor binding assays were performed. Monolayers of these two cell lines were harvested and the cell pellets were washed with PBS. The cell pellets were then homogenized in 3 ml of buffer (10 mM Tris, 2 mM dithiothreitol, 10 mM Na2MoO4, pH 7.5) using a Polytron Homogenizer (Brinkmann Instruments, Inc. Westbury, NY). Molybdate has been previously show to stabilize the ligand binding domain of GR and MR (50, 51). The crude homogenates were centrifuged for 1 h at 4 C and 100,000 x g and the resulting supernatants were used immediately for binding assays. The cytosolic extracts were preincubated for 2 h at 4 C with a 250-fold molar excess of RU28318 (MR antagonist) to block cross-over binding of labeled dexamethasone to MR, or with RU28362 (GR antagonist) to block cross-over binding of labeled aldosterone to GR. For quantitation of GR binding levels, aliquots of the RU28318-preincubated cytosol were incubated overnight at 4 C with 30 nM [3H]-dexamethasone in the absence or presence of a 500-fold molar excess of cold dexamethasone. For quantitation of MR binding levels, aliquots of the RU 28362-preincubated cytosol were incubated overnight with 10 nM [3H]-aldosterone in the absence or presence of a 500-fold molar excess of cold aldosterone. Specific binding to either the GR or MR was quantitated via the hydroxylapatite batch assay followed by liquid scintillation spectroscopy (52). Cytosolic GR and MR binding levels were then expressed as specifically bound dpm per mg of cytosolic protein. As a positive control for the binding assays, specific GR and MR binding levels were also quantitated in cytosolic extracts prepared from rat liver and colon.

RT-PCR and Cloning of c{alpha}ENaC and csgk cDNA
Total RNA was prepared from MDCK-C7 cells treated with 100 nM dexamethasone and aldosterone for 24 h. One hundred nanograms of MDCK-C7 RNA were reverse transcribed at 42 C for 60 min with oligo-dT and 50 U of M-MLV RT (Life Technologies, Inc.) in a 20 µl reaction mixture that also contained 50 mM KCl; 10 mM Tris-HCl, pH 8.0; 1 mM deoxynucleoside triphosphates (dNTPs); 5 mM MgCl2; and 0.5 µl RNAsin (Promega Corp.). For PCR the following primers were used: can{alpha} (F): 5'-GGATGAACCTGCCTTTATGG and can{alpha} (R): 5'-CCGAACCACAGGCTCCACTG. For PCR of canine sgk1 (csgk1) a two-step strategy was used. First, primers, 5'-AAGATTACTCCCCCTTTTAACC and 5'-CGCTCGTTTCAGAGATAGC, corresponding to human sgk1 sequence, were used to amplify a 440-bp fragment from canine cDNA (53). Next, internal primers, 5'-AAGAGCCAGTCCCCAAC- TCC and 5'-TCCTTCAAGACCAACCCTCG, corresponding to csgk1 were synthesized and used to amplify a 150-bp PCR fragment. Two microliters of first-strand cDNA were combined with 25 pmol of each primer, 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl2, and 1 mM dNTPs and subjected to 35 cycles at 95 C for 30 sec, 58 C for 30 sec, and 72 C for 3 min. Amplified products were cloned into pCRXL-TOPO (Invitrogen) and sequenced in both directions.

RNA Preparation and RPA
MDCK-C7 cells were grown to subconfluence in 100 mm petri dishes, switched to serum-free media, and incubated with 100 nM aldosterone, dexamethasone, or vehicle in the presence or absence of ZK98299 or RU28318 (10 µM). In some cases, 1 µM Actinomycin D, a transcription inhibitor, was added simultaneously with corticosteroid hormones or vehicle. RNA from cultured cells was prepared with the RNeasy Mini Kit (QIAGEN, Valencia, CA) following the manufacturer’s recommendations. To determine mRNA turnover, MDCK-C7 cells were stimulated with 100 nM aldosterone for 24 h and then treated with aldosterone or vehicle for various times in the presence of 1 µM actinomycin D. For RPA of {alpha}ENaC, a template containing the cloned {alpha}ENaC PCR fragment was linearized with DdeI and a 266-nt antisense cRNA probe synthesized with [32P]UTP and T7 polymerase. For RPA of sgk1, a template containing the cloned sgk1 fragment was digested with BamHI and a 195-nt antisense cRNA probe was synthesized. To control for RNA loading an 18S rRNA template (pTR1 RNA 18S, Ambion, Inc. Austin, TX) was also used to generate an antisense cRNA probe. RNA samples were cohybridized overnight and digested as described previously (12). The size of the nuclease-protected fragments was determined from a radiolabeled 50-bp DNA ladder (Life Technologies, Inc.) run alongside these samples.

To quantitate mRNA expression, autoradiograms were scanned and the density of individual bands was measured using Kodak Digital Science Image Analysis Software (Eastman Kodak Co, Rochester, NY). The {alpha}ENaC band was normalized for the density of the 18S rRNA band, and the data from three experiments were pooled and analyzed by Student’s t test. For calculation of mRNA half-life, data points were plotted on a semilogarithmic scale and exponential regression lines were derived for vehicle and aldosterone-treated samples.


    ACKNOWLEDGMENTS
 
The authors acknowledge the DNA synthesis and sequencing services provided by the University of Iowa DNA core facility. The authors thank H. Oberleithner and B. Blazer-Yost for the gift of the MDCK-C7 cell line, R. M. Evans for gifts of the hGR and hMR expression vectors, and David Pearce for the rMR expression vector.


    FOOTNOTES
 
Address requests for reprints to: Christie P Thomas, M.D., Department of Internal Medicine, E300 GH, University of Iowa, 200 Hawkins Drive, Iowa City, Iowa 52242. E-mail: christie-thomas{at}uiowa.edu

This work was presented at the 1999 American Society of Nephrology and Experimental Biology annual meeting and has been published in abstract form.

This work was supported by the NIH (Grant DK-54348), and the March of Dimes Foundation (6-FY99–444). C. P. Thomas is an Established Investigator of the American Heart Association.

The sequences reported in this paper have been submitted to GenBank with accession numbers AF209748, U81961, and AF317416.

Received for publication March 24, 2000. Revision received November 20, 2000. Accepted for publication December 20, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Barbry P, Hofman P 1997 Molecular biology of Na+ absorption. Am J Physiol 273:G571–G585
  2. Warnock DG 1999 Hypertension. Semin Nephrol 19:374–80[Medline]
  3. Stewart PM 1999 Mineralocorticoid hypertension. Lancet 353:1341–7[CrossRef][Medline]
  4. Champigny G, Voilley N, Lingueglia E, Friend V, Barbry P, Lazdunski M 1994 Regulation of expression of the lung amiloride-sensitive Na+ channel by steroid hormones. EMBO J 13:2177–2181[Medline]
  5. Volk KA, Sigmund RD, Snyder PM, McDonald FJ, Welsh MJ, Stokes JB 1995 rENaC is the predominant Na+ channel in the apical membrane of the rat renal inner medullary collecting duct. J Clin Invest 96:2748–2757
  6. Asher C, Wald H, Rossier BC, Garty H 1996 Aldosterone-induced increase in abundance of Na+ channel subunits. Am J Physiol 271:C605–C611
  7. Renard S, Voilley N, Bassilana F, Lazdunski M, Barbry P 1995 Localization and regulation by steroids of the {alpha}, ß and {gamma} subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney. Pfluegers Arch 430:299–307[CrossRef][Medline]
  8. Stokes JB, Sigmund RD 1998 Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue and steroid heterogeneity. Am J Physiol 274:C1699–C1707
  9. Escoubet B, Coureau C, Bonvalet J-P, Farman N 1997 Noncoordinate regulation of epithelial Na+ channel and Na+ pump subunit mRNAs in kidney and colon by aldosterone. Am J Physiol 272:C1482–C1491
  10. Masilamani S, Kim GH, Mitchell C, Wade JB, Knepper MA 1999 Aldosterone-mediated regulation of ENaC {alpha}, ß, and {gamma} subunit proteins in rat kidney. J Clin Invest 104:R19–23
  11. Loffing J, Pietri L, Aregger F, Bloch-Faure M, Ziegler U, Meneton P, Rossier BC, Kaissling B 2000 Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets. Am J Physiol Renal Physiol 279:F252–258
  12. Sayegh R, Auerbach SD, Li X, Loftus R, Husted R, Stokes JB, Thomas CP 1999 Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5' flanking region of the human epithelial sodium channel {alpha} subunit gene. J Biol Chem 274:12431–12437[Abstract/Free Full Text]
  13. Lin HH, Zentner MD, Ho H-LL, Kim K-J, Ann DK 1999 The gene expression of the amiloride-sensitive epithelial sodium channel {alpha}-subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells. J Biol Chem 274:21544–21554[Abstract/Free Full Text]
  14. Otulakowski G, Rafii B, Bremner HR, O’Brodovich H 1999 Structure and hormone responsiveness of the gene encoding the {alpha}-subunit of the rat amiloride-sensitive epithelial sodium channel. Am J Respir Cell Mol Biol 20:1028–1040[Abstract/Free Full Text]
  15. Agarwal MK 1994 Perspectives in receptor-mediated mineralocorticoid hormone action. Pharmacol Rev 46:67–87[Medline]
  16. Funder JW 1997 Glucocorticoid and mineralocorticoid receptors: biology and clinical relevance. Annu Rev Med 48:231–240[CrossRef][Medline]
  17. Kemendy AE, Kleyman TR, Eaton DC 1992 Aldosterone alters the open probability of amiloride-blockable sodium channels in A6 epithelia. Am J Physiol 263:C825–C837
  18. Rokaw MD, Wang J-M, Edinger RS, Weisz OA, Hui D, Middleton P, Shlyonsky V, Berdiev BK, Ismailov I, Eaton DC, Benos DJ, Johnson JP 1998 Carboxymethylation of the ß subunit of xENaC regulates channel activity. J Biol Chem 273:28746–28751[Abstract/Free Full Text]
  19. Stockand J, Al-Baldawi NF, Al-Khalili OK, Worrell RT, Eaton DC 1999 S-adenosyl-l-homocysteine hydrolase regulates aldosterone-induced Na+ transport. J Biol Chem 274:3842–3850[Abstract/Free Full Text]
  20. Mastroberardino L, Spindler B, Forster I, Loffing J, Assandri R, May A, Verrey F 1998 Ras pathway activates epithelial Na+ channel and decreases its surface expression in Xenopus oocytes. Mol Biol Cell 9:3417–3427[Abstract/Free Full Text]
  21. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D 1999 Epithelial sodium channel regulated by aldosterone- induced protein sgk. Proc Natl Acad Sci USA 96:2514–2519[Abstract/Free Full Text]
  22. Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, Fejes-Toth G 1999 sgk Is an aldosterone-induced kinase in the renal collecting duct. J Biol Chem 274:16973–16978[Abstract/Free Full Text]
  23. Shimkets RA, Lifton R, Canessa CM 1998 In vivo phosphorylation of the epithelial sodium channel. Proc Natl Acad Sci USA 95:3301–3305[Abstract/Free Full Text]
  24. Stockand JD, Spier BJ, Worrell RT, Yue G, Al-Baldawi N, Eaton DC 1999 Regulation of Na+ reabsorption by the aldosterone-induced small G protein K-Ras2A. J Biol Chem 274:35449–35454[Abstract/Free Full Text]
  25. Stoos B, Naray-Fejes-Toth A, Carretero O, Ito S, Fejes-Toth G 1991 Characterization of a mouse cortical collecting duct cell line. Kidney Int 39:1168–1175[Medline]
  26. Nakhoul N, Herring-Smith K, Gambala C, Hamm L 1998 Regulation of sodium transport in M-1 cells. Am J Physiol 275:F998–F1007
  27. Blazer-Yost BL, Record RD, Oberleithner H 1996 Characterization of hormone-stimulated Na+ transport in a high-resistance clone of the MDCK cell line. Pfluegers Arch 432:685–691[CrossRef][Medline]
  28. Canessa CM, Horisberger JD, Rossier BC 1993 Epithelial sodium channel related to proteins involved in neurodegeneration. Nature 361:467–470[CrossRef][Medline]
  29. McDonald FJ, Snyder PM, McCray PB, Welsh MJ 1994 Cloning, expression, and tissue distribution of a human amiloride-sensitive Na+ channel. Am J Physiol 266:L728–L734
  30. Lombes M, Binart N, Oblin M, Joulin V, Baulieu E 1993 Characterization of the interaction of the human mineralocorticoid receptor with hormone response elements. Biochem J 292:577–583
  31. Lim-Tio S, Keightley M-C, Fuller P 1997 Determinants of specificity of transactivation by the mineralocorticoid or glucocorticoid receptor. Endocrinology 138:2537–2543[Abstract/Free Full Text]
  32. Garty H, Palmer LG 1997 Epithelial sodium channels: function and regulation. Physiol Rev 77:359–396[Abstract/Free Full Text]
  33. Bonvalet J-P 1998 Regulation of sodium transport by steroid hormones. Kidney Int 53:S49–S56
  34. Verrey F 1999 Early aldosterone action: toward filling the gap between transcription and transport. Am J Physiol 277:F319–F327
  35. Bens M, Vallet V, Cluzeaud F, Pascual-Letallec L, Kahn A, Rafestin-Oblin ME, Rossier BC, Vandewalle A 1999 Corticosteroid-dependent sodium transport in a novel immortalized mouse collecting duct principal cell line. J Am Soc Nephrol 10:923–934[Abstract/Free Full Text]
  36. Arriza JL, Simerly RB, Swanson LW, Evans RM 1988 The neuronal mineralocorticoid receptor as a mediator of glucocorticoid response. Neuron 1:887–900[CrossRef][Medline]
  37. Rupprecht R, Arriza J, Spengler D, Reul J, Evans R, Holsboer F, Damm K 1993 Transactivation and synergistic properties of the mineralocorticoid receptor: relationship to the glucocorticoid receptor. Mol Endocrinol 7:597–603[Abstract/Free Full Text]
  38. Schmidt TJ, Husted RF, Stokes JB 1993 Steroid hormone stimulation of Na+ transport in A6 cells is mediated via glucocorticoid receptors. Am J Physiol 264:C875–C884
  39. de La Rosa DA, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, Canessa CM 1999 The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274:37834–37839[Abstract/Free Full Text]
  40. Geering K, Claire M, Gaeggeler HP, Rossier BC 1985 Receptor occupancy vs. induction of Na+-K+-ATPase and Na+ transport by aldosterone. Am J Physiol 248:C102–C108
  41. Farman N 1999 Mechanisms of mineralocorticoid selectivity. In: Grunfield J-P, Bach JF, Kreis H (eds) Advances In Nephrology. Mosby, St. Louis, MO, vol 29:115–126
  42. Chen SY, Wang J, Liu W, Pearce D 1998 Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor. Am J Physiol 274:C39–C46
  43. Montrella-Waybill M, Clore JN, Schoolwerth AC, Watlington CO 1991 Evidence that high dose cortisol-induced Na+ retention in man is not mediated by the mineralocorticoid receptor. J Clin Endocrinol Metab 72:1060–1066[Abstract/Free Full Text]
  44. Berger SBM, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W, Warth W, Greger R, Schutz G 1998 Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95:9424–9429[Abstract/Free Full Text]
  45. Bleich M, Warth R, Schmidt-Hieber M, Schulz-Baldes A, Hasselblatt P, Fisch D, Berger S, Kunzelmann K, Kriz W, Schutz G, Greger R 1999 Rescue of the mineralocorticoid receptor knock-out mouse. Pfluegers Arch 438:245–254[CrossRef][Medline]
  46. Wehling M 1997 Specific, nongenomic actions of steroid hormones. Annu Rev Physiol 59:365–93[CrossRef][Medline]
  47. Haseroth K, Gerdes D, Berger S, Feuring M, Gunther A, Herbst C, Christ M, Wehling M 1999 Rapid nongenomic effects of aldosterone in mineralocorticoid-receptor- knockout mice. Biochem Biophys Res Commun 266:257–261[CrossRef][Medline]
  48. Husted RF, Laplace JR, Stokes JB 1990 Enhancement of electrogenic Na+ transport across rat inner medullary collecting duct by glucocorticoid and mineralocorticoid hormones. J Clin Invest 86:498–506
  49. Thomas CP, Auerbach SD, Stokes JB, Volk KA 1998 5' heterogeneity in amiloride-sensitive epithelial sodium channel {alpha} subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol 274:C1312–1323
  50. Housley PR, Sanchez ER, Westphal HM, Beato M, Pratt WB 1985 The molybdate-stabilized L-cell glucocorticoid receptor isolated by affinity chromatography or with a monoclonal antibody is associated with a 90–92-kDa nonsteroid-binding phosphoprotein. J Biol Chem 260:13810–13817[Abstract/Free Full Text]
  51. Rafestin-Oblin ME, Lombes M, Lustenberger P, Blanchardie P, Michaud A, Cornu G, Claire M 1986 Affinity of corticosteroids for mineralocorticoid and glucocorticoid receptors of the rabbit kidney: effect of steroid substitution. J Steroid Biochem 25:527–534[CrossRef][Medline]
  52. Erdos T, Best-Belpomme M, Bessada R 1970 A rapid assay for binding estradiol to uterine receptors. Anal Biochem 37:244–252[CrossRef][Medline]
  53. Waldegger S, Barth P, Raber G, Lang F 1997 Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94:4440–4445[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. R. Stow, M. L. Gumz, I. J. Lynch, M. M. Greenlee, A. Rudin, B. D. Cain, and C. S. Wingo
Aldosterone Modulates Steroid Receptor Binding to the Endothelin-1 Gene (edn1)
J. Biol. Chem., October 30, 2009; 284(44): 30087 - 30096.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Martinerie, S. Viengchareun, A.-L. Delezoide, F. Jaubert, M. Sinico, S. Prevot, P. Boileau, G. Meduri, and M. Lombes
Low Renal Mineralocorticoid Receptor Expression at Birth Contributes to Partial Aldosterone Resistance in Neonates
Endocrinology, September 1, 2009; 150(9): 4414 - 4424.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
N. M. Jesse, J. McCartney, X. Feng, E. M. Richards, C. E. Wood, and M. Keller-Wood
Expression of ENaC subunits, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R453 - R461.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Zhang, S. Li, P. Cruz, and B. C. Kone
Sirtuin 1 Functionally and Physically Interacts with Disruptor of Telomeric Silencing-1 to Regulate {alpha}-ENaC Transcription in Collecting Duct
J. Biol. Chem., July 31, 2009; 284(31): 20917 - 20926.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Hu, E. A. Oboukhova, S. Kumar, M. Sturek, and A. G. Obukhov
Canonical Transient Receptor Potential Channels Expression Is Elevated in a Porcine Model of Metabolic Syndrome
Mol. Endocrinol., May 1, 2009; 23(5): 689 - 699.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. N. Gerber, K. Masuno, and M. I. Diamond
Discovery of selective glucocorticoid receptor modulators by multiplexed reporter screening
PNAS, March 24, 2009; 106(12): 4929 - 4934.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. W. Musch, A. Lucioni, and E. B. Chang
Aldosterone regulation of intestinal Na absorption involves SGK-mediated changes in NHE3 and Na+ pump activity
Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G909 - G919.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
W. Schoner and G. Scheiner-Bobis
Role of endogenous cardiotonic steroids in sodium homeostasis
Nephrol. Dial. Transplant., September 1, 2008; 23(9): 2723 - 2729.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Zhou, R. H. Oakley, and J. A. Cidlowski
DAX-1 (Dosage-Sensitive Sex Reversal-Adrenal Hypoplasia Congenita Critical Region on the X-Chromosome, Gene 1) Selectively Inhibits Transactivation But Not Transrepression Mediated by the Glucocorticoid Receptor in a LXXLL-Dependent Manner
Mol. Endocrinol., July 1, 2008; 22(7): 1521 - 1534.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
C. P. Thomas, J. I. Andrews, and K. Z. Liu
Intronic polyadenylation signal sequences and alternate splicing generate human soluble Flt1 variants and regulate the abundance of soluble Flt1 in the placenta
FASEB J, December 1, 2007; 21(14): 3885 - 3895.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Hitomi, H. Kiyomoto, A. Nishiyama, T. Hara, K. Moriwaki, K. Kaifu, G. Ihara, Y. Fujita, T. Ugawa, and M. Kohno
Aldosterone Suppresses Insulin Signaling Via the Downregulation of Insulin Receptor Substrate-1 in Vascular Smooth Muscle Cells
Hypertension, October 1, 2007; 50(4): 750 - 755.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Boyd and A. Naray-Fejes-Toth
Steroid-Mediated Regulation of the Epithelial Sodium Channel Subunits in Mammary Epithelial Cells
Endocrinology, August 1, 2007; 148(8): 3958 - 3967.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yokota, H. Shibata, I. Kurihara, S. Kobayashi, N. Suda, A. Murai-Takeda, I. Saito, H. Kitagawa, S. Kato, T. Saruta, et al.
Coactivation of the N-terminal Transactivation of Mineralocorticoid Receptor by Ubc9
J. Biol. Chem., January 19, 2007; 282(3): 1998 - 2010.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Nagata, M. Takahashi, K. Sawai, T. Tagami, T. Usui, A. Shimatsu, Y. Hirata, and M. Naruse
Molecular Mechanism of the Inhibitory Effect of Aldosterone on Endothelial NO Synthase Activity
Hypertension, July 1, 2006; 48(1): 165 - 171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhang, X. Xia, M. R. Reisenauer, C. S. Hemenway, and B. C. Kone
Dot1a-AF9 Complex Mediates Histone H3 Lys-79 Hypermethylation and Repression of ENaC{alpha} in an Aldosterone-sensitive Manner
J. Biol. Chem., June 30, 2006; 281(26): 18059 - 18068.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Zhang, X. Xia, D. I. Jalal, T. Kuncewicz, W. Xu, G. D. Lesage, and B. C. Kone
Aldosterone-sensitive repression of ENaC{alpha} transcription by a histone H3 lysine-79 methyltransferase
Am J Physiol Cell Physiol, March 1, 2006; 290(3): C936 - C946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, K. Z. Liu, and H. S. Vats
Medroxyprogesterone acetate binds the glucocorticoid receptor to stimulate {alpha}-ENaC and sgk1 expression in renal collecting duct epithelia
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F306 - F312.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart
Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney
Hypertension, October 1, 2005; 46(4): 787 - 798.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Z. Jaffe and M. E. Mendelsohn
Angiotensin II and Aldosterone Regulate Gene Transcription Via Functional Mineralocortocoid Receptors in Human Coronary Artery Smooth Muscle Cells
Circ. Res., April 1, 2005; 96(6): 643 - 650.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted
cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1
Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, R. W. Loftus, and K. Z. Liu
AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F460 - F468.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Grossmann, R. Freudinger, S. Mildenberger, A. W. Krug, and M. Gekle
Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1226 - F1231.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Wu, Y. Li, J. Dietz, and D. S. Lala
Repression of p65 Transcriptional Activation by the Glucocorticoid Receptor in the Absence of Receptor-Coactivator Interactions
Mol. Endocrinol., January 1, 2004; 18(1): 53 - 62.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Itani, J. R. Campbell, J. Herrero, P. M. Snyder, and C. P. Thomas
Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains
Am J Physiol Renal Physiol, November 1, 2003; 285(5): F916 - F929.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Itani, K. L. Cornish, K. Z. Liu, and C. P. Thomas
Cycloheximide increases glucocorticoid-stimulated alpha -ENaC mRNA in collecting duct cells by p38 MAPK-dependent pathway
Am J Physiol Renal Physiol, April 1, 2003; 284(4): F778 - F787.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas
Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region
Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. P. Thomas, J. Zhou, K. Z. Liu, V. E. Mick, E. MacLaughlin, and M. Knowles
Systemic Pseudohypoaldosteronism from Deletion of the Promoter Region of the Human {beta} Epithelial Na+ Channel Subunit
Am. J. Respir. Cell Mol. Biol., September 1, 2002; 27(3): 314 - 319.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. A. Schafer
Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct
Am J Physiol Renal Physiol, August 1, 2002; 283(2): F221 - F235.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Kitagawa, J. Yanagisawa, H. Fuse, S. Ogawa, Y. Yogiashi, A. Okuno, H. Nagasawa, T. Nakajima, T. Matsumoto, and S. Kato
Ligand-Selective Potentiation of Rat Mineralocorticoid Receptor Activation Function 1 by a CBP-Containing Histone Acetyltransferase Complex
Mol. Cell. Biol., June 1, 2002; 22(11): 3698 - 3706.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. D. Stockand
New ideas about aldosterone signaling in epithelia
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
O. A. Itani, S. D. Auerbach, R. F. Husted, K. A. Volk, S. Ageloff, M. A. Knepper, J. B. Stokes, and C. P. Thomas
Alveolar Epithelial Ion and Fluid Transport: Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression
Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L631 - L641.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, R. W. Loftus, K. Z. Liu, and O. A. Itani
Genomic organization of the 5' end of human beta -ENaC and preliminary characterization of its promoter
Am J Physiol Renal Physiol, May 1, 2002; 282(5): F898 - F909.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mick, V. E.
Right arrow Articles by Thomas, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mick, V. E.
Right arrow Articles by Thomas, C. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals