help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Manfroid, I.
Right arrow Articles by Muller, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Manfroid, I.
Right arrow Articles by Muller, M.
Molecular Endocrinology 15 (4): 625-637
Copyright © 2001 by The Endocrine Society

Inhibition of Protein Phosphatase PP1 in GH3B6, but Not in GH3 Cells, Activates the MEK/ERK/c-fos Pathway and the Human Prolactin Promoter, Involving the Coactivator CBP/p300

Isabelle Manfroid, Joseph A. Martial and Marc Muller

Laboratoire de Biologie Moléculaire et de Génie Génétique Université de Liège Institut de Chimie B6 B-4000 Sart-Tilman, Belgique


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 
The human (hPRL) PRL gene proximal promoter (-164/+15) is the target for numerous signal transduction pathways involving protein kinases. The inhibitor of Ser/Thr-protein phosphatases okadaic acid (OA) was shown to induce this promoter in rat pituitary GH3B6 through a synergism between increased amounts of the ubiquitous factor AP-1 and the pituitary-specific factor Pit-1. Here we show that this activation results mainly from transcriptional stimulation of the c-fos promoter leading to increased AP-1 activity. We report the surprising absence of the hPRL and c-fos promoter stimulation by OA in GH3 cells, closely related to GH3B6 cells, and we use this discrepancy to dissect the precise mechanism of action. c-fos gene activation involves the mitogen-activated kinase (MAPK)-ternary complex factor (TCF) pathway and can be obtained by expressing active V12ras in both cell lines. We show that OA acts by inhibiting protein phosphatase PP1, thereby protecting MAPK kinase (MEK)1/2 and/or a MEK1/2-kinase from dephosphorylation. PP1 inhibition of MEK activation by V12ras does not occur in GH3 cells, indicating that a distinct, PP1-sensitive phosphorylation site is used in GH3B6 cells to activate the TCF pathway in GH3B6 cells. Finally, we show that the synergistic OA activation of the hPRL promoter by Pit-1 and AP-1 is independent of the Pit-1 transactivation domain and is mediated by the general coactivator (CRE-binding protein)-binding protein (CBP)/p300.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 
The human (hPRL) PRL gene is predominantly expressed in lactotroph cells of the anterior pituitary, where its transcription is regulated by numerous hormones and neuromediators such as epidermal growth factor (EGF), TRH, dopamine, and vasoactive intestinal peptide. These factors exert their action through binding to specific transmembrane receptors, thereby modulating signaling pathways [cAMP, protein kinase C (PKC), Ca2+, mitogen-activated protein kinase (MAPK)] which ultimately converge almost exclusively on a small upstream region of the hPRL gene (-164/+15) (1, 2, 3, 4, 5). This proximal hPRL promoter (2) contains three types of elements important for basal and regulated activity: two binding sites for the pituitary- specific factor Pit-1, a binding site (sequence A) for ubiquitous proteins (5), and a binding site for the ubiquitous AP-1 complex (6, 7).

The pituitary-specific transcription factor Pit-1 is a member of the POU homeodomain protein family required for specific expression of several genes (PRL, GH ,and TSHß) in anterior pituitary. Pit-1 activity is mainly modulated by its expression level. A functional role for the reported phosphorylations of Pit-1 (8, 9, 10, 11) and their impact on target gene expression remain unclear (10, 12). Recently, Xu et al. (13) showed that the activation function of Pit-1 was mediated via the general transcriptional coactivator (CRE-binding protein)-binding protein (CBP)/p300 (14, 15), that stimulates histone acetylation and chromatin remodeling. Interestingly, the interaction of Pit-1 with CBP was inhibited in the presence of the well described nuclear receptor corepressor, N-CoR (16).

C-jun- and c-fos-related proteins (c-jun, JunB, JunD, and c-fos, FosB, Fra-1, and Fra-2) belong to the leucine-zipper protein family. Fos proteins heterodimerize with Jun factors to form the AP-1 complex which binds to a specific sequence (ATGAGTCA), the 2-O-tetradecanoylphorbol-13-acetate-responsive element (TRE). Stimulation of c-fos gene transcription leads to increased AP-1 activity and involves multiple control elements (17): the major cAMP responsive element (CRE), the sis-inducible element (SIE), the fos AP-1 site (FAP), and the serum response element (SRE). The latter binds the serum response factor (SRF), which subsequently recruits ternary complex factors (TCFs) belonging to the Ets protein family (reviewed in Ref. 18) such as Elk-1 or Sap-1. TCFs are rapidly activated in response to mitogenic signals through phosphorylation by MAP kinases (MAPKs) (reviewed in Refs. 19, 20). In addition, a large number of environmental stimuli modulate AP-1 activity at various levels (21). An important level of control is the posttranslational modification of both preexisting and newly synthesized jun and fos proteins such as oxidation/reduction and phosphorylation, e.g. by PKC, c-jun N-terminal kinases (JNK), or extracellular signal-regulated kinases (ERK) (22, 23, 24, 25). These modifications may affect both the DNA-binding activity and the transactivation capacity. Since the different AP-1 proteins are differentially modified, the composition of the dimer also contributes to determine AP-1 activity.

Okadaic acid (OA) is a polyether fatty acid isolated from marine sponges that is a potent tumor promoter (26). It specifically inhibits serine/threonine phosphoprotein phosphatases 1 and 2A (26, 27), leading to an increase of the phosphorylation status of many cellular proteins. Recently, we reported that OA stimulation of the proximal hPRL promoter activity in rat pituitary GH3B6 lactotroph cells (6) results from an increased cellular content of JunD and c-fos proteins, leading to the binding of heterodimeric AP-1 to the proximal hPRL promoter and to activation in synergism with Pit-1. The AP-1 binding sequence is located in the P1 region (defined as the most proximal DNase I protected region) just upstream from the Pit-1 binding site. The importance of the AP-1 site is illustrated by the fact that a mutation preventing the binding of AP-1 reduced basal activity and abolished OA-induction of the hPRL promoter. In addition, mutation of the Pit-1 recognition sequence similarly affected basal expression and OA-induction, showing that Pit-1 is required for these effects.

Here, we sought to further understand the molecular mechanism of the stimulation by AP-1 and Pit-1 of the proximal hPRL promoter in GH3B6 cells. We clearly show that this activation is mainly due to an increase of c-fos protein levels which is achieved by transcriptional stimulation of the c-fos promoter. This activation is mediated by the SRE via the MAPK kinase (MEK)/ERK signaling pathway. Furthermore, we report the surprising absence of OA responsiveness of the hPRL and c-fos promoters in GH3 cells, closely related to GH3B6 cells, due to the lack of MEK stimulation upon protein phosphatase inhibition. We show that phosphatase inhibition by OA acts on the pathway activated by ras, at the level of MEK1/2 or an upstream kinase, and that this pathway is inhibited by PP1 in GH3B6 cells. Moreover, we show that the Pit-1/AP-1 synergistic activation of the hPRL promoter is mediated by the general coactivator CBP/p300.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 
OA Stimulates the 164P-Luc in GH3B6 but Not in GH3 Cells
The OA stimulation of the proximal hPRL promoter was investigated in two closely related rat pituitary cell lines. GH3 cells derive from a rat pituitary tumor and express both PRL and GH. Subcloning and selection resulted in the isolation of the GH3B6 line whose rat PRL expression is increased about 5-fold compared with GH3 cells (Refs. 28, 29 ; E. Hooghe-Peters, personal communication).

Reporter plasmids containing the luciferase gene under the control of the wild-type proximal 164 bp of the hPRL promoter (164P-Luc), the hPRL promoter mutated in the (-61/-54) AP-1 binding site (164P(AP1 m)-Luc) or only its most proximal 40 bp (40P-Luc) (Fig. 1AGo) were transiently transfected in both cell types and their response to OA treatment was determined. As expected, the OA activation of 164P-Luc in GH3B6 cells was about 62-fold (Fig. 1BGo), whereas the negative control 40P-Luc displayed only an unspecific 6-fold response. Mutation of the AP-1 site abolished the specific OA induction (8-fold). In GH3 cells (Fig. 1CGo), in contrast, no significant OA induction of 164P-Luc, 164P(AP1 m)-Luc, and 40P-Luc constructs was observed: 1.8-, 1.9- and 2-fold, respectively. However, mutation of the AP-1 site resulted in a 2-fold decrease in basal level expression (data not shown), suggesting that the site is functional in GH3 cells.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. OA Stimulates the Proximal hPRL Promoter in GH3B6 Cells but Not in GH3 Cells

A, Schematic representation of the proximal and the minimal hPRL promoter constructs. Sequences P1 and P2, containing Pit-1 binding sites, and sequence A are represented. The mutation of the AP-1 consensus motif within the P1 sequence in 164P(AP1 m)-Luc is indicated (cross). B, GH3B6 cells and C, GH3 cells were electroporated with 6 pmol of 164P-Luc, 40P-Luc, or 164P(AP1 m)-Luc. Twenty four hours after transfection, cells were treated with 50 nM OA for 18 h. The luciferase activity was measured as described and the fold induction in the presence of OA relative to untreated controls was determined. The values represent mean ± SD from triplicate experiments performed at least twice.

 
Thus, the strong OA stimulation of the hPRL proximal promoter observed in GH3B6 cells is completely absent in the closely related GH3 cells.

The Increase of c-fos Protein Observed in GH3B6 Cells upon OA Treatment Is Absent in GH3 Cells
We previously showed an increase of JunD and c-fos protein levels in GH3B6 cells after OA treatment (6). Concomitantly, a decrease of Pit-1 protein content was observed. Therefore, we decided to compare the OA effects on these factors in GH3B6 and GH3 cells (Fig. 2AGo). Nuclear extracts were prepared from control cells or cells treated for 18 h with OA, and the protein amounts of each factor were compared by Western blot experiments. A clear increase (4-fold) of c-fos levels was observed in GH3B6 cells upon OA treatment, as expected, while in GH3 cells the low c-fos amount barely changed (1.2-fold). In contrast, the increase in JunD levels and the decrease of Pit-1 amounts were readily observed in both cell types.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. In Contrast to GH3B6 Cells, OA Does Not Stimulate c-fos Protein Amounts and AP-1 Activity in GH3 Cells

A, Western blot analysis was performed with c-fos, JunD, or Pit-1-specific antibodies using nuclear extracts from GH3B6 or GH3 cells treated (+) or not (-) with 50 nM OA for 18 h. Densitometric analysis of several similar experiments revealed a 4-fold increase of c-fos levels in GH3B6 compared with 1.2-fold in GH3 cells, and an increase of junD levels between 1.2- to 1.6-fold. B, EMSAs were performed using nuclear extracts from control (-) or OA-treated (+) GH3B6 or GH3 cells with 32P-labeled oligonucleotides corresponding to the P1 region or an AP-1 consensus sequence. AP-1, Pit-1 monomer (M) and dimer (D) complexes are indicated. C, GH3B6 and GH3 cells were transfected with 6 pmol of TKCAT or (TREpal)3XTKCAT and OA stimulation of the two constructs was determined. The values represent mean ± SD from triplicate experiments performed at least twice.

 
Gel retardation experiments were performed using the same nuclear extracts. The result (Fig. 2BGo) confirms the induction of a jun-D/c-fos complex and the decrease of Pit-1 complexes in GH3B6 cells when a 32P-labeled P1 or AP-1 oligonucleotide was used (lanes 2 and 3 and 6 and 7). The identification and characterization of these complexes were previously described (6). In contrast, no AP-1 complex was induced in GH3 cells on the P1 probe (lanes 4 and 5) or a consensus AP1 site (lanes 8 and 9). However, a decrease of Pit-1 binding was also observed on the P1 probe (lane 5) in GH3 cells. The presence of active AP-1 complex was also tested by assessing the transcriptional stimulation of (TREpal)3xTKCAT, containing three copies of the classical AP-1 response element. The very strong (20-fold) OA stimulation (Fig. 2CGo) of this construct in GH3B6 cells, as compared with the control TKCAT plasmid (3-fold), was completely absent in OA-treated GH3 cells, consistent with the lack of c-fos induction in these cells.

A time-course analysis of c-fos content after OA treatment in GH3 cells (Fig. 3AGo) shows that the c-fos content remains constant during the complete experiment, showing that no transient stimulation of c-fos takes place in these cells. In GH3B6 cells, the variation of protein levels was followed for all three factors involved (Fig. 3BGo). The c-fos protein content was clearly increased already after 2 h of treatment. The JunD increase occurs after 8 h and is maintained for up to 18 h, while the loss of Pit-1 is observed only after 18 h.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. OA Treatment Rapidly Stimulates c-fos Synthesis Only in GH3B6 Cells, but Increases JunD and Decreases Pit-1 Amounts in Both GH3B6 and GH3 Cells

Western blot analysis was performed using nuclear extracts from GH3 or GH3B6 cells treated with 50 nM OA for the indicated increasing times. A, GH3 cells probed with specific c-fos antibody and B, nuclear extracts from GH3B6 cells probed with JunD, c-fos, or Pit-1-specific antibodies.

 
The effect of overexpressing JunD/c-fos on the hPRL promoter activity was compared in GH3B6 and GH3 cells. Cotransfection experiments were performed using the 164P-Luc reporter and expression vectors encoding JunD (pRSV-JunD) or c-fos (pRSV-cfos) (Fig. 4AGo). Expression of c-fos resulted in a 5.2-fold induction of the hPRL proximal promoter, while the presence of JunD caused a 2.6-fold increase in GH3B6 cells. Western blots performed using extracts from transfected cells showed that the amounts of expressed c-fos and JunD were roughly equivalent (data not shown). Combination of c-fos and JunD resulted in a 7.6-fold stimulation. In GH3 cells, expression of c-fos led to a similar 5-fold activation, JunD caused a 1.5-fold stimulation while in combination, c-fos and JunD induced the 164P-Luc 14-fold. By contrast, the 40P-Luc was not significantly influenced by expression of JunD and/or c-fos in both cell lines (Fig. 4AGo and data not shown). These data indicate that increased levels of AP-1, mainly c-fos, stimulate the hPRL promoter in both cell lines.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Exogenous c-fos and JunD Transactivate the 164 hPRL Promoter in Both GH3 and GH3B6 Cells

GH3B6 or GH3 cells were cotransfected by lipofection with 0.2 pmol of the indicated reporter plasmid (164P-Luc or 40P-Luc) and 0.04 pmol of expression plasmids pRSV-JunD or/and pRSV-c-fos and harvested after 48 h. The mean luciferase activity ± SD relative to cells transfected with an empty expression vector is shown from triplicate experiments performed at least twice.

 
Our results clearly show that the outstanding difference between the two pituitary cell lines is the lack of c-fos stimulation in GH3 cells. The JunD accumulation and the long-term decrease of Pit-1 are also observed in GH3 cells, although no c-fos protein increase occurred. These observations suggest that c-fos is the main mediator for OA induction of the hPRL promoter in GH3B6 cells.

OA Activates the c-fos Promoter in GH3B6, but Not in GH3 Cells
To test whether the rise of c-fos protein content by OA involves c-fos gene transcription, transient transfection assays were performed using a reporter plasmid containing the luciferase gene under the control of the c-fos promoter (c-fos-Luc). c-fos promoter constructs are presented in Fig. 5Go. The OA effect was measured in parallel on the wild-type c-fos promoter, the c-fos promoter either mutated in the SIE (c-fos-LucmSIE) or deleted of the SRE (c-fos-Luc{delta}SRE) or of the AP1-response element FAP (c-fos-Luc{delta}FAP), and on a plasmid without promoter (p0-Luc). For comparison, OA induction of 164P-Luc was also measured within the same experiment. In GH3B6 cells (Fig. 5Go, black bars), a 50-fold stimulation of the 164P-Luc construct and a 4.7-fold activation of the negative control 40P-Luc were observed, as expected. The c-fos-Luc construct was induced 23-fold. Mutation of SIE or deletion of FAP did not significantly affect this stimulation (25- and 24-fold, respectively). In contrast, deletion of the SRE dramatically reduced the OA induction to 6.6-fold, comparable to the nonspecific response observed with the negative control p0-Luc (5-fold). In GH3 cells, OA stimulation of c-fos-Luc is very weak and mutations in the promoter hardly affected this result.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. The c-fos Promoter Is Activated by OA in GH3B6 Cells but Not in GH3 Cells and This Activation Requires SRE

A, Schematic representation of the c-fos promoter. The SIE, SRE, FAP, and the CRE are indicated (boxes), and the deletions or mutations in the different sites are described. B, GH3B6 or GH3 cells were transfected with 6 pmol of 40P-Luc, 164P-Luc, c-fos-Luc, c-fos-LucmSIE, c-fos-Luc{delta}SRE, c-fos-Luc{delta}FAP, or with the promoterless reporter p0-Luc. Cells were treated with 50 nM OA for 18 h and fold induction relative to untreated cells was determined.

 
These observations clearly show that the c-fos promoter is induced by OA in GH3B6 cells and that this stimulation does not occur in GH3 cells, thereby explaining the differential response of the hPRL promoter in these cell lines. Furthermore, we identified the SRE site as the target for OA action.

Expression of Oncogenic ras Activates the c-fos and 164 hPRL Promoters
The SRE binding site is recognized by a complex composed of SRF and TCF, thereby integrating several pathways (19). SRF is activated by the Rho- related small GTPases pathway (30), whereas TCFs are targets for the ERKs, JNKs, and p38 MAPKs (20). One of the best known pathways leading to TCF activation is triggered by activation of ras, resulting in phosphorylation of raf, MEK1/2, ERK1/2, and finally TCF. We therefore expressed a constitutively active ras variant (V12ras) in GH3B6 and GH3 cells. A clear stimulation of the hPRL and c-fos promoters was observed in the presence of V12ras both in GH3B6 and GH3 cells (Fig. 6Go). However, when V12ras was expressed in GH3B6 cells, a very weak further stimulation of both promoters (compare, respectively, 32- and 27-fold to 2- and 2.5 fold) was observed upon OA treatment (Fig. 6Go).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Oncogenic V12ras Activates the c-fos and hPRL Promoters in GH3B6 and GH3 cells and Strongly Weakens an Additional OA Stimulation in GH3B6 Cells

GH3B6 or GH3 cells were cotransfected by lipofection with 0.2 pmol of the reporter plasmids 164P-Luc, or c-fos-Luc, and 0.04 pmol of the expression plasmid for the constitutively active mutant V12ras. Twenty-four hours after transfection, GH3B6 cells were treated or not with 50 nM OA for 18 h. Columns show the mean ± SD luciferase activity relative to cells transfected with an empty expression vector in the absence of OA from triplicate experiments performed at least twice. The table indicates fold-stimulation upon OA treatment in GH3B6 cells.

 
Thus, OA and V12ras alone both stimulate c-fos and hPRL to similar extents, but the combination of both only results in a marginally higher activation.

OA and ras Stimulation of the c-fos and 164 hPRL Promoters in GH3B6 Cells Involves the MEK/ERK Kinase Pathway
To further investigate the involvement of the ras pathway in OA stimulation, a specific inhibitor of ras was used. When GH3B6 cells were treated with AFC (N-acetyl-S-farnesyl-L-cysteine), no effect was observed on basal level activity of the c-fos or hPRL promoters, and OA stimulation of both promoters was unaffected (Fig. 7AGo). To test the involvement of more downstream effectors in the ras pathway, the specific inhibitor of MEK1/2 activation, PD98059, was added to GH3B6 cells previously transfected with the 164P-Luc, 40P-Luc, c-fos-Luc, and c-fos-Luc{delta}SRE constructs. In GH3B6 cells, PD98059 alone did not affect 164P-Luc activity. In contrast, OA-induction of 164P-Luc (57-fold) was dramatically repressed by PD98059 (to 4.4-fold). Similarly, the activity of c-fos-Luc is weakly affected by PD98059 alone (1.6-fold), but its stimulation (40-fold) by OA is reduced (11-fold) in the presence of PD98059, to a value close to that of c-fos-Luc{delta}SRE. The IC50 for PD98059 effects was about 10 µM (not shown). Western blot experiments using antibodies directed specifically against phosphorylated MEK1/2 revealed MEK-1 hyperphosphorylation upon OA treatment which was inhibited in the presence of PD98059 in GH3B6 (Fig. 7BGo). No effect was observed in GH3 cell extracts. Similar to the OA effect, the V12ras-activation of the c-fos promoter was blocked by PD98059 in both cell types (Fig. 7CGo).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Inhibition of MEK1/2 Activation, but Not of ras, Severely Decreases OA Stimulation of the c-fos and 164 hPRL Promoters in GH3B6 Cells

A, GH3B6 cells were electroporated with 6 pmol of 40P-Luc, 164P-Luc, c-fos-Luc, or c-fos-Luc{delta}SRE as indicated. Twenty hours after transfection, the cells were treated with 50 nM OA, 70 µM PD98059, 40 µM AFC, or combinations thereof for 18 h. B, GH3B6 and GH3 cells were pretreated or not with 70 µM PD98059 for 4 h followed by treatment with 100 nM OA for an additional 10 min as indicated. Whole cell extracts were prepared in the presence of phosphatase inhibitors, and Western blot analysis was performed with specific MEK1/2 and phospho-MEK1/2 antibodies. Similar results were obtained twice; increases in phospho-MEK signals in GH3B6 and GH3 cells were, respectively, 4-fold and 1.3-fold. C, GH3B6 or GH3 cells were cotransfected by lipofection with 0.2 pmol of the reporter plasmid c-fos-Luc, and 0.04 pmol of the expression plasmid for the constitutively active mutant V12ras or an empty expression vector. Twenty hours after transfection, the cells were treated with 70 µM PD98059 for 18 h. The mean luciferase activity ± SD is shown from triplicate experiments performed at least twice.

 
These results clearly demonstrate that OA and ras both target the same signaling pathway, the MEK/ERK pathway. The fact that inhibition of ras did not affect OA stimulation shows that the phosphatase inhibition acts downstream from ras, by protecting either the MAPK kinase MEK1/2 or one of its upstream activating kinases (mainly raf) against dephosphorylation in GH3B6 cells.

Protein Phosphatase PP1, but Not PP2A, Inhibits Stimulation of the c-fos Promoter
The presence of the variant V12ras activates the c-fos and hPRL promoters and hinders further OA stimulation; thus expression of V12ras mimics the molecular events obtained by inhibition of Ser/Thr-protein-phosphatases in GH3B6 cells. To determine which phosphatase is directly involved in c-fos activation, the phosphatases PP1 or PP2A were expressed in GH3B6 cells in the absence or presence of V12ras. Expression of PP1 resulted in a clear inhibition of the ras-stimulated c-fos promoter, while PP2A had no effect (Fig. 8AGo). Inhibition by PP1 was clearly dose-dependent (Fig. 8BGo). No significant effect was obtained in GH3 cells with either phosphatase. These results show that the pathway used by ras to activate the c-fos promoter is inactivated by PP1 in GH3B6, but not in GH3 cells.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 8. Protein Phosphatase PP1, but not PP2A, Inhibits ras-Stimulation of the c-fos Promoter Only in GH3B6 Cells

A, GH3B6 or GH3 cells were cotransfected with 0.2 pmol of the reporter plasmid c-fos-Luc, and 0.04 pmol of the expression plasmid for V12ras or an empty expression vector. In addition, 0.04 pmol of expression vectors for PP1 or PP2A or the control plasmid were cotransfected; 48 h after transfection, the cells were harvested and the activity of the c-fos promoter was determined. B, GH3B6 cells were cotransfected with 0.2 pmol of the reporter plasmid c-fos-Luc, 0.04 pmol of the expression plasmid for V12ras, or an empty expression vector and increasing amounts of PP1 expression vector. The mean luciferase activity ± SD is shown from triplicate experiments performed at least twice. C, GH3B6 cells were transfected by electroporation with c-fos-Luc and treated after 24 h with 50 nM OA or 2 µM tautomycin for 18 h.

 
Addition of the PP1-specific inhibitor tautomycin resulted in stimulation of the c-fos promoter to an extent similar to that obtained by OA treatment (Fig. 8CGo), showing that PP1, but not PP2A, is the target for OA inhibition.

Synergistic 164P-Luc Transactivation by AP-1 (JunD/c-fos) and Pit-1 Requires the Coactivator CBP
The most proximal Pit-1 site immediately adjacent to the AP-1 site in the hPRL promoter is also required for the stimulation by OA (6). We used non-PRL-expressing CV-1 cells to study this functional cooperation between AP-1 and Pit-1.

CV-1 cells were transiently transfected with 164P-Luc and various amounts of the Pit-1 expression vectors in the presence or absence of c-fos and JunD (Fig. 9AGo). Pit-1 alone progressively stimulated the 164P-Luc activity in a dose-dependent manner, with a maximum at 16-fold reached at 0.25 pmol of Pit-1 expression vector. When c-fos and JunD were coexpressed (0.1 pmol of each vector), the stimulation was drastically enhanced, reaching a maximum of 98-fold at 0.1 pmol of Pit-1 vector, decreasing to 64-fold at 0.25 pmol and remaining at about 60-fold at higher Pit-1 amounts. These observations clearly show that the synergistic activation of 164P-Luc by AP-1 and Pit-1 can be reconstituted in nonpituitary CV-1 cells. The observed two-phase curve probably translates the existence of an optimal ratio of Pit-1 and AP-1 for maximal synergism. The decrease in synergistic activation at higher doses of Pit-1 presumably reflects titration (squelching) of a cofactor required specifically for synergism, as the decrease is not observed upon activation with Pit-1 alone.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 9. Synergistic Transactivation of the 164 hPRL Promoter by Pit-1 and JunD/c-fos Is Mediated by Interaction of CBP/p300 with the POU-Homeodomain of Pit-1

A, CV-1 cells were transfected by the calcium phosphate method as described with 2 pmol of reporter plasmid 164P-Luc, increasing doses of pcDNA3-hPit-1, with (+) or without (-) 0.4 pmol each of expression plasmids pRSV-JunD and pRSV-c-fos. The luciferase activity in the presence or absence of junD/c-fos is shown at the different amounts of added Pit-1 expression plasmid. B, Wild-type hPit-1 and hPit-1 mutants in the transactivation domain (TAD) are presented. The POU-specific (POUs) and POU homeodomain (POUh) are indicated. CV-1 cells were transfected with 2 pmol of reporter plasmid 164P-Luc and expression vectors for wild-type hPit1 (pcDNA3-hPit-1) or the indicated deletion mutants with (hatched bars) or without (black bars) 0.4 pmol each of expression plasmids pRSV-JunD and pRSV-c-fos. The luciferase activity is presented relative to transfection with empty expression vectors. The table shows the fold stimulation obtained upon expression of each Pit-1 mutant. C, GH3B6 cells were transfected by lipofection with 0.2 pmol of 164P-Luc, 40P-Luc, or c-fos-Luc reporter plasmid with 0.025 or 0.075 pmol of pCMVß-p300 (black bars) or pCMX-N-CoR (hatched bars). Cells were treated with 50 nM OA for 18 h and fold induction was determined relative to untreated cells.

 
Several Pit-1 deletion mutants were expressed in CV-1 cells in the absence or presence of expression vectors for c-fos and JunD (Fig. 9BGo). Full-length Pit-1 alone activated the 164P-Luc transcription 10-fold, while coexpression of c-fos and JunD resulted in a further 10-fold potentiation of stimulation. Deletion of a.a. 26–69 [Pit-1{delta}(26–69)] or 1–69 [Pit-1{delta}(1–69)], in the transactivation domain, although reducing the stimulation by Pit-1 alone (5- or 3.4-fold, respectively) led to a potentiation similar to full-length Pit-1, 36.5- and 28-fold, respectively, in the presence of AP-1. Deletion of a.a. 69–123 [Pit-1{delta}(69–123)] or 95–123 [Pit-1{delta}(95–123)] only marginally affected the activation potential of Pit-1 both in the absence and presence of AP-1. All the mutants displayed DNA binding properties similar to wild-type Pit-1 as shown in gel retardation assays from transfected cell extracts (data not shown). Thus, the synergistic activation of Pit-1 with AP1 appears to require mainly its DNA binding domain, the POU domain.

Recently, the coactivator CBP/p300 was shown to interact with Pit-1 through its POU domain and to efficiently coactivate transcription of a reporter gene controlled by a dimeric Pit-1 binding site (13). Furthermore, Pit-1 interaction and coactivation by CBP were shown to be efficiently competed by the nuclear receptor corepressor N-CoR. Interaction of AP-1 with CBP/p300 has also been described (31, 32). Since Pit-1 and AP-1 synergize on hPRL without apparent cooperative binding (6), we tested whether this cofactor could be involved in hPRL stimulation by OA. Cotransfection experiments in GH3B6 cells (Fig. 9CGo) showed that expression of p300 results in a weak, but significant, increase of OA induction of 164P-Luc, which was dependent on the amount of p300 expression vector used (Fig. 9CGo, black bars). Conversely, expression of the corepressor N-CoR resulted in a clear and dose-dependent inhibition of the OA response (Fig. 9CGo, hatched bars). No significant effect of p300 or N-CoR on the control vector 40P-Luc was observed. Moreover, coexpression of p300 or N-CoR did not affect the OA regulation of c-fos-Luc activity, strongly suggesting that CBP/p300 and N-CoR act directly at the hPRL promoter.

These results clearly show that p300 coactivates and N-CoR specifically counteracts the OA-stimulated, AP-1/Pit-1 synergistic stimulation of the 164 hPRL promoter.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 
Accumulation of c-fos Is Required for OA Stimulation of the hPRL Promoter
In this study, we further investigated the mechanism involved in the previously reported (6) stimulation of the hPRL promoter by OA, an inhibitor of Ser/Thr-protein-phosphatases PP1 and PP2A. OA treatment leads to increased synthesis of c-fos and JunD which bind as a heterodimer to an AP-1 recognition sequence located in the hPRL proximal promoter, just upstream of the most proximal Pit-1 binding site. We show that the strong OA stimulation of the hPRL promoter in pituitary GH3B6 cells results from inhibition of PP1, leading to activation of the MEK-ERK1/2-dependent signal transduction pathway, transcriptional activation of the c-fos promoter, and accumulation of c-fos protein.

The observation that OA stimulation of the hPRL promoter in GH3B6 cells is absent in the closely related GH3 cells allowed us to dissect the mechanism in a way that is rarely possible. The important role of c-fos accumulation in hPRL stimulation by OA is supported by several observations: 1) Increasing c-fos content, by expression of exogenous c-fos or expression of V12ras, activates 164P-Luc both in GH3B6 and GH3 cells; 2) the lack of hPRL stimulation in GH3 correlates with the absence of c-fos accumulation; 3) inhibition of c-fos activation by PD98059 abolishes 164P-Luc stimulation in GH3B6 cells. The facts that 164P-Luc stimulation by c-fos was stronger than by equivalent amounts of JunD and that accumulation of JunD is observed in GH3 cells, without leading to hPRL stimulation, indicate that the accumulation of c-fos is an absolute requirement for OA induction of 164P-Luc in GH3B6 cells.

Transcriptional Activation of the c-fos Gene Depends on the MEK-ERK1/2 Pathway
c-fos gene stimulation by OA in GH3B6 cells occurs at the transcriptional level; we show that the c-fos promoter is stimulated in GH3B6 cells and that deletion of the SRE completely abolished the OA induction of c-fos-Luc. The SRE site integrates signaling by different pathways via binding factors SRF and TCF (19). When the TCF pathway was activated by expressing V12ras, both c-fos and hPRL promoters were stimulated and the OA effect was severely reduced in GH3B6 cells. Inhibition of MEK activation using PD98059 abolished c-fos-Luc and 164P-Luc activation by OA and V12ras, indicating that the two pathways aim at a common target. In addition, hyperphosphorylation of MEK1/2 was detected after OA treatment in GH3B6 cells. Thus, the OA response in GH3B6 cells involves MEK1/2, its most common downstream targets ERK1/2, and probably TCF Elk-1. Inhibition of ras did not affect the OA stimulation, thus locating the target for OA protection from dephosphorylation downstream from ras and upstream from activated MEK1/2, i.e. MEK1/2 itself or an upstream kinase (Fig. 10Go). We previously showed that OA concentrations generally assumed to inhibit only PP2A (2 nM) were ineffective to stimulate the hPRL promoter (6). By expressing V12ras, thereby triggering similar molecular events without actually inhibiting the protein phosphatases, we showed that only expression of PP1 was able to block c-fos and hPRL promoter stimulation. Moreover, treatment of GH3B6 cells with the PP1-specific inhibitor tautomycin led to c-fos promoter stimulation similar to OA. Thus, protein phosphatase PP1 is the target for inhibition by OA in GH3B6 cells. Concerning the protein kinase that is opposing it, potential candidates are only MEK1/2-kinases or an upstream activating kinase. Note that interaction of PP1 with any of these kinases has not been described previously.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 10. Model

Outline of the proposed mechanism for protein phosphatase inhibition by OA. In GH3B6 cells, inhibition of PP1 leads to hyperphosphorylation of MEK1/2 and/or one of its upstream activating kinases. Activated MEK activates the ERK1/2-TCF pathway and stimulates c-fos gene transcription. c-fos forms a complex with JunD to activate the hPRL promoter in synergism with Pit-1. This latter process is coactivated by CBP/p300 and inhibited by N-CoR. Potential targets for PP1 are indicated by broken lines. In GH3 cells, an alternative ras-inducible pathway is present that is insensitive to PP1.

 
Differences between Closely Related Pituitary Cell Lines
Many cell lines have been subcloned from the rat mammosomatotrope pituitary carcinoma-derived GH3 line, characterized by various PRL and GH expression levels. For example, GH3B6 express more PRL than GH3 cells (Refs. 28, 29 and E. Hooghe-Peters, personal communication). Conversely, GC cells produce exclusively GH (33). The molecular basis for the differences observed in these pituitary cell lines is yet unknown, but transduction pathway components, target promoters, and transcriptional coregulators constitute as many levels that might characterize these closely related cell lines.

The absence of c-fos accumulation upon OA treatment in GH3 cells not only strengthens the hypothesis that c-fos is the main mediator of the OA effect in GH3B6 cells, it also points at an important discrepancy between GH3B6 and GH3 cells in the use of regulatory effectors. The possibility that OA does not enter or is inactivated in GH3 cells can be ruled out by the fact that the increase of JunD and the decrease of Pit-1 amounts are readily detected in these cells. Expression of c-fos/JunD in GH3 cells, and even in nonpituitary CV-1 cells, leads to activation of 164P-Luc, showing that no additional factor is involved in GH3B6 cells to mediate this response.

Our data clearly indicate that OA treatment activates the ERK1/2 pathway in GH3B6 cells. Expression of VI2ras leads to stimulation of the c-fos and hPRL promoters both in GH3B6 and in GH3 cells; thus the ERK1/2 pathway is functional in GH3 cells. Western blot analysis revealed an increase of MEK1/2 phosphorylation in GH3B6 cells, but not in GH3 cells, indicating that the two cell lines actually differ in the signaling pathway upstream from MEK activation. A constitutively active pathway leading to MEK phosphorylation in GH3 cells, masking the effect of phosphatase inhibition by OA in these cells, can be rejected since the phospho-MEK signal was low in GH3 cells compared with OA-treated GH3B6 cells. Moreover, inhibition of the ERK1/2 pathway by the specific MEK1/2 inhibitor PD98059 did not repress the basal c-fos or hPRL promoter activity.

In GH3B6 cells, we identified PP1 as the phosphatase inhibited by OA; interestingly PP1 was unable to block stimulation by ras in GH3 cells in a similar experiment. This observation suggests that the target site for dephosphorylation by PP1 is absent in GH3 cells, and thus that a different, alternative MEK1/2-kinase or (one of) the ill-defined upstream kinase(s) is used. Since inhibition of MEK activation blocks the V12ras-stimulation of c-fos in both GH3B6 and GH3 cells, it is likely that ras activation in GH3 leads to MEK1/2 activation by a phosphorylation event(s) different from that in GH3B6 cells, which would be resistant to inactivation by PP1. In conclusion, our results suggest that either a MEK1/2 kinase (e.g. raf) or an upstream activating kinase is absent or inactive in GH3 cells. Identification and analysis of these kinases will be required to definitely identify this subtle difference between the two cell lines.

Synergism of AP-1 and Pit-1 on the hPRL Promoter
The presence of the most proximal Pit-1 site (P1 region) in the hPRL promoter is also required for OA stimulation, and the synergism between Pit-1 and AP-1 is not due to cooperative binding to their respective adjacent sites (6). The decrease of Pit-1 protein amount is probably not involved in OA stimulation of the hPRL promoter, as it occurs several hours after OA treatment both in GH3 and GH3B6 cells, probably resulting from the increase in JunD protein (34).

We further analyzed the Pit-1/AP-1 synergism by coexpressing Pit-1 and c-fos/junD in CV-1 cells. The synergistic activation of the hPRL promoter by Pit-1 and AP-1 was decreased when high levels of Pit-1 expression vector were used, while activation by Pit-1 alone was unaffected, suggesting that a limiting factor might be required specifically for the synergistic activation. Unlike interaction of Pit-1 with other transcription factors, such as estrogen and thyroid hormone receptor or Zn-15 (35–37), the synergism with AP-1 required only its POU domain (POUs + POUh). The same region was previously shown to be required for Pit-1 synergism with Ets-1 (38) and for interaction with the coactivator/histone acetylase CBP/p300 (13). Consistent with an involvement of CBP/p300 in Pit-1/AP-1 synergism, overexpression of p300 slightly enhanced, while overexpression of the corepressor N-CoR clearly inhibited, the OA stimulation of the hPRL promoter in GH3B6 cells. The fact that 40P-Luc and c-fos-Luc activities were not affected by expression of either p300 or N-CoR suggests a specific involvement of both factors in OA induction of the 164 hPRL promoter.

In conclusion, we show that OA induction of the hPRL promoter in GH3B6 cells is primarily mediated by increasing the levels of c-fos protein amounts. The c-fos accumulation results from transcriptional activation of the c-fos promoter mediated by the MEK-ERK1/2-elk1 pathway. The OA effect results from inhibition of PP1, opposing a MEK1/2-kinase (raf) or an upstream kinase. The absence of OA response in GH3 cells probably results from the absence of this kinase. Furthermore, the c-fos/JunD synergism with the nearby Pit-1, required for OA induction, involves the general transcriptional coactivator CBP/p300 and is counteracted by the corepressor N-CoR.


    MATERIAL AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 
Materials
OA was purchased from Sigma (St. Louis, MO), PD98059 was from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA), and D-luciferin, N-acetyl-S-farnesyl-L-cysteine and tautomycin were from ICN Biomedicals, Inc. (Costa Mesa, CA). Polyclonal rabbit antibodies directed against JunD, c-fos, and Pit-1 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and PhosphoPlus MEK1/2 antibody Kit was from New England Biolabs, Inc. (Beverly, MA).

Plasmids
The reporter constructs 164P-Luc, 164P(AP1 m)-Luc, and 40P-Luc were previously described (6). TKCAT and (TREpal)3XTKCAT constructs have been described previously (Refs. 7, 39 , respectively). The wild-type and mutant c-fos promoter constructs c-fos-Luc, c-fos-Luc{delta}SRE, c-fos-Luc{delta}FAP, and c-fos-LucmSIE are generous gifts from U. Moens (40). Expression vector pRSV-JunD (mouse) was kindly provided by Dr. M. Yaniv (41), and pRSV-c-fos was a kind gift from P. Herrlich (42). pCMV{delta}-P300 (15) was obtained from M. Montminy, pcDNA3-hPit1 and mutant hPit-1{delta}(1–69) were from A. Chariot, PP1 and PP2A expression vectors were from M. Montminy (43, 44), and the V12ras (45) vector was kindly provided by Gutierrez-Hartmann. PCMX-N-CoR was generated by ligating the XbaI/SalI fragment (N-CoR interaction domain) from pBKS-N-CoR-C' into the XbaI/SalI restriction sites of pCMX-N-CoR-GAL4 containing the N-CoR repression domains (16). The parent plasmids pBKS-N-CoR-C' and pCMX-N-CoR-GAL4 (16) were generously provided by M. G. Rosenfeld.

Expression vectors for hPit-1 deletion mutants were generated by PCR using the following primers:

5bamh1: gctcggatccggagcagcgg

3bstx1: ctcagcttcctccagccatttgg

5{delta}95123: cctatacaccagatggattctccagaaatcagagaa

3{delta}95123: ggagaatccatctggtgtataggaggaaatccatg

5{delta}2669: gcctctgataatggcaggtagtttaaccccttg

3{delta}2669: aactacctgccattatcagaggcagagttgcagagg

5{delta}69123: acctatggagtgatggattctccagaaatcagagaa

3{delta}69123: ggagaatccatcactccataggttgatggctgg

Two parallel PCR reactions were performed to generate fragments upstream and downstream, respectively, of each deleted region: one using the 5bamh1 primer and each 3{delta} primer, the second PCR using each 5{delta} primer and the 3bstx1 primer. The corresponding upstream and downstream fragments were mixed, and a third PCR was performed using the 5bamh1 and 3bstx1 primers to amplify a fused fragment. The final product was digested with BamHI and BstXI and inserted into the corresponding restriction sites of pcDNA3. All the constructions were verified by restriction analysis and sequencing.

Cell Culture and Transfections
GH3B6 and GH3 (ATCC CCL-82.1) rat pituitary cells were grown in monolayer, in Ham’s F-12 and F-12K, respectively (Life Technologies, Inc., Gaithersburg, MD) supplemented with 15% horse serum (HS) (Life Technologies, Inc.), 2.5% FBS (BioWhittaker, Inc. Walkersville, MD), 1% penicillin/streptomycin solution (Life Technologies, Inc.), and 5 x 10-10 M estradiol (E2, Sigma). CV-1 monkey kidney cells were cultured in DMEM with 10% FBS and 1% penicillin/streptomycin solution.

GH3B6 and GH3 cells were transfected either by electroporation as described (6) or with Lipofectamine Plus (Life Technologies, Inc.) following the manufacturer’s protocol for cotransfection experiments. Briefly, 1 day before transfection, cells were trypsinized and plated in six-well culture dishes at about 3 x 105 cells per well. Just before transfection, the culture medium was replaced by 800 µl of serum- and antibiotic-free medium, after which 200 µl of plasmid/serum- and antibiotic-free medium/Lipofectamine-Plus reagent mixture were slowly added to the cells. After 4 h, the mixture was removed and replaced by 2 ml of culture medium.

The transfected cells were incubated for 24 h before treatment with the drugs for about 18 h. CV-1 cells were transfected using the calcium phosphate coprecipitation procedure as previously described (46).

Luciferase and CAT Assays
For luciferase assays, cells were lysed in 25 mM Tris/phosphate, pH 7.8, 8 mM EDTA, 1% Triton X-100, 15% glycerol, 1 mM dithiothreitol (DTT), and 0.5 mM phenylmethylsulfonyl fluoride (PMSF). The luciferase activity was determined as described (6). For CAT assays, cells were harvested in 250 mM Tris, pH 7.6, and assayed as described (47). Protein concentration was determined using the Bradford assay (48), and promoter activities were normalized to total protein. Results are expressed as the ratio of luciferase or CAT activity measured in treated vs. untreated cells or as the ratio of luciferase activity measured in the presence of expression vector vs. no expression vector (cotransfections). Results are expressed as the mean ± SD of three independent pools of transfected cells. Each experiment was performed at least twice.

Cell Extracts, Western Blot Assay, and Electrophoretic Mobility Shift Assay (EMSA)
Nuclear cell extracts were prepared from treated or control cells as previously described (6).

To obtain the whole cell extracts used for detection of phosphoproteins, cells were washed with PBS and harvested and lysed in 1xPBS, pH 7.6, 0.1% NP-40, 0.1% ß-mercaptoethanol, 1% SDS, 2 mM EDTA, 1 mM PMSF, 0.2 mM Na3VO4, 50 mM NaF, and 1 mM sodium pyrophosphate. After 10 min centrifugation at 15,000 x g, the pellet was removed and discarded.

Western blot analysis was performed as previously described (6) using 10 µg of nuclear extracts or 30 µg of whole cell extracts.

EMSAs and the oligonucleotides containing the P1 or the AP-1 consensus binding site were previously described (6).


    ACKNOWLEDGMENTS
 
The authors are grateful to U. Moens, M. Yaniv, P. Herrlich, M. Montminy, A. Chariot, M. Montminy, A. Gutierrez-Hartmann, and M. G. Rosenfeld for kindly providing, respectively, the c-fos promoter constructs, pRSV-JunD, pRSV-c-fos, pCMVß-P300, pcDNA3-hPit1, and its mutant d1–69, the PP1 and PP2A vectors, the V12ras construct, and the N-CoR vector. We also would like to thank E. Hooghe-Peters for kindly testing the PRL secretion of our cell lines.


    FOOTNOTES
 
Address requests for reprints to: Marc Muller, Laboratory of Molecular Biology and Genetic Engineering, Institut de Chimie-B6, University of Liege B-4000 Sart-Tilman, Liege, Belgium. E-mail: m.muller{at}ulg.ac.be

This work was supported by grants from the "Région Wallone (ULg 1815); the "Services Fédéraux des Affaires Scientifiques, Techniques et Culturelles" (PAI P3–042, P3–044 and P4/30 and "Actions de Recherche Concertes": 95/00–193); the Fonds National de la Recherche Scientifique (FNRS) (-3.4537.93 and -9.4569.95). I. Manfroid was holder of a doctoral fellowship from the F.R.I.A and from the patrimoine ULg. M. M. is a "Chercheur qualifié" at the Fonds National de la Recherche Scientifique (FNRS).

This work contains part of the Ph.D. thesis of I. Manfroid.

Received for publication September 1, 2000. Revision received November 21, 2000. Accepted for publication December 21, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIAL AND METHODS
 REFERENCES
 

  1. Berwaer M, Monget P, Peers B, Mathy-Hartert M, Bellefroid E, Davis JRE, Belayew A, Martial JA 1991 Multihormonal regulation of the human prolactin gene expression from 5000 bp of its upstream sequence. Mol Cell Endocrinol 80:53–64[CrossRef][Medline]
  2. Berwaer M, Peers B, Nalda AM, Monget P, Davis JRE, Belayew A, Martial JA 1993 Thyrotropin-releasing hormone and epidermal growth factor induce human prolactin expression via multiple cis elements. Mol Cell Endocrinol 92:1–7[CrossRef][Medline]
  3. Hoggard N, Davis JRE, Berwaer M, Monget P, Peers B, Belayew A, Martial JA 1991 Pit-1 binding sequences permit calcium regulation of human prolactin gene expression. Mol Endocrinol 5:1748–1754[Abstract/Free Full Text]
  4. Peers B, Monget P, Nalda AM, Voz ML, Berwaer M, Belayew A, Martial JA 1991 Transcriptional induction of the human prolactin gene by cAMP requires two cis-acting elements and at least the pituitary-specific factor Pit-1. J Biol Chem 266:18127–18134[Abstract/Free Full Text]
  5. Peers B, Nalda AM, Monget P, Voz ML, Belayew A, Martial JA 1992 Binding of a 100-kDa ubiquitous factor to the human prolactin promoter is required for its basal and hormone-regulated activity. Eur J Biochem 210:53–58[Medline]
  6. Caccavelli L, Manfroid I, Martial JA, Muller M 1998 Transcription factor AP1 is involved in basal and okadaic acid-stimulated activity of the human PRL promoter. Mol Endocrinol 12:1215–1227[Abstract/Free Full Text]
  7. Pernasetti F, Caccavelli L, Van de Weerdt C, Martial JA, Muller M 1997 Thyroid hormone inhibits the human prolactin gene promoter by interfering with activating protein-1 and estrogen stimulations. Mol Endocrinol 11:986–996[Abstract/Free Full Text]
  8. Gaddy-Kurten D, Vale WW 1995 Activin increases phosphorylation and decreases stability of the transcription factor Pit-1 in MtTW15 somatotrope cells. J Biol Chem 270:28733–28739[Abstract/Free Full Text]
  9. Howard PW, Maurer RA 1994 Thyrotropin releasing hormone stimulates transient phosphorylation of the tissue-specific transcription factor, Pit-1. J Biol Chem 269:28662–28669[Abstract/Free Full Text]
  10. Kapiloff MS, Farkash Y, Wegner M, Rosenfeld MG 1991 Variable effects of phosphorylation of Pit-1 dictated by the DNA response elements. Nature 2:786–789
  11. Steinfelder HJ, Radovick S, Wondisford FE 1992 Hormonal regulation of the thyrotropin ß-subunit gene by phosphorylation of the pituitary-specific transcription factor Pit-1. Proc Natl Acad Sci USA 89:5942–5945[Abstract/Free Full Text]
  12. Gutierrez-Hartmann A 1994 Insight: Pit-1/GHF-1: a pituitary-specific transcription factor linking general signalling pathways to cell-specific gene expression. Mol Endocrinol 8:1447–1449[Free Full Text]
  13. Xu L, Lavinsky RM, Dasen JS, Flynn SE, McInerney EM, Mullen TM, Heinzel T, Szeto D, Korzus E, Kurokawa R, Aggarwal AK, Rose DW, Glass CK, Rosenfeld MG 1998 Signal-specific co-activator domain requirements for Pit-1 activation. Nature 395:301–306[CrossRef][Medline]
  14. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855–859[CrossRef][Medline]
  15. Eckner R, Ewen ME, Newsome D, Gerdes M, DeCaprio JA, Lawrence JB, Livingston DM 1994 Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev 8:869–884[Abstract/Free Full Text]
  16. Hörlein AJ, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  17. Janknecht R 1995 Regulation of the c-fos promoter. Immunobiology 193:137–142[Medline]
  18. Treisman R 1994 Ternary complex factors: growth factor regulated transcriptional activators. Curr Opin Genet Dev 4:96–101[CrossRef][Medline]
  19. Cahill MA, Janknecht R, Nordheim A 1996 Signalling pathways: Jack of all cascades. Curr Biol 6:16–19[CrossRef][Medline]
  20. Treisman R 1996 Regulation of transcription by MAP kinase cascades. Curr Opin Cell Biol 8:205–215[CrossRef][Medline]
  21. Angel P, Karin M 1991 The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129–157[Medline]
  22. Binetruy B, Smeal T, Karin M 1991 Ha-ras augments c-Jun activity and stimulates phosphorylation of its activation domain. Nature 351:122–127[CrossRef][Medline]
  23. Deng T, Karin M 1994 C-Fos transcriptional activity stimulated by H-Ras-activated protein kinase distinct from JNK and ERK. Nature 371:171–175[CrossRef][Medline]
  24. Devary Y, Gottlieb RA, Smeal T, Karin M 1992 The mammalian ultraviolet response is triggered by activation of Src tyrosine kinases. Cell 71:1081–1091[CrossRef][Medline]
  25. Pulverer BJ, Kyriakis JM, Avruch J, Nikolakaki E, Woodgett JR 1991 Phosphorylation of c-Jun mediated by MAP kinases. Nature 353:670–674[CrossRef][Medline]
  26. Cohen P, Holmes CFB, Tsukitami Y 1990 Okadaic acid, a new probe for the study of cellular regulation. Trends Biochem Sci 15:98–102[CrossRef][Medline]
  27. Bialojan C, Takai A 1988 Inhibitory effect of a marine-sponge toxin, okadaic acid, on protein phosphatases. Specificity and kinetics. Biochem J 256:283–290[Medline]
  28. Gourdji D, Laverriere JN, Passegue E, Richard JL 1992 Hypophyseal cells model systems: the "GH" rat tumor-derived cell lines as a tool for the study of gene expression. Cell Biol Toxicol 8:29–38[CrossRef][Medline]
  29. Laverriere JN, Muller M, Buisson N, Tougard C, Tixier-Vidal A, Martial JA, Gourdji D 1986 Differential implication of deoxyribonucleic acid methylation in rat prolactin and rat growth hormone gene expressions: a comparison between rat pituitary cell strains. Endocrinology 118:198–206[Abstract/Free Full Text]
  30. Hill CS, Wynne J, Treisman R 1995 The Rho family GTPases RhoA, Rac1 and CDC42Hs regulate transcriptional activation by SRF. Cell 81:1159–1170[CrossRef][Medline]
  31. Bannister AJ, Oehler T, Wilhem D, Angel P, Kouzarides T 1995 Stimulation of c-jun activity by CBP: c-jun residues Ser63/73 are required for CBP induced stimulation in vivo and CBP binding in vitro. Oncogene 11:2509–2514[Medline]
  32. Bannister AJ, Kouzarides T 1995 CBP-induced stimulation of c-fos activity is abrogated by E1A. EMBO J 14:4758–4762[Medline]
  33. Tashjian Jr A, Yasamura Y, Levine L, Sato G, Parker ML 1968 Establishment of clonal strains of rat pituitary tumor cells that secrete growth hormone. Endocrinology 82:342–352[Abstract/Free Full Text]
  34. Delhase M, Castrillo JL, de la Hoya M, Rajas F, Hooghe-Peters E 1996 AP-1 and Oct-1 transcription factors down-regulate the expression of the human PIT1/GHF1 gene. J Biol Chem 271:32349–32358[Abstract/Free Full Text]
  35. Chang W, Zhou W, Theill LE, Baxter JD, Schaufele F 1996 An activation function in Pit-1 required selectively for synergistic transcription. J Biol Chem 271:17733–17738[Abstract/Free Full Text]
  36. Holloway JM, Szeto DP, Scully KM, Glass CK, Rosenfeld MG 1995 Pit-1 binding to specific DNA sites as a monomer or dimer determines gene-specific use of a tyrosine-dependent synergy domain. Genes Dev 9:1992–2006[Abstract/Free Full Text]
  37. Lipkin SM, Näär AM, Kalla KA, Sack RA, Rosenfeld MG 1993 Identification of a novel zinc finger protein binding a conserved element critical for Pit-1-dependent growth hormone gene expresion. Genes Dev 7:1674–1687[Abstract/Free Full Text]
  38. Bradford AP, Wasylyk C, Wasylyk B, Gutierrez-Hartmann A 1997 Interaction of Ets-1 and the POU-homeodomain protein GHF-1/Pit-1 reconstitutes pituitary-specific gene expression. Mol Cell Biol 17:1065–1074[Abstract/Free Full Text]
  39. Voz ML, Peers B, Wiedig MJ, Jacquemin P, Belayew A, Martial JA 1992 Transcriptional regulation by triiodothyronine requires synergistic action of the thyroid receptor with another trans-acting factor. Mol Cell Biol 9:3991–3997
  40. Seternes OM, Sörensen R, Johansen B, Loennechen T, Aabakke J, Moens U 1998 Synergistic increase in c-fos expression by simultaneous activation of the ras/raf/map-kinase A signalling pathways is mediated by the c-fos AP-1 and SRE sites. Biochim Biophys Acta 1395:345–360[Medline]
  41. Hirai SI, Ryseck RP, Mechta F, Bravo R, Yaniv M 1989 Characterization of junD: a new member of the jun proto-oncogene family. EMBO J 8:1433–1439[Medline]
  42. Schonthal A, Herrlich P, Rahmsdorf HJ, Ponta H 1988 Requirement for fos gene expression in the transcriptional activation of collagenase by other oncogenes and phorbol esters. Cell 54:325–334[CrossRef][Medline]
  43. Hagiwara M, Alberts A, Brindle P, Meinkoth J, Feramisco J, Deng T, Karin M, Shenolikar S, Montminy M 1992 Transcriptional attenuation following cAMP induction requires PP-1-mediated dephosphorylation of CREB. Cell 70:105–113[CrossRef][Medline]
  44. Green DD, Yang SI, Mumby MC 1987 Molecular cloning and sequence analysis of the catalytic subunit of bovine type 2A protein phosphatase. Proc Natl Acad Sci USA 84:4880–4884[Abstract/Free Full Text]
  45. Shih C, Weinberg RA 1982 Isolation of a transforming sequence from a human bladder carcinoma cell line. Cell 29:161–169[CrossRef][Medline]
  46. Steiner C, Kaltschmidt C 1989 An automated method for calcium phosphate-mediated gene transfer. Trends Genet 5:138[CrossRef][Medline]
  47. Martin B, Renkawitz R, Muller M 1994 Two silencing sub-domains of v-erbA synergize with each other, but not with RXR. Nucleic Acids Res 22:4899–4905
  48. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Neurosci.Home page
G. F. Hedou, K. Koshibu, M. Farinelli, E. Kilic, C. E. Gee, U. Kilic, K. Baumgartel, D. M. Hermann, and I. M. Mansuy
Protein Phosphatase 1-Dependent Bidirectional Synaptic Plasticity Controls Ischemic Recovery in the Adult Brain
J. Neurosci., January 2, 2008; 28(1): 154 - 162.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-S. Chen, S.-C. Weng, P.-H. Tseng, H.-P. Lin, and C.-S. Chen
Histone Acetylation-independent Effect of Histone Deacetylase Inhibitors on Akt through the Reshuffling of Protein Phosphatase 1 Complexes
J. Biol. Chem., November 18, 2005; 280(46): 38879 - 38887.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. S. Clark, L. Zhong, D. Filiault, S. Perman, Z. Ren, M. Gould, and X. Yang
Anti-Leukemia Effect of Perillyl Alcohol in Bcr/Abl-Transformed Cells Indirectly Inhibits Signaling through Mek in a Ras- and Raf-Independent Fashion
Clin. Cancer Res., October 1, 2003; 9(12): 4494 - 4504.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-H. Quentien, I. Manfroid, D. Moncet, G. Gunz, M. Muller, M. Grino, A. Enjalbert, and I. Pellegrini
Pitx Factors Are Involved in Basal and Hormone-regulated Activity of the Human Prolactin Promoter
J. Biol. Chem., November 8, 2002; 277(46): 44408 - 44416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Liu, R. E. Baker, C. Sun, V. C. Sundmark, and H. P. Elsholtz
Activation of Go-coupled Dopamine D2 Receptors Inhibits ERK1/ERK2 in Pituitary Cells. A KEY STEP IN THE TRANSCRIPTIONAL SUPPRESSION OF THE PROLACTIN GENE
J. Biol. Chem., September 20, 2002; 277(39): 35819 - 35825.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Manfroid, I.
Right arrow Articles by Muller, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Manfroid, I.
Right arrow Articles by Muller, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals