| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Laboratoire de Biologie Moléculaire et de Génie Génétique Université de Liège Institut de Chimie B6 B-4000 Sart-Tilman, Belgique
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The pituitary-specific transcription factor Pit-1 is a member of the POU homeodomain protein family required for specific expression of several genes (PRL, GH ,and TSHß) in anterior pituitary. Pit-1 activity is mainly modulated by its expression level. A functional role for the reported phosphorylations of Pit-1 (8, 9, 10, 11) and their impact on target gene expression remain unclear (10, 12). Recently, Xu et al. (13) showed that the activation function of Pit-1 was mediated via the general transcriptional coactivator (CRE-binding protein)-binding protein (CBP)/p300 (14, 15), that stimulates histone acetylation and chromatin remodeling. Interestingly, the interaction of Pit-1 with CBP was inhibited in the presence of the well described nuclear receptor corepressor, N-CoR (16).
C-jun- and c-fos-related proteins (c-jun, JunB, JunD, and c-fos, FosB, Fra-1, and Fra-2) belong to the leucine-zipper protein family. Fos proteins heterodimerize with Jun factors to form the AP-1 complex which binds to a specific sequence (ATGAGTCA), the 2-O-tetradecanoylphorbol-13-acetate-responsive element (TRE). Stimulation of c-fos gene transcription leads to increased AP-1 activity and involves multiple control elements (17): the major cAMP responsive element (CRE), the sis-inducible element (SIE), the fos AP-1 site (FAP), and the serum response element (SRE). The latter binds the serum response factor (SRF), which subsequently recruits ternary complex factors (TCFs) belonging to the Ets protein family (reviewed in Ref. 18) such as Elk-1 or Sap-1. TCFs are rapidly activated in response to mitogenic signals through phosphorylation by MAP kinases (MAPKs) (reviewed in Refs. 19, 20). In addition, a large number of environmental stimuli modulate AP-1 activity at various levels (21). An important level of control is the posttranslational modification of both preexisting and newly synthesized jun and fos proteins such as oxidation/reduction and phosphorylation, e.g. by PKC, c-jun N-terminal kinases (JNK), or extracellular signal-regulated kinases (ERK) (22, 23, 24, 25). These modifications may affect both the DNA-binding activity and the transactivation capacity. Since the different AP-1 proteins are differentially modified, the composition of the dimer also contributes to determine AP-1 activity.
Okadaic acid (OA) is a polyether fatty acid isolated from marine sponges that is a potent tumor promoter (26). It specifically inhibits serine/threonine phosphoprotein phosphatases 1 and 2A (26, 27), leading to an increase of the phosphorylation status of many cellular proteins. Recently, we reported that OA stimulation of the proximal hPRL promoter activity in rat pituitary GH3B6 lactotroph cells (6) results from an increased cellular content of JunD and c-fos proteins, leading to the binding of heterodimeric AP-1 to the proximal hPRL promoter and to activation in synergism with Pit-1. The AP-1 binding sequence is located in the P1 region (defined as the most proximal DNase I protected region) just upstream from the Pit-1 binding site. The importance of the AP-1 site is illustrated by the fact that a mutation preventing the binding of AP-1 reduced basal activity and abolished OA-induction of the hPRL promoter. In addition, mutation of the Pit-1 recognition sequence similarly affected basal expression and OA-induction, showing that Pit-1 is required for these effects.
Here, we sought to further understand the molecular mechanism of the stimulation by AP-1 and Pit-1 of the proximal hPRL promoter in GH3B6 cells. We clearly show that this activation is mainly due to an increase of c-fos protein levels which is achieved by transcriptional stimulation of the c-fos promoter. This activation is mediated by the SRE via the MAPK kinase (MEK)/ERK signaling pathway. Furthermore, we report the surprising absence of OA responsiveness of the hPRL and c-fos promoters in GH3 cells, closely related to GH3B6 cells, due to the lack of MEK stimulation upon protein phosphatase inhibition. We show that phosphatase inhibition by OA acts on the pathway activated by ras, at the level of MEK1/2 or an upstream kinase, and that this pathway is inhibited by PP1 in GH3B6 cells. Moreover, we show that the Pit-1/AP-1 synergistic activation of the hPRL promoter is mediated by the general coactivator CBP/p300.
| RESULTS |
|---|
|
|
|---|
Reporter plasmids containing the luciferase gene under the control of
the wild-type proximal 164 bp of the hPRL promoter (164P-Luc), the hPRL
promoter mutated in the (-61/-54) AP-1 binding site (164P(AP1 m)-Luc)
or only its most proximal 40 bp (40P-Luc) (Fig. 1A
) were transiently transfected in both
cell types and their response to OA treatment was determined. As
expected, the OA activation of 164P-Luc in GH3B6 cells was about
62-fold (Fig. 1B
), whereas the negative control 40P-Luc displayed only
an unspecific 6-fold response. Mutation of the AP-1 site abolished the
specific OA induction (8-fold). In GH3 cells (Fig. 1C
), in contrast, no
significant OA induction of 164P-Luc, 164P(AP1 m)-Luc, and 40P-Luc
constructs was observed: 1.8-, 1.9- and 2-fold, respectively. However,
mutation of the AP-1 site resulted in a 2-fold decrease in basal level
expression (data not shown), suggesting that the site is functional in
GH3 cells.
|
The Increase of c-fos Protein Observed in GH3B6 Cells upon OA
Treatment Is Absent in GH3 Cells
We previously showed an increase of JunD and c-fos
protein levels in GH3B6 cells after OA treatment (6). Concomitantly, a
decrease of Pit-1 protein content was observed. Therefore, we decided
to compare the OA effects on these factors in GH3B6 and GH3 cells (Fig. 2A
). Nuclear extracts were prepared from
control cells or cells treated for 18 h with OA, and the protein
amounts of each factor were compared by Western blot experiments. A
clear increase (4-fold) of c-fos levels was observed in
GH3B6 cells upon OA treatment, as expected, while in GH3 cells the low
c-fos amount barely changed (1.2-fold). In contrast, the
increase in JunD levels and the decrease of Pit-1 amounts were readily
observed in both cell types.
|
A time-course analysis of c-fos content after OA treatment
in GH3 cells (Fig. 3A
) shows that the
c-fos content remains constant during the complete
experiment, showing that no transient stimulation of c-fos
takes place in these cells. In GH3B6 cells, the variation of protein
levels was followed for all three factors involved (Fig. 3B
). The
c-fos protein content was clearly increased already after
2 h of treatment. The JunD increase occurs after 8 h and is
maintained for up to 18 h, while the loss of Pit-1 is observed
only after 18 h.
|
|
OA Activates the c-fos Promoter in GH3B6, but Not in
GH3 Cells
To test whether the rise of c-fos protein content by OA
involves c-fos gene transcription, transient transfection
assays were performed using a reporter plasmid containing the
luciferase gene under the control of the c-fos promoter
(c-fos-Luc). c-fos promoter constructs are presented in Fig. 5
. The OA effect was measured in parallel
on the wild-type c-fos promoter, the c-fos
promoter either mutated in the SIE (c-fos-LucmSIE) or deleted of the
SRE (c-fos-Luc
SRE) or of the AP1-response element FAP
(c-fos-Luc
FAP), and on a plasmid without promoter (p0-Luc). For
comparison, OA induction of 164P-Luc was also measured within the same
experiment. In GH3B6 cells (Fig. 5
, black bars), a 50-fold
stimulation of the 164P-Luc construct and a 4.7-fold activation of the
negative control 40P-Luc were observed, as expected. The c-fos-Luc
construct was induced 23-fold. Mutation of SIE or deletion of FAP did
not significantly affect this stimulation (25- and 24-fold,
respectively). In contrast, deletion of the SRE dramatically reduced
the OA induction to 6.6-fold, comparable to the nonspecific response
observed with the negative control p0-Luc (5-fold). In GH3 cells, OA
stimulation of c-fos-Luc is very weak and mutations in the promoter
hardly affected this result.
|
Expression of Oncogenic ras Activates the c-fos and 164
hPRL Promoters
The SRE binding site is recognized by a complex composed of SRF
and TCF, thereby integrating several pathways (19). SRF is activated by
the Rho- related small GTPases pathway (30), whereas TCFs are
targets for the ERKs, JNKs, and p38 MAPKs (20). One of the best known
pathways leading to TCF activation is triggered by activation of ras,
resulting in phosphorylation of raf, MEK1/2, ERK1/2, and finally TCF.
We therefore expressed a constitutively active ras variant (V12ras) in
GH3B6 and GH3 cells. A clear stimulation of the hPRL and
c-fos promoters was observed in the presence of V12ras both
in GH3B6 and GH3 cells (Fig. 6
). However,
when V12ras was expressed in GH3B6 cells, a very weak further
stimulation of both promoters (compare, respectively, 32- and 27-fold
to 2- and 2.5 fold) was observed upon OA treatment (Fig. 6
).
|
OA and ras Stimulation of the c-fos and 164 hPRL
Promoters in GH3B6 Cells Involves the MEK/ERK Kinase Pathway
To further investigate the involvement of the ras pathway in OA
stimulation, a specific inhibitor of ras was used. When GH3B6 cells
were treated with AFC
(N-acetyl-S-farnesyl-L-cysteine),
no effect was observed on basal level activity of the c-fos
or hPRL promoters, and OA stimulation of both promoters was unaffected
(Fig. 7A
). To test the involvement of
more downstream effectors in the ras pathway, the specific inhibitor of
MEK1/2 activation, PD98059, was added to GH3B6 cells previously
transfected with the 164P-Luc, 40P-Luc, c-fos-Luc, and c-fos-Luc
SRE
constructs. In GH3B6 cells, PD98059 alone did not affect 164P-Luc
activity. In contrast, OA-induction of 164P-Luc (57-fold) was
dramatically repressed by PD98059 (to 4.4-fold). Similarly, the
activity of c-fos-Luc is weakly affected by PD98059 alone (1.6-fold),
but its stimulation (40-fold) by OA is reduced (11-fold) in the
presence of PD98059, to a value close to that of c-fos-Luc
SRE. The
IC50 for PD98059 effects was about 10
µM (not shown). Western blot experiments using
antibodies directed specifically against phosphorylated MEK1/2 revealed
MEK-1 hyperphosphorylation upon OA treatment which was inhibited in the
presence of PD98059 in GH3B6 (Fig. 7B
). No effect was observed in GH3
cell extracts. Similar to the OA effect, the V12ras-activation of the
c-fos promoter was blocked by PD98059 in both cell types
(Fig. 7C
).
|
Protein Phosphatase PP1, but Not PP2A, Inhibits Stimulation of the
c-fos Promoter
The presence of the variant V12ras activates the c-fos
and hPRL promoters and hinders further OA stimulation; thus expression
of V12ras mimics the molecular events obtained by inhibition of
Ser/Thr-protein-phosphatases in GH3B6 cells. To determine which
phosphatase is directly involved in c-fos activation, the
phosphatases PP1 or PP2A were expressed in GH3B6 cells in the absence
or presence of V12ras. Expression of PP1 resulted in a clear inhibition
of the ras-stimulated c-fos promoter, while PP2A had no
effect (Fig. 8A
). Inhibition by PP1 was
clearly dose-dependent (Fig. 8B
). No significant effect was obtained in
GH3 cells with either phosphatase. These results show that the pathway
used by ras to activate the c-fos promoter is inactivated by
PP1 in GH3B6, but not in GH3 cells.
|
Synergistic 164P-Luc Transactivation by AP-1 (JunD/c-fos) and Pit-1
Requires the Coactivator CBP
The most proximal Pit-1 site immediately adjacent to the AP-1 site
in the hPRL promoter is also required for the stimulation by OA (6). We
used non-PRL-expressing CV-1 cells to study this functional cooperation
between AP-1 and Pit-1.
CV-1 cells were transiently transfected with 164P-Luc and various
amounts of the Pit-1 expression vectors in the presence or absence
of c-fos and JunD (Fig. 9A
).
Pit-1 alone progressively stimulated the 164P-Luc activity in a
dose-dependent manner, with a maximum at 16-fold reached at 0.25 pmol
of Pit-1 expression vector. When c-fos and JunD were
coexpressed (0.1 pmol of each vector), the stimulation was drastically
enhanced, reaching a maximum of 98-fold at 0.1 pmol of Pit-1 vector,
decreasing to 64-fold at 0.25 pmol and remaining at about 60-fold at
higher Pit-1 amounts. These observations clearly show that the
synergistic activation of 164P-Luc by AP-1 and Pit-1 can be
reconstituted in nonpituitary CV-1 cells. The observed two-phase curve
probably translates the existence of an optimal ratio of Pit-1 and AP-1
for maximal synergism. The decrease in synergistic activation at higher
doses of Pit-1 presumably reflects titration (squelching) of a cofactor
required specifically for synergism, as the decrease is not observed
upon activation with Pit-1 alone.
|
(2669)] or 169 [Pit-1
(169)], in the
transactivation domain, although reducing the stimulation by Pit-1
alone (5- or 3.4-fold, respectively) led to a potentiation similar to
full-length Pit-1, 36.5- and 28-fold, respectively, in the presence of
AP-1. Deletion of a.a. 69123 [Pit-1
(69123)] or 95123
[Pit-1
(95123)] only marginally affected the activation potential
of Pit-1 both in the absence and presence of AP-1. All the mutants
displayed DNA binding properties similar to wild-type Pit-1 as shown in
gel retardation assays from transfected cell extracts (data not shown).
Thus, the synergistic activation of Pit-1 with AP1 appears to require
mainly its DNA binding domain, the POU domain.
Recently, the coactivator CBP/p300 was shown to interact with Pit-1
through its POU domain and to efficiently coactivate transcription of a
reporter gene controlled by a dimeric Pit-1 binding site (13).
Furthermore, Pit-1 interaction and coactivation by CBP were shown to be
efficiently competed by the nuclear receptor corepressor N-CoR.
Interaction of AP-1 with CBP/p300 has also been described (31, 32).
Since Pit-1 and AP-1 synergize on hPRL without apparent cooperative
binding (6), we tested whether this cofactor could be involved in hPRL
stimulation by OA. Cotransfection experiments in GH3B6 cells (Fig. 9C
)
showed that expression of p300 results in a weak, but significant,
increase of OA induction of 164P-Luc, which was dependent on the amount
of p300 expression vector used (Fig. 9C
, black bars).
Conversely, expression of the corepressor N-CoR resulted in a clear and
dose-dependent inhibition of the OA response (Fig. 9C
, hatched
bars). No significant effect of p300 or N-CoR on the control
vector 40P-Luc was observed. Moreover, coexpression of p300 or N-CoR
did not affect the OA regulation of c-fos-Luc activity, strongly
suggesting that CBP/p300 and N-CoR act directly at the hPRL
promoter.
These results clearly show that p300 coactivates and N-CoR specifically counteracts the OA-stimulated, AP-1/Pit-1 synergistic stimulation of the 164 hPRL promoter.
| DISCUSSION |
|---|
|
|
|---|
The observation that OA stimulation of the hPRL promoter in GH3B6 cells is absent in the closely related GH3 cells allowed us to dissect the mechanism in a way that is rarely possible. The important role of c-fos accumulation in hPRL stimulation by OA is supported by several observations: 1) Increasing c-fos content, by expression of exogenous c-fos or expression of V12ras, activates 164P-Luc both in GH3B6 and GH3 cells; 2) the lack of hPRL stimulation in GH3 correlates with the absence of c-fos accumulation; 3) inhibition of c-fos activation by PD98059 abolishes 164P-Luc stimulation in GH3B6 cells. The facts that 164P-Luc stimulation by c-fos was stronger than by equivalent amounts of JunD and that accumulation of JunD is observed in GH3 cells, without leading to hPRL stimulation, indicate that the accumulation of c-fos is an absolute requirement for OA induction of 164P-Luc in GH3B6 cells.
Transcriptional Activation of the c-fos Gene Depends on
the MEK-ERK1/2 Pathway
c-fos gene stimulation by OA in GH3B6 cells occurs at
the transcriptional level; we show that the c-fos promoter
is stimulated in GH3B6 cells and that deletion of the SRE completely
abolished the OA induction of c-fos-Luc. The SRE site integrates
signaling by different pathways via binding factors SRF and TCF (19).
When the TCF pathway was activated by expressing V12ras, both
c-fos and hPRL promoters were stimulated and the OA effect
was severely reduced in GH3B6 cells. Inhibition of MEK activation using
PD98059 abolished c-fos-Luc and 164P-Luc activation by OA and V12ras,
indicating that the two pathways aim at a common target. In addition,
hyperphosphorylation of MEK1/2 was detected after OA treatment in GH3B6
cells. Thus, the OA response in GH3B6 cells involves MEK1/2, its most
common downstream targets ERK1/2, and probably TCF Elk-1. Inhibition of
ras did not affect the OA stimulation, thus locating the target for OA
protection from dephosphorylation downstream from ras and upstream from
activated MEK1/2, i.e. MEK1/2 itself or an upstream kinase
(Fig. 10
). We previously showed that OA
concentrations generally assumed to inhibit only PP2A (2
nM) were ineffective to stimulate the hPRL
promoter (6). By expressing V12ras, thereby triggering similar
molecular events without actually inhibiting the protein phosphatases,
we showed that only expression of PP1 was able to block
c-fos and hPRL promoter stimulation. Moreover, treatment of
GH3B6 cells with the PP1-specific inhibitor tautomycin led to
c-fos promoter stimulation similar to OA. Thus, protein
phosphatase PP1 is the target for inhibition by OA in GH3B6 cells.
Concerning the protein kinase that is opposing it, potential candidates
are only MEK1/2-kinases or an upstream activating kinase. Note that
interaction of PP1 with any of these kinases has not been described
previously.
|
The absence of c-fos accumulation upon OA treatment in GH3 cells not only strengthens the hypothesis that c-fos is the main mediator of the OA effect in GH3B6 cells, it also points at an important discrepancy between GH3B6 and GH3 cells in the use of regulatory effectors. The possibility that OA does not enter or is inactivated in GH3 cells can be ruled out by the fact that the increase of JunD and the decrease of Pit-1 amounts are readily detected in these cells. Expression of c-fos/JunD in GH3 cells, and even in nonpituitary CV-1 cells, leads to activation of 164P-Luc, showing that no additional factor is involved in GH3B6 cells to mediate this response.
Our data clearly indicate that OA treatment activates the ERK1/2 pathway in GH3B6 cells. Expression of VI2ras leads to stimulation of the c-fos and hPRL promoters both in GH3B6 and in GH3 cells; thus the ERK1/2 pathway is functional in GH3 cells. Western blot analysis revealed an increase of MEK1/2 phosphorylation in GH3B6 cells, but not in GH3 cells, indicating that the two cell lines actually differ in the signaling pathway upstream from MEK activation. A constitutively active pathway leading to MEK phosphorylation in GH3 cells, masking the effect of phosphatase inhibition by OA in these cells, can be rejected since the phospho-MEK signal was low in GH3 cells compared with OA-treated GH3B6 cells. Moreover, inhibition of the ERK1/2 pathway by the specific MEK1/2 inhibitor PD98059 did not repress the basal c-fos or hPRL promoter activity.
In GH3B6 cells, we identified PP1 as the phosphatase inhibited by OA; interestingly PP1 was unable to block stimulation by ras in GH3 cells in a similar experiment. This observation suggests that the target site for dephosphorylation by PP1 is absent in GH3 cells, and thus that a different, alternative MEK1/2-kinase or (one of) the ill-defined upstream kinase(s) is used. Since inhibition of MEK activation blocks the V12ras-stimulation of c-fos in both GH3B6 and GH3 cells, it is likely that ras activation in GH3 leads to MEK1/2 activation by a phosphorylation event(s) different from that in GH3B6 cells, which would be resistant to inactivation by PP1. In conclusion, our results suggest that either a MEK1/2 kinase (e.g. raf) or an upstream activating kinase is absent or inactive in GH3 cells. Identification and analysis of these kinases will be required to definitely identify this subtle difference between the two cell lines.
Synergism of AP-1 and Pit-1 on the hPRL Promoter
The presence of the most proximal Pit-1 site (P1 region) in the
hPRL promoter is also required for OA stimulation, and the synergism
between Pit-1 and AP-1 is not due to cooperative binding to their
respective adjacent sites (6). The decrease of Pit-1 protein amount is
probably not involved in OA stimulation of the hPRL promoter, as it
occurs several hours after OA treatment both in GH3 and GH3B6 cells,
probably resulting from the increase in JunD protein (34).
We further analyzed the Pit-1/AP-1 synergism by coexpressing Pit-1 and c-fos/junD in CV-1 cells. The synergistic activation of the hPRL promoter by Pit-1 and AP-1 was decreased when high levels of Pit-1 expression vector were used, while activation by Pit-1 alone was unaffected, suggesting that a limiting factor might be required specifically for the synergistic activation. Unlike interaction of Pit-1 with other transcription factors, such as estrogen and thyroid hormone receptor or Zn-15 (3537), the synergism with AP-1 required only its POU domain (POUs + POUh). The same region was previously shown to be required for Pit-1 synergism with Ets-1 (38) and for interaction with the coactivator/histone acetylase CBP/p300 (13). Consistent with an involvement of CBP/p300 in Pit-1/AP-1 synergism, overexpression of p300 slightly enhanced, while overexpression of the corepressor N-CoR clearly inhibited, the OA stimulation of the hPRL promoter in GH3B6 cells. The fact that 40P-Luc and c-fos-Luc activities were not affected by expression of either p300 or N-CoR suggests a specific involvement of both factors in OA induction of the 164 hPRL promoter.
In conclusion, we show that OA induction of the hPRL promoter in GH3B6 cells is primarily mediated by increasing the levels of c-fos protein amounts. The c-fos accumulation results from transcriptional activation of the c-fos promoter mediated by the MEK-ERK1/2-elk1 pathway. The OA effect results from inhibition of PP1, opposing a MEK1/2-kinase (raf) or an upstream kinase. The absence of OA response in GH3 cells probably results from the absence of this kinase. Furthermore, the c-fos/JunD synergism with the nearby Pit-1, required for OA induction, involves the general transcriptional coactivator CBP/p300 and is counteracted by the corepressor N-CoR.
| MATERIAL AND METHODS |
|---|
|
|
|---|
Plasmids
The reporter constructs 164P-Luc, 164P(AP1 m)-Luc, and 40P-Luc
were previously described (6). TKCAT and (TREpal)3XTKCAT constructs
have been described previously (Refs. 7, 39 , respectively). The
wild-type and mutant c-fos promoter constructs c-fos-Luc,
c-fos-Luc
SRE, c-fos-Luc
FAP, and c-fos-LucmSIE are generous gifts
from U. Moens (40). Expression vector pRSV-JunD (mouse) was kindly
provided by Dr. M. Yaniv (41), and pRSV-c-fos was a kind gift from P.
Herrlich (42). pCMV
-P300 (15) was obtained from M. Montminy,
pcDNA3-hPit1 and mutant hPit-1
(169) were from A. Chariot, PP1 and
PP2A expression vectors were from M. Montminy (43, 44), and the V12ras
(45) vector was kindly provided by Gutierrez-Hartmann.
PCMX-N-CoR was generated by ligating the
XbaI/SalI fragment (N-CoR interaction domain)
from pBKS-N-CoR-C' into the XbaI/SalI restriction
sites of pCMX-N-CoR-GAL4 containing the N-CoR repression domains (16).
The parent plasmids pBKS-N-CoR-C' and pCMX-N-CoR-GAL4 (16) were
generously provided by M. G. Rosenfeld.
Expression vectors for hPit-1 deletion mutants were generated by PCR using the following primers:
5bamh1: gctcggatccggagcagcgg
3bstx1: ctcagcttcctccagccatttgg
5
95123: cctatacaccagatggattctccagaaatcagagaa
3
95123: ggagaatccatctggtgtataggaggaaatccatg
5
2669: gcctctgataatggcaggtagtttaaccccttg
3
2669: aactacctgccattatcagaggcagagttgcagagg
5
69123: acctatggagtgatggattctccagaaatcagagaa
3
69123: ggagaatccatcactccataggttgatggctgg
Two parallel PCR reactions were performed to generate fragments
upstream and downstream, respectively, of each deleted region: one
using the 5bamh1 primer and each 3
primer, the second PCR using each
5
primer and the 3bstx1 primer. The corresponding upstream and
downstream fragments were mixed, and a third PCR was performed using
the 5bamh1 and 3bstx1 primers to amplify a fused fragment. The final
product was digested with BamHI and BstXI and
inserted into the corresponding restriction sites of pcDNA3. All the
constructions were verified by restriction analysis and sequencing.
Cell Culture and Transfections
GH3B6 and GH3 (ATCC CCL-82.1) rat pituitary cells were grown in
monolayer, in Hams F-12 and F-12K, respectively (Life Technologies, Inc., Gaithersburg, MD) supplemented with 15%
horse serum (HS) (Life Technologies, Inc.), 2.5%
FBS (BioWhittaker, Inc. Walkersville, MD), 1%
penicillin/streptomycin solution (Life Technologies, Inc.), and 5 x 10-10 M
estradiol (E2, Sigma). CV-1 monkey
kidney cells were cultured in DMEM with 10% FBS and 1%
penicillin/streptomycin solution.
GH3B6 and GH3 cells were transfected either by electroporation as described (6) or with Lipofectamine Plus (Life Technologies, Inc.) following the manufacturers protocol for cotransfection experiments. Briefly, 1 day before transfection, cells were trypsinized and plated in six-well culture dishes at about 3 x 105 cells per well. Just before transfection, the culture medium was replaced by 800 µl of serum- and antibiotic-free medium, after which 200 µl of plasmid/serum- and antibiotic-free medium/Lipofectamine-Plus reagent mixture were slowly added to the cells. After 4 h, the mixture was removed and replaced by 2 ml of culture medium.
The transfected cells were incubated for 24 h before treatment with the drugs for about 18 h. CV-1 cells were transfected using the calcium phosphate coprecipitation procedure as previously described (46).
Luciferase and CAT Assays
For luciferase assays, cells were lysed in 25 mM
Tris/phosphate, pH 7.8, 8 mM EDTA, 1% Triton X-100, 15%
glycerol, 1 mM dithiothreitol (DTT), and 0.5 mM
phenylmethylsulfonyl fluoride (PMSF). The luciferase activity was
determined as described (6). For CAT assays, cells were harvested in
250 mM Tris, pH 7.6, and assayed as described (47). Protein
concentration was determined using the Bradford assay (48), and
promoter activities were normalized to total protein. Results are
expressed as the ratio of luciferase or CAT activity measured in
treated vs. untreated cells or as the ratio of luciferase
activity measured in the presence of expression vector vs.
no expression vector (cotransfections). Results are expressed as the
mean ± SD of three independent pools of
transfected cells. Each experiment was performed at least twice.
Cell Extracts, Western Blot Assay, and Electrophoretic Mobility
Shift Assay (EMSA)
Nuclear cell extracts were prepared from treated or control
cells as previously described (6).
To obtain the whole cell extracts used for detection of phosphoproteins, cells were washed with PBS and harvested and lysed in 1xPBS, pH 7.6, 0.1% NP-40, 0.1% ß-mercaptoethanol, 1% SDS, 2 mM EDTA, 1 mM PMSF, 0.2 mM Na3VO4, 50 mM NaF, and 1 mM sodium pyrophosphate. After 10 min centrifugation at 15,000 x g, the pellet was removed and discarded.
Western blot analysis was performed as previously described (6) using 10 µg of nuclear extracts or 30 µg of whole cell extracts.
EMSAs and the oligonucleotides containing the P1 or the AP-1 consensus binding site were previously described (6).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by grants from the "Région Wallone (ULg 1815); the "Services Fédéraux des Affaires Scientifiques, Techniques et Culturelles" (PAI P3042, P3044 and P4/30 and "Actions de Recherche Concertes": 95/00193); the Fonds National de la Recherche Scientifique (FNRS) (-3.4537.93 and -9.4569.95). I. Manfroid was holder of a doctoral fellowship from the F.R.I.A and from the patrimoine ULg. M. M. is a "Chercheur qualifié" at the Fonds National de la Recherche Scientifique (FNRS).
This work contains part of the Ph.D. thesis of I. Manfroid.
Received for publication September 1, 2000. Revision received November 21, 2000. Accepted for publication December 21, 2000.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. F. Hedou, K. Koshibu, M. Farinelli, E. Kilic, C. E. Gee, U. Kilic, K. Baumgartel, D. M. Hermann, and I. M. Mansuy Protein Phosphatase 1-Dependent Bidirectional Synaptic Plasticity Controls Ischemic Recovery in the Adult Brain J. Neurosci., January 2, 2008; 28(1): 154 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Chen, S.-C. Weng, P.-H. Tseng, H.-P. Lin, and C.-S. Chen Histone Acetylation-independent Effect of Histone Deacetylase Inhibitors on Akt through the Reshuffling of Protein Phosphatase 1 Complexes J. Biol. Chem., November 18, 2005; 280(46): 38879 - 38887. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Clark, L. Zhong, D. Filiault, S. Perman, Z. Ren, M. Gould, and X. Yang Anti-Leukemia Effect of Perillyl Alcohol in Bcr/Abl-Transformed Cells Indirectly Inhibits Signaling through Mek in a Ras- and Raf-Independent Fashion Clin. Cancer Res., October 1, 2003; 9(12): 4494 - 4504. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Quentien, I. Manfroid, D. Moncet, G. Gunz, M. Muller, M. Grino, A. Enjalbert, and I. Pellegrini Pitx Factors Are Involved in Basal and Hormone-regulated Activity of the Human Prolactin Promoter J. Biol. Chem., November 8, 2002; 277(46): 44408 - 44416. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Liu, R. E. Baker, C. Sun, V. C. Sundmark, and H. P. Elsholtz Activation of Go-coupled Dopamine D2 Receptors Inhibits ERK1/ERK2 in Pituitary Cells. A KEY STEP IN THE TRANSCRIPTIONAL SUPPRESSION OF THE PROLACTIN GENE J. Biol. Chem., September 20, 2002; 277(39): 35819 - 35825. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |